Identifying Mechanisms by which Escherichia coli O157:H7 Subverts Interferon-gamma Mediated Signal Transducer and Activator of Transcription-1 Activation
by
Nathan Koul-Lin Ho
A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Laboratory Medicine and Pathobiology
University of Toronto
© Copyright by Nathan Koul-Lin Ho 2012
ii
Identifying Mechanisms by which Escherichia coli O157:H7
Subverts Interferon-gamma Mediated Signal Transducer and
Activator of Transcription-1 Activation
Nathan Koul-Lin Ho
Doctor of Philosophy
Laboratory Medicine and Pathobiology University of Toronto
2012
Abstract Enterohemorrhagic Escherichia coli (EHEC) serotype O157:H7 is a foodborne pathogen that
causes significant morbidity and mortality in developing and industrialized nations. EHEC
infection of host epithelial cells is capable of inhibiting the interferon gamma (IFNγ) pro-
inflammatory pathway through the inhibition of Stat-1 phosphorylation, which is important for
host defense against microbial pathogens. The aim of this thesis was to determine the bacterial
factors involved in the inhibition of Stat-1 tyrosine phosphorylation. Human HEp-2 and Caco-2
epithelial cells were challenged directly with either EHEC or bacterial culture supernatants,
stimulated with IFNγ, and then protein extracts were analyzed by immunoblotting. The data
showed that IFNγ-mediated Stat-1 tyrosine phosphorylation was inhibited by EHEC secreted
proteins. Using 2D-Difference Gel Electrophoresis, EHEC Shiga toxins were identified as
candidate inhibitory factors. EHEC Shiga toxin mutants were then generated, complemented in
trans, and mutant culture supernatant was supplemented with purified Stx to confirm their ability
to subvert IFNγ-mediated cell activation. I conclude that E. coli-derived Shiga toxins represent a
novel mechanism by which EHEC evades the host immune system.
iii
Acknowledgements This thesis is dedicated my family, friends, and colleagues who have supported me through this
PhD journey. You all know who you are, and how you have contributed to my life in and outside
of the laboratory. I would not have been able to progress this far as a person without every one of
you, and I thank you all from the bottom of my heart.
Family Millie Ho Desmond Ho Serena Park-Ho Grandma Stanley Ho Eric Ho Connie Ho Kimberley Ho Hillary Ho Eddy Ho Jocelyn Ho Julius Ho Elizabeth Ho Kiara Ho Raymond Chan Anne Chan Chloe Chan Ellie Chan Sherman Group Philip Sherman Kathene Johnson-Henry Melanie Gareau Eytan Wine Juan Ossa Kevin Donato Grace Shen-Tu David Rodrigues Andrew Sousa Robert Lorentz Steve Hawley
Linköping Group Johan Söderholm Anders Carlsson Linda Gerdin Åsa Keita Ylva Braaf Maria Jönsson Cellsignals Group Richard Ellen Najib Yourish Science Rendezvous Lauren Kilgour Linda Vong Songyi Xu Ron Ammar Christopher Smith Gladys Wong Robert Lorentz Grace Shen-Tu Claire Scherzinger Yifang Liu Steve Hawley Gursonika Binepal Iwona Wenderska Kamna Singh Maher Bourbia Maisha Syeda Kelly Thickett Cherry Leung Kelsey Miller
LSCDS Group Chan-mi Lee SickKids Administration Margaret Johnson Suzanne Shek UofT Staff and Administrators Ian Crandall Martha Brown Ken Greaves Raul Cunha Peter Hurley Elissa Strome Emanuel Istrate Cynthia Goh Dwayne Miller CIHR Administrator Mary-Jo Makarchuk
Linda Vong
iv
Table of Contents Title Page ......................................................................................................................................... i
Abstract ........................................................................................................................................... ii
Acknowledgements ........................................................................................................................ iii
Table of Contents ........................................................................................................................... iv
Dissemination of Work Arising from this Thesis .......................................................................... vi
List of Tables ............................................................................................................................... viii
List of Figures ................................................................................................................................ ix
Chapter 1: Introduction ................................................................................................................1
1.1 Epidemiology of E. coli O157:H7 (EHEC) .........................................................................4
1.2 Evolution of E. coli O157:H7 ..............................................................................................8
1.3 Virulence Factors of E. coli O157:H7 .................................................................................8
1.3.1 Shiga toxins ............................................................................................................11
1.3.2 Locus of Enterocyte Effacement Pathogenicity Island (LEE PAI) and the Type 3 Secretion System (T3SS) ....................................................................................12
1.3.3 Escherichia coli O157:H7 pO157 plasmid ............................................................16
1.4 Innate immune responses to EHEC O157:H7 infection ....................................................18
1.4.1 Interferons and the Interferon-gamma (IFNγ) Pathway .........................................18
1.4.2 Health Implications Arising from Defects in IFNγ Signaling ...............................24
1.4.3 Pathogen Inhibition of the IFNγ Signaling Pathway .............................................24
1.5 Management of EHEC Infections ......................................................................................25
1.6 Probiotics ...........................................................................................................................26
1.7 Summary ............................................................................................................................28
Chapter 2: Hypothesis and Objectives .......................................................................................29
Chapter 3: Identifying Mechanisms by which Escherichia coli O157:H7 Subverts Interferon-γ Mediated Signal Transducer and Activator of Transcription-1 Activation ............................................................................................................30
v
3.1 ABSTRACT ........................................................................................................................31
3.2 INTRODUCTION ..............................................................................................................32
3.3 MATERIALS AND METHODS ........................................................................................33
3.4 RESULTS ...........................................................................................................................39
3.5 DISCUSSION .....................................................................................................................54
3.6 ACKNOWLEDGEMENTS ................................................................................................58
Chapter 4: Enterohemorrhagic Escherichia coli O157:H7 Shiga Toxins Inhibit Interferon-gamma Mediated Cellular Activation .............................................59
4.1 ABSTRACT ........................................................................................................................60
4.2 INTRODUCTION ...............................................................................................................61
4.3 MATERIALS AND METHODS ........................................................................................62
4.4 RESULTS ............................................................................................................................73
4.5 DISCUSSION .....................................................................................................................88
4.6 ACKNOWLEDGEMENTS ................................................................................................92
Chapter 5: Immune Signaling Responses in Intestinal Epithelial Cells Exposed to Pathogenic Escherichia coli and Lactic Acid-Producing Probiotics .................93
5.1 ABSTRACT ........................................................................................................................94
5.2 INTRODUCTION ...............................................................................................................95
5.3 MATERIALS AND METHODS ........................................................................................96
5.4 RESULTS ..........................................................................................................................100
5.5 DISCUSSION ...................................................................................................................127
5.6 ACKNOWLEDGEMENTS ..............................................................................................128
Chapter 6: Discussion, Future Directions, and Significance ..................................................129
6.1 DISCUSSION ...................................................................................................................130
6.2 FUTURE DIRECTIONS ...................................................................................................135
6.3 SIGNIFICANCE ...............................................................................................................137
References ....................................................................................................................................138
vi
Dissemination of Work Arising from this Thesis Publications:
Ho NK, Crandall I, Sherman PM (2012) Identifying Mechanisms by which Escherichia coli
O157:H7 Subverts Interferon-γ Mediated Signal Transducer and Activator of
Transcription-1 Activation. PLoS ONE. 4(1):e30145.
Ho NK, Ossa JC, Silphaduang U, Johnson R, Johnson-Henry KC, Sherman PM (2012)
Enterohemorrhagic Escherichia coli O157:H7 Shiga Toxins Inhibit Interferon-gamma
Mediated Cellular Activation. Infect Immun. 80(7):2307-15.
Ho NK, Ossa JC, Hawley S, Mathieu O, Tompkins TA, Johnson-Henry KC, Sherman PM.
Immune Signaling Responses in Intestinal Epithelial cells Exposed to Pathogenic
Escherichia coli and Lactic Acid-Producing Probiotics. Manuscript accepted pending
revision. Journal of Beneficial Microbes
Other publications arising from this work
Jandu N, Ho NK, Donato K, Karmali M, Mascarenhas M, Duffy S. P, Tailor C, Sherman PM,
(2009) Enterohemorrhagic Escherichia coli O157:H7 gene expression profiling in
response to growth in the presence of host epithelia. PLoS One. 4(3):e4889.
Gareau MG, Ho NK, Brenner D, Sousa AJ, LeBourhis L, Mak TW, Girardin SE, Philpott DJ,
Sherman PM, (2011) Enterohemorrhagic, but not enteropathogenic, Escherichia coli
infection of epithelial cells disrupts signaling responses to tumor necross factor-alpha.
Microbiology. 157:2963-2973.
Ossa JC, Ho NK, Wine E, Leung N, Gray-Owen SD, Sherman PM, (2012) Adherent-Invasive
Escherichia coli Blocks Interferon-Gamma Induced Signal Transducer and Activation of
Transcription (STAT)-1 in Human Intestinal Epithelial Cells. Cellular Microbiology.
Under second review. Cellular Microbiology.
vii
Oral Presentations:
Ho N, Sherman PM. (2011) Bacterial subversion of host signaling: How Escherichia coli
O157:H7 suppresses Interferon-gamma mediated Stat-1 phosphorylation. The Hospital
for Sick Children Cell Biology Research Day. Old Mill Inn, Toronto.
Ho N, Sherman PM. (2011) Ph.D. training in the Life Sciences. Cellsignals CIHR Strategic
Training Initiative in Health Research. Old Mill Inn, Toronto.
Ho N, Crandall I, Sherman PM. (2011) Defining mechanisms by which Escherichia coli
O157:H7 subverts Interferon-γ mediated host epithelial cell activation. Cellsignals
Webinar.
Ho N, Crandall I, Sherman PM. (2010) Elucidating the Mechanisms by which Escherichia coli
O157:H7 subverts Interferon-γ mediated cell activation. Farncombe-Toronto Research
Day. Toronto, Canada
Ho N (2010) International Relations in Health Research Training. The Gastro-Intestinal Mucosal
Inflammation and Infection Centre Research Program. Linköping, Sweden.
http://vimeo.com/15525784
Ho N, Sherman PM. (2010) Elucidating the Mechanisms by which Escherichia coli O157:H7
subverts Interferon-γ mediated cell activation. Annual Regenerative Medicine
Symposium. CIHR Training Program in Regenerative Medicine. Toronto, Canada.
Ho N, Sherman PM. (2009) Defining mechanisms by which Escherichia coli O157:H7 subverts
host epithelial cell activation of signal transducers and activators of transcription (Stat)-1
by Interferon-γ. Research Topics in GI Disease IX. The Canadian Association of
Gastroenterology. King City, Ontario, Canada.
viii
List of Tables Chapter 1: Introduction
Table 1.1: Clinical and epidemiological characteristics of pathogenic Escherichia coli ... 2
Table 1.2: Shiga Toxin producing E. coli (STEC) seropathotype classification ................ 7
Table 1.3: LEE and non-LEE encoded EHEC virulence factors ...................................... 14
Table 1.4: pO157 encoded virulence factors .................................................................... 17
Table 1.5: STAT proteins, triggering factors, and association functions ......................... 21
Chapter 3: Identifying Mechanisms by which Escherichia coli O157:H7 Subverts
Interferon-γ Mediated Signal Transducer and Activator of Transcription-1
Activation
Table 3.1: Primers employed in this study ........................................................................ 37
Chapter 4: Enterohemorrhagic Escherichia coli O157:H7 Shiga Toxins Inhibit Interferon-
gamma Mediated Cellular Activation
Table 4.1: Primers employed in this study ........................................................................ 64
Table 4.2: List of bacterial strains and plasmids used in this study .................................. 82
Table 4.3: Quantification of Stx1 and Stx2 present in culture supernatants. .................... 87
Chapter 5: Immune Signaling Responses in Intestinal Epithelial Cells Exposed to
Pathogenic Escherichia coli and Lactic Acid-Producing Probiotics
Table 5.1: Genes modified significantly in the ImmuneArray analysis ......................... 103
Table 5.2: Primer pairs used in the qRT-PCR analysis. ................................................. 117
ix
List of Figures Chapter 1: Introduction
Figure 1.1: A brief overview of E. coli O157:H7 pathogenesis. ........................................ 9
Figure 1.2: The IFNγ signaling pathway. ......................................................................... 22
Chapter 3: Identifying Mechanisms by which Escherichia coli O157:H7 Subverts
Interferon-γ Mediated Signal Transducer and Activator of Transcription-1
Activation
Figure 3.1: EHEC, but not EPEC, inhibits IFNγ mediated Stat-1 tyrosine
phosphorylation................................................................................................................. 40
Figure 3.2: Secreted factor(s) have protein qualities. ....................................................... 43
Figure 3.3: EHEC secreted inhibitory factor identified as YodA. .................................... 46
Figure 3.4: Isogenic yodA and etpD mutants inhibit Stat-1 tyrosine phosphorylation at
levels comparable tos wild-type. ...................................................................... 49
Figure 3.5: Purified YodA failed to inhibit Stat-1 tyrosine phosphorylation as well as
wild-type culture supernatant. .......................................................................... 52
Figure 3.6: EHEC LEE and pO157 are not involved in the suppression of the IFNγ
signaling pathway. ............................................................................................ 56
Chapter 4: Enterohemorrhagic Escherichia coli O157:H7 Shiga Toxins Inhibit Interferon-
gamma Mediated Cellular Activation
Figure 4.1: EHEC, but not EPEC, inhibits IFNγ-mediated Stat-1 tyrosine
phosphorylation in a non-cytotoxic manner. .................................................... 74
x
Figure 4.2: Secreted factor(s) have protein-like qualities. ................................................ 77
Figure 4.3: Comparative proteomic profiles between EHEC- and EPEC-secreted proteins
........................................................................................................................................... 80
Figure 4.4: Shiga-like toxins from EHEC suppress IFNγ-mediated activation of Stat-1 85
Figure 4.5: Infection with an EHEC StxDKO and T3SS triple mutant suppresses IFNγ
mediated Stat-1 phosphorylation comparable to the wild-type strain .............. 90
Chapter 5: Immune Signaling Responses in Intestinal Epithelial Cells Exposed to
Pathogenic Escherichia coli and Lactic Acid-Producing Probiotics
Figure 5.1: Gene expression profiles. ............................................................................ 101
Figure 5.2: Microarray and qRT-PCR analysis of Caco-2 cells infected alone, co-
incubated, or pre-incubated with probiotics and pathogens ........................... 122
Figure 5.3: qRT-PCR analysis of Caco-2 cells incubated with either probiotics or
pathogens alone, or pre-incubated with probiotics ......................................... 125
Chapter 6: Discussion, Future Directions, and Significance
Figure 6.1.1: The results of this thesis presented as a model of EHEC O157:H7
pathogenesis ................................................................................................... 133
1
Chapter 1 Introduction
Escherichia coli was first discovered in 1885 by Theodore Escherich as a Gram-negative,
facultative anaerobe, which typically inhabits the lower intestinal tract of many warm-blooded
animals. In humans, the organism is acquired as a commensal bacterium in the colon shortly
after weaning, and persists for life as part of the gut microbiota within the lumen and mucus
layer of the large intestine (Kaper et al., 2004).
Pathogenic E. coli evolved from commensal E. coli through the acquisition of multiple virulence
determinants, such as toxins, adhesins, and secreted effector proteins that modulate multiple host
responses through the acquisition of mobile virulence plasmids, phages, and pathogenicity
islands (PAI). The combined effects of different virulence factors determine the extent of E. coli
pathogenesis and the severity of human disease. Infectious strains resulting in common diseases
are grouped as pathotypes, including: adherent-invasive E. coli (AIEC), diffusely adherent E.
coli (DAEC), enteroaggregative E. coli (EAEC), enterohemorrhagic E. coli (EHEC),
enteroinvasive E. coli (EIEC), enteropathogenic E. coli (EPEC), atypical enteropathogenic
(ATEC), enterotoxigenic E. coli (ETEC), sepsis/meningitis causing E. coli (MNEC), and
uropathogenic E. coli (UPEC) Table 1.1 (Croxen and Finlay, 2010).
Within each pathotype classification, E. coli strains are further characterized by antigenic
variants including O-antigen (lipopolysaccharide), H-antigen (flagellar), and K-antigen
(capsular) types (DebRoy et al., 2011).
2
Table 1.1: Clinical and epidemiological characteristics of pathogenic Escherichia coli
Pathogen Epidemiology Clinical Symptoms Virulence Factors
Adherent-Invasive
(AIEC)
Developed countries Crohn’s Disease Adhesion and invasion
factors
Enteroaggregative
(EAEC)
Traveller’s diarrhea
in developing and
developed countries
Watery diarrhea
with mucus or
blood
Fimbriae, Cytotoxins
Enterohemorrhagic
(EHEC)
Food-borne and
water-borne
outbreaks in
developed countries
Watery diarrhea,
Hemorrhagic
colitis, Hemolytic
uremic syndrome
Shiga-like toxins
(Verotoxins), Locus of
Enterocyte Effacement
pathogenicity island (LEE
PAI), pO157 plasmid
Enteropathogenic
(EPEC)
Food-borne and
water-borne
outbreaks in
developing countries
Diarrhea EPEC adherence factor
plasmid (EAF). Locus of
Enterocyte Effacement
pathogenicity island (LEE
PAI)
Atypical
Enteropathogenic
(A-EPEC)
Food-borne and
water-borne
Diarrhea Lacks EPEC adherence
factor plasmid (EAF)
Enteroinvasive
(EIEC)/Shigella
Food-borne
outbreaks
Dysentery Cellular invasion,
Intracellular motility, Diffuse
adherence
Enterotoxigenic
(ETEC)
Childhood diarrhea
in developing
countries, traveller’s
diarrhea
Watery diarrhea Fimbriae, Heat-labile and
heat stable enterotoxins
Diffusely adhering
(DAEC)
Food-borne and
water-borne
Diarrhea in
children, urinary
Fimbriae and afrimbrial
adhesins (Afa-Dr), toxins
3
tract infections in
adults
Meningitis-
associated
(NMEC)
Neonates Meningitis K1 capsule, S fimbriae,
Cellular invasion
Uropathogenic
(UPEC)
Sexually active
women
Cystitis,
Pyelonephritis
Type I and P fimbriae,
Hemolysin, Pathogenicity
islands
(Croxen and Finlay, 2010)
4
E. coli serotype O157:H7 is the prototypical EHEC, and was first associated with hemorrhagic
colitis in 1983 in the United States (Riley et al., 1983). This pathogen was subsequently shown to
be cytotoxic towards Vero cells (African green monkey kidney cells), and was henceforth
referred to as Verocytotoxin producing E. coli (VTEC) (Karmali et al., 1985). The parallel
discovery that this pathogen produced Shiga-like toxins gave rise to the alternate name Shiga-
like toxin-producing E. coli (STEC) (Calderwood et al., 1987). This pathogen was implicated in
pediatric cases of hemolytic-uremic syndrome in 1983 at the Hospital for Sick Children in
Toronto, Canada (Karmali et al., 1983).
While VTEC and STEC describe over 200 serotypes of cytotoxin-producing E. coli ranging in
human pathogenesis from severe disease to non-pathogenic, (Levine, 1987) first coined the term
enterohemorrhagic E. coli (EHEC) to incorporate only the E. coli serotypes known to cause
hemorrhagic colitis and the hemolytic uremic syndrome (HUS), and is classically reserved for E.
coli serotypes O157:H7 and O26:H11. Despite these efforts, a conflict in naming schema for this
pathotype of E. coli remains; the term VTEC is widely used in Canada and Europe, while the
term STEC is commonly employed in the United States and Asia. For purposes of consistency,
the term EHEC will be used throughout this thesis.
1.1 Epidemiology of E. coli O157:H7 (EHEC) Although E. coli O157:H7 (EHEC) is a human pathogen responsible for numerous infectious
outbreaks worldwide, it is also a resident commensal bacterium commonly found in the intestinal
tract of ruminants such as cattle, sheep, goats, and deer (Karch et al., 2005). Human exposure to
this pathogen is classically associated with the ingestion of undercooked ground beef, but
infections can also arise following the ingestion of fecally contaminated foodstuffs such as fruits,
vegetables, drinking water, as well as person-to-person contact (Karch et al., 2005).
EHEC outbreaks are attributed to its low infectious dose (<100 organisms), and high
transmissibility, which can either remain isolated or develop into widespread international
outbreaks. Examples of EHEC outbreaks in North America include a multi-state outbreak
resulting in ~200 cases of infection following ingestion of fecally contaminated spinach from a
single commercial vendor in the fall of 2006 (Maki, 2006). The largest EHEC outbreak in
5
Canada occurred in Walkerton, Ontario in 2000 due to inadequately chlorinated drinking water,
which resulted in ~2,300 cases of infection and 7 deaths (Schuster et al., 2005).
While individuals may be asymptomatic even though EHEC is detected in stools, others can
develop severe cases of infection characterized by abdominal cramps and bloody diarrhea within
3 days of consuming the contaminated foodstuff (Melton-Celsa et al., 2012). The most severe
cases of infection typically occur in children <5 years of age, the elderly, and immune-
compromised persons. In severe cases of infection, individuals present with hemorrhagic colitis,
hemolytic-uremic syndrome (HUS is the leading cause of acute renal failure in children),
microangiopathic hemolytic anemia (fragmented erythrocytes), and thrombocytopenia (low
platelet count) (Marshall et al., 2006). Long term complications of EHEC infection include
irritable bowel syndrome (IBS), as seen with a significant number of subjects experiencing post-
infectious IBS 8 years after the Walkerton outbreak compared to those who did not experience
acute enterocolitis (15.4% vs 5.4% p<0.0001) (Marshall et al., 2010).
In North America, approximately 75,000 cases of EHEC infections are reported annually. Of
these, 10-15% of cases develop HUS, another 5-10% result in long-term complications, and 3-
5% of HUS cases are fatal (Panos et al., 2006). EHEC infections account for roughly 250 deaths
in North America each year (Serna and Boedeker, 2008).
In addition to serotype O157:H7, multiple non-O157:H7 EHEC are also a major cause of human
infections and disease outbreaks. In North America, E. coli serotype O157:H7 accounts for
roughly 75% of all EHEC infections, while non-O157:H7 EHEC account for the remaining 25%
(Andreoli et al., 2002). For example, an outbreak of EHEC O111:H8 in Texas (June 1999)
resulted in 2 cases of HUS (Jelacic et al., 2003) and an outbreak of EHEC O104:H21 in Montana
in 1994 resulted in 8 cases of hemorrhagic colitis (Brooks et al., 2005). Nonetheless, the exact
number of non-O157:H7 infections in North America is likely to be underestimated, since
serotyping techniques are rarely used in the setting of a hospital clinical microbiology laboratory
(Werber et al., 2012).
In certain parts of Europe and Australia, non-O157:H7 E. coli is the predominant cause of
infectious outbreaks. In Germany (Misselwitz et al., 2003), Denmark (Ethelberg et al., 2007),
and the UK (Jenkins et al., 2008) EHEC O26:H11 is frequently implicated in diarrhea-associated
HUS. In Belgium, EHEC serogroups O145 and O26 were implicated in an outbreak related to
6
the ingestion of contaminated ice cream (De Schrijver et al., 2008). EHEC serotype O111:H- is
the most common isolate in Australian cases of EHEC infection (Elliott et al., 2001). In
Argentina and Brazil multiple non-O157:H7 EHEC serotypes are related to infectious disease
and outbreaks of human illness (Mora et al., 2005). EHEC serogroups O103, O111, and O91 also
are commonly implicated in non-O157:H7 infections in humans (Jelacic et al., 2003; Karch et
al., 2006).
The latest non-O157 outbreak occurred in Germany in May 2011 in which sprouts were
contaminated with a Stx2 expressing enteroaggregative E. coli of the serotype O104:H4. Over
the course of 3 months, 3,800 cases of infection were reported, including 54 fatalities, and over
800 individuals developed HUS (Werber et al., 2012).
Over 200 non-O157:H7 EHEC have been documented, and are classified based on their O-
antigen, the severity of disease, and the frequency of human outbreaks caused by the organisms.
Accordingly, EHEC strains are now categorized into five seropathotypes (A-E) Table 1.2
(Karmali et al., 2003). This seropathotype classification does not take into account the virulence
properties of these organisms. EHEC, the prototypical VTEC, is grouped into the seropathotype
A, representing the most virulent and pathogenic group. EHEC strains belonging to
seropathotype B are also associated with outbreaks and human disease, though less commonly
than those of seropathotype A. Those in seropathotype C retain the potential to cause severe
human disease (HUS), but are rarely associated with clinical outbreaks. EHEC of seropathotype
D have not been associated with disease outbreaks or HUS, but can cause diarrhea. Lastly,
seropathotype E comprises those EHEC isolates only associated with colonization of animals.
7
Table 1.2: Shiga Toxin producing E. coli (STEC) seropathotype classification
Seropathotype Relative
Incidence
Involvement in
outbreaks
Associated with
Severe Disease
Serotypes
A High Common Yes O157:H7,
O157:H-
B Moderate Uncommon Yes O26:H11,
O103:H2,
O111:H-,
O121:H19,
O145:H-
C Low Rare Yes O91:H21,
O104:H21,
O113:H21
D Low Rare No Multiple
E Non-human only Not Applicable N/A Multiple
(Karmali et al., 2003)
8
1.2 Evolution of E. coli O157:H7 Enterohemorrhagic E. coli O157:H7 is believed to have evolved from enteropathogenic E. coli
O55:H7 approximately 4.5 million years ago (Feng et al., 1998). The current model proposes that
E. coli O157:H7 evolved through a series of stepwise acquisitions of genetic markers such as
Shiga toxin-encoding stx genes; the loss of phenotypic markers such as the ability to ferment
sorbitol (SOR) or β-glucuronidase (GUD) activity; and nucleotide changes in the uidA (the gene
that encodes β-glucuronidase) and fimA and fimH fimbrial genes (Kyle et al., 2012). In addition
to these changes, there was a parallel evolution of both enteropathogenic and enterohemorrhagic
within related serogroups via multiple acquisitions of the locus of enterocyte effacement
pathogenicity island (LEE PAI), the large virulence plasmids EAF and pO157, respectively, and
stx-containing lambda-like bacteriophages in the case of EHEC (Kyle et al., 2012).
