Chapter V.

Isolation and characterization of

Listeria

124

5.1 Introduction

Listeria monocytogenes, a cause of listeriosis, is a worldwide zoonotic

pathogen. All members of the genus Listeria are widely distributed in nature

and have been isolated from soil, vegetation, sewage, water, animal feed, fresh

and frozen meat, slaughterhouse wastes and the faeces of healthy animals.

Thus, farm animals and their environment may present an important source of

food contamination and infections for humans (Jemmi and Stephen, 2006;

Swaminathan and Gerner-Scmidt, 2007). The genus-Listeria has two

pathogenic species namely, L. monocytogenes and L. ivanovii. Listeriosis is a

high-risk disease for pregnant women and vulnerable ages of life and primarily

causes abortion, septicaemia or infections of the central nervous system

(Rebagliati et al., 2009). It causes listeriosis in humans characterized by

invasive and non-invasive illness associated with high mortality (20–30%) and

has a propensity to cause severe problems especially in pregnant women,

neonates, the elderly, and immunosuppressed individuals (Vlaemynck et al.,

2000; Liu, 2006).

The public health importance of listeriosis is not always recognized,

particularly since listeriosis is a relatively rare disease compared with other

common foodborne illnesses such as salmonellosis or botulism. However,

because of its high case fatality rate, listeriosis ranks among the most frequent

causes of death due to foodborne illness: second after salmonellosis (Rossi et

al., 2008). It is responsible for the highest hospitalisation rates (91%) amongst

known food-borne pathogens and has also been linked to sporadic episodes

and large outbreaks of human illness worldwide (Jemmi and Stephen, 2006).

Epidemiological data from different countries show that the majority of human

125

outbreaks are associated with three L. monocytogenes serotypes (1/2a, 1/2b and

4b).

The contamination of food by L. monocytogenes occurs along the food

chain from farm-to-fork (Farber and Peterkin, 1991). The ability to persist in

food-processing environments and multiply under refrigeration temperatures

makes L. monocytogenes a significant threat to public health. L.

monocytogenes contamination is one of the leading microbiological causes of

food recalls, mainly of meat, poultry, seafood and dairy products. Prevention

and control measures are based on hazard analysis and critical control point

programmes throughout the food industry, and on specific recommendations

for high-risk groups (Jemmi and Stephen, 2006). Products such as raw milk,

soft cheese produced from raw milk, raw meat products and salads are

frequently implicated in the literature (Johansson et al., 1999; Kathariou, 2002;

Barbuddhe et al., 2011). Cross-contamination, which can occur within the

environment of food-processing equipment, is considered to be a possible

source of Listeria contamination in processed food. Listeria monocytogenes is

able to attach to and survive on various working contact surfaces. One reason

may be its ability to form biofilms (Wong, 1998; Borucki et al., 2003).

Globally, the cases of human listeriosis are on increase which is evident

from the major outbreaks recorded in various countries. The first proof that

milk products could be responsible for listeriosis outbreaks was corroborated

by Fleming et al. (1985) which involved 49 cases, seven of them in the fetus or

in infants and 42 in immunocompromised adults. In major foodborne

outbreaks of listeriosis recorded world over, the vehicle of transmission has

been suggested to be a wide range of foods including vegetables (lettuce,

126

celery and tomatoes) (Ho et al., 1986), Coleslaw (Schlech et al., 1983),

pasteurized milk (Flemming et al., 1985), Mexican style cheese (Linnan et al.,

1988), raw milk cheese (Goulet et al., 1995), liver pates (Kittson, 1992), pork

tongue in aspic (Goulet et al., 1993) and Rillettes i.e. pork pate (Goulet, 1995).

Listeriosis outbreaks have mostly been linked to consumption of raw milk or

cheese made of unpasteurized milk (Fleming et al., 1985; Linnan et al., 1988;

Lyytikainen et al., 2000; Rebagliati et al., 2009). Changes in the manner food

is produced, distributed and stored have created the potential for widespread

outbreaks involving many countries. Incorrect milk pasteurization and its

subsequent contamination are the most possible explanations for the presence

of pathogens in pasteurized milk. Some of the milk borne bacteria from cows

with bovine mastitis may survive the pasteurization and replicate at

refrigeration temperatures. When cattle are infected with L. monocytogenes,

the organism is excreted in the milk. L. monocytogenes is quite resistant to

heat and milk's post-pasteurization storage at a refrigeration temperature might

allow the selective growth of the remaining organisms (Dalton et al., 1997).

Extensive work has been ongoing in many countries during the last decade to

prevent outbreaks and decrease the incidence of listeriosis (Rossi et al., 2008).

The availability of subtyping procedures to track individual strains

involved in listeriosis outbreaks, and to examine the epidemiology and

population genetics of Listeria monocytogenes bacteria is integral to control

and prevention programs aimed at limiting listeriosis (Barbuddhe et al., 2008).

Serotyping may potentially be useful for tracking L. monocytogenes strains

involved in disease outbreaks. Indeed, it has been observed that L.

monocytogenes serotypes 1/2a, 1/2b, and 4b are responsible for 98% of

127

documented human listeriosis cases, whereas serotypes 4a and 4c are rarely

associated with outbreaks of the disease (Wiedmann et al., 1996; Jacquet et al.,

2002). The development of PCR-based serotyping procedures has provided

additional tools for the identification and grouping of L. monocytogenes

(Borucki and Call, 2003; Doumith et al., 2004).

India, the largest producer of milk in the world, also has the highest

number of cattle in the world. In India, the first documentation of isolation of

L. monocytogenes from an animal dates back to 1950 when it was recovered

from an infected sheep in Madras (Vishwanathan and Ayyar, 1950).

