Dr. Ashraf Yahia Osman MohamedMBBS, MSC
Whatsapp:00249922577404
Introduction to Mendelian &
NonMendelian Diseases
Genotype & Phenotype
• Alleles are alternate forms of a gene that difer in their sequences and can encode diferent phenotypes.
• phenotype: observable properties of an organism.
• Locus: position of a gene on a chromosome.
Genotype & Phenotype
• Mendelian phenotype (monogenic) is a phenotype whose presence or absence depends on the genotype at a single locus.
• Mendelian phenotypes are classifed to dominant and recessive phenotypes.
• Non Mendelian phenotype (multifactorial) is a character whose presence or absence depends on the genotype at multiple loci.
Recessive character: Only manifests in homozygous individuals
Dominant character: can manifest in heterozygous individuals
Variation
Meiosis contribute to genetic and phenotypic variation by two mechanisms:1- Independent assortment of chromosomes
2- Recombination
Variation
• In humans for each of the 23 homologous pairs of chromosomes.
• Homologs distribute randomly in daughter cells.
Variation
Recombination: exchange (crossover) of analogous chromosomal segments between homologous chromosomes.
Mutations
Frame-shift mutations
In-frame mutations
Trinucleotide repeat
mutations
Point Mutations
Silent mutations
Missense mutations
Nonsense mutations
Variation
5’CCCTACATGTTTATT3’If a gene sequence is as shown above, what will be the sequence of mRNA if all nucleotides in the gene are transcribed?Answer: GGGAUGUACAAAUAA
5’GGGAUGUACAAAUAA3’If the sequence above is of a mRNA, infer the sequence of the polypeptide chain encoded by this mRNA by using the following codons information:
GGG: Gly GGA: Gly GGU: Gly UGG: TrpAUG: Initiation codone/Met UAC: Thr ACA: Thr AAA: Lys AAG: lys AAC: Asn AAU: Asn UAA: stop codon Answer: Met-Thr-Lys
Variation
5’GGGAUGUACAAAUAA3’If the abovementioned mRNA sequence is changed to :
5’GGGAUGUACAAGUAA3’1-What will be amino acid sequence?2- What is the type of this mutation?
Met-Thr-LysSilent mutation
Variation
Silent mutations: The codon containing the changed base code for the same amino acid.
E.g.: The rat get fat The rat get Fat
Variation
5’GGGAUGUACAAAUAA3’If the abovementioned mRNA sequence is changed to :
5’GGGAUGUACAACUAA3’1-What will be amino acid sequence?2- What is the type of this mutation?
Met-Thr-AsnMissense mutation
Variation
Missense mutation: The codon containing the changed base code for diferent amino acid.
E.g.: The rat get fat The rat get cat
Variation
5’GGGAUGUACAAAUAA3’If the abovementioned mRNA sequence is changed to :
5’GGGAUGUAAAACUAA3’1-What will be amino acid sequence?2- What is the type of this mutation?
MetNonsense mutation
Variation
Nonsense mutation: The codon containing the changed base codes for termination (stop codon).
E.g.: The rat get fat The rat
Variation
5’GGGAUGUACAAAUAA3’If the abovementioned mRNA sequence is changed to :
5’AUGGGAUGGGGUACAAAUAA3’1-What will be amino acid sequence?2- What is the type of this mutation?
Met-Gly-Trp-Gly-Thr-AsnFrame shift mutation
Variation
Frame-shift mutations:If one or two nucleotides are added to or deleted from the coding region of a message sequence.
E.g.: The rat get fat Her atg etf at
Variation
5’GGGAUGUACAAAUAA3’If the abovementioned mRNA sequence is changed to :5’GGGAUGUACAAGAAGAAGAAGAAGUAA
3’1-What will be amino acid sequence?2- What is the type of this mutation?
Met-Thr-Lys-Lys-Lys-Lys-LysTrinucleotide repeat
Variation
Trinucleotide repeat mutations: a sequence of three bases that becomes repeated in tandem many times.
E.g.: The rat get fatThe rat rat rat rat rat get fat