1.3 Virulence Factors of E. coli O157:H7 The pathophysiology of EHEC O157:H7 infection is attributed to the effects of multiple
virulence determinants including Shiga toxins, the Locus of Enterocyte Pathogenicity island
(LEE PAI) as well as the pO157 plasmid. A brief overview of E. coli O157:H7 pathogenesis is
illustrated in Figure 1.1.
9
Figure 1.1. Diagram summarizing the common sources of E. coli O157:H7 contamination, sites
of infection within the body, and symptoms associated with colonization.
10
Figure 1.1
11
1.3.1 Shiga toxins
One of the major virulence factors attributed to EHEC pathogenesis are its Shiga toxins. The
cytotoxic effects of these toxins were first documented on Vero cells (African green monkey
kidney epithelial cells) in 1977 (Konowalchuk et al., 1977), and later confirmed in 1983 from a
patient with an E. coli O157:H7 infection and hemolytic-uremic syndrome (Karmali et al., 1983).
Subsequent studies showed that multiple E. coli serotypes elicited the same cytotoxic effects
(Karmali et al., 1985), and further studies showed that EHEC contains two Shiga toxins encoded
by bacteriophages (Stx1 and Stx2) (Obrig, 2010).
EHEC Shiga toxins are similar to the toxin found in Shigella dysenteriae; Stx1 displays 98%
sequence homology, while Stx2 shares ~55% amino acid identity (Ethelberg et al., 2004).
Despite their related primary amino acid sequences, Stx1 and Stx2 are immunologically distinct.
Stx2 is many times more potent than Stx1 in mice, demonstrating a lethal dose (LD50) that is
400-fold lower than Stx1, resulting in greater mortality and significantly increased renal damage
and toxicity (Tesh et al., 1993). Stx2 also shows greater cell toxicity towards human vascular
endothelial cells (Louise & Obrig 1995; Jacewicz 1999), and is the toxin most commonly
associated with clinical isolates (Imamovic et al., 2009; Mora et al., 2007).
EHEC Shiga toxins are AB5 type toxins, comprised of a single 30 kDa A-subunit and a pentamer
of non-covalently attached identical 7 kDa B-subunits (Fraser et al., 2004). During infection, the
toxins are expressed and located in the periplasm of the bacterium, and are secreted by EHEC
into the extracellular milieu on cell death (Obrig, 2010). Secreted toxin traverses the intestinal
cell wall via binding to the glycosphingolipid globotriosylceramide (Gb3) receptor on the surface
of Paneth cells lining the intestinal tract(Schuller et al., 2007). It should be noted that while Stx
classically enters the host cell through binding of the Gb3 receptor, there are reports that Stx can
enter Gb3 negative cells through retrograde trafficking (Maluykova et al., 2008), and can enter
kidney and brain endothelial cells through globotetraosylceramide (Gb4) surface receptors (Betz
et al., 2011). These data suggest that Gb3 may not be the sole receptor involved in Stx
pathogenesis.
Upon internalization, the A subunit dissociates from the B5 subunits and then, via retrograde
transport, traverses the Golgi stacks to the lumen of the endoplasmic reticulum (Sandvig 2004)
where it proceeds to depurinate 28S eukaryotic rRNA thereby inhibiting protein synthesis, and
12
causing cell apoptosis (Obrig, 2010). During infection, the Shiga toxins target the Gb3 receptors
on glomerular endothelial cells, podocytes, and various tubular epithelial cells in the kidney,
thereby causing kidney damage, and leading to hemolytic-uremic syndrome in 10-15% of EHEC
infections (Ethelberg et al., 2004).
1.3.2 Locus of Enterocyte Effacement Pathogenicity Island (LEE PAI) and the Type 3 Secretion System (T3SS)
Following ingestion, EHEC travels to the distal ileum and large bowel in humans where it comes
in contact with, binds intimately to, and forms actin pedestals underneath the site of attachment
with the host intestinal epithelium forming attaching and effacing (A/E) lesions. This phenotype
is afforded to EHEC by genes encoded on a 42 kb PAI known as the Locus of Enterocytes
Effacement Pathogenicity Island (LEE PAI). The LEE PAI is highly regulated and encodes a
type 3 secretion system (T3SS) that serves as a molecular syringe to translocate bacterial effector
proteins directly into the host cell cytoplasm (Croxen and Finlay, 2010; Melton-Celsa et al.,
2012).
Once EHEC comes in contact with the host epithelium, the pathogen uses the T3SS to inject at
least fifty bacterial effector proteins directly into the host cell. One of these effectors is
Translocated Intimin Receptor (Tir). Upon injection, Tir anchors itself onto the surface of the
host cell plasma membrane, and acts as a receptor for intimin, an outer membrane protein found
on the surface of the EHEC bacterium (Vingadassalom et al., 2009).
Binding of Tir to intimin triggers the indirect recruitment of another EHEC effector, EspFu,
using the host proteins IRTKS and IRSp53 as adaptors. Once this complex is formed, EspFu
binds to N-WASP (neural Wiskott-Aldrich syndrome protein), which activates the host Arp2/3
complex resulting in actin polymerization and pedestal formation (Vingadassalom et al., 2010).
Interestingly, this process differs in EPEC, where the Tir molecule is phosphorylated and recruits
the host cell protein Nck, which then binds and activates N-WASP and the Arp2/3 complex
(Campellone and Leong, 2005). In addition to experiments demonstrating that EHEC and EPEC
Tir are not functionally interchangeable (Kenny, 2001), these studies indicate that EHEC and
EPEC use slightly different mechanisms to induce actin polymerization and pedestal formation.
13
In addition to Tir and EspFu, the T3SS injects several other EHEC encoded proteins encoded by
the LEE, most of which are called E. coli secreted proteins (Esp). EspA, B, and D serve as the
structural proteins of the T3SS molecular syringe and are involved in delivery of other effectors
into the cell. Additional LEE-encoded effectors include EspG, F, H, and Map (mitochondrial
associated protein), all of which interfere with host cell signaling. The T3SS also allows for the
delivery of effectors that are not encoded within the LEE and are largely categorized as non-
LEE-encoded (Nle) effectors. The findings have highlighted the multifunctional nature of the
effectors and their ability to participate in redundant and overlapping roles in subverting host cell
processes. An overview of EHEC LEE and non-LEE effectors is presented in Table 1.3.
14
Table 1.3: LEE and non-LEE encoded EHEC virulence factors
LEE encoded
effectors
Function Reference
Tir Intimin receptor, actin pedestal formation,
downregulates Map-dependent filopodia formation,
SGLT-1 inactivation
(Vingadassalom et
al., 2009)
EspA Translocaton of effectors (Ide et al., 2001)
EspB Translocation pore component, AJ disruption, binds
myosins to inhibit phagocytosis
(Hamaguchi et al.,
2008)
EspD Translocation of effectors (Ide et al., 2001)
EspF Mitochondrial disruption, NHE3 inactivation, SGLT-1
inactivation, TJ disruption, disrupts nucleolus, disrupts
intermediate filaments, activates SNX9 to induce
membrane remodelling, binds and activates N-WASP,
inhibits PI3K-dependent phagocytosis
(Dean et al., 2010)
EspG Disrupts microtubules, blocks ARF GTPase signaling
and stimulates PAKs to inhibit endomembrane
trafficking
(Selyunin et al.,
2011)
EspH Blocks Rho GTPase signaling and FCγR-mediated
phagocytosis, promotes actin pedestal length
(Dong et al., 2010)
EspZ Enhances β1-integrin and FAK signaling to inhibit
apoptosis and cellular cytotoxicity
(Shames et al.,
2010)
Map Cdc42 GEF that induces transient filopodia formation,
mitochondrial disruption, SGLT-1 inactivation, TJ
disruption
(Martinez et al.,
2010)
Non-LEE
encoded
effectors
15
EspI/NleA Inhibits COPII-dependent protein export from ER, TJ
disruption
(Thanabalasuriar et
al., 2010)
EspJ Inhibits FCγR-mediated and CR3-mediated trans-
phagocytosis
(Kurushima et al.,
2010)
EspL Enhances F-actin bundling activity of Annexin 2 (Miyahara et al.,
2009)
EspM RhoA GEF that induces stress fibre formation (Arbeloa et al.,
2010)
EspO Unknown (Kim et al., 2009)
EspT Activates Cdc42 and Rac1 that induces membrane
ruffles and lammelipodia, promotes intracellular
bacterial uptake via trigger mechanism
(Bulgin et al., 2010)
EspV Modulates cytoskeleton (Arbeloa et al.,
2011)
NleB Inhibits TNF-induced NF-κB activation (Nadler et al., 2010)
NelC Metalloprotease that cleaves p65 (RelA), c-Rel, p50
and IκB to inhibit NF-κB activation
(Pearson et al.,
2011)
NleD Metalloprotease that cleaves JNK to inhibit AP-1
activation
(Baruch et al.,
2011)
NleE Blocks IκB degradation to inhibit NF-κB activation (Nadler et al., 2010)
NleG/NleI U-box E3 ubiquitin ligase (Wu et al., 2010)
NleH Binds Bax-inhibitor 1 to block apoptosis, sequesters
RPS3 to inhibit NF-κB signaling
(Wan et al., 2011)
EspFu/TccP Relieves N-WASP autoinhibition to trigger actin
pedestal formation
(Vingadassalom et
al., 2010)
(Wong et al., 2011)
16
1.3.3 Escherichia coli O157:H7 pO157 plasmid
E. coli O157:H7 contains a highly conserved, nonconjugative F-like plasmid, pO157 that ranges
in size between 92 to 104 kb (Caprioli et al., 2005). Sequence analysis shows a heterogeneous
mixture of genetic elements, transposons, and prophages as well as parts of other plasmids
indicating its mottled evolution (Lim et al., 2010).
The complete sequence of pO157 reveals 100 open reading frames; among them, 43 ORFs show
similarities to known proteins. Unfortunately, the role of pO157 in disease pathogenesis is not
well defined, as current studies report conflicting results of its role in vivo (Lim et al., 2010). A
summary of the proposed virulence proteins expressed by genes contained in pO157 are listed in
Table 1.4.
17
Table 1.4: pO157 encoded virulence factors
pO157 encoded
effector
Function Reference
EhxA Hemolysin (Schmidt et al., 1994)
KatP Catalase-peroxidase: Aids in EHEC colonization of
host intestine by reducing oxidative stress
(Brunder et al., 1996)
EspP Serine Protease: Cleaves pepsin A and human
coagulation factor V; contributes to mucosal
hemorrhage in HC patients
(Brunder et al., 1997)
ToxB Adhesin (Tatsuno et al., 2001)
StcE Zinc metalloprotease: Inhibits the regulation of host
inflammation pathways, complement
(Lathem et al., 2002)
T2SS Type II secretion system (Schmidt et al., 1997)
(Lim et al., 2010)
18
1.4 Innate immune responses to EHEC O157:H7 infection One of the first lines of defense against EHEC infection is through the activation of the innate
immune system, which uses pattern recognition receptors (PRRs) to detect pathogen-associated
molecular patterns (PAMPs) associated with invading microbes to elicit an immune response
(Jones and Neish, 2011). Of the many host PRR’s, Toll-like receptors (TLRs) and Nod-like
receptors (NLRs) are the principal pathogen recognition receptors involved in bacterial
recognition. TLRs are a family of membrane bound receptors which recognize specific microbial
components such as bacterial lipopolysaccharide (TLR 4) and flagellin (TLR 5) present in the
extracellular milieu (Trinchieri and Sher, 2007), while NLRs sense microbial products such as
peptidoglycan (Nod-2) in the cytoplasm of the host cell (Saleh, 2011). The activation of
leukocytes surrounding the intestine by E. coli leads to their general activation and secretion of
interleukin-12, which activates nearby macrophages, T cells, and NK T cells to secrete IFNγ
(Zhang et al., 2008). IFNγ then binds to the IFNγ receptors ubiquitously expressed in all host
cells and activates the Jak 1, 2, Stat1 signal transduction pathway to initiate an anti-microbial
state in the body (Zhang et al., 2008). As a successful human pathogen, however, E. coli
O157:H7 has evolved various mechanisms to subvert specific host innate immune responses (Ho
et al., 2012a; Ho et al., 2012b). In fact, it has been demonstrated by our laboratory previously
that all EHEC seropathotypes (Table 1.2), including the EHEC precursor (O55:H7), are capable
of suppressing the IFNγ pathway (Jandu et al., 2007).
1.4.1 Interferons and the Interferon-gamma (IFNγ) pathway
Interferons are a family of structurally related cytokines found only in vertebrates that modulate
the immune system. Interferons are categorized into 3 main types: Type I, II, and III (Stark and
Darnell, 2012). Type I interferons, of which there are 17 subtypes, bind to the IFNα receptor
complex consisting of INFAR1 and IFNAR2, and have anti-viral and anti-tumor abilities (Zhang
et al., 2008). Type III interferons are similar to Type I interferons, because they also elicit anti-
viral responses, but are structurally distinct and utilize a distinct combination of receptor
subunits: IFN-λR1 and IL-10Rβ (Zhang et al., 2008). Type II interferons, of which IFNγ is the
only member, has the distinct ability to trigger an anti-bacterial response in the host, and binds to
the ubiquitously expressed surface heterocomplex IFNGR1 and IFNGR2 (Commins et al., 2010).
19
Following EHEC infection, pro-inflammatory cytokines including IFNγ are secreted into the
extracellular environment by macrophages, Natural Killer (NK) T cells, and activated T cells.
IFNγ then binds to IFNGR1 and IRNGR2 receptors expressed on the outer plasma membrane on
the surface of host cells (Shea-Donohue et al., 2010). IFNGR1 and IFNGR2 are transmembrane
receptors belonging to the class II family of cytokine receptors, and associate with each other in
an anti-parallel and non-covalent manner (Bach et al., 1997; Renauld, 2003). With IFNγ binding,
the IFNGR1/2 associated Janus family of tyrosine kinases, Jak1 and Jak2, become tyrosine
phosphorylated, which leads to Jak1 phosphorylating both IFNGR subunits at tyrosine 440 and
exposing two adjacent SRC homology 2 (SH-2) domains within each IFNGR (Schroder et al.,
2004). Latent cytoplasmic Stat-1 (Signal transducers and activation of transcription 1) proteins
subsequently bind to these IFNGR SH-2 domains and become activated by tyrosine
phosphorylation (Heim et al., 1995).
Stat-1 is one of 7 members in the Stat family of proteins: Stat-1, Stat-2, Stat -3, Stat-4, Stat-5a,
Stat-5b, and Stat-6 (Table 1.5). Stat proteins each contain a SRC homology 2 (SH-2) domain, a
DNA binding domain, and a transactivation domain at the C terminus (Mao and Chen, 2005).
Activation of the IFNγ pathway leads to the phosphorylation and association of Stat-1
homodimers at tyrosine residue 701, whereas type I interferon signaling leads to the formation of
multiple homo and heterodimer complexes of Stat-1, Stat-2, Stat-3, and Stat-4 molecules (Levy
and Darnell, 2002).
Upon Stat-1 tyrosine phosphorylation, two molecules homodimerize in the cell cytosol and then
translocate to the nucleus via nuclear translocation sequences (McBride et al., 2002). In the
nucleus, Stat-1 binds to gamma activation sequence (GAS) elements to promote transcriptional
activation of up to 2,000 IFNγ-stimulated genes (ISGs) which together mount a defense against
infecting microbes. Activated genes include, for example, inducible nitric oxide synthase
(iNOS), monocyte chemoattractant protein-1 (MCP-1), lymphocyte adhesion protein ICAM-1,
and Interferon regulatory factor (IRF)-1, as well as increased MHC II expression (Saha et al.,
2010; Schroder et al., 2004). The IFNγ pathway is illustrated in Figure 1.2. It has been
demonstrated in a mouse model of infection with Citrobacter rodentium, a murine-specific
homologue of EHEC (Higgins et al., 1999), that iNOS is locally suppressed at sites of
colonization (Vallance et al., 2002) indicating that the IFNγ signal transduction pathway plays an
20
important role in defense against infection, and that it can be subverted by an enteric bacterial
pathogen in vivo.
21
Table 1.5: STAT proteins, triggering factors, and associated functions
STAT
protein
Cytokine or triggering
factor
Phenotype in knockout mice
STAT1 IL-2, IL-6, IL-10, IFN-α,
IFN-β, IFN-γ, IL-27
Impaired responses to interferons; increased
susceptibility to tumors; impaired growth control
STAT2 IFN-α, IFN-β Impaired responses to interferons
STAT3 LIF, IL-10, IL-6, IL-27,
Growth hormone
Embryonic lethality; multiple defects in adult tissues
including impaired cell survival; impaired response to
pathogens
STAT4 IL-12 Impaired TH1 differentiation owing to loss of IL-12
responsiveness
STAT5a/b Prolactin, Growth
hormone, Thrombopoietin
Impaired mammary gland development owing to loss
of prolactin responsiveness; impaired growth owing to
loss of growth hormone responsiveness
STAT6 IL-4, IL-13 Impaired TH1 differentiation owing to loss of Il-4
responsiveness
Adapted from Saha et al. (2010) and Levy and Darnell, (2002)
22
Figure 1.2: The IFNγ signaling pathway. Binding of IFNγ results in receptor oligomerization
followed by trans-phosphorylation and activation of JAK1 and JAK2. Activated JAKs
phosphorylate IFNGR1 and IFNGR2 resulting in docking and phosphorylation of STAT1.
Phosphorylated STAT1 homodimerizes and translocates to the nucleus to bind GAS (gamma
activation sequences) located in the promoters of several primary response genes. Upon binding,
several genes are expressed, including iNOS, MCP-1, ICAM-1, and IRF-1. Figure adapted from
Saha et al. (2010).
23
24
1.4.2 Health Implications Arising from Defects in IFNγ Signaling
As reviewed by Zhang et al. (2008) and Casanova et al. (2012), multiple studies demonstrate the
biological significance of the IFNγ signal transduction pathway in response to various microbial
infections. For instance, mouse IFNγ is critical for protective immunity against viruses, bacteria,
fungi, and parasites (Muller et al., 1994; Schroder et al., 2004). In humans, gene mutations
resulting in structural defects in the IFNγ receptors lead to clinical disease caused by normally
weakly virulent mycobacterial species, such as bacilli Calmette-Guérin (BCG) vaccines, and
non-tuberculous environmental mycobacteria (Zhang et al., 2008).
Patients with Stat-1 gene mutations resulting in a dysfunctional protein present with even more
severe clinical symptoms since Stat-1 is a downstream molecule of both the IFNα and IFNγ
signaling pathways, and do not mount an effective anti-viral response against vesicular stomatitis
virus (VSV), encephalomyocarditis virus, and herpes simplex virus 1 (HSV-1). In addition,
recurrent bacterial infections are experienced by IFNGR deficient patients (Casanova et al.,
2012). Taken together, these findings indicate that an intact IFNγ signaling pathway is essential
to fight off infections initiated from a wide range of microbial pathogens, with patients harboring
genetic defects in any part of the IFNγ signal transduction pathway being prone to recurrent,
severe, and often life threatening infections (Averbuch et al., 2011; Casanova et al., 2012; Zhang
et al., 2008).
1.4.3 Pathogen Inhibition of the IFNγ Signaling Pathway
The importance of anti-microbial aspects of the IFNγ, Jak, Stat-1 signaling pathway make it an
attractive target for pathogen subversion (Jones and Neish, 2011). In bacteria, for instance,
Mycobacterium tuberculosis secreted proteins ESAT-6 and ESAT-19 inhibit the production of
IFNγ in T cells (Peng et al., 2011) and the IFNγ signaling pathway (Gehring et al., 2003),
respectively. Mycobacterium avium inhibits IFNγ signaling by down-regulating IFNGR
expression (Hussain et al., 1999), and Listeria monocytogenes inhibits the IFNγ pathway by up-
regulating SOCS activity (suppressors of cytokine signaling; a down-regulator of IFNγ
activation) (Stoiber et al., 2001). The parasite Leishmania donovani prevents the phosphorylation
of Stat-1 (Nandan and Reiner, 1995) while influenza A (Uetani et al., 2008) and vaccinia viruses
(Mann et al., 2008) prevent Stat-1 tyrosine phosphorylation and nuclear translocation. Taken
25
together, these findings show that multiple microbial pathogens are able to exploit the IFNγ
signal transduction pathway; some pathogens modulate host factors, whereas other secrete and
express their own products that inhibit signaling.
1.5 Management of EHEC infections Hemolytic uremic syndrome (HUS) is comprised of acute renal failure, hemolysis,
thrombocytopenia, and the risk of stroke (Goldwater and Bettelheim, 2012). This syndrome,
together with the effects of Shiga toxin and complement complex formation, must be
immediately managed. Unfortunately, current treatment options for EHEC infection and HUS
are largely supportive, and consist of fluid resuscitation (Tarr et al., 2012), peritoneal dialysis
(Hickey et al., 2011), and plasma exchange (Slavicek et al., 1995).
Antibiotic treatment against E. coli O157:H7 infection is not recommended, because while they
are effective in pathogen elimination, antibiotics may also induce toxin release from the
pathogen. In fact, antibiotic usage is reported to increase the frequency of HUS occurrence in
EHEC-infected children (Wong et al., 2000) and adults (Dundas et al., 2001).
In vitro studies have shown increased Stx production (in the range of 150-400%) by various
antibiotics (ciprofloxacin, co-trimoxazole, cefiximine, and tetracycline) (Walterspiel et al.,
1992). In general, the amount of toxin production increases steadily when increasing
concentrations of antibiotics are applied (Grif et al., 1998).
Alternative strategies to sequester and limit Shiga toxin-associated pathology have been
proposed. For instance, Stx ligand mimics should theoretically sequester Stx from binding to
host cells and limit pathology. However, in the sole clinical trial of such a molecule, Synsorb Pk,
the treatment failed to diminish the severity of disease in pediatric patients with HUS (Trachtman
et al., 2003). In clinical practice, it is likely that vascular endothelial damage has already
occurred before these ligand receptors could prove to be of benefit.
Alternatively, neutralizing Shiga toxin specific antibodies have been shown to be highly
protective when administered to animals challenged with lethal doses of the toxin (Islam and
Stimson, 1990). In addition, it was shown recently that the divalent cation manganese (Mn2+)
26
blocks endosome-to-Golgi trafficking of Stx in vitro, which could potentially offer a novel
therapeutic approach for managing human disease (Mukhopadhyay and Linstedt, 2012).
Based on evidence that Shiga-toxin activates complement in hemolytic-uremic syndrome (Orth
et al., 2009; Thurman et al., 2009), a few case reports of successful treatment of severe Stx
associated HUS by employing the monoclonal antibody eculizumab (targeted against the
complement protein C5) have been described (Lapeyraque et al., 2011).
Vaccines are another therapeutic avenue currently under active investigation, and could provide
a long-term prevention approach for those at highest risk for contracting and spreading EHEC.
Many EHEC proteins are highly immunogenic (Asper et al., 2011) and promising results in
animal studies have been described using vaccines targeting Shiga toxins (Cai et al., 2011; Gu et
al., 2009). Another avenue currently under active investigation is the immunization of cattle
with a vaccine against E. coli O157:H7 to prevent bacterial shedding in these animals, as well as
animal to animal spread (Allen et al., 2011).
While it is clear that many of these therapeutic options are still quite far away from testing in
human clinical trials, the frequent outbreaks and devastating consequences of EHEC infections
serve to remind us of the urgent need to protect the population against this devastating pathogen.
1.6 Probiotics In recent years, there has been an explosion of interest regarding the potential beneficial effects
of probiotics and the implications for their use in promoting human health and preventing
clinical disease (WHO, 2002). Probiotics are defined as live, non-pathogenic microorganisms
that confer health benefits to the host, and are increasingly being employed as an option for
preventing and treating bacterial infections (Gareau et al., 2010). Probiotics include multiple
bacterial species such as Lactobacilli, Bifidobacteria, and Streptococci which have been found to
generally promote and maintain a balanced intestinal microenvironment, and may prevent active
viral and bacterial infections (Gareau et al., 2010).
Probiotics elicit their beneficial effects through a diverse array of mechanisms, ranging from
secreting antimicrobial products to modulating host immune pathways. As reviewed by Sherman
et al. (2009), certain probiotics secrete antibacterial products, such as bacteriocins, that inhibit
27
the growth and virulence of pathogenic bacteria (Corr et al., 2007), while other lactic acid
producing probiotics suppress pathogen growth by altering the pH in the local microenvironment
(Fayol-Messaoudi et al., 2005), or inhibit enteropathogenic infection through acetate production
(Fukuda et al., 2011).
With other probiotics, such as Lactobacillus helveticus R0052, direct contact with host cells act
as a protective mechanism simply by obscuring pathogen receptor mediated binding to host cells
(Johnson-Henry et al., 2007). Alternatively, probiotics such as Saccharomyces boulardii have the
potential to sequester EHEC pathogens away from host cells by binding directly to them (Gedek,
1999).
Specific probiotic strains can also modulate host cell signaling cascades in a protective manner.
For example, Lactobacillus plantarum strain 299v upregulates intestinal mucin secretion
(Caballero-Franco et al., 2007), and Lactobacillus fermentum upregulates host antibacterial
cationic peptides, called defensins, to reduce and eliminate pathogens present on the epithelial
cell surface. Lactobacillus rhamnosus GG can also upregulate the expression of intestinal
epithelial intercellular tight junction proteins and, thereby prevent pathogen-induced breaks in
intestinal barrier integrity (Seth et al., 2008).