Subsequently, it was reported from other animals (Nigam et al., 1999; Malik et

al., 2002; Shakuntala et al., 2006) and from foods (Karunasagar and

Karunasagar, 2000; Barbuddhe, et al., 2002; Kalorey et al., 2008; Barbuddhe

et al., 2011). However, studies on raw milk samples collected at different

levels of collection and processing for L. monocytogenes are largely lacking.

Since the dairy processing industry in India is growing rapidly as in the

developed world, milk borne outbreaks of listeriosis cannot be ruled out. The

association of L. monocytogenes with raw and pasteurized milk, dairy farms

and processing plants contributes to the potential threat of listeriosis.

Human listeriosis is a public health problem of low incidence but high

mortality, requiring prompt diagnosis and adequate antibiotic therapy.

Antibiotic resistance and inefficient empirical treatment of Listeria infections

could be responsible for this increased mortality (Rodas-Sua´rez et al., 2006).

Review of literature published on the prevalence of bacterial foodborne

pathogens in milk and in the dairy environment supports the model in which

the presence of pathogens depends on ingestion of contaminated feed followed

128

by amplification in bovine hosts and fecal dissemination in the farm

environment. The final outcome of this cycle is a constantly maintained

reservoir of foodborne pathogens that can reach humans by direct contact,

ingestion of raw contaminated milk or cheese, or contamination during the

processing of milk products.

In view of the above, the attempt to isolate the pathogenic Listeria

species from milk collected at different levels will reveal the risk of this

foodborne pathogen of public health significance. The unorganized sectors of

India have rarely been analyzed to see the occurrence of this important

pathogen. This chapter deals with the studies on occurrence of pathogenic

Listeria in raw bovine milk with an ultimate aim to ascertain whether the

population in this region is really at risk for listeriosis. The present study also

aimed to use various methods for rapid, economical and reliable detection of

pathogenic L. monocytogenes strains isolated from milk employing in vitro

tests viz., hemolysis on SBA, PI-PLC assay, chromogenic ALOA medium and

PCR targeting virulent associated gene, hlyA gene encoding listeriolysin O

(LLO). The genotypic characterization of L. monocytogenes isolates that were

recovered from milk at different levels of collection was carried out utilizing

PFGE in combination with multiplex serotyping PCR assay to study the

genetic diversity exhibited by these isolates.

5.2 Material and Methods

5.2.1 Bacteria

The standard strains of Listeria monocytogenes (MTCC 657 /NCTC

7973 /ATCC 19111), Listeria monocytogenes (MTCC 1143 /NCTC 11994),

129

Staphylococcus aureus (MTCC 1144), Rhodococcus equi (MTCC 1135) were

obtained from microbial type culture collection and gene bank (MTCC),

Institute of Microbial Technology (IMTECH), Chandigarh, India. Twenty

strains of L. monocytogenes isolated from milk and milk products from Indian

Listeria Culture Collection available at ICAR Research Complex for Goa, Old

Goa were also included in the study. The reference strains of Listeria ivanovii

(NCTC 11846) and L. seeligeri (NCTC 11856) were procured form Division

of Veterinary Public Health, Indian Veterinary Research Institute, Izatnagar.

The strains were tested for their morphological, biochemical and

cultural characteristics. Subsequently, the strains of L. monocytogenes were

tested for their pathogenicity by in vitro tests. Finally, the strains of L.

monocytogenes, L. ivanovii, and S. aureus were tested for their

phosphatidylinositol specific phospholipase-C (PI-PLC) activity by overlay

assay as per the method of Notermans et al. (1991a).

5.2.2 Samples

The details of samples processed are given in section 3.2. A total of 767

milk samples from dairy cows were taken at different levels of collection and

processing (udder, from milking utensils/cans, dairy cooperative society,

receiving dock and market) and were processed for isolation of Listeria.

5.2.3 Isolation

Isolation of Listeria from the milk samples was attempted as per the US

Department of Agriculture (USDA) method described by McClain and Lee

(1988) after making necessary modifications.

130

5.2.3.1 Enrichment

About 10 ml of milk sample was directly inoculated into 90 ml of

University of Vermont Medium-1 (UVM-1) and incubated overnight at 300C.

The enriched UVM-1 inoculum (0.1 ml) was then transferred to UVM-2

medium and again incubated overnight at 300C.

5.2.3.2 Plating on Selective media

The enriched inoculum from UVM-2 was streaked on polymixin acriflavin

lithium chloride ceftazidime aesculin mannitol (PALCAM) agar (Himedia

Labs, Mumbai, India). The inoculated plates were incubated at 370C for 24 –

48 h. Grey green colonies with black sunken centers from PALCAM were

suspected to be of Listeria. The presumed colonies of Listeria (at least 3/plate)

were subcultured for further confirmation.

5.2.4 Confirmation of Isolates

5.2.4.1 Biochemical characterization

From the isolation media, suspected colonies of Listeria were

subcultured on 5% sheep blood agar. Morphologically typical colonies were

verified by Gram’s staining, catalase reaction, tumbling motility at 25OC,

methyl red-Voges Proskauer (MR-VP) reactions, CAMP test with

Staphylococcus aureus and Rhodococcus equi, nitrate reduction, fermentation

of sugars (rhamnose, xylose, mannitol and α-methyl- D-mannopyranoside) and

hemolysis.

131

5.3.2.3 Hemolysis on Sheep Blood Agar

All the Listeria isolates that were confirmed using biochemical tests

were analyzed for the type of hemolysis on Sheep blood agar (SBA) as per the

method described by Seeliger and Jones (1986). The isolates were streaked

onto 5% SBA plates and incubated at 37oC for 24 h and examined for

haemolytic zones around the colonies. The characteristic β-haemolysis in the

form of wider and clear zone of haemolysis represented L. ivanovii while, a

narrow zone of β-haemolysis was the characteristic of L. monocytogenes.

 

5.2.3.4 Christie-Atkins-Munch-Peterson (CAMP) test

All the presumptive Listeria isolates were tested by Christie-Atkins-

Munch-Peterson (CAMP) test as per the method of BIS (1994). Briefly, the

standard strains of Staphylococcus aureus and Rhodococcus equi grown in

BHI broth for 18 h were streaked on sheep blood agar (SBA) plates having 7%

sheep blood in a manner that these were wide apart and parallel to each other.

The test cultures were streaked parallel to one another, but at right angles to

and between the S. aureus and R. equi streaks. After incubation at 370C for 24-

48 h, the plates were examined for hemolysis. L. monocytogenes hemolytic

reactions were enhanced in the zone influenced by the S. aureus streak. The

other species remained non-hemolytic.

5.2.4.2 ALOA assay

Agar Listeria according to Ottaviani and Agosti (ALOA) assay, an

alternative way to assess PI-PLC activity was carried out using Chromogenic

media, ALOA which helped to differentiate pathogenic Listeria spp. (Ottaviani

132

et al., 1997). The biochemically characterized 81 Listeria isolates were assayed

for PI-PLC activity on chromogenic ALOA (Hi-media, Mumbai, India) media.

In brief, the Listeria isolates were grown overnight onto SBA plates at 370C.

The growth of each Listeria isolate harvested from SBA plate was spot

inoculated on ALOA plates. On this medium, all the Listeria species form

bluish green colonies due to the presence of a chromogenic compound X-

glucoside which detects β-glucosidase present in all Listeria species. Typical

colonies of L. monocytogenes in ALOA agar are green-blue, surrounded by an

opaque halo.

5.2.4 Detection of Virulence gene of Listeria

The primers for detection of the hemolysin gene (hlyA) of L.

monocytogenes used in this study were synthesized by Sigma Aldrich, USA.

The primers employed were, forward 5’-GCA GTT GCA AGC GCT TGG

AGT GAA-3’ and reverse 5’-GCA ACG TAT CCT CCA GAG TGA TCG-3’

(Paziak-Domanska et al., 1999). The PCR was standardized for the detection

of the hlyA gene of L. monocytogenes as per the method described (Notermans

et al., 1991) with suitable modifications. In brief, the standard strain of

pathogenic L. monocytogenes (MTCC 1143) was grown overnight in brain

heart infusion broth at 370C. The genomic DNA of all the isolates was

extracted using bacterial DNA extraction kit (Chromous Biotech, Bangalore,

India). The obtained DNA was used as a template in PCR reaction mixture.

Based on optimization trials, the standardized PCR protocol for 50 μl

reaction mixture included 10X PCR buffer (100 mM Tris–HCl buffer, pH 8.3

containing 500 mM KCl, 15 mM MgCl2 and 0.01% gelatin), 0.2 mM dNTP

133

mix, 2 mM MgCl2 and 0.1μM of a primer set containing forward and reverse

primers, one unit of Taq DNA polymerase, 5 μl of DNA template and

sterilized milliQ water to make up the reaction volume. Positive and negative

controls were included in each of the PCR run. The DNA amplification

reaction was performed in Mastercycler epGradient (Eppendorf, Germany)

with a preheated lid. The cycling conditions for PCR included an initial

denaturation of DNA at 950C for 2 min followed by 35 cycles each of 15 s

denaturation at 950C, 30 s annealing at 600C and 1 min 30 s extension at 720C,

followed by a final extension of 10 min at 720C and hold at 40C. The resultant

PCR products were further analyzed by agarose gel electrophoresis, stained

with ethidium bromide (0.5μg/ml) and visualized by a UV transilluminator

(Alphaimager, USA).

5.2.5 Serotyping

Somatic (O) and flagellar (H) antigen-based serotyping was performed

using commercially prepared antisera (Denka Seiken Co., Tokyo, Japan).

Determination of the O-antigen was carried out with heat inactivated bacteria

using the slide agglutination method and that of H-antigen was carried out with

liquid bacterial cultures in a test tube, according to the manufacturer's

instructions.

5.2.6 Serotyping by multiplex PCR (mPCR)

The genomic DNA of all the isolates was extracted using bacterial

DNA extraction kit (Chromous Biotech, Bangalore, India) and were subjected

to mPCR based serotyping (Doumith et al., 2004). The five primer sets for

134

target fragments from genes lmo0737, lmo1118, ORF2819, ORF2110 and prs

were synthesized by Sigma Aldrich, USA. The details of primers used in the

study are given in Table 5.1. The mPCR serotyping was standardized as per

the methodology described by Doumith et al. (2004). Fifty microliter reaction

mixtures were prepared each containing 2 units Taq DNA Polymerase, 10x

PCR Buffer (50 mM TriseHCl, 10 mM KCl, 50 mM Ammonium Sulfate, 2

mM MgCl2), 300 mM dNTP mix, 2 mM MgCl2, 2 mM each of primer

lmo0737, ORF2819, ORF2110 and prs and 10 mg/ml of DNA template. PCR

was performed in Master Cycler Gradient Thermocycler (Eppendorf,

Germany) having a pre-heated lid with an initial denaturation step at 940C for 5

min, 35 cycles of 940C for 30 s, 540C for 1 min 15 s, and 720C for 1 min 15 s,

and one final cycle of 720C for 10 min in thermocycler. Samples were held at

40C until electrophoresis. Eight microliter of PCR product was separated by

electrophoresis in 1.5% agarose gel stained by ethidium bromide.

Table 5.1 Primer sequences for L. monocytogenes used in Multiplex-PCR

serotyping.