Furthermore, other probiotics can modulate host innate and adaptive arms of the immune system.
For instance, Lactobacillus casei DN-114 001 attenuates the NFκB pro-inflammatory signal
transduction cascade that is activated by pathogen (Tien et al., 2006). Lactococcus lactis has
demonstrated the ability to upregulate regulatory T cells expressing CD4 and Foxp3 (Huibregtse
et al., 2007). In humans with irritable bowel syndrome (IBS), participants randomized to
treatment with Bifidobacterium infantis 35624 showed improvement in clinical symptoms that
correlated with normalization in cytokine profiles. In contrast, Lactobacillus salivarius
UCC4331, another probiotic used during the same study, had no effect (O'Mahony et al., 2005).
These observations serve to highlight the strain-specific effects of various agents proposed for
use as probiotics.
Taken together, these studies are cited as part of the mounting body of evidence indicating that
probiotics are capable of preventing and perhaps treating pathogen mediated dysbiosis in the gut
through a variety of complementary mechanisms. Accordingly, benefical microbies could
28
potentially be used as therapeutic options for the management of EHEC infections - particularly
in an outbreak setting.
1.7 Summary EHEC pathology is attributed to the synergistic effects of multiple virulence factors that have
been acquired by the pathogen during its evolution. EHEC mechanisms of infection include
bacterial colonization and adhesion to gut epithelial cells; toxin secretion, dissemination, and
activity; and microbial subversion of host innate immune responses. The IFNγ, Jak, Stat-1
pathway is an essential host immune response responsible for addressing microbial infection, and
EHEC mediated subversion of this pathway is a testament to its critical nature in the
pathobiology of disease.
29
Chapter 2
Hypothesis and Objectives
Overall Hypothesis
2.1 Hypothesis
Escherichia coli O157:H7 suppression of interferon-γ stimulated STAT-1 tyrosine
phosphorylation is mediated by a secreted bacterial factor.
2.2 Study Objectives
1. Identify the factor(s) by which Escherichia coli O157:H7 subverts the interferon-γ
pathway using column chromatography (Chapter 3)
2. Identify the factor(s) by which Escherichia coli O157:H7 subverts the interferon-γ
pathway using 2D-DIGE (Chapter 4)
3. Describe the effects of probiotics on enterohemorrhagic and adherent-invasive
Escherichia coli mediated host cell immune responses (Chapter 5)
30
Chapter 3
Identifying Mechanisms by which Escherichia coli O157:H7
Subverts Interferon-γ Mediated Signal Transducer and Activator
of Transcription-1 Activation
Published as:
Ho NK, Crandall I, Sherman PM (2012) Identifying Mechanisms by which Escherichia coli
O157:H7 Subverts Interferon-γ Mediated Signal Transducer and Activator of Transcription-1
Activation. PLoS ONE. 4(1):e30145.
31
3.1 ABSTRACT
Enterohemorrhagic Escherichia coli serotype O157:H7 is a food borne enteric bacterial pathogen
that causes significant morbidity and mortality in both developing and industrialized nations. E.
coli O157:H7 infection of host epithelial cells inhibits the interferon gamma pro-inflammatory
signaling pathway, which is important for host defense against microbial pathogens, through the
inhibition of Stat-1 tyrosine phosphorylation. The aim of this study was to determine which
bacterial factors are involved in the inhibition of Stat-1 tyrosine phosphorylation. Human
epithelial cells were challenged with either live bacteria or bacterial-derived culture supernatants,
stimulated with interferon-gamma, and epithelial cell protein extracts were then analyzed by
immunoblotting. The results show that Stat-1 tyrosine phosphorylation was inhibited by E. coli
O157:H7 secreted proteins. Using sequential anion exchange and size exclusion
chromatography, YodA was identified, but not confirmed to mediate subversion of the Stat-1
signaling pathway using isogenic mutants. We conclude that E. coli O157:H7 subverts Stat-1
tyrosine phosphorylation in response to interferon-gamma through a still as yet unidentified
secreted bacterial protein.
32
3.2 INTRODUCTION
Enterohemorrhagic Escherichia coli (EHEC), including the most common serotype O157:H7, is
a non-invasive enteric bacterial pathogen that causes both sporadic cases and outbreaks of
hemorrhagic colitis and hemolytic-uremic syndrome in humans (DuPont, 2009). Human zoonotic
infections with EHEC occur through the ingestion of contaminated foodstuffs and water
supplies, as well as from person-to-person transmission of the organism (Croxen and Finlay,
2010).
One of the first lines of host defense against bacterial insults is through activation of the innate
and adaptive immune systems (Jones and Neish, 2011). Pro-inflammatory cytokines, including
interferon gamma (IFNγ), are secreted into the extracellular environment and activate an anti-
microbial state in the body (Shea-Donohue et al., 2010). IFNγ production by macrophages,
Natural Killer (NK) T cells and activated T cells triggers an antimicrobial state in host cells by
binding to the IFNγ receptor, and tyrosine phosphorylation of the signal transducer and activator
of transcription-1 (Stat-1) molecule. This activation leads to Stat-1 dimerization and
translocation from the cytosol into the nucleus, where it binds to the gamma activating sequence
(GAS) and triggers the up-regulation of up to 2,000 pro-inflammatory genes, including inducible
nitric oxide synthase (iNOS), monocyte chemoattractant protein-1 (MCP-1) and lymphocyte
adhesion protein ICAM-1 (Saha et al., 2010). An intact IFNγ pathway is essential to combat
infection initiated from a wide range of microbial pathogens; therefore patients with genetic
defects in Stat-1 signaling are susceptible to microbial infections (Averbuch et al., 2011;
Chapgier et al., 2006; Dupuis et al., 2003).
Subversion of the IFNγ/Stat-1 signal transduction pathway by microbial pathogens promotes
bacterial colonization and prevents bacterial clearance from the host (Jones and Neish, 2011).
EHEC has evolved a method to subvert the IFNγ pathway, through a still unknown factor
(Ceponis et al., 2003). Therefore, the aim of this study was to determine how EHEC infection
disrupts IFNγ signal transduction in human epithelial cells. The findings revealed that the IFNγ
signal transduction pathway, important for host defense, is compromised at the level of Stat-1
tyrosine activation by an unknown EHEC secreted protein.
33
3.3 MATERIALS AND METHODS
Tissue culture
HEp-2 epithelial cells (ATCC CCL-23) were used as a model epithelial cell line, as previously
described (Jandu et al., 2009a). Briefly, cells were grown in minimal essential medium (MEM)
containing 15% (v/v) fetal bovine serum (FBS), 2% (v/v) sodium bicarbonate, 2.5% (v/v)
penicillin streptomycin and 1% (v/v) amphotericin B (all from Invitrogen, Burlington, Ontario,
Canada). Cells were grown in T75 flasks (Corning Inc., Corning, NY) at 37°C in 5% CO2 until
confluent (8×106 cells/flask). Confluent cells were trypsinized using 0.05% trypsin (Invitrogen)
for 5 min at 37°C in 5% CO2. Trypsinized cells were then pelleted by centrifugation at 40g for 5
min (Beckman Coulter, Mississauga, ON, Canada), resuspended in MEM and re-seeded into
either 6 well (Becton Dickinson Labware, NJ) or 24 well dishes (Corning Inc.) and grown at
37°C in 5% CO2 until confluent. Prior to bacterial infection, cells were incubated in MEM
without antibiotics for 16h at 37°C in 5% CO2.
Bacterial strains and growth conditions
Enterohemorrhagic E. coli O157:H7, strain EDL933 (EHEC) (accession: AE005174.2) and
enteropathogenic E. coli O127:H6 strain E2348/69 (EPEC) (accession: NC_011601.1) were used
in this study. Strains were cultured on 5% sheep blood agar plates (Becton, Dickinson and
Company, Sparks, MD) at 37°C for 16h and stored at 4°C until use. Prior to infecting epithelial
cells, bacteria were grown in 10 ml of static, non-aerated Penassay broth (Becton, Dickinson
Co.) overnight at 37°C.
Bacterial culture supernatants
To collect bacteria culture supernatants, ~1x109 CFU/ml of EHEC O157:H7 culture was
centrifuged (3,000g, 15 min) and resuspended in 10 ml of serum free MEM without antibiotics.
After growth for 24h at 37°C in 5% CO2, the medium was centrifuged (3,000g, 15 min), filtered
(0.22 μm) and stored at 4°C. Sterility was confirmed by lack of bacterial growth of 0.1 ml of
culture supernatant plated onto 5% sheep blood agar plates and then incubated overnight at 37°C.
Proteinase K and heat inactivation treatment of culture supernatants
34
Bacterial culture supernatants from EHEC were incubated with proteinase K conjugated to
agarose beads (10 to 1000 µg/ml, 1h shaking, 37°C) (Sigma Aldrich, Oakville, Ontario, Canada).
Culture supernatants incubated with agarose beads and pre-incubated with bovine serum albumin
(5% BSA) were used as a negative control. After incubation, agarose beads were removed from
the solution by centrifugation (3,000g, 1 min) before incubation with HEp-2 cells. Culture
supernatants from EHEC were also heat inactivated by boiling (100°C, 0.5h) and cooled to 37°C
before incubation with HEp-2 cells.
Epithelial cell infection
Infection of HEp-2 cells was performed at a multiplicity of infection (MOI) of 100:1. Overnight
bacterial culture (10mL) was centrifuged (3,000g, 10 min), the supernatant decanted, and
bacterial pellets resuspended in 1.0 ml of antibiotic and serum-free MEM. An aliquot of this
bacterial suspension (~1×108 CFU in 0.1 ml) was then used to infect confluent HEp-2
monolayers grown in 6 well plates (~1x106 cells/well). The cells were infected with either EHEC
or EPEC for 6h at 37°C in 5% CO2. Cells were then washed with PBS and stimulated with IFNγ
(50 ng/ml; 0.5h at 37°C in 5% CO2), followed by whole cell protein extracts for immunoblotting.
To determine if active bacterial protein synthesis was required to inhibit the phosphorylation of
Stat-1, in a subset of experiments epithelial cells and EHEC were incubated with
chloramphenicol (100 μg/ml) at 0 to 4h after infectious challenge with (MOI 100:1, 6h).
Immunoblotting
Whole cell protein extracts were collected by resuspending epithelial cells in RIPA buffer (1%
Nonidet P-40, 0.5% sodium deoxylate, 0.1% sodium dodecyl sulfate [SDS] in PBS)
supplemented with 150 mM NaCl, 50 mM sodium fluoride, 1 mM sodium orthovanadate, 20
µg/ml phenylmethylsulfonyl fluoride, 15 µg/ml aprotinin, 2 µg/ml leupeptin, and 2 µg/ml
pepstatin A (all from Sigma Aldrich). Aliquots were applied directly onto cells, mixed and left
on ice for 0.5h. Re-suspended pellets were centrifuged at 20,000g for 1 min at 4°C. Supernatants
were collected and stored at −80°C until further analysis by western blotting.
Immunoblotting was conducted by combining whole cell protein extracts with SDS-PAGE
loading buffer in a 1:1 (v/v) ratio, incubation at 100°C for 3 min, followed by loading into
precast 10% polyacrylamide gels (Ready Gel®; BioRad Laboratories, Hercules, CA). Gels were
electrophoresed (150 V, 1h at room temperature), followed by protein transfer onto nitrocellulose
35
membranes (BioTrace NT; Pall Corporation, Ann Arbor, MI) (110 V, 1h at 4°C). Membranes
were incubated in Odyssey blocking buffer (Mandel Scientific Company Inc., Guelph, Ontario,
Canada) for 0.5h at room temperature on a shaker, followed by incubation with primary
antibodies (4°C overnight on a shaker). Primary antibodies included rabbit anti-native-Stat-1 (1
in 1,000 dilution; Cell Signaling, Beverly, MA), rabbit anti-phospho-Stat-1 (1 in 1,000 dilution;
Cell Signaling), rabbit anti-IRF1 (1 in 2,000 dilution; Sigma-Aldrich), and mouse anti-β-actin (1
in 5,000 dilution; Sigma). Membranes were washed 3 times with PBS+0.1% Tween (5 min per
wash) and then incubated with secondary antibodies (1h at RT on a shaker). Secondary
antibodies included IRDye 800 goat anti-rabbit IgG (1 in 20,000 dilution; Rockland
Immunochemicals, Gilbertsville, PA) and Alexa Fluor® 680 goat anti-mouse IgG (1 in 20,000
dilution; Molecular Probes, Eugene, OR).
Immunoblots were scanned into an infrared imaging system (Odyssey, LI-COR Biosciences,
Lincoln, NE), using both the 700 nm and 800 nm channels, at a resolution of 169 µm. Using
automated software (LI-COR Biosciences) densitometry was performed to obtain the integrative
intensity of positively stained bands. Integrative intensity values for each of the phospho-Stat-1
and native-Stat-1 bands were normalized to the integrative intensity values obtained for the
corresponding β-actin bands. Uninfected cells stimulated with IFNγ were used as positive
controls, and standardized to 100%. Densitometry values obtained from samples incubated with
live bacteria, or sterile culture supernatants, were then calculated as a percentage of the positive
uninfected control.
Column chromatography
Bacterial culture supernatants were diluted 1 in 3 with 10 mM Tris-HCL buffer (pH 8.0) and
applied onto a DEAE Sephacel anion exchange column (Sigma Aldrich, Oakville, Ontario,
Canada), and proteins eluted with increasing concentrations of sodium chloride (0 to 1 M).
Protein fractions were dialyzed in 10 mM Tris-HCL buffer (pH 8.0) overnight at 4°C, and further
separated using a size exclusion column containing Sepharose CL-6B (Sigma-Aldrich).
Fractions were screened for activity in inhibiting IFNγ mediated Stat-1-phosphorylation. Active
fractions were analyzed by 18% SDS-PAGE followed by silver staining. Candidate proteins
were excised and identified using Mass Spectrometry (Advanced Protein Technology Centre at
The Hospital for Sick Children, Toronto, Ontario, Canada).
36
Isogenic mutant strains
Isogenic etpD (1.9Kb), yodA (672bp), and escN (1.3Kb) mutants were generated from EHEC
O157:H7 strain EDL933 using a one-step inactivation technique and primers detailed in Table
3.1 (Datsenko and Wanner, 2000). Briefly, EDL933 was transformed with pKD46, and λ-red
recombinase expression induced with L-arabinose at 30°C on a shaker until the OD600 reached
0.6. etpD mutants were generated by electroporating linear DNA fragments containing a
kanamycin resistance cassette with 5’ and 3’ flanking regions homologous to etpD using primers
etpDKOP1 and etpDKOP2 on plasmid pKD4 (template plasmid with FLP recognition target sites
flanking a 1.6Kb kanamycin resistance gene). yodA mutants were generated in the same fashion,
except with primers yodAKOP1 and yodAKOP2, and escN mutants with primers escNKOP1 and
escNKOP2. All mutants generated were verified by PCR.
37
Table 3.1. Primers employed in this study.
Name Sequence (5’->3’)
etpDKOP1 GTGTTCACTACAGTAATTTTGGGGGCCATTCCAGGGTGGGGGGCTGA
ATTGTGTAGGCTGGAGCTGCTTC
etpDKOP2 TTACATCTCCTGCGCATAAAACGCAGCAATCGCCGCTTTCACCTTCC
GGACATATGAATATCCTCCTTAG
escNKOP1 ATGATTTCAGAGCATGATTCTGTATTGGAAAAATACCCACGTGTAGG
CTGGAGCTGCTTC
escNKOP2 GGCAACCACTTTGAATAGGCTTTCAATCGTTTTTTCGTAACATATGA
ATATCCTCCTTAG
YodAKOP1 TTGGCGATTCGTCTTCACAAACTGGCTGTTGCTTTAGGTGTCTTTATT
GTGTGTAGGCTGGAGCTGCTTC
YodAKOP2 TCAATGAGACATCATTTCCTCGACCACTTCTTCGCTACTCAACTGATA
TGCATATGAATATCCTCCTTAG
yodA-C’P1 GAGGAATAATAAATGACTCTGGAGGAAACTGTTTTGG
yodA-C’P2 ATGAGACATCATTTCCTCGACCAC
38
EHEC pO157 plasmid removal
The pO157 plasmid was cured from EHEC using the pCURE2 kit from Plasgene (Plasgene,
Birmingham UK) (Hale et al., 2010). Briefly, Escherichia coli O157:H7 strain EDL933 was
transformed with the pCURE2 plasmid which displaces the pO157 plasmid, and transformants
were selected for resistance on LB kanamycin plates (50µg/ml). Transformants were then
counter-selected for sucrose sensitivity (sacB) by incubation on LB plates supplemented with 5%
sucrose, and colonies recovered were verified for their loss of the pO157 and pCURE2 plasmids
by PCR.
YodA cloning, over-expression and purification
To over-express and purify the YodA protein (24.6kDa), the yodA gene was cloned into the
pBAD-TOPO TA cloning kit (Invitrogen) under control of the arabinose promoter. Briefly, the
yodA gene was PCR amplified using primers yodA-C’P1 and yodA-C’P2, cloned upstream of a
6x-His tag to generate pBAD-yodA-His, and verified using PCR and DNA sequencing (Centre
for Applied Genomics, Hospital for Sick Children, Toronto, Ontario, Canada). YodA over-
expression was induced in Escherichia coli DH5α with 0.2% arabinose and purified using nickel
column chromatography employing a Qiagen His-tagged purification kit (Qiagen, Toronto).
Statistics
Results are expressed as means, ± standard error (SE). Levels of Stat-1 tyrosine phosphorylation
were compared by using one-way analysis of variance (ANOVA), with Tukey’s multiple
comparison test. Analyses were performed using Prism4 (GraphPad, San Diego, California,
USA). Differences of p<0.05 were considered significant.
39
3.4 RESULTS
EHEC, but not EPEC, inhibits IFNγ mediated Stat-1 tyrosine phosphorylation via secreted
factors.
To demonstrate that EHEC, but not EPEC, was able to subvert the IFNγ pathway, we assessed
the tyrosine phosphorylation state of Stat-1 in cell protein extracts. In un-stimulated epithelia,
Stat-1 is normally not tyrosine phosphorylated, but becomes activated in response to IFNγ
stimulation (Ceponis et al., 2003; Saha et al., 2010). Infection with either pathogen does not
affect native Stat-1 expression (Figure 3.1A), however EHEC prevented Stat-1 tyrosine
phosphorylation in response to IFNγ stimulation (Figure 3.1A). By contrast, EPEC did not
inhibit IFNγ mediated Stat-1 tyrosine phosphorylation (Ceponis et al., 2003; Ho et al., 2011-
Submitted), indicating that the ability to subvert IFNγ signaling is a specific ability of EHEC,
and not all pathogenic E. coli.
Incubation of HEp-2 cells with sterile culture supernatants showed that EHEC, but not EPEC,
culture supernatants are able to inhibit IFNγ mediated Stat-1 tyrosine phosphorylation, with no
affect on native Stat-1 levels (Figure 3.1B) (Ho et al., 2011-Submitted). The addition of
chloramphenicol within 1h of EHEC infection prevented bacterial inhibition of Stat-1 tyrosine
phosphorylation in response to IFNγ (Figure 3.1C), suggesting that subversion of IFNγ mediated
Stat-1 tyrosine phosphorylation is time dependent, and requires new and active bacterial protein
synthesis (Ho et al., 2012b).
40
Figure 3.1. EHEC, but not EPEC, inhibits IFNγ mediated Stat-1 tyrosine phosphorylation.
Whole-cell protein extracts from HEp-2 cells analyzed by immunoblotting showed that (A) IFNγ
mediated (50ng/ml, 0.5h) Stat-1 tyrosine phosphorylation is suppressed by enterohemorrhagic
Escherichia coli O157:H7, strain EDL933 (EHEC), but not by enteropathogenic Escherichia coli
O127:H6, strain E2348/69 (EPEC) (MOI of 100:1; 6h). (B) Incubation with sterile culture
supernatants (6h) from EHEC, but not EPEC, suppressed IFNγ-mediated tyrosine
phosphorylation of Stat-1. (C) Incubation with chloramphenicol (100 µg/ml) up to 1h after
infection with EHEC (MOI 100:1; 6h) prevented EHEC suppression of IFNγ mediated Stat-1
tyrosine phosphorylation.
41
Figure 3.1
42
Secreted inhibitory factor(s) have protein-like qualities
To verify that the inhibitory effects of EHEC were not due to heat resistant factors, such as
lipopolysaccharide (Rietschel and Brade, 1992; Rietschel et al., 1993), culture supernatants were
incubated at 100°C for 30 min and then assessed for the ability to inhibit Stat-1 tyrosine
phosphorylation. As observed previously in our laboratory (Ho et al., 2011-Submitted), boiled
culture supernatants did not inhibit Stat-1 tyrosine phosphorylation, even after 6h of incubation
with tissue culture epithelial cells (Figure 3.2A).
To confirm that the inhibitory factor(s) were protein in nature, bacterial culture supernatants
were treated with proteinase K, and then tested for their ability to inhibit Stat-1 tyrosine
phosphorylation. Culture supernatants treated with agarose beads as a negative control still
blocked signaling responses to IFNγ, while those treated with increasing concentrations of
proteinase K progressively lost the ability to subvert IFNγ mediated Stat-1 tyrosine
phosphorylation (Figure 3.2B) (Ho et al., 2012b).
43
Figure 3.2. Secreted factor(s) have protein qualities. Whole cell protein extracts from HEp-2
cells analyzed by immunoblotting showed that (A) Incubation with heat treated (100°C, 0.5h)
EHEC CS did not suppress IFNγ mediated Stat-1 tyrosine phosphorylation, and (B) incubation
with EHEC CS (6h) pre-treated with proteinase K conjugated to agarose beads (0 – 1,000mg/ml,
37°C, 1h) did not suppress IFNγ induced tyrosine phosphorylation of Stat-1 (n=3, one-way
ANOVA ,* p < 0.05).
44
Figure 3.2
45
EHEC secreted inhibitory factor identified as YodA
In order to identify the secreted inhibitory factor(s), we separated the protein contents of EHEC
culture supernatants based on charge density differences using anion exchange chromatography.
After an initial loading and low salt rinsing step, bound material was eluted using a linear salt
gradient, and fractions were collected at regular intervals and analyzed for their protein
concentration using the Bradford assay (Figure 3.3A). Fractions from distinct regions of the
anion exchange profile were pooled into 4 groups, dialyzed, and incubated with HEp-2 cells.
Only fractions 32-43 inhibited IFNγ mediated Stat-1 tyrosine phosphorylation (Figure 3.3B). In
order to further identify the inhibitory factor(s), fractions 32-43 from the DEAE column were
pooled and separated using size exclusion chromatography to separate the proteins based on
molecular mass. Fractions from the size exclusion column were then retested for protein
concentration using the Bradford assay (Figure 3.3C), and tested for their ability to inhibit IFNγ
mediated Stat-1 tyrosine phosphorylation (Figure 3.3D). According to western blotting, fractions
13-16 showed inhibitory qualities, which appeared to correspond to the presence of a single band
present in fractions 14-16 when separated by SDS-PAGE (Figure 3.3E). The band was excised,
digested by trypsin, and identified as YodA by standard methods of peptide fingerprint analysis
using mass spectrometry (Advanced Protein Technology Centre at The Hospital for Sick
Children, Toronto, Ontario, Canada).
46
Figure 3.3. EHEC secreted inhibitory factor identified as YodA. A Bradford assay was
performed on EHEC culture supernatants separated by anion exchange (A). A 1.2cm by 50cm
column containing DEAE Sephacel that had been mixed with 0.5L of culture supernatant was
initially rinsed with low salt buffer prior to being eluted with a 0 to 1M gradient of NaCl. Three
mL fractions were collected and protein content was determined by Bradford assay. Fraction 60
represents a NaCl concentration of ~200mM and no further protein elution at higher salt
concentrations was observed. Fractions of interest were pooled and dialyzed before incubation
with HEp-2 cells, and tested for their ability to inhibit IFNγ mediated Stat-1 tyrosine
phosphorylation (B). Pooled fractions 32-43 from the DEAE Sephacel column were concentrated
by membrane filtration prior to being subjected to size exclusion chromatography using a 1.2cm
by 50cm Sepharose CL-6B column equilibrated with 10 mM Tris-HCL buffer (pH 8.0). Three
mL fractions were collected and the protein concentration present was determined by Bradford
assay (C). Select fractions from size exclusion chromatography were tested for their ability to
inhibit IFNγ mediated Stat-1 tyrosine phosphorylation (D). Fractions of interest were separated
using 18% SDS-PAGE and stained with silver (E).
47
Figure 3.3
48
YodA is a metal binding protein of unknown function (David et al., 2002; David et al., 2003). To
determine if YodA played a role in Stat-1 suppression, isogenic yodA mutants in E. coli
O157:H7 strain EDL933 were created using the λ-red knockout system (Datsenko and Wanner,
2000) along with the E. coli Type-2 Secretion system (etpD) which is required for YodA
excretion (Ho et al., 2008). Both isogenic mutants were verified by PCR (Figure 3.4A, B), and
then assessed for their ability to inhibit Stat-1-phosphorylation (Figure 3.4C, D).
49
Figure 3.4. Isogenic yodA and etpD mutants inhibit Stat-1 tyrosine phosphorylation at
levels comparable to wild-type. Isogenic yodA and etpD mutants were verified by PCR (panels
A and B, respectively). Whole-cell protein extracts from HEp-2 cells were incubated with sterile
culture supernatants from WT, yodA and etpD mutants and then tested for their ability to inhibit
IFNγ mediated Stat-1 tyrosine phosphorylation; representative immunoblot (C) and repeated
experiments analyzed by densitometry (n=3) (D).