Target gene Primer sequence Product size (bp)

lmo0737 Forward 5’-AGGGCTTCAAGGACTTACCC-3’ 691

Reverse 5’-ACGATTTCTGCTTGCCATTC-3’

lmo1118 Forward 5’-AGGGGTCTTAAATCCTGGAA-3’ 906

Reverse 5’-CGGCTTGTTCGGCATACTTA-3’

ORF2819 Forward 5’-AGCAAAATGCCAAAACTCGT -3’ 471

Reverse 5’- CATCACTAAAGCCTCCCATTG-3’

ORF2110 Forward 5’- AGTGGACAATTGATTGGTGAA -3’ 597

Reverse 5- CATCCATCCCTTACTTTGGAC -3’

prs Forward 5’- GCTGAAGAGATTGCGAAAGAAG-3’ 370

Reverse 5’- CAAAGAAACCTTGGATTTGCGG-3’

135

5.2.7 Pulsed field gel electrophoresis analysis

Thirty six Listeria isolates were subjected to PFGE analysis to cover

different sampling areas and different species. PFGE was performed according

to the CDC PulseNet standardized procedure (Graves and Swaminathan, 2001)

used for typing L. monocytogenes by using the CHEF-DRII apparatus (Bio-

Rad Laboratories, Hercules, USA).

5.2.7.1 Preparation of culture

Bacteria were grown on brain heart infusion agar plates at 370C for 16–

18 h. Cells were removed from the plate to plastic tubes containing 3 ml of TE

using a sterile cotton swab and the cell density adjusted to OD 0.79 to 0.81.

The standardized cell suspension (240 μl) was transferred to 1.5 ml

microcentrifuge tubes. Sixty microliters of 10 mg/ml lysozyme solution

(Sigma, St. Louis, MO) was added and mixed with the cells by pipetting up

and down. The mixture was incubated in a waterbath at 370C for 10 min.

5.2.7.2 Casting of Plugs

An equal volume of molten 1.2% PFGE grade agarose, 1% sodium

dodecyl sulfate, 0.2 mg/ml Proteinase K (Sigma, St. Louis, MO) (SSP)

prepared in sterile distilled water and maintained at 53–560C was added to the

cell suspension and mixed by gently pipetting up and down several times. The

mixture (600 μl) was dispensed into two forms (300 μl each) of a sample

reusable plug mold (Bio-Rad, Hercules, CA) and allowed to cool for 5 min.

136

5.2.7.3 Lysis of Cells in Agarose Plugs

The agarose plugs were transferred to 50 ml polypropylene conical

tubes containing 4 ml of lysis buffer (50 mM Tris pH 8.0, 50 mM EDTA, pH

8.0, 1% sodium lauryl sarcosine, 0.15 mg/ml Proteinase K), incubated for 2 h

at 50–540C in an orbital water bath shaker and shaking at 200 rpm. After

proteolysis, the lysis buffer solution was removed and the plugs were washed

twice with 15 ml of preheated (50–540C) sterile distilled water for 10 min each

followed by four washes with 15 ml of preheated (50–540C) TE buffer for 15

min each in the orbital water bath shaker (50–540C) at 200 rpm.

After the final TE wash, the plugs were sliced (2–2.5 mm slices) using

a Gel-Cutting Fixture and prepared for restriction digestion or stored in 1.5 ml

TE at 40C until ready for restriction.

5.2.7.4 Restriction digestion of agarose plugs

Sample plugs were digested with 25 U of AscI (Fermentas, USA) at

370C for 3 h or 160-200 U of ApaI (New England Biolabs) at 300C for 5 h.

5.2.7.5 Casting Agarose Gel

The gel casting tray was assembled and the comb was fitted. 1%

agarose in 1X TE buffer was prepared and poured when it was 450C into the

gel casting tray and allowed to solidify. Electrophoresis was performed in a

1% agarose gel (in 0.5X Tris-borate EDTA buffer). The agarose gel was

loaded into the electrophoresis chamber containing 2000 ml of 0.5X buffer.

The following electrophoresis conditions were used: voltage, 6 V; initial

137

switch time, 4.0 s; final switch time 40 s; runtime 22 h. Lambda ladder (New

England Biolabs, Beverly, MA) was loaded on the gel.

5.2.7.6 Staining and Documentation of PFGE Agarose Gel

After electrophoresis, the gel was stained for 30 min in 400 ml of 0.5x

TBE containing 25 ml (10 mg/ml) of ethidium bromide and destained by two

washes of 20 to 30 min each using 400 ml of deionized water and

photographed with Alpha Imager. The generated PFGE patterns were analyzed

using the Gel Compare II (Applied Maths) software. The pattern clustering

was performed by the unweighted-pair group algorithm and the Dice

correlation coefficient with a tolerance of 1%. The results of the clustering

analysis were confirmed by visual comparison of the PFGE profiles. A

similarity coefficient of 60% was selected to define the pulsed field type

clusters.

5.2.8 Antibiotic sensitivity

Listeria monocytogenes isolates were tested for their susceptibility to

antimicrobial agents by the standard Kirby- Bauer disc diffusion method

following National Committee for Clinical Laboratory Standards (NCCLS)

guidelines, 1997. Listeria monocytogenes (MTCC 1143) was used as the

reference strain and Escherichia coli (MTCC 443) as the control strain. Also,

L. monocytogenes ATCC 19114, Escherichia coli ATCC 29922, and

Staphylococcus aureus MTCC 1144 strains were used as controls in all assays.

All the 37 L. monocytogenes isolates were grown in BHI broth

overnight at 370C. The culture suspension was adjusted to 0.5 McFarland

138

Standard (approximately 1.5 x 108 cells). Within 15 minutes after adjusting the

turbidity of the inoculum suspension, a sterile cotton swab was dipped into the

adjusted suspension. The swab was rotated several times, pressing firmly on

the inner wall of the tube above the fluid level to remove excess inoculum

from the swab. Mueller-Hinton Agar (Hi-media) supplemented with 5% sterile

defibrinated Sheep Blood was used as medium to study the susceptibility to

antibiotics. Commercially available disks (Hi-Media) with the following

antibiotics were used: Tetracycline (30µg/disc), Ciprofloxacin (30µg/disc),

Vancomycin (30µg/disc), Chloramphenicol (30µg/disc), Linezolid (30µg/disc),

Meropenem (10µg/disc), Penicillin (10µg/disc), Gentamycin (10µg/disc),

Trimethoprim (25µg/disc) and Ampicillin (25µg/disc).

5.3 Results and discussion

A total of 767 milk samples collected from dairy cows, collection

centres, receiving dock and market milk were examined for Listeria spp.

throughout the four-year sampling period using two step enrichment followed

by streaking on selective agar. The grey green colonies with black sunken

centers from PALCAM (Fig 5.1), Gram-positive, coccobacillary forms with

characteristic tumbling motility at 20 to 250C were further characterized

biochemically and tested for their pathogenicity. Overall, 10.56% of the

samples (81 of 767) were positive for Listeria species. The catalase positivity

and oxidase negativity was observed in all the 81 isolates.

On further testing, 37 isolates produced acid from rhamnose and α-

methyl D-mannopyranoside but not from xylose, and therefore, were

tentatively designated as L. monocytogenes.

139

On streaking of 81 confirmed Listeria isolates onto SBA (7%), a

varying degree of haemolysis was observed (Fig 5.2). Unlike a typical β-

haemolysis with broad and clear zones exhibited by the isolate of L. ivanovii,

the degree of haemolysis shown by L. monocytogenes isolates was moderate.

A total of 38 isolates showed haemolysis.

On testing of 81 Listeria isolates from milk by CAMP test, 37 L.

monocytogenes isolates showed characteristic enhancement of haemolytic zone

with Staphylococcus aureus while the one L. ivanovii isolate showed enhanced

haemolytic zone typically against Rhodococcus equi (Table 5.2, Fig. 5.3). The

CAMP test, therefore, confirmed the results of biochemical characterization of

L. monocytogenes and L. ivanovii isolates. The enzymatic activity expressed

by L. monocytogenes isolates on ALOA agar was reckoned as high (with 8-9

mm zones), moderate (with 5-6 mm zones) and low (with >4 mm zone) in case

of 11, 18 and 8 isolates, respectively. The only isolate of L. ivanovii showed a

low enzymatic activity. Out of the 81 isolates of Listeria, 38 isolates were

haemolytic, CAMP positive, and exhibited halo formation on ALOA (Fig 5.4).

Based on the biochemical and pathogenicity profiles, 37 isolates were

confirmed as L. monocytogenes (Table 5.2). The prevalence of L.

monocytogenes was worked out to be 4.82%. Other Listeria species confirmed

were L. innocua (5.47%), L. ivanovii (0.13%) and L. grayi (0.13%) (Table

5.3).

The prevalence of L. monocytogenes reported in the present work from

the bovine raw milk samples is less than that reported by Bhilegaonkar et al.

(1997) as 8.1% of the 86 raw milk samples tested in Northern India.

Barbuddhe et al. (2002) reported 6.25% and 26.13% prevalence of L.

140

Fig 5.3. L. monocytogenes

showing positive CAMP

test.

141

 

 

 

 

 

 

 

Fig 5.1. Colonies of Listeria species on PALCAM agar.

 

 

 

 

 

 

Fig 5.2. L. monocytogenes isolates showing haemolysis Fig 5.4. L. monocytogenes on sheep blood agar isolates showing positive PI-PLC activity on ALOA agar.

monocytogenes and Listeria spp., respectively in 64 raw buffalo milk sampled in Northern

India. In a larger survey (2060 samples) in Central India, Kalorey et al (2008) reported L.

monocytogenes from 5.1% raw milk samples. The incidence of contaminated milk samples

varies among countries, being 1.2% in Denmark of 1,132,958 raw milk samples (Jensen et

al., 1996), 3.62% in Spain

Table 5.2. Biochemical and pathogenicity profiles of pathogenic Listeria isolates.

Isolate

No.