50
Figure 3.4
51
Contrary to expectations, both isogenic mutants inhibited Stat-1-phosphorylation at levels
comparable to the wild-type EHEC strain, indicating that neither yodA nor etpD was involved in
EHEC subversion of IFNγ/Stat-1 signaling. To verify the mutation experiments, the yodA gene
was cloned into the pBAD-TOPO protein expression system with a C-terminal histidine tag
(Figure 3.5A), and verified by PCR (Figure 3.5B) and sequencing. Protein over-expression and
solubility was verified using western blotting (Figure 3.5C) and then purified by nickel column
chromatography (Figure 3.5D). Varying concentrations of the eluted and dialyzed YodA-His
protein (Figure 3.5E, F, respectively) were then tested directly on HEp-2 cells; however,
purified YodA did not inhibit IFNγ mediated Stat-1 tyrosine phosphorylation.
52
Figure 3.5. Purified YodA failed to inhibit Stat-1 tyrosine phosphorylation as well as wild-
type culture supernatant. EHEC yodA gene was cloned into the pBAD protein expression
vector (A) and verified by PCR (B). Over-expressed YodA-His was detected in the soluble
fraction, but not in the insoluble or supernatant fraction, by western blot (C) and purified using
nickel column chromatography (D). Varying concentrations of eluted and dialyzed YodA-His
were tested for the ability to inhibit IFNγ mediated Stat-1 tyrosine phosphorylation (panels E and
F, respectively).
53
Figure 3.5
54
3.5 DISCUSSION
In the present study, we have shown that EHEC, but not EPEC, subverts the IFNγ signaling
pathway at the level of Stat-1 tyrosine phosphorylation. Direct contact of the non-invasive
enteric pathogen with host cells is not required to mediate this effect, as extracellular bacterial
culture medium was able to produce the effect associated with the subversion factor in the
absence of intact bacteria. Through a series of biochemical tests, we establish in this report that
the secreted bacterial factor has properties consistent with it being a protein (Figure 2), but it is
not secreted via the type two secretion protein export system.
Recent studies have found that subversion of innate immune pathways is a theme common to
multiple pathogens, illustrating the important role of the IFNγ signal transduction pathway in
combating microbial infections (Jones and Neish, 2011). For example, viruses of the
Paramyxoviridae family subvert the IFNγ pathway by degrading intracellular Stat-1 (Didcock et
al., 1999), while the parasite Leishmania donovani prevents tyrosine-phosphorylation of Stat-1
(Nandan and Reiner, 1995). The ability of EHEC O157:H7 to suppress the IFNγ pathway could
promote its ability to colonize the gut of the infected host by reducing immune surveillance
(Jones and Neish, 2011).
EHEC and EPEC both contain an array of virulence factors that aid in infection, of which the
LEE (Locus of Enterocyte Effacement) pathogenicity island encoded type three secretion system
(T3SS) is common to both; allowing the bacterium to adhere intimately onto host cells. The
LEE’s of EHEC and EPEC were acquired through horizontal gene transfer and provide these
non-invasive pathogens the ability to deliver effector proteins directly into host cells (Schmidt,
2010). These effectors allow the bacterium to subvert host cytoskeleton processes, destroy brush
border microvilli, and cause rearrangements of F-actin resulting in attaching and effacing (A/E)
lesions on epithelial cell surfaces (Frankel and Phillips, 2008; Garmendia et al., 2005; Kaper et
al., 2004).
Studies on the T3SS and its protein effectors have shown that many of these bacterial-derived
proteins have redundant and overlapping functions, each of which appears to have multiple roles
in subverting eukaryotic cellular processes, and thereby aid in disease pathogenesis (Dean and
Kenny, 2009). Despite both pathogens having a LEE, they are not identical, and many of the
effectors, while having similar effects on host cells, can vary between the two enteric pathogens
55
(Castillo et al., 2005; Muller et al., 2009). However, the EHEC LEE is not involved in subverting
the IFNγ signaling pathway, as demonstrated in this report by showing that an isogenic escN
mutant suppresses Stat-1 tyrosine phosphorylation comparable to the parental wild-type strain
(Figure 3.6A).
EHEC also contains other virulence factors distinct from EPEC, which gives this enteric
pathogen the ability to inhibit Stat-1 tyrosine phosphorylation. For instance, EHEC contains
phage encoded Shiga toxins, which are responsible for causing hemorrhagic colitis and
hemolytic-uremic syndrome (Lingwood, 1996; Obrig, 2010). EHEC also harbors the pO157
virulence plasmid that encodes a metalloprotease (stcE) (Lathem et al., 2002), a serine protease
(espP) (Brockmeyer et al., 2007), a hemolysin (ehxA) (Schmidt et al., 1994), a catalase-
peroxidase (katP) (Brunder et al., 1996), a putative adhesion (toxB) (Tatsuno et al., 2001), as
well as 22 other open reading frames that have no strong similarity with any known proteins
(Lim et al., 2010). However, the EHEC pO157 plasmid is also not involved in subverting the
IFNγ signal transduction pathway, because a pO157 plasmid cured mutant suppressed Stat-1
tyrosine phosphorylation comparable to the parental wild-type strain (Figure 3.6B).
56
Figure 3.6. EHEC LEE and pO157 are not involved in the suppression of the IFNγ
signaling pathway. Isogenic escN, and pO157 cured mutants were tested for their ability to
inhibit IFNγ mediated Stat-1 tyrosine phosphorylation (A and B, respectively).
57
Figure 3.6
58
The expression of the YodA protein in bacterial supernatants leads to its co-purification with the
Stat-1-P inhibitory activity that was present in the sample. Further, the relatively small size of the
protein, ~25kD, was consistent with the observed behavior of the inhibitory activity when
supernatant was passed through filters with defined molecular cut–offs. YodA therefore appeared
to match the characteristics of the inhibitor molecule, however our inability to detect Stat-1-P
suppression in the presence of overly expressed YodA (Figure 3.5C-D) suggests that this protein
is either not the inhibitor, or alternatively it is dysfunctional in the form in which it is expressed.
It’s recovery as a small molecule on the size exclusion column suggests that it does not natively
pair with another protein or entity for activity, however the resolution of the DEAE and the
Sepharose CL-6B columns may not be sufficient to detect if specific post-translational
modifications are required to create the activate form of the YodA protein. Nonetheless, the
inability of the purified YodA protein to suppress Stat-1 tyrosine phosphorylation, in addition to
the yodA mutant’s preserved ability to suppress Stat-1 tyrosine phosphorylation, indicates that
EHEC likely utilizes a different protein factor to suppress IFNγ activation.
EHEC undoubtedly contains other virulence factors which are distinct from EPEC, but which are
currently uncharacterized. Recent studies have shown that EHEC, strain EDL933 (5.62Mb;
5,312 genes) is roughly 11% larger than EPEC strain E2348/69 (5.07Mb; 4,554 genes)
(Lukjancenko et al., 2010). Further research focusing on the differences between the EHEC and
EPEC genomes will elucidate the EHEC-derived protein factor that is responsible for the
subversion of the IFNγ signaling pathway. Identification of this inhibitory factor(s) could
potentially be used to restore host cell signaling responses following EHEC infection and,
thereby, reduce the severity and spread of this infectious agent.
3.6 ACKNOWLEDGEMENTS: We thank Dr. John Brumell (University of Toronto) for the λ-
red knockout vectors pKD46, pKD3, pKD4 and pCP20 as well as for advice on E. coli
mutagenesis.
59
Chapter 4
Enterohemorrhagic Escherichia coli O157:H7 Shiga Toxins Inhibit
Interferon-gamma Mediated Cellular Activation
Published as:
Ho NK, Ossa JC, Silphaduang U, Johnson R, Johnson-Henry KC, Sherman PM (2012)
Enterohemorrhagic Escherichia coli O157:H7 Shiga Toxins Inhibit Interferon-gamma
Mediated Cellular Activation. Infect Immun. Manuscript number IAI00255-12R1. In
Press, July 2012.
60
4.1 ABSTRACT
Enterohemorrhagic Escherichia coli (EHEC) serotype O157:H7 is a foodborne pathogen that
causes significant morbidity and mortality in developing and industrialized nations. EHEC
infection of host epithelial cells is capable of inhibiting the interferon gamma (IFNγ) pro-
inflammatory pathway through the inhibition of Stat-1 phosphorylation, which is important for
host defense against microbial pathogens. The aim of this study was to determine the bacterial
factors involved in the inhibition of Stat-1 tyrosine phosphorylation. Human HEp-2 and Caco-2
epithelial cells were challenged directly with either EHEC or bacterial culture supernatants,
stimulated with IFNγ and then the protein extracts were analyzed by immunoblotting. The data
showed that IFNγ-mediated Stat-1 tyrosine phosphorylation was inhibited by EHEC secreted
proteins. Using 2D-Difference Gel Electrophoresis, EHEC Shiga toxins were identified as
candidate inhibitory factors. EHEC Shiga toxin mutants were then generated, complemented in
trans, and mutant culture supernatant was supplemented with purified Stx to confirm their ability
to subvert IFNγ-mediated cell activation. We conclude that while other factors are likely
involved in the suppression of IFNγ-mediated Stat-1 tyrosine phosphorylation, E. coli-derived
Shiga toxins represent a novel mechanism by which EHEC evades the host immune system.
61
4.2 INTRODUCTION
Enterohemorrhagic Escherichia coli (EHEC), including the most common serotype O157:H7, is
a non-invasive enteric bacterial pathogen that causes both sporadic cases and outbreaks of
diarrheal disease in humans as well as hemorrhagic colitis and hemolytic-uremic syndrome
(DuPont, 2009). Human infections with EHEC occur through the ingestion of contaminated
foodstuffs and water supplies, as well as from person-to-person transmission of the organism
(Croxen and Finlay, 2010).
One of the first lines of host defense against bacterial insult is through activation of the innate
immune system (Jones and Neish, 2011). Pro-inflammatory cytokines, including interferon
gamma (IFNγ), are secreted into the extracellular environment, and activate an anti-bacterial
state in the body (Shea-Donohue et al., 2010). IFNγ production by macrophages, Natural Killer
(NK) T cells and activated T cells triggers an antimicrobial state in host cells by tyrosine
phosphorylation of the signal transducer and activator of transcription-1 (Stat-1) molecule,
leading to dimerization, translocation to the nucleus, binding to the gamma-activating sequence
(GAS), and downstream up-regulation of up to 2,000 pro-inflammatory genes, such as inducible
nitric oxide synthase (iNOS), monocyte chemoattractant protein-1 (MCP-1), lymphocyte
adhesion protein ICAM-1, as well as increased MHC II expression (Saha et al., 2010; Schroder
et al., 2004). An intact IFNγ pathway is essential to fight off infection initiated from a wide range
of microbial pathogens, with patients harboring genetic defects in Stat-1 signaling being prone to
infection (Averbuch et al., 2011; Chapgier et al., 2006; Dupuis et al., 2003). IFNγ levels are
elevated in a mouse model of infection with Citrobacter rodentium, a murine-specific homolog
of enterohemorrhagic Escherichia coli (Higgins et al., 1999), and in humans following E. coli
infection (Long et al., 2010).
Subversion of the IFNγ pathway by microbial pathogens promotes bacterial colonization and
prevents bacterial clearance from the host (Jones and Neish, 2011; Pedron and Sansonetti, 2008).
EHEC has evolved a method to subvert the IFNγ pathway, through still unknown factor(s)
(Ceponis et al., 2003). Therefore, the aim of this study was to determine how EHEC infection
disrupts IFNγ signal transduction in human epithelial cells. The findings reveal that the IFNγ
signal transduction pathway, important for host defense, is compromised at the level of Stat-1
activation, at least in part, by EHEC-derived Shiga toxins (Stx).
62
4.3 MATERIALS AND METHODS
Tissue culture
HEp-2 epithelial cells (ATCC CCL-23) were used as a model epithelial cell line, as previously
described (Jandu et al., 2009a). Briefly, cells were grown in minimal essential medium (MEM)
containing 15% (v/v) fetal bovine serum (FBS), 2% (v/v) sodium bicarbonate, 2.5% (v/v)
penicillin-streptomycin and 1% (v/v) amphotericin B (all from Invitrogen, Burlington, Ontario,
Canada). Cells were grown in T75 flasks (Corning Inc., Corning, NY) at 37°C in 5% CO2 until
confluent (8×106 cells/flask). Confluent cells were trypsinized using 0.05% trypsin (Invitrogen)
for 5 min at 37°C in 5% CO2. Trypsinized cells were then pelleted by centrifugation at 40g for 5
min (Beckman Coulter, Mississauga, ON, Canada), resuspended in MEM and re-seeded into
either 6 well (Becton Dickinson Labware, NJ) or 24 well dishes (Corning Inc.) and grown at
37°C in 5% CO2 until confluent. Prior to bacterial infection, cells were incubated in MEM
without antibiotics for 16h at 37°C in 5% CO2.
Caco-2bbe human colonic adenocarcinoma cells (ATCC CRL-2102) were used as a model
polarized epithelial cell line. These cells form confluent, polarized epithelial monolayers with
well-differentiated intercellular tight junction (TJ) structures and a pattern of brush border
protein expression that is comparable to that of primary human enterocytes (Peterson and
Mooseker, 1992). Briefly, cells were grown in Dulbecco's Modified Eagle Medium (DMEM),
10% FBS, 0.01 mg/ml human transferrin, 1 mM sodium pyruvate, 200 U/ml penicillin, and 200
μg/ml streptomycin (all reagents from GIBCO). Cell culture medium was changed to antibiotic-
free culture medium prior to experimental trials using equivalent conditions as those with HEp-2
cells.
Bacterial strains and growth conditions
Enterohemorrhagic E. coli O157:H7 strain EDL933 (EHEC) (accession: AE005174.2) and
enteropathogenic E. coli O127:H6 strain E2348/69 (EPEC) (accession: NC_011601.1) were used
in this study. Strains were cultured on 5% sheep blood agar plates (Becton, Dickinson and
Company, Sparks, MD) at 37°C for 16h and stored at 4°C until use. Prior to infecting epithelial
cells, bacteria were grown in 10 ml Penassay broth (Becton, Dickinson Co.) overnight at 37°C.
63
Isogenic mutant strains
Isogenic mutants were generated from EHEC O157:H7 strain EDL933 using a one-step
inactivation technique (Datsenko and Wanner, 2000) and primers in Table 4.1. Briefly, EDL933
was transformed with pKD46, and λ-red recombinase expression induced with L-arabinose at
30°C on a shaker until the OD600 reached 0.6. Mutants were generated by electroporating linear
DNA fragments containing a kanamycin or chloramphenicol resistance cassette with 5’ and 3’
flanking regions homologous to the gene target using primers targetKOP1 and targetKOP2 on
plasmid pKD4 (template plasmid with FLP recognition target sites flanking a kanamycin
resistance gene) or pKD3 containing the chloramphenicol resistance gene. Double knockouts
were generated from a previously created mutant after removal of the kanamycin resistance
cassette using pCP20. All mutants generated were verified by PCR.
64
Table 4.1. Primers employed in this study.
Name Sequence (5’->3’)
pBAD-stx2-F GCGCGAATTCGAAGAAACCAATTGTCCATATTGCATCA
pBAD-stx2-R GAATGGTACCCGCCCTTTTATTTACCCGTTGTATATA
pBAD-stx1-F GCGCGGTACCGAAGATCCTTTTTGATAATCTCATGACCA
pBAD-stx1-R GCGCGAATTCATCTAAAGTATATATGAGTAAACTTGGTCTGA
EscNKOP1 ATGATTTCAGAGCATGATTCTGTATTGGAAAAATACCCACGTGTAGG
CTGGAGCTGCTTC
EscNKOP2 GGCAACCACTTTGAATAGGCTTTCAATCGTTTTTTCGTAACATATGA
ATATCCTCCTTAG
EspAKOP1 ATGGATACATCAAATGCAACATCCGTTGTTAATGTGAGTGGTGTAGG
CTGGAGCTGCTTC
EspAKOP2 TTATTTACCAAGGGATATTGCTGAAATAGTTCTATATTGTCATATGA
ATATCCTCCTTAG
EspBKOP1 ATGAATACTATTGATAATACTCAAGTAACGATGGTTAATTGTGTAGG
CTGGAGCTGCTTC
EspBKOP2 TTACCCAGCTAAGCGACCCGATTGCCCCATACGATTCTGGCATATGA
ATATCCTCCTTAG
EspDKOP1 ATGCTTAACGTAAATAACGATACCCTGTCTGTAACGTCTGGTGTAGG
CTGGAGCTGCTTC
EspDKOP2 TTAAATTCGGCCACTAACAATACGACTATTTACCCGTGCTCATATGA
ATATCCTCCTTAG
EspFKOP1 ATGCTTAATGGAATTAGTAACGCTGCTTCTACACTAGGGCGTGTAGG
65
CTGGAGCTGCTTC
EspFKOP2 TTACCCTTTCTTCGATTGCTCATAGGCAGCTAAATGATCTCATATGAA
TATCCTCCTTAG
EspFuKOP1 ATGATTAACAATGTTTCTTCACTTTTTCCAACCGTCAACCGTGTAGGC
TGGAGCTGCTTC
EspFuKOp2 TCACGAGCGCTTAGATGTATTAATGCCATGCTCTGCAAGACATATGA
ATATCCTCCTTAG
FliCKOP1 ATGGCACAAGTCATTAATACCAACAGCCTCTCGCTGATCAGTGTAGG
CTGGAGCTGCTTC
FliCKOP2 TTAACCCTGCAGCAGAGACAGAACCTGCTGCGGTACCTGGCATATG
AATATCCTCCTTAG
Stx1KOP1 ATGAAAATAATTATTTTTAGAGTGCTAACTTTTTTCTTTGGTGTAGGC
TGGAGCTGCTTC
Stx1KOP2 TCAACTGCTAATAGTTCTGCGCATCAGAATTGCCCCCAGACATATGA
ATATCCTCCTTAG
Stx2KOP1 ATGAAGTGTATATTATTTAAATGGGTACTGTGCCTGTTACGTGTAGG
CTGGAGCTGCTTC
Stx2KOP2 TTATTTACCCGTTGTATATAAAAACTGTGACTTTCTGTTCCATATGAA
TATCCTCCTTAG
Stx1A-C’-P1 GAGGAATAATAAATGAAAATAATTATTTTTAGAGTGCTAACTTTTTT
Stx1A-C’-P2 TCAACTGCTAATAGTTCTGCGCA
Stx2A-C’-P1 GAGGAATAATAAATGAAGTGTATATTATTTAAATGGGTACTGTGC
Stx2A-C’-P2 TTATTTACCCGTTGTATATAAAAACTGTGACT
StcEKOP1 ATGAACACTAAAATGAATGAGAGATGGAGAACACCGATGAAATTAA
66
AGTAGTGTAGGCTGGAGCTGCTTC
StcEKOP2 TTATTTATATACAACCCTCATTGACCTAGGTTTACTGAAGTCCAAAT
ACTCATATGAATATCCTCCTTAG
TirKOP1 ATGCCTATTGGTAATCTTGGTCATAATCCCAATGTGAATAGTGTAGG
CTGGAGCTGCTTC
TirKOP2 TTAGACGAAACGATGGGATCCCGGCGCTGGTGGGTTATTCCATATGA
ATATCCTCCTTAG
Z1787KOP1 GTGCTTATGTGGATTGTGTTAGTACTGTCACTGTCAACTCGTGTAGG
CTGGAGCTGCTTC
Z1787KOP2 TCAATTATGTTTTAAAAATGGATAGGTAAAGAATAACAAGCATATG
AATATCCTCCTTAG
67
Bacterial complementation
The stx1A- and stx2A- mutants were complemented in trans by the introduction of the pBAD-
TOPO TA cloning kit (Invitrogen) containing either stx1A or stx2A under control of the
arabinose promoter. Briefly, the stx1A gene was PCR amplified using primers Stx1A-C’-P1 and
Stx1A-C’P2, while the stx2A gene was amplified using primers Stx2A-C’-P1 and Stx2A-C’-P2
to generate pBAD-stx1A and pBAD-stx2A plasmids, respectively. The stxDKO mutant was
complemented in trans by cloning the pBAD promoter and downstream stx2A gene from pBAD-
stx2 using primers pBAD-stx2-F and pBAD-stx2-R into the pBAD-stx1A inverse PCR product,
using primers pBAD-stx1-F and pBAD-stx1-R. All constructs were verified using PCR and
DNA sequencing (The Centre for Applied Genomics, Hospital for Sick Children, Toronto,
Ontario, Canada). Genes were induced in the complements with 0.02% arabinose while
generating bacterial cultured supernatants.
Bacterial culture supernatants
To collect sterile culture supernatants (CS), ~1x109 CFU/ml of EHEC O157:H7 strain EDL933
or EPEC O127:H6 strain E2348/69 culture were centrifuged (3,000g, 15 min) and resuspended
in 10 ml of serum free MEM without antibiotics. After 24h growth at 37°C in 5% CO2, the
medium was centrifuged (3,000g, 15 min), filtered (0.22 μm) and stored at 4°C. Sterility was
confirmed by lack of bacterial growth of 0.1 ml of culture supernatant plated onto 5% sheep
blood agar plates and incubated overnight at 37°C.
Proteinase K and heat inactivation treatment of culture supernatants
Bacterial culture supernatants from EHEC were incubated with proteinase K conjugated to
agarose beads (10 to 1000 µg/ml, 1h shaking, 37°C) (Sigma Aldrich, Oakville, Ontario, Canada).
Culture supernatants incubated with agarose beads and pre-incubated with bovine serum albumin
(5% BSA) were used as a negative control. After incubation, agarose beads were removed from
the solution by centrifugation (3,000g, 1 min) before incubation with HEp-2 cells. Culture
supernatants from EHEC were also heat inactivated by boiling (100°C, 0.5h) and cooled to 37°C
before incubation with HEp-2 cells.
68
Epithelial cell infection
Infection of HEp-2 or Caco-2 epithelial cells was performed at a multiplicity of infection (MOI)
of 100:1. Overnight bacterial culture (10 mL) was centrifuged (3,000g, 10 min), the supernatant
decanted, and bacterial pellets resuspended in 1.0 ml of antibiotic and serum-free MEM. An
aliquot of this bacterial suspension (~1×108 CFU in 0.1 ml) was then used to infect either
confluent HEp-2 or Caco-2 monolayers grown in 6 well plates (roughly 1x106 cells/well). The
cells were infected with either EHEC or EPEC for 6h at 37°C in 5% CO2. Infections at an MOI
of 10:1 required approximately 8hr for robust Stat-1 suppression. Cells were then washed with
PBS and stimulated with IFNγ (50 ng/ml; 0.5h at 37°C in 5% CO2), followed by whole cell
protein extracts for immunoblotting. To determine if active bacterial protein synthesis was
required to inhibit the phosphorylation of Stat-1, in a subset of experiments epithelial cells and
EHEC were incubated with chloramphenicol (100 μg/ml) at 0 to 4h after infectious challenge
(MOI 100:1, 6h).
Immunoblotting
Whole cell protein extracts were collected by resuspending epithelial cells in RIPA buffer (1%
Nonidet P-40, 0.5% sodium deoxylate, 0.1% sodium dodecyl sulfate [SDS] in PBS)
supplemented with 150 mM NaCl, 50 mM sodium fluoride, 1 mM sodium orthovanadate, 20
µg/ml phenylmethylsulfonyl fluoride, 15 µg/ml aprotinin, 2 µg/ml leupeptin, and 2 µg/ml
pepstatin A (all from Sigma Aldrich). Aliquots were applied directly onto cells, mixed and left
on ice for 0.5h. Re-suspended pellets were centrifuged at 20,000g for 1 min at 4°C. Supernatants
were collected and stored at −80°C until further analysis by western blotting.
Immunoblotting was conducted by combining whole cell protein extracts with SDS-PAGE
loading buffer in a 1:1 (v/v) ratio, incubation at 100°C for 3 min, followed by loading into
precast 10% polyacrylamide gels (Ready Gel®; BioRad Laboratories, Hercules, CA). Gels were
electrophoresed (150 V, 1h at room temperature), followed by protein transfer onto nitrocellulose
membranes (BioTrace NT; Pall Corporation, Ann Arbor, MI) (110 V, 1h at 4°C). Membranes
were incubated in Odyssey blocking buffer (Mandel Scientific Company Inc., Guelph, Ontario,
Canada) for 0.5h at room temperature on a shaker, followed by incubation with primary
antibodies (4°C overnight on a shaker). Primary antibodies included rabbit anti-native-Stat-1 (1
in 1,000 dilution; Cell Signaling, Beverly, MA), rabbit anti-phospho-Stat-1 (1 in 1,000 dilution;
69
Cell Signaling), rabbit anti-IRF1 (1 in 2,000 dilution; Sigma-Aldrich), and mouse anti-β-actin (1
in 5,000 dilution; Sigma). Membranes were washed 3 times with PBS+0.1% Tween (5 min per
wash) and then incubated with secondary antibodies (1h at RT on a shaker). Secondary
antibodies included IRDye 800 goat anti-rabbit IgG (1 in 20,000 dilution; Rockland
Immunochemicals, Gilbertsville, PA) and Alexa Fluor® 680 goat anti-mouse IgG (1 in 20,000
dilution; Molecular Probes, Eugene, OR).
Immunoblots were scanned into an infrared imaging system (Odyssey, LI-COR Biosciences,
Lincoln, NE), using both the 700 nm and 800 nm channels, and immunoblots scanned at a
resolution of 169 µm. Using automated software (LI-COR Biosciences) densitometry was
performed to obtain the integrative intensity of positively stained bands. Integrative intensity
values for each of the phospho-Stat-1 were normalized to the integrative intensity values
obtained for the corresponding β-actin bands as they were run on the same gel; native-Stat-1 is
presented to confirm that its levels are unaffected by incubation with EHEC, EPEC, or sterile
culture supernatants. Uninfected cells stimulated with IFNγ were used as positive controls, and
standardized to 100%. Densitometry values obtained from samples incubated with live bacteria,
or sterile culture supernatants, were then calculated as a percentage of the positive uninfected
control.