Biochemical profile Pathogenicity profile

Sugar fermentation

Species

identified

In-vitro tests Serogroup

Xyl

ose

Rha

mno

se

α- m

ethy

l

D-m

anno

pyr

anno

side

CAMP

with

S/R

Haemolysis

on SBA

PI-

PLC

Assay

hlyA

gene

LM5 - + + Lm +S + + + 1/2a,3a,3c

LM11 - + + Lm +S ++ +++ + 1/2a,3a,3c

LM12 - + + Lm +S + + + 1/2a,3a,3c

LM13 - + + Lm +S ++ +++ + 1/2a,3a,3c

LM14 - + + Lm +S + + + 1/2a,3a,3c

LM15 - + + Lm +S + ++ + 1/2b,3b

LM19 - + + Lm +S ++ ++ + 1/2a,3a,3c

LM21 - + + Lm +S + ++ + 1/2a,3a,3c

LM22 - + + Lm +S + + + 1/2a,3a,3c

LM23 - + + Lm +S ++ ++ + 1/2a,3a,3c

142

LM24 - + + Lm +S + + + 1/2a,3a,3c

LM25 - + + Lm +S + + + 1/2a,3a,3c

LM26 - + + Lm +S + + + 1/2a,3a,3c

LM28 - + + Lm +S + + + 1/2a,3a,3c

LM31 - + + Lm +S + + + 1/2a,3a,3c

LM39 - + + Lm +S + + + 1/2a,3a,3c

LM40 - + + Lm +S + + + 4b,4d,4e

LM41 - + + Lm +S + + + 1/2a,3a,3c

LM42 - + + Lm +S + + + 1/2a,3a,3c

LM45 - + + Lm +S + + + 1/2a,3a,3c

LM723 + - - Li +R +++ + + -

LM54 - + + Lm +S + + + 4b,4d,4e

LM55 - + + Lm +S + + + 1/2b,3b

LM56 - + + Lm +S + + + 1/2b,3b

LM378 - + + Lm +S ++ +++ + 1/2b,3b

LM381 - + + Lm +S + + + 1/2b,3b

LM453 - + + Lm +S ++ +++ + 1/2a,3a,3c

143

144

LM481 - + + Lm +S + + + 1/2b,3b

LM492 - + + Lm +S + ++ + 1/2a,3a,3c

LM501 - + + Lm +S ++ ++ + 1/2a,3a,3c

LM511 - + + Lm +S + ++ + 1/2b,3b

LM568 - + + Lm +S + + + 1/2a,3a,3c

LM574 - + + Lm +S ++ ++ + 1/2a,3a,3c

LM584 - + + Lm +S + + + 1/2a,3a,3c

LM588 - + + Lm +S + + + 1/2a,3a,3c

LM591 - + + Lm +S + + + 1/2a,3a,3c

LM734 - + + Lm +S + + + 1/2b,3b

LM760 - + + Lm +S + + + 1/2a,3a,3c

CAMP : Christie, Atkins, Munch- Petersen test

+S : Enhanced zone of haemolysis with Staphylococcus aureus Lm : Listeria monocytogenes

+R : Enhanced zone of haemolysis with Rhodococcus equi Li : Listeria ivnovii

PI-PLC : Phosphatidylinositol-specific phospholipase-C SBA : Sheep blood agar V

of 774 samples (Gaya, et al., 1998) and 3.48% as calculated by Ryser and

Marth (1991) in the USA. In a study in UK, the incidence of Listeria from

milk processing equipments was found to be 18.8% (6.3% L. monocytogenes),

while in the environment and raw milk was 54.7% (40.6% L. monocytogenes)

and 44.4% (22.2% L. monocytogenes), respectively (Kells and Gilmour, 2004).

The variation in the number of Listeria spp. from different studies carried out

could also be due to the diverse isolation and enumeration methods. The ability

of L. monocytogenes to grow at low temperatures is important in the

bacterium’s persistence in food processing environments. Further biofilms

forming abilities (Di Bonaventura et al., 2008) and sanitizer resistance

(Lunden et al., 2003) contribute to the persistence of L. monocytogenes in food

processing environments.

In the present study, maximum isolates were recovered from samples

collected from market (Table 5.3) followed by samples at the milk processing

unit.

Table 5.3. Isolation of Listeria at different levels of collection and processing.

Level No. of Lm Lin Liva Lg

Samples

Udder 126 3 8 0 0

Milk cans 126 5 4 0 0

Milk receiving 126 3 5 0 0

centres

Processing unit 269 10 19 1 0

Market 120 16 6 0 1

Total 767 37 42 1 1

145

The foodborne pathogens in raw milk originate from the farm

environment and direct excretion from animals’ infected udder and poor silage

quality, whereas, in dairy plants the pathogens may enter via contaminated raw

milk, colonize the dairy plant environment and consequently contaminate dairy

products. Important sources of contamination during the handling and

processing might be the workers as well (Bemrah et al., 1998; Kousta et al.,

2010). Listeria shed in the faeces (Van Kessel et al., 2004). The prolonged

excretion of the organism in milk, the apparently normal appearance of the

milk in majority cases and the consumption of raw milk, especially on farms,

could be important factors in the transmission and epidemiology of Listeria

infection. We believe that the sources of contamination of Listeria spp. in raw

milk are probably insufficient hygiene during milking so also storage and

transport of milk. L. monocytogenes may directly contaminate milk as a

consequence of listerial mastitis, encephalitis or Listeria related abortion in

cattle. Rawool et al. (2007) reported overall occurrence of L. monocytogenes in

0.55% of 243 cattle and buffaloes with subclinical mastitis in India.

Haemolysis, CAMP test, PI-PLC assay and PCR besides biochemical

confirmation for characterization of the isolates were employed in the present

study. The confirmation methods employed here seems to be adequate. Among

the virulence genes of Listeria, the hlyA gene has been used most commonly

for confirmation of the isolates (Aznar and Alarcón, 2002). All the isolates

were subjected to PCR assay for amplification of the hlyA gene. It allowed

amplification of the hlyA gene of L. monocytogenes to its respective 456 bp

product represented by a single band in the corresponding region of the DNA

marker ladder (Fig 5.5). Out of 81 Listeria isolates the hlyA gene was detected

146

in 37 isolates. All other Listeria spp. isolates were negative in PCR analysis.

Conventional culture-based methods are labour intensive and time consuming.

Based on the results, it can be concluded that detection of PI-PLC activity by

ALOA simultaneously with PCR targeting hlyA gene can be used for detecting

the pathogenic strains of L. monocytogenes.

1 2 3 4 5 6 7 8 9 10 M

456 bp

Fig 5.5. Amplification of the hlyA gene in Listeria monocyotgenes isolates.

Lane 1: Negative control; Lanes 2-9: Listeria monocytogenes isolates;

Lane 10: Listeria monocytogenes MTCC 1143.

Serotyping

Typing of L. monocytogenes is important in epidemiological studies for

investigation of foodborne outbreaks (i.e. comparing clinical and food

isolates), and in the food-processing environment, to identify the source or

sources of contamination and routes of dissemination. A rapid multiplex-PCR

serotyping assay has been developed which separated the four major L.

monocytogenes serovars into distinct groups (Doumith et al., 2004). The

performance of this assay was evaluated through a multicenter typing study

(Doumith et al., 2005). This assay was employed in the present investigation to

serotype L. monocytogenes isolates recovered from milk. The profiles of

147

148

multiplex-PCR serotyping of standard Listeria strains (Fig 5.6) and L.

monocytogenes isolates recovered from milk are depicted in Table 5.4. Out of

37 L. monocytogenes isolates, a larger proportion of isolates (26) belonged to

the group corresponding to serovars 1/2a, 1/2c, 3a, and 3c. Serogroup

corresponding to serovars 4b, 4d and 4e was detected in two strains while

serogroup 1/2b, 3b, 4b, 4d, and 4e was detected in nine strains (Table 5.2; 5.4).

Using conventional serotyping, the isolates were assigned to serotypes 1/ 2a

(26), 1/2b (9) and 4b (2). Our data showed that most of the isolates belonged to

1/2a, which was considered as a sporadic cause for human listeriosis (Liu,

2006). Studies have found that serotype 1 ⁄ 2a was the predominant serotype of

L. monocytogenes food and environmental isolates (Lukinmaa et al. 2003;

Gilbreth et al. 2005; Corcoran et al. 2006). Serotyping of 196 L.

monocytogenes isolates from food sources revealed 3 serovars with 1/2a to be

dominant serovar presented by 94.4% of the isolates (Rivoal et al., 2010).

Serotyping of 145 L. monocytogenes isolates from foods and food processing

environments revealed serovar 1/2a to be the most frequent (57.4%) serovar

(O’Connor et al., 2010). Our earlier studies indicated predominance of L.

monocytogenes serotype 4b in human clinical isolates (Kalekar et al., 2011)

and 1/2a in isolates from milk processing environments (Doijad et al., 2011).

The observation indicates the potential of milk and milk products to serve as

vehicles of transmission of virulent L. monocytogenes. Serotyping of L.

monocytogenes isolates using conventional and PCR methods revealed

serotypes 1/2a, 1/2b, and 4b to the extent of 78% of the typeable strains (Fox et

al., 2009). The strains were isolated from the dairy farm environment and in

particular the milking facility.

Table 5.4. Serotypes of L. monocytogenes isolates recovered from milk.

Strains Serotype No of strains

Standard NCTC 11994 4b, 4d, 4e 1

Standard MTCC 1143 4b, 4d, 4e 1

L. monocytogenes 4b, 4d, 4e 2

L. monocytogenes 1/2b, 3b, 4b, 4d, 4e 9

L. monocytogenes 1/2a, 1/2c, 3a, 3c. 26

 

 

 

 

 

 

 

 

 

Fig 5.6. Serotype profile of Listeria species by multiplex-PCR serotyping Lanes 1-5

L. monocytogenes isolates, Lane 6 – L. monocytogenes, 4b (NCTC 11994), Lane 7-

L. innocua, Lane 8 – Negative control, M – DNA ladder

149

PFGE

Multiplex PCR and PFGE analysis are currently used by several public and

private laboratories for serogrouping and subtyping L. monocytogenes. PFGE is

considered the gold standard method for subtyping foodborne pathogens, because

of its high discriminatory power and reproducibility. Thirty six Listeria isolates

were subjected to PFGE analysis to cover different sampling areas and different

species.

PFGE discriminated the L. monocytogenes isolates into 5 ApaI and 4 AscI

PFGE patterns (pulsotypes) at 80% similarity, but could differentiate serovars

within MPCR serogroups, in which isolates from different serovars displaying the

same pulsotype were found (Figs 5.7; 5.8 and 5.9).

Dendrogram analysis showed that PFGE yielded a good binary division into

genetic lineages I (serotypes 1/2b, 3b, 4b, and 4e) and II (serotypes 1/2a, 1/2c, 3a

and 3c) a result that is consistent with previous studies (Gilbreth et al., 2005;

Nadon et al., 2001) and further confirm that these two lineages represent distinct

subgroups. Our data also showed that there was a nearly complete correlation

between pulsotypes and serotypes with identical PFGE patterns belonged to the

same serotype.

A total of 25 L. monocytogenes isolates recovered from milk and milk

products at different places in India were subjected to PFGE (Fig 5.10). The

isolates originated from different geographic regions. All isolates were investigated

by multiplex PCR, allowing serovar predictions and DNA macrorestriction patterns

were determined by pulsed field gel electrophoresis (PFGE) employing ApaI and

150

AscI enzymes. A larger proportion of isolates belonged to PCR group

corresponding to serovars 4b, 4d and 4e (92.68%). PCR group corresponding to

serovars 1/2a and 3a was detected in three strains. DNA macrorestriction pattern

analysis of PCR groups showed that isolates had a very low diversity. PFGE

analysis of isolates showed that the profiles constitute a homogeneous population.

Isolates showed just two pulsotypes. In spite of the fact that the isolates were

completely independent, the distribution of L. monocytogenes genotypes was

relatively homogeneous, suggesting the existence of resident strains.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Fig 5.7. Dendrogram of Listeria monocytogenes isolates obtained from milk samples with ApaI digestion  

151

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Fig 5.8. Dendrogram of Listeria monocytogenes isolates with AscI digestion. 

 

152

 

 

          Fig 5.9. AscI and ApaI profiles of selected Listeria monocytogenes isolates.

M 1 2 3 4 5 6 7 8 9 10 11 12 M 13 14 15 16 17 18 19 20 21 22 23 24 25 M

AscI ApaI

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Fig 5.10. PFGE analysis of Listeria monocytogenes strains isolated from milk and milk products at different locations in India. The cultures were maintained under Indian Listeria Culture Collection. Lanes M: Lambda DNA marker, Lanes 1 to 22 isolates of L. monocytogenes

153

The application of PFGE in the characterization of L. monocytogenes

isolated from the food can provide a valuable insight into the presence of endemic

strains and can provide valuable information on potential sites of cross-

contamination. Epidemiological tracking of strains over a period of time is required

to enable more precise identification of sites of cross-contamination, or critical

control points, and to enable to take some measures to avoid of the persistence of

individual strains within the processing environment.