Cell cytotoxicity assay
Lactate dehydrogenase (LDH) released into the tissue culture medium from HEp-2 cells
challenged with bacteria or culture supernatants was quantified using Cytoscan (G-Biosciences,
St. Louis, MO). Briefly, HEp-2 cells were incubated with either live bacteria (MOI 100:1) or
culture supernatants for 6h. Supernatants were then transferred to a new 96-well plate, and
incubated with a commercial substrate mixture in the dark for 30 min at room temperature. A
stop solution was added to samples and absorbance at 490nm measured in a plate reader (Victor3
Reader, Perkin Elmer, Ontario, Canada). The level of LDH released from the infected cells was
calculated as a percentage, compared to LDH activity measured in total cell lysates.
2-D Gel electrophoresis
2-D Difference Gel Electrophoresis (DIGE) and protein identification was performed by Applied
Biomic Inc. (Hayward, CA). Briefly, 1 ml of 2D lysis buffer (30 mM Tris-HCl, pH 8.8, 7 M
urea, 2 M thiourea and 4% CHAPS), and EDTA (5 mM final concentration) was added to each
70
sample, and the mixtures transferred to 3K MWCO Amicon Filters (Millipore). The samples
were spun in a GS-6KR Centrifuge (Beckman Coulter) at 5,000g until the volume was
concentrated to 400 µl per sample. Samples were then transferred to 5K MWCO spin columns
(Sartorius Biolab Products, Goettingen, Germany), and spun at 15,000g until the volume was
concentrated to 50 µl per sample. The samples were precipitated with 100% methanol and
resuspended in 30 µl of 2D cell lysis buffer. The samples were sonicated at 4oC, followed by
shaking for 30 minutes at room temperature, centrifuged for 30 min at 15,000g and the
supernatants collected. Protein concentration was measured by Bradford assay (Bio-Rad).
For CyDye labeling, 30µg of protein was mixed with 1.0 µl of diluted Cy2 or Cy3 and kept in
the dark on ice for 0.5h. The labeling reaction was stopped by adding 1 µl of 10 mM lysine to
each sample and incubated in the dark on ice for an additional 15 min. The labeled samples were
then mixed together and 2X 2-D Sample buffer (8 M urea, 4% CHAPS, 20 mg/ml DTT, 2%
pharmalytes and a trace amount of bromophenol blue), destreak solution (GE Healthcare), and
rehydration buffer (7 M urea, 2 M thiourea, 4% CHAPS, 20 mg/ml DTT, 1% pharmalytes and
trace amount of bromophenol blue) were added to a final volume of 260 µl. The samples were
mixed well and spun down before loading onto a strip holder. After loading labeled samples onto
pH 3-10 linear IPG strips (GE Healthcare), isoelectric focusing was run for 12h rehydration at
20oC, followed by 500 V for 1000 VHr, 1000 V for 2000 VHr, and 8000 V for 24000 VHr. IPG
strips were then incubated in freshly made equilibration buffer-1 (50 mM Tris-HCl, pH 8.8,
containing 6 M urea, 30% glycerol, 2% SDS, trace amount of bromophenol blue and 10 mg/ml
DTT) for 15 min with gentle shaking. Strips were then rinsed in freshly made equilibration
buffer-2 (50 mM Tris-HCl, pH 8.8, containing 6 M urea, 30% glycerol, 2% SDS, trace amount of
bromophenol blue and 45 mg/ml iodacetamide) for 10 min with gentle shaking. Next, the IPG
strips were rinsed in SDS-gel running buffer before transferring into 12% SDS-gels (18 cm x 16
cm) followed by sealing with 0.5% agarose (Bio-Rad) in SDS-PAGE running buffer. The SDS-
gels were run at 15oC.
Image scan and data analysis
Gel images were scanned immediately following SDS-PAGE using Typhoon TRIO (Amersham
BioSciences). The scanned images were then analyzed by Image Quant software Version 6.0
(Amersham BioSciences), followed by in-gel analysis using DeCyder software Version 6.0
71
(Amersham BioSciences). Fold-change of protein expression levels was obtained from in-gel
DeCyder analysis, with a set cut-off of 1.5.
Shiga toxin immunoassay
The concentration of Stx1 and Stx2 present in culture supernatants of both wild-type (WT) and
mutant bacteria was determined by a Stx-capture ELISA as described previously (Atalla et al.,
2000; Chen et al., 1998; Ziebell et al., 2008) at the Laboratory for Foodborne Zoonoses, Guelph,
Ontario (LFZ). Briefly, flat-bottom wells of eight-well immunostrips (Nunc Maxisorb Immuno-
Module, Thermo Scientific) in 96-well frames were coated with 100 µl of 2 μg/ml rabbit anti-Stx
antibodies (LFZ) in carbonate-bicarbonate buffer pH 9.6, and then post-coated by the addition of
200 µl/well of a stabilizing/blocking solution (LFZ). The culture supernatants were added to
each well, incubated at 22°C for 30 min, and then washed five times with 300 µl of 0.01 M PBS
pH7.4 containing 0.1% Tween 20. Bound Stx in the wells were detected by sequential
incubations at 22°C with monoclonal antibodies directed against either Stx1 or Stx2/2c (2 µg/ml,
LFZ) for 30 min, followed by horseradish peroxidase-labeled anti-mouse IgG (Jackson
Immunoresearch, PA, USA) at 0.6 µg/ml for 30 min. Then, 100 µl of 3, 3’, 5, 5’ tetramethyl-
benzidine (Sigma Aldrich, Oakville, Ontario, Canada) was added for 10 min to induce color
development, and the reaction was stopped with 100 µl 0.2 M sulfuric acid. Plates were read in a
microplate spectrophotometer (ELx 808TM Ultra Microplate reader, Bio-Tek Instruments) at dual
wavelengths of 450/630 nm. Mean optical density of Stx standards were used to generate a
standard curve for each toxin, which was then used to calculate the amount of Stx1 and Stx2
present in the bacterial-derived culture supernatants.
Shiga toxin purification
Purified Shiga toxins were kindly provided by Dr. Clifford Lingwood, Hospital for Sick
Children. Shiga toxin 1 was purified from E. coli strain JB28 (Huang et al., 1986), as previously
described (Lingwood et al., 1987), and Shiga toxin 2 purified from E. coli R82pJES120DH5α, as
previously described (Tesh et al., 1994).
Statistics
Results are expressed as means, ± standard error (SE). One-way analysis of variance (ANOVA)
with Tukey’s multiple comparison test was performed to analyze the statistical significance of
72
the results between groups of treatments from multiple independent experiments. Analyses were
performed using Prism4 (GraphPad, San Diego, California, USA). Differences of p<0.05 were
considered significant.
73
4.4 RESULTS
EHEC, but not EPEC, inhibits IFNγ-mediated Stat-1 tyrosine phosphorylation in a non-
cytotoxic manner
To demonstrate that EHEC, but not EPEC, was able to subvert the IFNγ pathway, we assessed
the phosphorylation state of the Stat-1 molecule. In un-stimulated circumstances, Stat-1 is
normally not tyrosine phosphorylated, but becomes activated in response to IFNγ stimulation
(Saha et al., 2010). Infection with EHEC prevented Stat-1 tyrosine phosphorylation in response
to cytokine stimulation (Figure 4.1A) (Ho et al., 2012a; Jandu et al., 2007). By contrast,
infection with EPEC did not inhibit IFNγ-mediated Stat-1 tyrosine phosphorylation, indicating
that the ability to subvert IFNγ signaling is a specific ability of EHEC, and not all pathogenic E.
coli. Levels of native Stat-1 were not affected by either pathogen (Figure 4.1A). Both pathogens
have been demonstrated to adhere at similar levels to HEp-2 cells (Riff et al., 2005).
The addition of chloramphenicol, a specific bacterial protein synthesis inhibitor, prevented
bacterial inhibition of Stat-1 tyrosine phosphorylation in response to IFNγ within 1h of EHEC
infection (Figure 4.1B), suggesting that subversion of IFNγ-mediated Stat-1 tyrosine
phosphorylation is time dependent, and requires new and active bacterial protein synthesis. HEp-
2 cell cytotoxicity analysis confirmed that infection with EHEC or EPEC did not cause a
significant difference in cell death compared to uninfected controls (Figure 4.1C), indicating
that the lack of Stat-1 tyrosine phosphorylation due to IFNγ stimulation was not due to cell
death.
74
Figure 4.1. EHEC, but not EPEC, inhibits IFNγ-mediated Stat-1 tyrosine phosphorylation
in a non-cytotoxic manner. Whole-cell protein extracts from HEp-2 cells analyzed by
immunoblotting showed that (A) IFNγ-mediated (50 ng/ml, 0.5h) Stat-1 tyrosine
phosphorylation is suppressed by enterohemorrhagic Escherichia coli O157:H7, strain EDL933
(EHEC), but not by enteropathogenic Escherichia coli O127:H6, strain E2348/69 (EPEC) (MOI
of 100:1; 6h). (B) Incubation with chloramphenicol (100 µg/ml) up to 1h after infection with
EHEC (MOI 100:1; 6h) prevented EHEC suppression of IFNγ-mediated Stat-1 tyrosine
phosphorylation. (C) LDH cytotoxicity assay was performed on HEp-2 cells after infection with
EHEC or EPEC (MOI 100:1), or sterile EHEC culture supernatants (CS) for 6h (n=3, one-way
ANOVA, p>0.05). (D) Incubation with EHEC, but not EPEC, culture supernatants (6h)
suppressed IFNγ-mediated tyrosine phosphorylation of Stat-1. (E) Caco-2 bbe cells infected with
EHEC or with sterile EHEC CS, but not EPEC (MOI 100:1) suppressed IFNγ-mediated tyrosine
phosphorylation of Stat-1.
75
Figure 4.1
76
Inhibitor of IFNγ-mediated Stat-1 tyrosine phosphorylation is a secreted factor and affects
different cell lines
As shown in Figure 4.1D, EHEC, but not EPEC, culture supernatants inhibited Stat-1 tyrosine
phosphorylation in response to IFNγ stimulation. Culture supernatants harvested from bacteria
while in exponential growth phase (6h) showed less inhibitory properties than those generated at
stationary phase (24h) (data not shown). EHEC has been shown to successfully adhere and form
Attaching and Effacing (A/E) lesions with Caco-2-bbe cells, a human polarized epithelial cell
line (Tatsuno et al., 2000). Caco-2 incubation with EHEC (or culture supernatants) or EPEC
demonstrated similar results as the HEp-2 cell line (Figure 4.1E), indicating that the inhibitory
factor secreted by EHEC affects multiple cell lines. As shown in Figure 4.2A-B, the inhibitory
effects of EHEC-derived culture supernatants occurred in a time dependent manner. Taken
together, these findings demonstrate that a bacterial factor was secreted specifically from EHEC,
and that direct contact of the pathogen with host epithelia was not required for subverting IFNγ-
mediated Stat-1 tyrosine phosphorylation.
Secreted inhibitory factors are proteins
To verify that the inhibitory effects of EHEC were not due to heat resistant factors, such as
lipopolysaccharide (Rietschel and Brade, 1992; Rietschel et al., 1993), culture supernatants were
heated to 100°C for 30 min and then assessed for the ability to inhibit Stat-1 tyrosine
phosphorylation. Boiled culture supernatants did not inhibit Stat-1 tyrosine phosphorylation,
even after 6h of incubation with tissue culture epithelial cells (Figure 4.2C-D).
To confirm that the inhibitory factors were protein in nature, bacterial culture supernatants were
treated with proteinase K, and then tested for their ability to inhibit Stat-1 tyrosine
phosphorylation. Culture supernatants treated with agarose beads as a negative control still
blocked signaling responses to IFNγ, while those treated with increasing concentrations of
proteinase K progressively lost the ability to subvert IFNγ-mediated Stat-1 tyrosine
phosphorylation (Figure 4.2E- F).
77
Figure 4.2. Secreted factor(s) have protein-like qualities. Panels A, C, and E are
representative western blots of densitometry analyses shown in panels B, D, and F, respectively.
Whole cell protein extracts from HEp-2 cells analyzed by immunoblotting showed that (A, B)
incubation with sterile culture supernatants (CS) from EHEC, but not EPEC, (1, 3 and 6h)
increases suppression of IFNγ-mediated (50 ng/ml, 0.5h) Stat-1 tyrosine phosphorylation over
time (n=3, one-way ANOVA ,* p < 0.05). (C, D) Incubation with heat treated (100°C, 0.5h)
EHEC CS did not suppress IFNγ-mediated Stat-1 tyrosine phosphorylation. (E, F) incubation
with EHEC CS (6h) pre-treated with proteinase K conjugated to agarose beads (0 – 1,000 mg/ml,
37°C, 1h) did not suppress IFNγ-induced tyrosine phosphorylation of Stat-1 (n=3, one-way
ANOVA ,* p < 0.05).
78
Figure 4.2
79
Comparative proteomic profiles of EHEC- and EPEC-secreted proteins
To identify the EHEC factor involved in subverting IFNγ-mediated Stat-1 phosphorylation, the
secreted protein profile of EHEC O157:H7 (Figure 4.3A in green) was compared with EPEC
O126:H7 (Figure 4.3B in red). Secreted proteins from both enteric pathogens were differentially
labeled, separated using 2D difference gel electrophoresis (2D-DIGE), and the gels overlayed to
compare profiles between the two pathogens (Figure 4.3C). Densitometry analyses revealed
increased, decreased and no change in 124, 216 and 190 proteins, respectively in EHEC culture
supernatants compared to EPEC culture supernatants. Subsequently, proteins that were over-
expressed in the EHEC fraction compared to the EPEC fraction were identified using Mass
Spectrometry, and 14 isogenic EHEC mutants were generated using the λ-red gene deletion
technique (Datsenko and Wanner, 2000) to determine if the proteins identified were involved in
subverting the IFNγ signal transduction pathway (Table 4.2).
80
Figure 4.3. Comparative proteomic profiles between EHEC- and EPEC-secreted proteins.
Culture supernatants from EHEC (A) or EPEC (B) were separated by 2D Difference Gel
Electrophoresis (DIGE) and labeled with Cy3 and Cy2, respectively. Resulting gels were
overlayed (C), and candidate spots then picked and identified using mass spectrometry.
81
Figure 4.3
82
Table 4.2. List of bacterial strains and plasmids used in this study
Strains and
plasmids Description
Affects
IFNγ
Signaling Reference
E. coli O127:H6
strain E2348/69 Wild-type EPEC strain used in this study -
(Philpott
et al.,
1996)
E. coli O157:H7
strain EDL933 Wild-type EHEC strain used in this study +
(Karmali
et al.,
2003)
espA espA disrupted by kanamycin resistance cassette - This study
espB espB disrupted by kanamycin resistance cassette - This study
espD espD disrupted by kanamycin resistance cassette - This study
espF espF disrupted by kanamycin resistance cassette - This study
espFu espFu disrupted by kanamycin resistance cassette - This study
espF/Fu
espFu disrupted by kanamycin resistance cassette of
espF kanamycin cassette cured mutant - This study
fliC fliC disrupted by kanamycin resistance cassette - This study
pO157 cured
pO157 plasmid cured mutant using pCURE2 kit (Hale
et al., 2010) - This study
stx1A stx1A disrupted by kanamycin resistance cassette + This study
stx2A stx2A disrupted by kanamycin resistance cassette + This study
stxDKO stx1A disrupted by kanamycin resistance cassette of + This study
83
stx2A kanamycin cassette cured mutant
stxDKO + escN
StxDKO mutant with escN gene disrupted by a
chloramphenicol casette + This study
stcE stcE disrupted by kanamycin resistance cassette - This study
Tir Tir disrupted by kanamycin resistance cassette - This study
Z1787 Z1787 disrupted by kanamycin resistance cassette - This study
Plasmids
pBAD-stx1A
stx1A gene inserted downstream of the pBAD-TOPO
plasmid + This study
pBAD-stx2A
stx1A gene inserted downstream of the pBAD-TOPO
plasmid + This study
pBAD-stx12
pBAD promoter and downstream stx2A gene inserted
in the vector backbone of the pBAD-stx1A plasmid + This study
84
Stx1A and Stx2A suppress IFNγ-mediated Stat-1 tyrosine phosphorylation
Of the isogenic mutants generated, only culture supernatants from the stx1A- and stx2A- isogenic
mutants partially (n=5, p<0.05) recovered Stat-1 tyrosine phosphorylation in response to IFNγ
(Figure 4.4A-B). Culture supernatants prepared from a Stx double gene knockout (stxDKO)
completely recovered Stat-1 phosphorylation (n=5, p<0.05), compared to culture supernatants
derived from the parent strain (Figure 4.4A-C), indicating that secreted Shiga toxins mediate
EHEC suppression of the IFNγ signaling pathway. The amount of Stx1 and Stx2 present in
culture supernatants was measured using an established ELISA assay (Ziebell et al., 2008), and
the levels were confirmed to be reduced by the λ-red gene deletion technique (Table 4.3).
Culture supernatants from the complemented mutants returned Stat-1 tyrosine phosphorylation to
levels comparable to wild-type, indicating that each of the Shiga toxins contribute to the
suppression of IFNγ-mediated Stat-1 tyrosine phosphorylation (Figure 4.4A-C). To further
confirm that Shiga toxins are involved in the suppression of IFNγ-mediated Stat-1 tyrosine
phosphorylation, epithelial cells were incubated with mutant culture supernatants supplemented
with purified Stx1 and Stx2. Incubation with these supernatants showed suppressive effects that
were comparable to wild-type culture supernatant (Figure 4.4B-C). However, experiments with
purified Stx alone did not inhibit Stat-1 tyrosine phosphorylation (data not shown). These results
indicate that while Stx1 and Stx2 play a role in inhibiting Stat-1 phosphorylation, it is possible
that other bacterial-derived factors are also involved.
To confirm that the IFNγ signaling pathway is subverted due to EHEC Stx, IRF1 expression was
assessed. IRF1 expression is induced only after IFNγ stimulation (Saha et al., 2010). Similar to
Stat-1 tyrosine phosphorylation, incubation of cells with EHEC culture supernatants prior to
IFNγ stimulation suppressed IRF1 expression, whereas incubation with EPEC or the stxDKO
culture supernatants did not have an inhibitory effect (Figure 4.4D).
85
Figure 4.4. Shiga-like toxins from EHEC suppress IFNγ-mediated activation of Stat-1.
Whole cell protein extracts from HEp-2 cells analyzed by immunoblotting showed that
incubation with sterile culture supernatants (CS) from EHEC Shiga-like toxin single mutants
partially suppressed IFNγ-mediated (50 ng/ml, 0.5h) tyrosine phosphorylation of Stat-1, while
the suppressive ability from the stxDKO mutant was completely ablated. (A) A representative
western blot showing CS from single and double mutants inhibiting Stat-1 tyrosine
phosphorylation less than WT CS, and CS from bacterial complements returning suppression to
WT levels. (B) A representative western blot showing CS from single and double mutants
supplemented with either purified Stx1 (5 ng/ml), Stx2 (50 ng/ml) or both suppressing IFNγ-
mediated Stat-1 tyrosine phosphorylation at levels comparable to WT CS. (C) Densitometry
analysis of western blotting (n=3-5, one-way ANOVA, * p<0.05). (D) Whole cell protein
extracts from HEp-2 cells analyzed by immunoblotting showed that incubation with EHEC, but
not EPEC or EHEC stxDKO, culture supernatants (6h) suppressed IFNγ-mediated (50 ng/ml, 2h)
expression of IRF1.
86
Figure 4.4
87
Table 4.3. Quantification of Stx1 and Stx2 present in culture supernatants obtained from
WT E. coli O157:H7 strain EDL933, and corresponding isogenic mutants. Results are
expressed as means, +/- SD (n=3).
Bacterial
strain
Stx1 (ng/ml) Stx2 (ng/ml)
WT 3.84 ± 0.28 33.59 ± 1.58
stx1A- 1.21 ± 0.05 28.66 ± 0.93
stx2A- 0.96 ± 0.11 5.60 ± 0.23
stxDKO 0.32 ± 0.01 5.06 ± 0.46
88
4.5 DISCUSSION
In the present study, we show that EHEC, but not EPEC, subverts the IFNγ signaling pathway at
the level of Stat-1 tyrosine phosphorylation in different human epithelial cell lines. Direct contact
of this pathogen with host cells is not required to mediate the effect, and the subversive factor is
secreted into the extracellular culture medium. Through a series of complementary biochemical
tests, we have now established that at least one of the secreted factors is protein in nature, and
through genetic manipulation of the EHEC chromosome and the use of purified Stx, we show
that EHEC suppresses IFNγ-mediated Stat-1 phosphorylation at least in part through elaboration
of Shiga toxins.
While EHEC produces an array of virulence factors that aid in infection such as
lipopolysaccharide (Landoni et al., 2010) and flagella (Bellmeyer et al., 2009), one of the
virulence factors classically associated with EHEC infection are its Shiga toxins, which can
cause systemic complications including hemorrhagic colitis and the hemolytic-uremic syndrome
(Obrig, 2010). The German E. coli O104:H4 outbreak in May 2011, where approximately 4000
cases of infection and 50 deaths were reported, was due to an enteroaggregative E. coli that
acquired the ability to produce Stx2 (Bielaszewska et al., 2011; Rasko et al., 2011). The
importance of Stx2 mediating infection severity stems from the fact that E. coli O104:H4 without
Stx2 was previously associated with sporadic cases of human disease, but not with large-scale
outbreaks (Frank et al., 2011; Kuijper et al., 2011).
Another EHEC virulence factor is its pathogenicity island encoded type three secretion system
(T3SS), which allows the bacterium to disrupt host processes by injecting protein effectors
directly into the host cell (Spears et al., 2006). Studies on the T3SS and its effectors have found
that many of these bacterial-derived proteins have redundant and overlapping functions, each of
which appears to have multiple roles in subverting eukaryotic cellular processes, and thereby aid
in EHEC-mediated pathogenesis (Dean and Kenny, 2009). For example, EspF in EHEC and
EPEC plays multiple roles in the subversion of host cellular pathways, such as effacing the
microvilli of infected cells, disrupting the nucleolus, and preventing phagocytosis to name a few
(Holmes et al., 2010). Furthermore, EspF, along with Tir and Map, all contribute to SGLT-1
inactivation (Wong et al., 2011). Our novel finding that EHEC Shiga toxins possess the ability
89
to subvert IFNγ-mediated Stat-1 tyrosine phosphorylation, supports previous findings that EHEC
virulence proteins can be multifunctional, cooperative and redundant (Dean and Kenny, 2009).
Recent studies have found that subversion of innate immune pathways is a theme common to
multiple pathogens, illustrating the important role of the IFNγ signal transduction pathway in
fighting off microbial infections (Jones and Neish, 2011). For example, viruses of the
Paramyxoviridae family subvert the IFNγ pathway by degrading intracellular Stat-1 (Didcock et
al., 1999), while the parasite Leishmania donovani prevents the phosphorylation of Stat-1
(Nandan and Reiner, 1995). The ability of EHEC O157:H7 to suppress the IFNγ pathway could
promote its ability to colonize the gut (Jones and Neish, 2011).
While previous studies from our laboratory suggested that culture supernatants were not capable
of suppressing IFNγ-mediated Stat-1 tyrosine phosphorylation (Jandu et al., 2006), it has been
demonstrated that bicarbonate ions stimulate gene expression in EHEC (Abe et al., 2002), and
we were able to induce expression of the inhibitory factors through the supplementation of
sodium bicarbonate in the media (Ho et al., 2012a). Furthermore, our laboratory has also
published studies that Shiga toxins were not involved in the suppression of IFNγ-mediated Stat-1
tyrosine phosphorylation (Ceponis et al., 2003; Jandu et al., 2006). In the present study, we show
through the use of knockout mutagenesis, genetic complementation in trans, as well as
supplementation with purified Stx that these toxins are involved in the suppression of Stat-1
activation. While Stx classically enters the cell through the globotriaosylceramide (Gb3) receptor
present in HEp-2 cells (Ching et al., 2002), the role of the glycolipid receptor in mediating the
suppression of Stat-1 tyrosine phosphorylation is uncertain, because EHEC O157:H7 also
suppresses IFNγ-mediated Stat-1 activation in Gb3-negative T84 epithelial cells (Jandu et al.,
2006) in which Stx still undergoes retrograde trafficking (Maluykova et al., 2008). Furthermore,
no suppression of Stat-1 activation was observed when purified Stx was added without culture
supernatant (data not shown). Indeed, direct infection of the stxDKO mutant, or even a triple
mutant with an inactivated T3SS (stxDKO + escN) (Golan et al., 2011) suppressed IFNγ-
mediated Stat-1 tyrosine phosphorylation completely (Figure 4.5), indicating that there are likely
to be additional factors involved in the suppression of Stat-1 tyrosine phosphorylation, and which
may explain why WT culture supernatants did not fully suppress Stat-1 tyrosine phosphorylation.
90
Figure 4.5. Infection with an EHEC StxDKO and T3SS triple mutant suppresses IFNγ
mediated Stat-1 phosphorylation comparable to the wild-type strain. Whole-cell protein
extracts from HEp-2 cells showed that Stat-1 tyrosine phosphorylation is suppressed equally
between enterohemorrhagic Escherichia coli O157:H7 strain EDL933, and a triple mutant with
gene knockouts in Stx1, 2, and the type 3 secretion system (escN-).
91
Figure 4.5
92
To our knowledge, this is the first study to show that Shiga toxins modulate IFNγ signaling, and
supports recent findings that each of EHEC’s many effectors has multiple and overlapping roles
in subverting host cell processes (Dean and Kenny, 2009; Hamada et al., 2010). Further research
should elucidate the mechanisms by which these Shiga toxins are able to suppress Stat-1 tyrosine
phosphorylation. Such information then could be used to restore host signaling responses to
EHEC infection and, thereby, reduce the severity and spread of this infectious agent.
4.6 Acknowledgments: We thank Dr. John Brumell (University of Toronto, Toronto, Ontario,
Canada) for the λ-red knockout vectors pKD46, pKD3, pKD4 and pCP20 as well as for advice
on E. coli mutagenesis. We also thank Drs. Clifford Lingwood and Beth Binnington (The
Hospital for Sick Children, Toronto, Ontario, Canada) for purified Shiga toxins. 2D-gel analyses
were done by Applied Biomics (Hayward, CA). This work was supported by an operating grant
from the Canadian Institutes of Health Research (MOP-89894). NH was supported by a doctoral
research award from the Canadian Institutes of Health Research (JDD-95413). PMS was
supported by a Canada Research Chair in Gastrointestinal Disease.
93
Chapter 5
Immune Signaling Responses in Intestinal Epithelial Cells
Exposed to Pathogenic Escherichia coli and Lactic Acid-
Producing Probiotics
Manuscript submitted:
Ho NK, Ossa JC, Hawley S, Mathieu O, Tompkins TA, Johnson-Henry KC, Sherman PM.
Immune Signaling Responses in Intestinal Epithelial cells Exposed to Pathogenic Escherichia
coli and Lactic Acid-Producing Probiotics. Manuscript Accepted Pending Revision. Journal
of Beneficial Microbes
94
5.1 ABSTRACT
Enterohemorrhagic Escherichia coli O157:H7 and adherent-invasive Escherichia coli are two
groups of enteric bacterial pathogens associated with hemorrhagic colitis and Crohn’s Disease,
respectively. Bacterial contact with host epithelial cells stimulates an immediate innate immune
response designed to combat infection. In this study, immune responses of human epithelial cells
to pathogens, either alone or in combination with probiotic bacteria Lactobacillus helveticus
strain R0052 and Lactobacillus rhamnosus strain GG (LGG), were evaluated using
complementary microarray and qRT-PCR approaches. Results showed host immune activation
responses induced following pathogen exposure, which were ameliorated using probiotics, with
the effect dependent on both the preparation employed and conditions of exposure. These
findings provide additional support for the concept that specific probiotic strains serve as a
promising option for use in preventing the risk of enteric bacterial infections.
95
5.2 INTRODUCTION
Enterohemorrhagic and Adherent-invasive Escherichia coli (EHEC and AIEC, respectively), are
two bacterial enteric pathogens associated with human intestinal diseases (Croxen and Finlay,
2010). While EHEC is non-invasive and causes sporadic outbreaks of diarrhea as well as
hemorrhagic colitis (HC) and hemolytic-uremic syndrome (HUS) in humans (DuPont, 2009),
AIEC is invasive and is associated with Crohn’s Disease, a chronic inflammatory condition of
the gastrointestinal tract (Darfeuille-Michaud et al., 1998).
Following ingestion and gut colonization, epithelial cell contact with bacterial pathogens triggers
an innate immune response through pathogen-recognition receptors (PRRs) present both on the
cell surface and in the cytosol. PRRs are typically transmembrane proteins that detect pathogen-
associated molecular patterns (PAMPs), which activate an inflammatory response characterized
by the activation of pro-inflammatory and anti-microbial pathways leading to cytokine
production and chemokine-mediated recruitment of acute inflammatory cells (Dalpke et al.,
2003; Shang et al., 2008). Current treatment regimens against EHEC infections are limited to
supportive therapies (such as fluids to prevent dehydration), because the use of antibiotics may
increase the development of HUS both in children (Wong et al., 2000) and adults (Dundas et al.,
2001).
Probiotics are live, non-pathogenic micro-organisms that confer health benefits to the host, and
are increasingly being employed as an option for preventing and treating bacterial infections
(Gareau et al., 2010). For instance, probiotic bacteria alter the activation, expression and
secretion of pro-inflammatory cytokines (like TNFα) and chemokines (CXCL-8) caused by
enteric pathogens (Gareau et al., 2011). Specifically, Lactobacillus helveticus R0052 and
Lactobacillus rhamnosus GG are two probiotic strains of bacteria that can alter host cell gene
expression responses to pathogens (Donato et al., 2010; Jandu et al., 2009b).
The aim of the current study was to characterize the effects of EHEC O157:H7- and AIEC LF82-
mediated innate immune activation of infected epithelial cells by employing a reductionist tissue
culture cell model in the absence and presence of probiotic bacteria. The findings show that
probiotics modulate pathogen-induced immune responses in epithielia in a preparation, duration
and strain specific manner.
96
5.3 MATERIALS AND METHODS
Tissue culture: Caco-2bbe human colonic adenocarcinoma cells (ATCC CRL-2102) were used
as a model polarized epithelial cell line. These cells form confluent, polarized epithelial
monolayers with well-differentiated intercellular tight junctions (TJ) and a pattern of brush
border protein expression comparable to that of primary human enterocytes (Peterson and
Mooseker, 1992). Briefly, cells were grown in Dulbecco's Modified Eagle Medium (DMEM),
10% fetal bovine serum (FBS), 0.01 mg human transferrin ml−1, 1 mM sodium pyruvate, 200 U
penicillin ml−1 and 200 μg streptomycin ml−1 (all reagents from Gibco, Burlington, Ontario,
Canada). Tissue culture medium was changed to antibiotic-free culture medium prior to
experimental trials.
Bacterial strains and growth conditions: Enterohemorrhagic E. coli (EHEC) O157:H7, strain
EDL933 (accession: AE005174.2) and Adhesive-Invasive E. coli (AIEC) O83:H1, strain LF82
(courtesy of Dr. A. Darfaud-Michaud, Clermont-Ferrand, France) were cultured on 5% sheep
blood agar plates (Becton, Dickinson Co., Sparks, MD) at 37°C for 16h and stored at 4°C until
use. Prior to infecting epithelial cells, bacteria were grown in 10 ml of static Penassay broth
(Becton, Dickinson Co.) overnight at 37°C. Probiotic bacteria, Lactobacillus helveticus strain
R0052 (Lallemand Human Nutrition, Montreal, Quebec, Canada), and Lactobacillus rhamnosus
strain GG (LGG) (ATCC Accession #53103) were cultured on MRS agar plates (Becton,
Dickinson Co.) at 37°C for 16h and then stored at 4°C until use. Prior to challenge of epithelial
cells, bacteria were grown in 10 ml MRS broth (Becton, Dickinson Co.) overnight at 37°C. For
comparative purposes, an industrially prepared and lyophilized sample of L. helveticus strain
R0052 was tested (Lallemand Human Nutrition). For rehydration, 1g of lyophilized bacteria was
mixed for 15 min at room temperature in phosphate buffer (0.1 % soy peptone (w/v), 0.121 %
K2HPO4 (w/v), 0.034 % KH2PO4 (w/v)) prior to incubation with epithelial cells.
Epithelial cell infection and RNA extraction: Microbial challenge of Caco-2-bbe cells was
performed at a multiplicity of infection (MOI) of 100:1 for probiotic bacteria and 10:1 for
pathogenic bacteria. Bacterial cultures grown overnight (10 mL) were centrifuged (3,000g, 10
min), the supernatant decanted and bacterial pellets resuspended in 1.0 ml of antibiotic and
serum-free MEM. An aliquot of the bacterial suspension was then applied to the apical
compartment of confluent Caco-2 monolayers grown in T25 flasks (roughly 1x108 pathogens and
97
1x109 probiotics per flask). Polarized cells were exposed to probiotics or pathogens for 3h at
37°C in 5% CO2 either independently or in co-challenge experiments. In some instances, the
Caco-2 epithelial cells were pre-incubated for 3h with a probiotic and then for an additional 3h
with the enteropathogen. Cells were then washed with PBS and resuspended in Trizol reagent
(Invitrogen, Burlington, Ontario, Canada).
RNA was collected and purified using a Qiagen RNeasy Kit, following the manufacturer’s
instructions, and verified for concentration using a Nanodrop 2000c spectrophotometer (Thermo
Scientific, New York, NY) and quality using an Agilent 2100 bioanalyzer at the Centre for
Applied Genomics at the Hospital for Sick Children (Toronto, Ontario, Canada). All RNA
samples were verified to have a RIN value of 9.7 or greater and an A260/280 ratio between 1.9
and 2.1.
Immune Microarray: As previously described (Kanehisa and Goto, 2000), ImmuneArray2 is a
custom-designed two-color, long oligonucleotide DNA microarray detecting 1,354 specific
genes in 17 pathways related to innate immune function and barrier defense. Eleven genes to be
used for q-RT-PCR were added to confirm gene expression: B2M, GAPDH, HPRT1, MAN1B1,
MTR, MYC, POLR2A, RPLP0, RPS14 and SI (Dydensborg et al., 2006). These genes were
selected from the Kyoto Encyclopedia of Genes and Genomes (KEGG) database and the gene
specific long oligonucleotides sequences (70-mers) recovered from the Human Exonic Evidence
Based Oligonucleotide (HEEBO) database (Kim and Pollack, 2009). Oligonucleotides were
synthesized (IDT Integrated Technology Inc., IA) at a normalized concentration of 25 mM and
spotted onto Corning UltraGAPS Coated Slides using a PBI robot from Vertex. The
ImmuneArray2 was repeated twice per slide in six subgrids and each gene was spotted in
duplicate. Microarray slides were printed in the Microarray Laboratory at the National Research
Council Biotechnology Research Institute (Montreal, Quebec, Canada). Additional information
regarding the microarray platform can be found at the NCBI Gene Expression Omnibus (GEO;
http://www.ncbi.nlm.nih.gov/geo/) under GEO platform no. GPL6366.
After extraction and purification from Caco-2-bbe cells, 15 μg of total RNA was converted into
cDNA by using Super Script III (200 U; Invitrogen) and either Cy5- or Cy3-labeled dCTP (1
mM; GE Healthcare Life Sciences, Buckinghamshire, England), as previously described
(Marquis et al., 2008), except that 1.5 µL of Oligo dT23 primers (3.0 µg µl-1) was used. cDNA
was purified with QIAquick PCR Purification Kit (Qiagen, Toronto, Ontario, Canada), according
98
to manufacturer’s instructions and then concentrated by evaporation under vacuum. Labeled
cDNA was then used to hybridize to the Immune Array. The prehybridization and hybridization
at 50°C were performed, as described previously (Marquis et al., 2008). The arrays were washed
twice for 5 min with 1X saline sodium citrate (SSC; 20× SSC is: 3 M sodium chloride, 0.3 M
sodium citrate, pH 7.0) and 0.1 % sodium dodecyl sulfate (SDS) at 42°C and then at room
temperature for 2 min with 1X SSC and one time with 0.1X SSC. Slides were then scanned,
digitized images acquired using a ScanArray 5000 (Perkin-Elmer, Waltham, MA) and the
intensities of individual spots from 16-bit TIFF images quantified using QuantArray software
package (Perkin-Elmer).
Microarray Analyses: Assessment of slide quality, LOWESS normalization within slide,
Aquantile normalization between slides, and statistical analyses were conducted using the
Limma Package from BioConductor in R software (version 2.8.1). The comparative analysis
consisted of a minimum of four dye-swap hybridizations of Caco-2-bbe cells treated with
pathogens or probiotics compared to unchallenged Caco-2-bbe. For each treatment, biological
replicates consisted of Caco-2-bbe RNA extracted on different days. Genes with significant
changes in transcript abundance were selected with two criteria: a t-test p value below 0.05 and a
change in transcript abundance of at least 1.3-fold. Cluster and principal component analyses
were carried out with the MultiExperiment Viewer, which is part of the TM4 Microarray
Software from J. Craig Venter Institute (Saeed et al., 2003).
Relative q-RT-PCR: Measurement of transcript abundance of differentially expressed and
reference genes were confirmed by quantitative Real-Time PCR (qRT-PCR) on cDNA. Samples
were standardized to 1 µg of mRNA using a Nanodrop 2000c spectrophotometer (Thermo
Scientific, New York, NY) and then treated with DNaseI (Invitrogen) and converted to cDNA
using an iScript cDNA synthesis kit (Bio-Rad). Resulting cDNA was diluted 1:5 prior
amplification and 2 µl of diluted cDNA used as template in qPCR with 300 nmol of gene
specific primers in a 10 µl reaction volume in Ssofast Evagreen supermix (Bio-Rad). Primers
were designed using the online QPrimerDepot tool (http://primerdepot.nci.nih.gov/) (Cui et al.,
2007). qRT-PCR quality control and primer standardization were conducted as outlined by the
Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE)
guidelines adapted by Bio-Rad (Taylor et al., 2010). Initial incubation of 5 min at 95°C was
performed followed with forty cycles consisting of template denaturation (15s at 95°C) and by
99
one-step annealing and elongation (30s at 60°C) with a CFX1000 thermocycler (Bio-Rad).
Changes in gene expression were quantified using the Bio-Rad CFX qRT-PCR software
normalized to the geometric mean of three reference genes: β-actin, RPLP0, and β2-
microglobulin.
Statistical analyses: For qRT-PCR, results were expressed as means, ± standard error (SE). Two-
way analysis of variance (ANOVA) with a Bonferroni post-test was performed to analyze the
statistical significance of results between groups of treatments from multiple independent
experiments. Analyses were performed using Prism4 (GraphPad, San Diego, California, USA).
Differences of p<0.05 were considered significant.
100
5.4 RESULTS
Enteric pathogens and probiotics are dramatically different in inducing host gene
responses. Principal Component Analysis (PCA), Non-Negative Matrix Factorization (NMF),
and genetic heat map analyses of the gene expression profiles of Caco-2 cells showed distinct
differences when incubated with either pathogens or probiotics (Figure 5.1). By contrast, under
the experimental conditions employed, co-challenge with both a pathogen and a probiotic
showed little deviation away from pathogen-infected Caco-2 cells only.
According to microarray analysis, 131 genes were significantly affected by at least one of the
infection conditions (p<0.05, fold difference ≥ 1.3), and were combined into 7 groups based on
their cellular effects: pro-inflammatory, anti-inflammatory, cellular growth/protection, cell
death/arrest, tight junctions, cytoskeletal genes, and other (Table 5.1). Of these 131 genes, a
sample of 17 representative genes in each of the 7 groups were selected for qRT-PCR analysis,
and then compared to three reference genes: ACTB, B2M, and RPLP0. The 11 genes with primer
sets meeting qPCR quality control (Table 5.2) were then used to confirm the microarray
analysis.
101
Figure 5.1. Gene expression profiles of Caco-2-bbe cells incubated with either Escherichia coli
O157:H7 strain EDL933 (EDL933), Escherichia coli O83:H1 strain LF82 (LF82), Lactobacillus
helveticus strain R0052 (R0052) or in combination for 3h were analyzed by (A) Principle
component Analysis (PCA), or (B) Non-Negative Matrix Factorization (NMF) to separate them
in a two-dimensional space according to genes modified significantly. Heat map analysis (C)
showed 131 out of 1,354 genes present on the ImmuneArray were modulated significantly by at
least 1.3-fold by one of the microbes. Transcriptional profiles were organized by two-
dimensional hierarchical clustering where more abundant transcripts in Caco-2 cells treated with
bacteria compared to untreated Caco-2 cells are shown in red, and less abundant transcripts are
shown in green. All analyses were done using independently collected samples (n=6, p < 0.05,
fold difference ≥ 1.3).
102
103
Table 5.1: Genes modified significantly in the ImmuneArray analysis.
Function EDL933 LF82 EDL933
+
R0052
LF82+
R0052
R0052
Pro-inflammation
AICDA – involved in IG class switching No
change
No
change
No
change
No
change
up
ATF4 camp response element binder. Pro-
inflammatory.
No
change
No
change
Up No
change
No
change
BCL3 NFKB associated – pro-inflamation Up Up Up Up No
change
BMP2 TGFb family of proteins – involved
in cytokine-cytokine receptor
interactions
Up Up Up Up No
change
C3 complement component C3 No
change
No
change
No
change
up up
CCL3 CC type chemokine that activates
PMN’s – pro-inflammatory
chemokine
No
change
No
change
No
change
No
change
No
change
CCL20 CC type chemokine that activates
PMN’s – pro-inflammatory
chemokine
Up Up Up Up No
change
CD1D - Antigen-presenting protein that binds
self and non-self glycolipids and
presents them to T-cell receptors on
natural killer T-cells
No
change
up No
change
No
change
No
change
CD276 – costimulatory B-cell molecule No
change
up No
change
No
change
No
change
CEBPB - transcriptional activator in the Up No Up No No
104
regulation of genes involved in
immune and inflammatory responses
– pro-inflammatory
change change change
CKLFSF4 AKA CMTM4. Chemokine like
protein – proinflammatory.
No
change
No
change
down No
change
No
change
CLCF1 cytokine of IL6 family. Phospho’s
Stat-3. Induces IL-1.
Up No
change
Up No
change
No
change
CSF1 secreted cytokine which influences
hemopoietic stem cells to
differentiate into macrophages
up No
change
Up up No
change
CSF3 Granulocyte colony-stimulating
factors – stimulates maturation of
granulocytes – pro-inflammatory
mediator.
Up No
change
Up Up No
change
CX3CL1 chemokine – pro-inflammatory No
change
No
change
Up Up No
change
CXCL1 Chemokine up up Up up no
change
CXCL2 Chemokine Up Up Up Up No
change
CXCL3 Chemokine Up Up Up Up No
change
CXCL10 Chemokine – neutrophil
chemoattractant
up No
change
Up up No
change
CXCL11 Chemokine – neutrophil
chemoattractant
No
change
No
change
Up No
change
No
change
ELF3 E74-like factor 3 (ets domain
transcription factor, epithelial-
specific Involved in mediating
vascular inflammation
Up Up Up Up No
change
105
FOS part of AP-1 complex. Pro-
inflammation
Up Up Up Up No
change
G1P2 a ubiquitin-like protein that becomes
conjugated to many cellular proteins
upon activation by interferon-alpha –
pro-inflammatory
up No
change
Up No
change
No
change
Hla-A/B MHC gene No
change
up No
change
up No
change
ICAM1 intercellular adhesion molecule for
leukocyte mediated transmigration –
pro-inflammatory
up No
Change
Up up No
Change
ICAM3 intercellular adhesion molecule for
leukocyte mediated transmigration –
pro-inflammatory
No
change
No
change
Down No
change
No
change
ICOSLG Acts as a costimulatory signal for T-
cell proliferation and cytokine
secretion
No
change
No
change
Up No
change
No
change
IFNA5
- Produced by macrophages, IFN-
alpha have antiviral activities.
Interferon stimulates the production
of two enzymes: a protein kinase and
an oligoadenylate synthetase pro-
inflammatory
No
change
No
change
No
change
No
change
down
IFNGR1 Interferon gamma receptor 1 – pro-
inflammatory
up No
change
Up up No
change
IFNGR2 Interferon gamma receptor 2 – pro-
inflammatory
No
change
No
change
Up up No
change
IFRD1 This gene is an immediate early gene
that encodes a protein related to
interferon-gamma
No
change
No
change
Up No
change
No
change
IKBKE dissociates inhibitors of NFkappaB up up Up up No
106
complex – pro-inflammatory change
IL1R1 IL1 cytokine receptor No
change
No
change
No
change
down No
change
IL2RG – Interleukin 2 receptor – pro-
inflammatory
No
change
No
change
No
change
up No
change
IL28RA proinflammatory cytokine No
change
No
change
Up No
change
No
change
IL8 Cytokine Up Up Up Up No
change
Il32 – cytokine that induces expression of
TNFa, il8
Up Up Up Up No
change
ILF3 Nuclear factor of activated T-cells
(NFAT) is a transcription factor
required for T-cell expression of
interleukin 2
No
change
No
change
down No
change
No
change
IRF-1 serves as an activator of interferons
alpha and beta transcription
up No
change
Up Up No
change
IRAK2 upregulates NfkappaB pro-
inflammatory
Up No
change
Up No
change
No
change
ISG20 degrades RNA – anti-viral function
of IFN against RNA viruses
No
change
No
change
Up No
change
No
change
ISGF3G – AKA IRF9 – Transcription
regulatory factor that mediates
signaling by type I IFNs (IFN-alpha
and IFN-beta). Following type I IFN
binding to cell surface receptors –
pro-inflammatory
No
change
No
change
No
change
down No
change
JUN associated with FOS to make AP-1
complex
Up Up Up Up No
change
JUNB same as JUN, associated with FOS to Up Up Up Up No
107
make AP-1 complex change
JUND same as JUN, associated with FOS to
make AP-1 complex
Up Up Up Up No
change
LIF cytokine – mitogenic - growth
promotion and cell differentiation of
different types of target cells
Up No
change
Up No
change
No
change
LTB lymphotoxin Beta – inducer of
inflammatory response system
Up Up Up Up No
change
LTBR protein encoded by this gene is a
member of the tumor necrosis factor
(TNF) family of receptors. Pro-
inflammatory
No
change
No
change
No
change
down No
change
MAP3k1 activates MAPK and JNK pathways.
Induce production of NFKappaB
up No
change
Up Up No
change
MAP3k8 activates MAPK and JNK pathways.
Induce production of NFKappaB
up No
change
Up No
change
No
change
MAP3K13 activates nfkb pathway – pro-
inflammatory.
No
change
No
change
Up No
change
No
change
MAP3K14 activates nfkb pathway – pro-
inflammatory.
No
change
No
change
Up No
change
No
change
NFATC2 member of the nuclear factors of
activated T cells transcription
complex
No
change
No
change
Up No
change
No
change
NFKB2 NF-kappa-B is a pleiotropic
transcription factor which is present
in almost all cell types and is
involved in many biological
processed such as inflammation,
immunity, differentiation, cell
growth, tumorigenesis and apoptosis
Up Up Up Up No
change
108
NR4A1 The NGFIB protein plays a key role
in mediating inflammatory responses
in macrophages
Up No
change
Up Up No
change
PELI1 Scaffold protein involved in the IL-1
signaling pathway via its interaction
with the complex containing IRAK
kinases and TRAF6. Required for
NF-kappa-B activation and IL-8 gene
expression in response to IL-1
Up No
change
Up No
change
No
change
PIM1 regulates cytokine pathwyas - These
include interleukins (IL-2, IL-3,IL-5,
IL-6, IL-7, IL12, IL-15), prolactin,
TNFα, EGF and IFNγ, among others
Up Up Up Up Up
PLA2G2A Phospholipases are a group of
enzymes that hydrolyze
phospholipids into fatty acids and
other lipophilic molecules.
Phospholipases are ubiquitously
expressed and have diverse
biological functions including roles
in inflammation, cell growth,
signaling and death and maintenance
of membrane phospholipids.
No
change
No
change
Down No
change
No
change
PTGS2 codes for cycloxygenase-2 –
upregulated during inflammation –
produces prostaglandins – pro-
inflammatory
Up Up Up Up No
change
RELB protein binds to NFKappaB to form
complex – pro-inflammatory
Up No
change
Up No
change
No
change
RIPK1 Essential adapter molecule for the
activation of NF-kappa-B – pro-
inflammatory
No
change
No
change
No
change
down No
change
SOCS3 cytokine-inducible negative Up Up Up Up No
109
regulators of cytokine signaling. Pro-
inflammatory
change
SMAD7 blocks TGFbeta – cAMP response
element binders – pro-inflammation
Up No
change
Up No
change
No
change
TNF (AKA TNF-a) pro-inflammatory
cytokine that induces cell apoptosis.
Up No
change
Up Up No
change
TNFRSF21 This receptor has been shown to
activate NF-kappaB and
MAPK8/JNK, and induce cell
apoptosis
No
change
No
change
Up No
change
No
change
TRIP associated with TLR3/TLR4.