Antibiotic sensitivity

The first emergence of multi resistant strains of L. monocytogenes has been

reported in France (Poyart-Salmeron et al. 1990). L. monocytogenes is widely

susceptible to clinically relevant classes of antibiotics active against Gram-positive

bacteria, with the exception of natural in vitro resistance to older quinolones,

fosfomycin, and expanded-spectrum cephalosporins, (Troxler et al., 2000). The

treatment of choice is currently based on a synergistic association of high doses of

amino-penicillin (ampicillin or amoxicillin) and gentamicin (Temple and Nahata,

2000; Hof, 2004). Rifampin, vancomycin, linezolid, and carbapenems have been

proposed as possible alternatives, trimethoprim is generally used in case of

intolerance of beta-lactams (Temple and Nahata, 2000; Hof, 2004). The importance

of continuous monitoring of environmental, food and clinical Listeria isolates for

antibiotic resistance is emphasized by the slow and gradual emergence of

antimicrobial-resistant strains.

154

Results of disc diffusion assay were recorded as per the guidelines of

NCCLS, 1997. All the 37 L. monocytogenes isolates were subjected to antibiotic

sensitivity testing using disc diffusion method. Seven antibiotics, tetracycline,

ciprofloxacin, chloramphenicol, linezolid, meropenem, gentamycin, and

trimethoprim exhibited complete sensitivity (Table, 5.5; Fig 5.11). However, the

isolates showed variable resistance against ampicillin (16.21%), vancomycin

(21.62%) and penicillin (43.24%). L. monocytogenes rarely develops acquired

resistance to antibiotics. However, some studies have recently reported an increased

rate of resistance to one or several clinically relevant antibiotics in strains of

Listeria isolated from food, the environment, or patients with listeriosis (Walsh et

al., 2001; Srinivasan et al., 2005; Conter et al., 2009). A recent study revealed a

high level of resistance in L. monocytogenes isolated from dairy farms (Srinivasan

et al., 2005). An increase in antimicrobial resistance of L. monocytogenes, which

may be linked to over-use of antibiotics in animals and humans (Davies, 1998; Rao,

1998), is a major public health concern owing to the high mortality rates associated

with listeriosis (Li et al., 2007). Results of the present study are in accordance with

above findings as we found all of the L. monocytogenes isolates recovered from

milk were sensitive to seven of the antibiotics (Hof, 1991; Charpentier and

Courvalin, 1999). In our study, out of 37 L. monocytogenes isolates, 16 were found

resistant to penicillin, 8 to vancomycin and 6 to ampicillin. A review of antibiotic

resistance in Listeria spp. (Charpentier and Courvalin, 1999) reported no cases of

resistance to penicillin in strains of Listeria spp. from human, food and

environmental sources. In a study to test the susceptibility of 120 L. monocytogenes

155

strains isolated from food and food-processing environments to 19 antibiotics

currently used in veterinary and human therapy, resistance to at least one antibiotic

was reported in 11.7% strains. Resistance to ampicilin and vancomycin was also

reported (Conter et al., 2009).

Table 5.5. Per cent sensitivity/resistance of L. monocytogenes isolates.

Sr.

no.

Antibiotic

with concentration

(n=37)

S

No. %

R

No. %

1 Ampicillin (A)

(25 µg/disc) 31 84.21 6 15.79

2 Ciprofloxacin

(30µg/disc) 37 100 0

3 Cloramphenicol

(30µg/disc) 37 100 0

4 Gentamicin

(10µg/disc) 37 100 0

5 Linezolid

(30µg/disc) 37 100 0

6 Meropenem

(10µg/disc) 37 100 0

7 Penicillin

(10µg/disc) 21 57.89 16 42.11

8 Tetracycline (T)

(30µg/disc) 37 100 0

9 Trimethoprim

(25µg/disc) 37 100 0

10 Vancomycin

(30µg/disc) 29 78.95 8 21.05

156

Conclusions

Despite the high incidence of contamination of raw milk, it carries a low risk of

listeriosis transmission because of the heat treatment prior to consumption. However,

considering the level of incidence of L. monocytogenes in raw milk, it seems likely that L.

monocytogenes may be transferred to milk products or milk that have not been correctly

pasteurized or that have been contaminated post pasteurization with raw milk. A number of

farms sampled supply raw milk to the milk industry that produces market milk. This study

demonstrates the prevalence of L. monocytogenes in the dairy farm environment and the

need for good hygiene practices to prevent its entry into the food chain.

The occurrence of L. monocytogenes in raw bovine milk is of great concern from

public health point of view as it can serve as a source for the transmission of human

listeriosis. This occurrence could be as a result of unhygienic conditions and improper

husbandary practices. This calls for an urgent need of hygienic measures to be adopted at

farm level as well as at dairies. In addition, to minimize human listeriosis, milk needs to be

properly pasteurized to ensure destruction of L. monocytogenes.

In conclusion effective food safety interventions to reduce or control foodborne

pathogens are needed throughout the food continuum, from the farm to the end user.

Current production and processing procedures for livestock and their products do not have

sufficiently robust food safety interventions to ensure pathogen free raw milk and products.

Since there is no single widely accepted food safety intervention that will eliminate

pathogen contamination of fresh and minimally processed foods, the application of

effective food safety interventions must be at the farm and additional interventions need to

be thereafter at subsequent stages of food processing, packaging, distribution, retail, and

home or food service establishments.

157