Activates IFNa and IFNb in
inflammatory immune response
Up Up Up Up No
change
Anti-
inflammation
Function EDL933 LF82 EDL933
+
R0052
LF82+
R0052
R0052
CD55 – AKA DAF – stops complement
cascade
No
change
No
change
Up No
change
No
change
DUSP2 negatively regulates MAPK pathway No
change
No
change
No
change
down No
change
DUSP1 negatively regulates MAPK pathway Up Up Up Up No
change
DUSP5 negatively regulates MAPK pathway Up Up Up Up No
change
DUSP6 negatively regulates MAPK pathway No
change
No
change
Up No
change
No
change
DUSP8 negatively regulates MAPK pathway Up No
change
Up No
change
No
change
110
DUSP16 negatively regulates MAPK pathway Up No
change
Up Up No
change
NFKBIA NF-kB-pathway signaling up up Up Up No
change
NFKBIE NF-kB-pathway signaling up up Up Up No
change
SIGIRR Acts as a negative regulator of the
Toll-like and IL-1R receptor
signaling pathways
No
change
No
change
No
change
down No
change
TNFAIP3 induced by TNF. Limits
inflammation by inhibiting NFKB
activation and TNF mediated
apoptosis. – anti-inflammation
Up Up Up Up No
change
TOLLIP
– ubiquitin binding protein that
interacts with TLR signal cascade
proteins. Anti-inflammatory
No
change
No
change
No
change
down No
change
Tight
Junctions
Function EDL933 LF82 EDL933
+
R0052
LF82+
R0052
R0052
CLDN4 Tight junction Up Up Up Up No
change
CLDN10 Claudin 10 – Tight Junction Protein No
change
No
change
No
change
up Up
CLDN17 Claudin 17 – Tight Junction Protein No
change
No
change
down No
change
No
change
Jam1 regulates tight junction assembly in
epithelia
No
change
No
change
No
change
up No
change
MGC16207 This gene encodes an adhesion No No Down No No
111
protein that plays a role in the
organization of adherens junctions
and tight junctions in epithelial and
endothelial cells.
change change change change
PVRL2 This protein is one of the plasma
membrane components of adherens
junctions
No
change
No
change
Up No
change
No
change
THBS1 adhesive glycoprotein that mediates
cell-cell and cell-matrix interactions
Up No
change
Up No
change
No
change
VCL Actin filament (F-actin)-binding
protein involved in cell-matrix
adhesion and cell-cell adhesion
No
change
No
change
Up No
change
No
change
Cytoskeletal
Genes
Function EDL933 LF82 EDL933
+
R0052
LF82+
R0052
R0052
TUBB2B Tubulin Up No
change
Up No
change
No
change
TUBB2C Tubulin No
change
No
change
No
change
down No
change
VAV3 – Guanine nucleotide exchange
factor – involved in actin cytoskeletal
rearrangements
No
change
up No
change
No
change
No
change
Cellular
Growth/Prote
ction
Function EDL933 LF82 EDL933
+
R0052
LF82+
R0052
R0052
ADM Pro cell survival – increase tolerance
of cells to stress, injury, promotes
angiogenesis
up up Up Up No
change
112
AKT2 kinase – pro-cell survival No
change
No
change
No
change
down No
change
AREG part of epidermal growth factor
family
up up Up Up up
ASH1L associated to tight junctions No
change
No
change
down No
change
No
change
ATF1 encodes transcription factor that is
involved in growth, survival, and
other cellular activities
No
change
down No
change
No
change
No
change
BIRC3 inhibits apoptosis by inhibiting
capases
up up Up Up No
change
BNIP3 an apoptotic protector No
change
No
change
Up No
change
No
change
CCND1 Cell growth No
change
No
change
Up No
change
No
change
CCND3 Cell growth No
change
No
change
Up No
change
No
change
EVI1 AKA MECOM – anti apoptosis. No
change
No
change
Down No
change
No
change
EPHA2 encodes receptor involved in
angiogenesis
Up No
change
Up No
change
No
change
GADD45A activated by environmental stresses
and activates p38/JNK pathway. Cell
protection
Up Up Up Up No
change
GADD45B activated by environmental stresses
and activates p38/JNK pathway. Cell
protection
Up No
change
Up Up No
change
GDF15 regulating inflammatory and
apoptotic pathways in injured tissues
Up Up Up Up No
change
113
and during disease processes
GPR109B counteracts prolipolytic influences
due to oxidation stress
Up Up Up Up No
change
HBEGF cell growth No
change
No
change
Up No
change
No
change
HSPA8 Heatshock protein 8 No
change
No
change
Down No
change
No
change
ID1 This protein may play a role in cell
growth, senescence, and
differentiation
No
change
down Up Down No
change
ID3 This protein may play a role in cell
growth, senescence, and
differentiation
No
change
No
change
Up No
change
No
change
ITIH2 a family of structurally related
plasma serine protease inhibitors
involved in extracellular matrix
stabilization
No
change
Down Down Down No
change
PLK2 – involved in cell division No
change
No
change
Up No
change
No
change
MAP3K3 – activates SEK, MEK1/2, not p38. No
change
No
change
No
change
down No
change
MNT This protein is likely a transcriptional
repressor and an antagonist of Myc-
dependent transcriptional activation
and cell growth.
No
change
No
change
Up Down No
change
NDRG1 The protein encoded by this gene is a
cytoplasmic protein involved in
stress responses, hormone responses,
cell growth, and differentiation
No
change
No
change
Up No
change
No
change
PDGFA Platelet derived growth factor – Up No Up No No
114
mitogen for cells- wound healing change change change
PDGFRA
Platelet derived growth factor –
mitogen for cells- wound healing
No
change
No
change
No
change
down No
change
PIK3R1 proliferation, cell survival,
degranulation, vesicular trafficking
and cell migration. Anti-apoptosis
No
change
No
change
down No
change
No
change
PTPNS1 AKA SIRPA – his protein was found
to participate in signal transduction
mediated by various growth factor
receptors -
No
change
No
change
down No
change
No
change
PTPRB phosphatase involved in cell growth No
change
No
change
No
change
up No
change
RPS6KA4 regulate diverse cellular processes
such as cell growth, motility, survival
and proliferation
No
change
No
change
down No
change
No
change
TGFBR2 This receptor/ligand complex
phosphorylates proteins, which then
enter the nucleus and regulate the
transcription of a subset of genes
related to cell proliferation
No
change
No
change
down down No
change
TNFRSF21A Promotes angiogenesis and the
proliferation of endothelial cells
No
change
No
change
Up No
change
No
change
VEGF stimulates angiogenesis Up Up Up Up No
change
Cell Death Function EDL933 LF82 EDL933
+
R0052
LF82+
R0052
R0052
DDIT3 pro-apoptotic factor Up No
change
Up No
change
No
change
115
FADD pro-apoptosis signal. No
change
No
change
No
change
down No
change
TAOK2 involved in apoptotic morphological
changes – pro-apoptosis
down No
change
No
change
down No
change
Cell Arrest Function EDL933 LF82 EDL933
+
R0052
LF82+
R0052
R0052
CDKN1A cell cycle inhibitor No
change
No
change
Up Up No
change
CDKN1B cell cycle inhibitor up No
change
Up up No
change
INHBB inhibin – inhibits cell growth and
differentiation
No
change
No
change
Up No
change
No
change
KLF10 inhibits cell growth Up No
change
Up No
change
No
change
Other Genes Function EDL933 LF82 EDL933
+
R0052
LF82+
R0052
R0052
ADCY3 enzyme that makes cAMP. No
change
No
change
Down No
change
No
change
CACNA1A calcium channel, voltage-dependent,
P/Q type, alpha 1A subunit
up No
change
Up No
change
No
change
EGR1 – transcription factor – target genes
involved in differentiation and
mitogenesis
Up No
change
Up Down No
change
EMP3 epithelial membrane protein 3 up No No No No
116
change change change change
ENDOG encodes a DNAse/RNAse protein No
change
No
change
down No
change
No
change
GRM1 – activates phospholipase C - No
change
No
change
Up No
change
No
change
KLF6 functions as a tumor suppressor Up Up Up Up No
change
MUC13
produce mucins. No
change
up Up No
change
up
MUC12 No
change
up No
change
No
change
No
change
NTRK1 – encodes receptor that binds to
neutrophin, activates MAPK pathway
No
change
No
change
No
change
up Up
RGS3 - inhibits G-protein mediated signal
transduction
No
change
No
change
No
change
down No
change
SNAI1 downregulates expression of
ectodermal genes within mesoderm.
Up No
change
Up No
change
No
change
117
Table 5.2: Primer pairs used in the qRT-PCR analysis.
Gene
Name
Function GenBank
Accession
Number
Primer Sequence
Normalizing Genes
ACTB
Involved in various types of cell
motility and ubiquitously expressed
in all eukaryotic cells used as a
reference gene
NM_00110
1
F: GTTGTCGACGACGAGCG
R: GCACAGAGCCTCGCCTT
B2M
Serum protein involved in a
complex with another protein on the
surface of nearly all nucleated cells
used as a reference gene
NM_00404
8
F: TCTCTGCTGGATGACGTGAG
R: TAGCTGTGCTCGCGCTACT
RPLP0 Ribosomal protein P0 used as a
reference gene
NM_00100
2
F: GGCGACCTGGAAGTCCAACT
R: CCATCAGCACCACAGCCTTC
Pro-inflammation
PIM1 regulates cytokine pathways such as
interleukins, prolactin, TNFα, EGF
and IFNγ. Plays a role in signal
transduction in blood cells.
Contributes to both cell proliferation
and survival
NM_00264
8.3 F: ATGGTAGCGGATCCACTCTG
R: CTCAAGCTCATCGACTTCGG
CXCL1 Chemokine NM_00151
1.2
F: CTTCCTCCTCCCTTCTGGTC
R: GAAAGCTTGCCTCAATCCTG
IL8 One of the major mediators of the NM_00058 F: AAATTTGGGGTGGAAAGGTT
118
inflammatory response 4 R: TCCTGATTTCTGCAGCTCTGT
JUN associated with FOS to make AP-1
complex
Transcription factor that regulates
gene expression
NM_00222
8.3
F: TCTCACAAACCTCCCTCCTG
R: GAGGGGGTTACAAACTGCAA
Anti-inflammation
DUSP1 negatively regulates MAPK pathway NM_00441
7
F: GGCCCCGAGAACAGACAAA
R: GTGCCCACTTCCATGACCAT
NFKBI
A
Inhibits the activity of the NF-
kappa-B (NFKB) protein complex
NM_02052
9
F: CCGCACCTCCACTCCATCC
R:
ACATCAGCACCCAAGGACACC
TNFAI
P3
induced by TNF. Limits
inflammation by inhibiting NFKB
activation and TNF mediated
apoptosis. – anti-inflammation
NM_00629
0.2
F: TCACAGCTTTCCGCATATTG
R: GGACTTTGCGAAAGGATCG
Tight Junctions
CLDN4 Tight junction NM_00130
5.3
F: ATAAAGCCAGTCCTGATGCG
R: TAACTGCTCAACCTGTCCCC
CLDN1
0
Tight Junction Protein NM_18284
8.3
F: GCTGACAGCAGCGATCATAA
R: AGGGTCTGTGGATGAACTGC
THBS1 adhesive glycoprotein that mediates
cell-cell and cell-matrix interactions
NM_00324
6.2
F:
CACAGCTCGTAGAACAGGAGG
R: CAATGCCACAGTTCCTGATG
119
Cellular Growth/Protection
AREG part of epidermal growth factor
family
NM_00165
7.2
F:
TGGAAGCAGTAACATGCAAATG
TC
R:
GGCTGCTAATGCAATTTTTGATA
A
ADM Pro cell survival – increase tolerance
of cells to stress, injury, promotes
angiogenesis
NM_00112
4.1
F: ACGGAAACCAGCTTCATCC
R: GCCAGTGGGACGTCTGAG
BIRC3 inhibits apoptosis by inhibiting
capases
NM_00116
5.3
F: TGTTGGGAATCTGGAGATGA
R: CGGATGAACTCCTGTCCTTT
Cell Death
DDIT3 pro-apoptotic factor NM_00408
3.5
F: TGGATCAGTCTGGAAAAGCA
R: AGCCAAAATCAGAGCTGGAA
FADD pro-apoptosis signal NM_00382
4.3
F: TCTCCAATCTTTCCCCACAT
R: GAGCTGCTCGCCTCCCT
Cell Arrest
CDKN
1A
cell cycle inhibitor NM_07846
7.2
F:
TGGAGACTCTCAGGGTCGAAA
R:
GGCGTTTGGAGTGGTAGAAATC
120
CDKN
1B
cell cycle inhibitor NM_00406
4.3
F: CGCCATATTGGGCCACTAA
R: CGCAGAGCCGTGAGCAA
121
Industrially prepared probiotics do not alter pathogen mediated genetic responses. qRT-
PCR analysis of the 11 genes generally showed higher fold changes compared to microarray
analysis (Figure 5.2). qRT-PCR also showed that both enteric pathogens (EHEC O157:H7,
strain EDL933 and AIEC, strain LF82) induced higher gene expression changes in Caco-2 cells
compared to the probiotic L. helveticus R0052. Co-incubation or pre-incubation with the
probiotics did not affect changes in gene expression caused by the pathogens (Figure 5.2).
122
Figure 5.2. Microarray and qRT-PCR analysis of Caco-2 cells infected alone, co-incubated, or
pre-incubated with probiotics and pathogens. Caco-2 cells were incubated with either probiotics
or pathogens alone for 3h, co-incubated with probiotic and pathogen for 3h, or pre-incubated
with probiotics for 3h before the addition of a pathogen for 3h. Pro-inflammatory genes (Panels
A to C), anti-inflammatory genes (Panels D and E), cellular growth/protection genes (Panels F
to H), cell arrest/death genes (Panels I and J) and tight junction genes (Panel K) were analyzed
by both microarray and qRT-PCR. qRT-PCR fold expression were normalized to three reference
genes: ACTB, B2M, and RPLP0. All analyses were performed using independently collected
samples (n=6).
123
124
Growth of probiotics in MRS medium enables the suppression of pathogen gene mediated
effects. Previous studies demonstrated that preparation conditions can affect probiotic activity
(Sherman et al., 2005). Therefore, the effects of L. helveticus R0052 and L. rhamnosus GG
cultured in MRS broth on gene expression changes in Caco-2 cells either alone or as a 3h
pretreatment before challenge with E. coli EDL933 and E. coli LF82 was tested. As shown in
Figure 5.3, probiotics grown in MRS broth affected Caco-2 gene expression in a manner
distinctly different from the same strain prepared by using industrial means. Furthermore, MRS
cultured probiotics also prevented pathogen mediated changes in Caco-2 cell gene expression
(Figure 5.3).
125
Figure 5.3. qRT-PCR analysis of Caco-2 cells incubated with either probiotics or pathogens
alone, or pre-incubated with probiotics. Probiotics were prepared either industrially or
cultured in MRS broth, while E. coli enteropathogens were cultured in LB broth. Expression of
pro-inflammatory genes (Panels A to C), anti-inflammatory genes (Panels D and E), cellular
growth/protection genes (Panels F to H), Cell arrest/death genes (Panels I and J) and tight
junction gene (Panel K) were analyzed by qRT-PCR. Fold expression changes were normalized
to three reference genes: ACTB, B2M, and RPLP0. All analyses were performed using
independently collected samples (n=3-6, Two-way ANOVA,* p < 0.05 compared to EDL933, &
p <0.05 compared to LF82).
126
127
5.5 DISCUSSION
This is the first study, at least to our knowledge, that has analyzed using microarray and qRT-
PCR the human immune pathways affected by the pathogenic E. coli strain EDL933 and LF82 in
combination with the probiotics L. helveticus R0052 and L. rhamnosus GG. In the present study,
we show through a series of complementary microarray and qRT-PCR analyses that two enteric
bacterial pathogens (EHEC O157:H7, strain EDL933 and AIEC, strain LF82) alter gene
expression changes in Caco-2 cells in a distinct manner compared to the probiotic bacteria L.
helveticus R0052 and L. rhamnosus GG alone. Moreover, probiotics prepared in MRS broth
prevented pathogen-mediated changes in Caco-2 cell gene expression in a co-infection model.
EHEC and AIEC are both human pathogens that modulate immune pathways upon contact with
the host cell. Their pathogen-associated molecular patterns (PAMPs) are recognized by host
pathogen-recognition receptors (PRRs) leading to the activation of an inflammatory response.
For example, Toll-like receptor signaling in the intestine activates cytokine production (Dalpke
et al., 2003), chemokine-mediated recruitment of acute inflammatory cells and immunoglobulin
A (IgA) production (Shang et al., 2008), epithelial cell proliferation (Fukata et al., 2009),
maintenance of the integrity of intercellular tight junctions and antimicrobial peptide expression
(Hooper and Macpherson, 2010).
Probiotics are live, non-pathogenic microorganisms that confer health benefits to the host, and
are increasingly being employed to prevent and treat bacterial infection (Gareau et al., 2010). For
instance, probiotic bacteria have been shown to inhibit pathogen adhesion and invasion, and
changes in epithelial cell permeability induced by enteroinvasive E. coli (Resta-Lenert and
Barrett, 2006), Salmonella typhimurium (Gill et al., 2001) and Shigella flexneri (Tien et al.,
2006). Probiotics also mediate the activation, expression and secretion of pro-inflammatory
cytokines (TNFα) and chemokines (CXCL-8) caused by enteric pathogen infection (Gareau et
al., 2011).
In the present study, we have shown that pre-incubation of Caco-2 cells with probiotics L.
helveticus R0052 and L. rhamnosus GG grown in MRS broth were able to significantly
ameliorate E. coli EDL933 and LF82-induced modulation of genes involved in pro-
inflammatory, anti-inflammatory, cellular growth/protection and cellular arrest/death signaling
pathways (Figure 5.3).
128
The results of this study raise several issues with regards to the use of probiotics as a
management option for intestinal infections. In a previous study, we observed a more beneficial
effect from industrially versus MRS broth grown probiotics in modulating epithelial cell barrier
function in T84 cells (Sherman et al., 2005). In the present study, we confirm that the specific
methods used to prepare probiotics can dramatically affect their biological effects. However, in
this case MRS grown probiotics were more efficacious in mediating host immune pathways
compared to industrially prepared L. helveticus R0052. As reviewed by (Foster et al., 2011), it
has been observed that the probiotics Lactobacillus rhamnosus R0011 can reduce the
pathogenicity of Campylobacter jejuni in HT-29 cells (Alemka et al., 2010), but not when using
T84 cells (Wine et al., 2009). These findings suggest that there is specificity to the interactions
between probiotics and human cells. Furthermore, while it is not currently known precisely how
preparation conditions affect probiotic effectiveness, this area of research is currently under
active investigation (Grzeskowiak et al., 2011).
The results arising from this study also show the benefits of employing probiotics as a
prevention, strategy, rather than as an intervention option, as pre-incubation with probiotics
prepared in MRS medium prevented pathogen-induced pro-inflammatory gene expression.
Recent findings presented from our laboratory demonstrate that probiotics can be effective in
both preventing and treating bacterial intestinal infections in vivo, but efficacy in the rodent
model of bacterial-induced colitis diminished the longer the infection goes unchecked
(Rodrigues et al., 2012).
Future work focusing on the preparation conditions mediating probiotic effectiveness, as well
experiments to determine the temporal restrictions involved in using probiotics as a therapeutic
option should now be undertaken. Such information could be used to elucidate the mechanisms
by which probiotics achieve their health benefits, and direct use as a management option for
bacterially-induced enterocolitis.
5.6 ACKNOWLEDGEMENTS:
This work was supported by an operating grant from the Canadian Institutes of Health Research
(MOP-89894). NH was supported by a doctoral research award from the Canadian Institutes of
Health Research (JDD-95413). PMS was supported by a Canada Research Chair in
Gastrointestinal Disease.
129
Chapter 6
Discussion, Future Directions, and Significance
130
6.1 DISCUSSION
The studies presented in this thesis evaluated the mechanisms by which E. coli O157:H7 is able
to subvert host IFNγ/Jak1,2/Stat-1 signaling. Through a series of complementary biochemical
and genetic techniques, I have demonstrated the ability of EHEC to subvert the IFNγ pathway by
ways that are independent of direct bacterial contact with epithelial cells, and through the use of
secreted proteins (Chapter 3). I then showed that EHEC secreted Shiga toxins play a role in the
subversion of IFNγ signaling when testing several human epithelial cell lines (Chapter 4); and
that probiotics could ameliorate host immune activation responses induced following EHEC
exposure in a manner that is dependent on both the preparation employed and the conditions of
exposure (Chapter 5).
Chapters 3 and 4 address one of the central themes of this thesis as the concept of pathogen
mediated host immune activation, and the subversion by EHEC to evade the host immune system
and thereby potentially promote pathogenesis. It is not surprising to discover that EHEC has
evolved a way to subvert the host IFNγ pathway, as subversion of the host immune system is
increasingly recognized as a common theme as an underlying strategy employed among many
human pathogens (Jones and Neish, 2011). For example, viruses of the Paramyxoviridae family
subvert the IFNγ pathway by degrading intracellular Stat-1 (Didcock et al., 1999), while the
parasite Leishmania donovani prevents tyrosine-phosphorylation and activation of Stat-1
(Nandan and Reiner, 1995). The ability of EHEC O157:H7 to suppress the IFNγ pathway could
arguably promote its ability to colonize the gut of the infected host by reducing immune
surveillance (Jones and Neish, 2011).
As EHEC contains an array of virulence factors that aid in infection pathogenicity and
subversion of host immune signaling, such as the Locus of Enterocyte Effacement (LEE)
pathogenicity island encoded type three secretion system (T3SS), its pO157 plasmid, and phage
encoded Shiga toxins, I focused on each of these virulence factors to identify potential
mechanisms by which this pathogen can subvert the host IFNγ/Jak/Stat signal transduction
pathway.
One virulence factor of primary interest was the LEE pathogenicity island and the encoded
T3SS, which allows the bacterium to inject bacterial effector proteins directly into the host cell to
subvert host cytoskeleton processes, destroy brush border microvilli, and cause rearrangements
131
of F-actin resulting in attaching and effacing (A/E) lesions on epithelial cell apical membrane
surfaces (Frankel and Phillips, 2008; Garmendia et al., 2005; Kaper et al., 2004). Studies on the
T3SS and its effectors have found that many of these bacterial-derived proteins have redundant
and overlapping functions, each of which appears to have multiple roles in subverting eukaryotic
cellular processes, thereby aiding in EHEC-mediated disease pathogenesis (Dean and Kenny,
2009). For example, the EspF protein appears to play several roles in the subversion of host
cellular signaling pathways, such as effacing the microvilli of infected cells, disrupting the
nucleolus, and preventing phagocytosis (Holmes et al., 2010). Furthermore, EspF, along with Tir
and Map, all contribute to SGLT-1 transporter inactivation (Wong et al., 2011). As a whole, it
appears that many of the virulence proteins expressed by EHEC are multifunctional, cooperative,
and redundant (Dean and Kenny, 2009). However, experiments utilizing isogenic mutants in the
T3SS system demonstrated that the LEE PAI in E. coli O157:H7 was not responsible for EHEC
mediated subversion of the IFNγ signaling pathway (Chapter 3).
EHEC O157:H7 also harbors a pO157 virulence plasmid that encodes several putative virulence
factors, such as: a metalloprotease (stcE) (Lathem et al., 2002), a serine protease (espP)
(Brockmeyer et al., 2007), a hemolysin (ehxA) (Schmidt et al., 1994), a catalase-peroxidase
(katP) (Brunder et al., 1996), and a putative adhesin (toxB) (Tatsuno et al., 2001). However,
experiments using pO157 plasmid cured strains continued to subvert the host IFNγ pathway as
well as wild-type strains (Chapter 3), indicating that this plasmid does not contain a factor
related to subverting of this signal transduction cascade.
Shiga toxins serve as a distinct marker for EHEC infections, and aid the pathogen in causing
systemic complications, including hemorrhagic colitis and the hemolytic-uremic syndrome
(HUS) (Obrig, 2010). In North America, approximately 75,000 cases of EHEC infections are
reported annually. Of these, 10-15% of cases develop HUS (Panos et al., 2006). In Chapter 5, I
demonstrate through the use of knockout mutagenesis, genetic complementation in trans, as well
as use of purified Stx that these toxins are involved in the suppression of the IFNγ/Jak 1,2/Stat-1
pathway. To our knowledge, this is the first study to show that Shiga toxins modulate IFNγ
signaling, which supports recent findings that many EHEC effectors have multiple and
overlapping roles in subverting host cell processes (Dean and Kenny, 2009; Hamada et al.,
2010).
132
The second theme of this thesis is that probiotics are a potential therapeutic option for use in the
management of EHEC infections. Studies of these beneficial microbes over recent years
demonstrate that probiotics can prevent and perhaps be used to treat enteric infections
(Rodrigues et al., 2012) through a multitude of mechanisms ranging from secreting antimicrobial
peptides (Corr et al., 2007), physical displacement of pathogenic bacteria (Johnson-Henry et al.,
2007), to modulation of host immune pathways (Seth et al., 2008). In Chapter 6, I evaluated two
such strains of probiotics, Lactobacillus helveticus R0052 and Lactobacillus rhamnosus GG, and
showed that pre-treatment with these probiotics can ameliorate host immune activation responses
to challenge of epithelial cells with two pathogenic bacteria, E. coli O157:H7, strain EDL933
and E. coli O83:H1, strain LF82, in a preparation dependent manner. The findings of this PhD
thesis can be used to form a model of EHEC O157:H7 pathogenesis, and is illustrated in Figure
6.1.1.
133
Figure 6.1.1. The results of this thesis presented as a model of EHEC O157:H7
pathogenesis. EHEC has evolved a method to subvert the IFNγ signaling pathway. The results
of Chapter 4 show that EHEC can mediate this effect through the secretion of its proteins, but
YodA does not appear to be involved. The results of Chapter 5 demonstrate that the secreted
EHEC Shiga toxins are involved, but also indicate that non-secreted proteins can play a
significant part in subverting the IFNγ signaling pathway. The results of Chapter 6 demonstrate
that probiotics could help prevent pathogen gene mediated effects on human intestinal epithelial
cells.
134
135
6.2 FUTURE DIRECTIONS
There are several areas presented in this thesis which could direct future research in the field. For
instance, YodA was identified as a candidate protein mediating the inhibition of IFNγ induced
Stat-1 phosphorylation in Chapter 3. While I demonstrated that a YodA knockout in EHEC, as
well as a purified YodA product were still able to subvert Stat-1 phosphorylation, further work
could be done to verify these results. For example, column chromatography could be repeated
using YodA CS to determine if the inhibitory protein is again observed, and subsequent isolation
experiments, using the methodologies described in Chapter 3 could then be undertaken to
identify the secreted factor.
Furthermore, the complete mechanisms by which EHEC O157:H7 subverts the IFNγ pathway
remains to be elucidated. I have demonstrated that Stx are involved in mediating this ability
(Chapter 5), but it is also clear that other non-secreted factors are likely to be involved, since
direct infection with StxDKO mutants retain the ability to completely suppress IFNγ mediated
Stat-1 tyrosine phosphorylation.
An interesting direction for future research would be to identify and characterize differences
between proteins expressed and localized in the outer membranes of EPEC and EHEC. As
illustrated by Molley et al. (2001), this could be accomplished by collecting total bacterial
proteins, and then use an alkaline pH wash to remove non-membrane bound proteins. The
remaining membrane bound proteins could then be solubilized using strong denaturing
conditions and analyzed using 2D Difference Gel Electrophoresis, as was previously done in
Chapter 5. Differing proteins can then be verified for their role in subverting the IFNγ pathway
by E. coli O157:H7 using knockout mutagenesis and complementation in trans.
Another prime area for future study would be to further elucidate mechanisms by which Stx
suppress IFNγ mediated Stat-1 tyrosine phosphorylation. It can be presumed that the toxin’s
effects are mediated by direct protein interaction with at least one part of the IFNγ pathway.
Hence, experiments using co-immunoprecipitation (co-IP) techniques could be employed to
determine any direct binding of Stx’s to either the IFNγ receptors (IFNGR1, IFNGR2) the Jak’s
(Jak1, Jak2), or perhaps Stat-1 itself. The scope of such experiments then could be expanded to
include other EHEC proteins that might interact with Stx, as it was observed that purified Stx
136
alone did not affect IFNγ signaling, and that culture supernatants were required for IFNγ
suppression (Chapter 5).
In parallel with these proposed studies, alternative experiments employing modified Stx could be
utilized to elucidate the active sites required for mediating IFNγ subversion. Since nothing is
known about the mechanisms by which Stx mediates effects on the IFNγ pathway, either the use
of inactive Stx toxins (Glu167 and Arg176 double mutations in their active site) (Di et al., 2011),
or employing purified Stx A and B subunits could be tested to infer the minimal requirements for
Stx mediated IFNγ subversion. Results from these experiments could potentially be applied to
developing therapeutic options for use in the treatment of chronic diseases which have elevated
IFNγ levels, such as Crohn’s disease (Pak et al., 2012).
An interesting corollary of the Stx mutations is that, despite knockouts in stx1A, stx2A or both,
there remains some residual expression of toxin activity in the isogenic mutants (Table 4.3).
Theoretically, there shouldn’t be any detected at all since 1) the genes were ablated entirely, 2)
the antibody used in the ELISA are monoclonal towards the toxins, and 3) the technique used is
sensitive to pg/ml levels of the toxin. It is likely that this is an experimental artifact. Further
inquiry to define the exact specificity of the antibodies used in the immunoassay would be of
interest in determining the robustness of the knockout mutation studies.
Future work with probiotics would also likely prove to be meaningful. Additional microarray
experiments using MRS grown probiotics would complete the data currently present in Chapter
5. It would also be of interest to determine the ineffectiveness of the industrially prepared
probiotics compared to the MRS grown variants. One hypothesis is that since the industrially
prepared R0052 is packaged for human consumption and protection from the stomach acids in
vivo, it may require more time to activate the bacteria, a possibility which was not considered
during our experiments in vitro. One way to test this hypothesis would be to perform a growth
curve experiment on both the industrially and MRS prepared probiotics. Should a significant
delay in growth be seen in the industrially prepared probiotics, this could indicate a fault with the
in vitro experimentation design, and explain why the industrially prepared R0052 was ineffective
in modulating pathogen mediate host immune responses compared to MRS prepared probiotics.
137
It would be of great interest to assess the effects of probiotic administration during and post-
infection so as to determine if these beneficial microbes could be extended to use beyond
preventative strategies, such as in the setting of an outbreak of infection or to prevent intra-
familial or nosocomial spread of the illness. The inclusion of different preparation strategies,
such as collection during different growth phases (exponential vs. stationary), as well as
experiments with varying initial dosages would also be of value in determining the optimal
preparation conditions required for creating an effective probiotic for use in a therapeutic setting.
6.3 SIGNIFICANCE
EHEC is responsible for 75,000 infections annually in North America. The hemolytic-uremic
syndrome is the most severe clinical manifestation of EHEC infections, which accounts for >200
deaths every year. Antibiotics exacerbate EHEC infection as they increase the potential for
developing systemic disease. Characterizing novel EHEC virulence factors and the mechanisms
of bacterial disruption of host cellular responses will, therefore, advance current knowledge of
EHEC immune evasion strategies. Although the results of my thesis are reductionist in nature,
the finding that EHEC can subvert the IFNγ pathway is significant and should be verified in
relevant animal models (Higgins et al., 1999) before extended to human intervention studies.
Such information could lead to the development of novel alternative strategies to prevent and
treat EHEC infections in humans.
138
References Abe, H., Tatsuno, I., Tobe, T., Okutani, A., and Sasakawa, C. (2002). Bicarbonate ion stimulates the expression of locus of enterocyte effacement-encoded genes in enterohemorrhagic Escherichia coli O157:H7. Infect Immun 70, 3500-3509.
Alemka, A., Clyne, M., Shanahan, F., Tompkins, T., Corcionivoschi, N., and Bourke, B. (2010). Probiotic colonization of the adherent mucus layer of HT29MTXE12 cells attenuates Campylobacter jejuni virulence properties. Infect Immun 78, 2812-2822.
Allen, K.J., Rogan, D., Finlay, B.B., Potter, A.A., and Asper, D.J. (2011). Vaccination with type III secreted proteins leads to decreased shedding in calves after experimental infection with Escherichia coli O157. Can J Vet Res 75, 98-105.
Andreoli, S.P., Trachtman, H., Acheson, D.W., Siegler, R.L., and Obrig, T.G. (2002). Hemolytic uremic syndrome: epidemiology, pathophysiology, and therapy. Pediatr Nephrol 17, 293-298.
Arbeloa, A., Garnett, J., Lillington, J., Bulgin, R.R., Berger, C.N., Lea, S.M., Matthews, S., and Frankel, G. (2010). EspM2 is a RhoA guanine nucleotide exchange factor. Cell Microbiol 12, 654-664.
Arbeloa, A., Oates, C.V., Marches, O., Hartland, E.L., and Frankel, G. (2011). Enteropathogenic and enterohemorrhagic Escherichia coli type III secretion effector EspV induces radical morphological changes in eukaryotic cells. Infect Immun 79, 1067-1076.
Asper, D.J., Karmali, M.A., Townsend, H., Rogan, D., and Potter, A.A. (2011). Serological response of Shiga toxin-producing Escherichia coli type III secreted proteins in sera from vaccinated rabbits, naturally infected cattle, and humans. Clin Vaccine Immunol 18, 1052-1057.
Atalla, H.N., Johnson, R., McEwen, S., Usborne, R.W., and Gyles, C.L. (2000). Use of a Shiga toxin (Stx)-enzyme-linked immunosorbent assay and immunoblot for detection and isolation of Stx-producing Escherichia coli from naturally contaminated beef. J Food Prot 63, 1167-1172.
Averbuch, D., Chapgier, A., Boisson-Dupuis, S., Casanova, J.L., and Engelhard, D. (2011). The clinical spectrum of patients with deficiency of Signal Transducer and Activator of Transcription-1. Pediatr Infect Dis J 30, 352-355.
Bach, E.A., Aguet, M., and Schreiber, R.D. (1997). The IFN gamma receptor: a paradigm for cytokine receptor signaling. Annu Rev Immunol 15, 563-591.
Baruch, K., Gur-Arie, L., Nadler, C., Koby, S., Yerushalmi, G., Ben-Neriah, Y., Yogev, O., Shaulian, E., Guttman, C., Zarivach, R., et al. (2011). Metalloprotease type III effectors that specifically cleave JNK and NF-kappaB. EMBO J 30, 221-231.
Bellmeyer, A., Cotton, C., Kanteti, R., Koutsouris, A., Viswanathan, V.K., and Hecht, G. (2009). Enterohemorrhagic Escherichia coli suppresses inflammatory response to cytokines and its own toxin. Am J Physiol Gastrointest Liver Physiol 297, G576-581.
139
Betz, J., Bielaszewska, M., Thies, A., Humpf, H.U., Dreisewerd, K., Karch, H., Kim, K.S., Friedrich, A.W., and Muthing, J. (2011). Shiga toxin glycosphingolipid receptors in microvascular and macrovascular endothelial cells: differential association with membrane lipid raft microdomains. J Lipid Res 52, 618-634.
Bielaszewska, M., Mellmann, A., Zhang, W., Kock, R., Fruth, A., Bauwens, A., Peters, G., and Karch, H. (2011). Characterisation of the Escherichia coli strain associated with an outbreak of haemolytic uraemic syndrome in Germany, 2011: a microbiological study. Lancet Infect Dis 11, 671-676.
Brockmeyer, J., Bielaszewska, M., Fruth, A., Bonn, M.L., Mellmann, A., Humpf, H.U., and Karch, H. (2007). Subtypes of the plasmid-encoded serine protease EspP in Shiga toxin-producing Escherichia coli: distribution, secretion, and proteolytic activity. Appl Environ Microbiol 73, 6351-6359.
Brooks, J.T., Sowers, E.G., Wells, J.G., Greene, K.D., Griffin, P.M., Hoekstra, R.M., and Strockbine, N.A. (2005). Non-O157 Shiga toxin-producing Escherichia coli infections in the United States, 1983-2002. J Infect Dis 192, 1422-1429.
Brunder, W., Schmidt, H., and Karch, H. (1996). KatP, a novel catalase-peroxidase encoded by the large plasmid of enterohaemorrhagic Escherichia coli O157:H7. Microbiology 142 ( Pt 11), 3305-3315.
Brunder, W., Schmidt, H., and Karch, H. (1997). EspP, a novel extracellular serine protease of enterohaemorrhagic Escherichia coli O157:H7 cleaves human coagulation factor V. Mol Microbiol 24, 767-778.
Bulgin, R., Raymond, B., Garnett, J.A., Frankel, G., Crepin, V.F., Berger, C.N., and Arbeloa, A. (2010). Bacterial guanine nucleotide exchange factors SopE-like and WxxxE effectors. Infect Immun 78, 1417-1425.
Caballero-Franco, C., Keller, K., De Simone, C., and Chadee, K. (2007). The VSL#3 probiotic formula induces mucin gene expression and secretion in colonic epithelial cells. Am J Physiol Gastrointest Liver Physiol 292, G315-322.
Cai, K., Gao, X., Li, T., Wang, Q., Hou, X., Tu, W., Xiao, L., Tian, M., Liu, Y., and Wang, H. (2011). Enhanced immunogenicity of a novel Stx2Am-Stx1B fusion protein in a mice model of enterohemorrhagic Escherichia coli O157:H7 infection. Vaccine 29, 946-952.
Calderwood, S.B., Auclair, F., Donohue-Rolfe, A., Keusch, G.T., and Mekalanos, J.J. (1987). Nucleotide sequence of the Shiga-like toxin genes of Escherichia coli. Proc Natl Acad Sci U S A 84, 4364-4368.
Campellone, K.G., and Leong, J.M. (2005). Nck-independent actin assembly is mediated by two phosphorylated tyrosines within enteropathogenic Escherichia coli Tir. Mol Microbiol 56, 416-432.
Caprioli, A., Morabito, S., Brugere, H., and Oswald, E. (2005). Enterohaemorrhagic Escherichia coli: emerging issues on virulence and modes of transmission. Vet Res 36, 289-311.
140
Casanova, J.L., Holland, S.M., and Notarangelo, L.D. (2012). Inborn Errors of Human JAKs and STATs. Immunity 36, 515-528.
Castillo, A., Eguiarte, L.E., and Souza, V. (2005). A genomic population genetics analysis of the pathogenic enterocyte effacement island in Escherichia coli: the search for the unit of selection. Proc Natl Acad Sci U S A 102, 1542-1547.
Ceponis, P.J., McKay, D.M., Ching, J.C., Pereira, P., and Sherman, P.M. (2003). Enterohemorrhagic Escherichia coli O157:H7 disrupts Stat1-mediated gamma interferon signal transduction in epithelial cells. Infect Immun 71, 1396-1404.
Chapgier, A., Wynn, R.F., Jouanguy, E., Filipe-Santos, O., Zhang, S., Feinberg, J., Hawkins, K., Casanova, J.L., and Arkwright, P.D. (2006). Human complete Stat-1 deficiency is associated with defective type I and II IFN responses in vitro but immunity to some low virulence viruses in vivo. J Immunol 176, 5078-5083.
Chen, J., Johnson, R., and Griffiths, M. (1998). Detection of verotoxigenic Escherichia coli by magnetic capture-hybridization PCR. Appl Environ Microbiol 64, 147-152.
Ching, J.C., Jones, N.L., Ceponis, P.J., Karmali, M.A., and Sherman, P.M. (2002). Escherichia coli Shiga-like toxins induce apoptosis and cleavage of poly(ADP-ribose) polymerase via in vitro activation of caspases. Infect Immun 70, 4669-4677.
Commins, S.P., Borish, L., and Steinke, J.W. (2010). Immunologic messenger molecules: cytokines, interferons, and chemokines. J Allergy Clin Immunol 125, S53-72.
Corr, S.C., Li, Y., Riedel, C.U., O'Toole, P.W., Hill, C., and Gahan, C.G. (2007). Bacteriocin production as a mechanism for the antiinfective activity of Lactobacillus salivarius UCC118. Proc Natl Acad Sci U S A 104, 7617-7621.
Croxen, M.A., and Finlay, B.B. (2010). Molecular mechanisms of Escherichia coli pathogenicity. Nat Rev Microbiol 8, 26-38.
Cui, W., Taub, D.D., and Gardner, K. (2007). qPrimerDepot: a primer database for quantitative real time PCR. Nucleic Acids Res 35, D805-809.
Dalpke, A.H., Eckerle, S., Frey, M., and Heeg, K. (2003). Triggering of Toll-like receptors modulates IFN-gamma signaling: involvement of serine 727 STAT1 phosphorylation and suppressors of cytokine signaling. Eur J Immunol 33, 1776-1787.
Darfeuille-Michaud, A., Neut, C., Barnich, N., Lederman, E., Di Martino, P., Desreumaux, P., Gambiez, L., Joly, B., Cortot, A., and Colombel, J.F. (1998). Presence of adherent Escherichia coli strains in ileal mucosa of patients with Crohn's disease. Gastroenterology 115, 1405-1413.
Datsenko, K.A., and Wanner, B.L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97, 6640-6645.
David, G., Blondeau, K., Renouard, M., and Lewit-Bentley, A. (2002). Crystallization and preliminary analysis of Escherichia coli YodA. Acta Crystallogr D Biol Crystallogr 58, 1243-1245.
141
David, G., Blondeau, K., Schiltz, M., Penel, S., and Lewit-Bentley, A. (2003). YodA from Escherichia coli is a metal-binding, lipocalin-like protein. J Biol Chem 278, 43728-43735.
De Schrijver, K., Buvens, G., Posse, B., Van den Branden, D., Oosterlynck, O., De Zutter, L., Eilers, K., Pierard, D., Dierick, K., Van Damme-Lombaerts, R., et al. (2008). Outbreak of verocytotoxin-producing E. coli O145 and O26 infections associated with the consumption of ice cream produced at a farm, Belgium, 2007. Euro Surveill 13.
Dean, P., and Kenny, B. (2009). The effector repertoire of enteropathogenic E. coli: ganging up on the host cell. Curr Opin Microbiol 12, 101-109.
Dean, P., Scott, J.A., Knox, A.A., Quitard, S., Watkins, N.J., and Kenny, B. (2010). The enteropathogenic E. coli effector EspF targets and disrupts the nucleolus by a process regulated by mitochondrial dysfunction. PLoS Pathog 6, e1000961.
DebRoy, C., Roberts, E., and Fratamico, P.M. (2011). Detection of O antigens in Escherichia coli. Anim Health Res Rev 12, 169-185.
Di, R., Kyu, E., Shete, V., Saidasan, H., Kahn, P.C., and Tumer, N.E. (2011). Identification of amino acids critical for the cytotoxicity of Shiga toxin 1 and 2 in Saccharomyces cerevisiae. Toxicon 57, 525-539.
Didcock, L., Young, D.F., Goodbourn, S., and Randall, R.E. (1999). The V protein of simian virus 5 inhibits interferon signalling by targeting STAT1 for proteasome-mediated degradation. J Virol 73, 9928-9933.
Donato, K.A., Gareau, M.G., Wang, Y.J., and Sherman, P.M. (2010). Lactobacillus rhamnosus GG attenuates interferon-{gamma} and tumour necrosis factor-alpha-induced barrier dysfunction and pro-inflammatory signalling. Microbiology 156, 3288-3297.
Dong, N., Liu, L., and Shao, F. (2010). A bacterial effector targets host DH-PH domain RhoGEFs and antagonizes macrophage phagocytosis. EMBO J 29, 1363-1376.
Dundas, S., Todd, W.T., Stewart, A.I., Murdoch, P.S., Chaudhuri, A.K., and Hutchinson, S.J. (2001). The central Scotland Escherichia coli O157:H7 outbreak: risk factors for the hemolytic uremic syndrome and death among hospitalized patients. Clin Infect Dis 33, 923-931.
DuPont, H.L. (2009). Clinical practice. Bacterial diarrhea. N Engl J Med 361, 1560-1569.
Dupuis, S., Jouanguy, E., Al-Hajjar, S., Fieschi, C., Al-Mohsen, I.Z., Al-Jumaah, S., Yang, K., Chapgier, A., Eidenschenk, C., Eid, P., et al. (2003). Impaired response to interferon-alpha/beta and lethal viral disease in human STAT1 deficiency. Nat Genet 33, 388-391.
Dydensborg, A.B., Herring, E., Auclair, J., Tremblay, E., and Beaulieu, J.F. (2006). Normalizing genes for quantitative RT-PCR in differentiating human intestinal epithelial cells and adenocarcinomas of the colon. Am J Physiol Gastrointest Liver Physiol 290, G1067-1074.
Elliott, E.J., Robins-Browne, R.M., O'Loughlin, E.V., Bennett-Wood, V., Bourke, J., Henning, P., Hogg, G.G., Knight, J., Powell, H., and Redmond, D. (2001). Nationwide study of haemolytic
142
uraemic syndrome: clinical, microbiological, and epidemiological features. Arch Dis Child 85, 125-131.
Ethelberg, S., Olsen, K.E., Scheutz, F., Jensen, C., Schiellerup, P., Enberg, J., Petersen, A.M., Olesen, B., Gerner-Smidt, P., and Molbak, K. (2004). Virulence factors for hemolytic uremic syndrome, Denmark. Emerg Infect Dis 10, 842-847.
Ethelberg, S., Smith, B., Torpdahl, M., Lisby, M., Boel, J., Jensen, T., and Molbak, K. (2007). An outbreak of Verocytotoxin-producing Escherichia coli O26:H11 caused by beef sausage, Denmark 2007. Euro Surveill 12, E070531 070534.
FAO/WHO (2002). Joint FAO/WHO Working Group Report on Drafting Guidelines for the Evaluation of Probiotics in Food (London, Canada).
Fayol-Messaoudi, D., Berger, C.N., Coconnier-Polter, M.H., Lievin-Le Moal, V., and Servin, A.L. (2005). pH-, Lactic acid-, and non-lactic acid-dependent activities of probiotic Lactobacilli against Salmonella enterica Serovar Typhimurium. Appl Environ Microbiol 71, 6008-6013.
Feng, P., Lampel, K.A., Karch, H., and Whittam, T.S. (1998). Genotypic and phenotypic changes in the emergence of Escherichia coli O157:H7. J Infect Dis 177, 1750-1753.
Foster, L.M., Tompkins, T.A., and Dahl, W.J. (2011). A comprehensive post-market review of studies on a probiotic product containing Lactobacillus helveticus R0052 and Lactobacillus rhamnosus R0011. Benef Microbes 2, 319-334.
Frank, C., Werber, D., Cramer, J.P., Askar, M., Faber, M., Heiden, M.A., Bernard, H., Fruth, A., Prager, R., Spode, A., et al. (2011). Epidemic Profile of Shiga-Toxin-Producing Escherichia coli O104:H4 Outbreak in Germany - Preliminary Report. N Engl J Med.
Frankel, G., and Phillips, A.D. (2008). Attaching effacing Escherichia coli and paradigms of Tir-triggered actin polymerization: getting off the pedestal. Cell Microbiol 10, 549-556.
Fraser, M.E., Fujinaga, M., Cherney, M.M., Melton-Celsa, A.R., Twiddy, E.M., O'Brien, A.D., and James, M.N. (2004). Structure of shiga toxin type 2 (Stx2) from Escherichia coli O157:H7. J Biol Chem 279, 27511-27517.
Fukata, M., Hernandez, Y., Conduah, D., Cohen, J., Chen, A., Breglio, K., Goo, T., Hsu, D., Xu, R., and Abreu, M.T. (2009). Innate immune signaling by Toll-like receptor-4 (TLR4) shapes the inflammatory microenvironment in colitis-associated tumors. Inflamm Bowel Dis 15, 997-1006.
Fukuda, S., Toh, H., Hase, K., Oshima, K., Nakanishi, Y., Yoshimura, K., Tobe, T., Clarke, J.M., Topping, D.L., Suzuki, T., et al. (2011). Bifidobacteria can protect from enteropathogenic infection through production of acetate. Nature 469, 543-547.
Gareau, M.G., Ho, N.K., Brenner, D., Sousa, A.J., Lebourhis, L., Mak, T.W., Girardin, S.E., Philpott, D.J., and Sherman, P.M. (2011). Enterohaemorrhagic, but not enteropathogenic, Escherichia coli infection of epithelial cells disrupts signalling responses to tumour necrosis factor-alpha. Microbiology 157, 2963-2973.
143
Gareau, M.G., Sherman, P.M., and Walker, W.A. (2010). Probiotics and the gut microbiota in intestinal health and disease. Nat Rev Gastroenterol Hepatol 7, 503-514.
Garmendia, J., Frankel, G., and Crepin, V.F. (2005). Enteropathogenic and enterohemorrhagic Escherichia coli infections: translocation, translocation, translocation. Infect Immun 73, 2573-2585.
Gedek, B.R. (1999). Adherence of Escherichia coli serogroup O 157 and the Salmonella typhimurium mutant DT 104 to the surface of Saccharomyces boulardii. Mycoses 42, 261-264.
Gehring, A.J., Rojas, R.E., Canaday, D.H., Lakey, D.L., Harding, C.V., and Boom, W.H. (2003). The Mycobacterium tuberculosis 19-kilodalton lipoprotein inhibits gamma interferon-regulated HLA-DR and Fc gamma R1 on human macrophages through Toll-like receptor 2. Infect Immun 71, 4487-4497.
Gill, H.S., Shu, Q., Lin, H., Rutherfurd, K.J., and Cross, M.L. (2001). Protection against translocating Salmonella typhimurium infection in mice by feeding the immuno-enhancing probiotic Lactobacillus rhamnosus strain HN001. Med Microbiol Immunol 190, 97-104.
Golan, L., Gonen, E., Yagel, S., Rosenshine, I., and Shpigel, N.Y. (2011). Enterohemorrhagic Escherichia coli induce attaching and effacing lesions and hemorrhagic colitis in human and bovine intestinal xenograft models. Dis Model Mech 4, 86-94.
Goldwater, P.N., and Bettelheim, K.A. (2012). Treatment of enterohemorrhagic Escherichia coli (EHEC) infection and hemolytic uremic syndrome (HUS). BMC Med 10, 12.
Grif, K., Dierich, M.P., Karch, H., and Allerberger, F. (1998). Strain-specific differences in the amount of Shiga toxin released from enterohemorrhagic Escherichia coli O157 following exposure to subinhibitory concentrations of antimicrobial agents. Eur J Clin Microbiol Infect Dis 17, 761-766.
Grzeskowiak, L., Isolauri, E., Salminen, S., and Gueimonde, M. (2011). Manufacturing process influences properties of probiotic bacteria. Br J Nutr 105, 887-894.
Gu, J., Liu, Y., Yu, S., Wang, H., Wang, Q., Yi, Y., Zhu, F., Yu, X.J., Zou, Q., and Mao, X. (2009). Enterohemorrhagic Escherichia coli trivalent recombinant vaccine containing EspA, intimin and Stx2 induces strong humoral immune response and confers protection in mice. Microbes Infect 11, 835-841.
Hale, L., Lazos, O., Haines, A., and Thomas, C. (2010). An efficient stress-free strategy to displace stable bacterial plasmids. Biotechniques 48, 223-228.
Hamada, D., Hamaguchi, M., Suzuki, K.N., Sakata, I., and Yanagihara, I. (2010). Cytoskeleton-modulating effectors of enteropathogenic and enterohemorrhagic Escherichia coli: a case for EspB as an intrinsically less-ordered effector. FEBS J 277, 2409-2415.
Hamaguchi, M., Hamada, D., Suzuki, K.N., Sakata, I., and Yanagihara, I. (2008). Molecular basis of actin reorganization promoted by binding of enterohaemorrhagic Escherichia coli EspB to alpha-catenin. FEBS J 275, 6260-6267.
144
Heim, M.H., Kerr, I.M., Stark, G.R., and Darnell, J.E., Jr. (1995). Contribution of STAT SH2 groups to specific interferon signaling by the Jak-STAT pathway. Science 267, 1347-1349.
Hickey, C.A., Beattie, T.J., Cowieson, J., Miyashita, Y., Strife, C.F., Frem, J.C., Peterson, J.M., Butani, L., Jones, D.P., Havens, P.L., et al. (2011). Early volume expansion during diarrhea and relative nephroprotection during subsequent hemolytic uremic syndrome. Arch Pediatr Adolesc Med 165, 884-889.
Higgins, L.M., Frankel, G., Connerton, I., Goncalves, N.S., Dougan, G., and MacDonald, T.T. (1999). Role of bacterial intimin in colonic hyperplasia and inflammation. Science 285, 588-591.
Ho, N.H., Ossa, J.C., Sousa, A.J., and Sherman, P.M. (2011). Enterohemorrhagic Escherichia coli O157:H7 Shiga toxins inhibit interferon-gamma mediated cellular activation. Infect Immun. Submitted.
Ho, N.K., Crandall, I., and Sherman, P.M. (2012a). Identifying mechanisms by which Escherichia coli O157:H7 subverts interferon-gamma mediated signal transducer and activator of transcription-1 activation. PLoS One 7, e30145.
Ho, N.K., Ossa, J.C., Silphaduang, U., Johnson, R., Johnson-Henry, K.C., and Sherman, P.M. (2012b). Enterohemorrhagic Escherichia coli O157:H7 Shiga Toxins Inhibit Interferon-gamma Mediated Cellular Activation. Infect Immun.
Ho, T.D., Davis, B.M., Ritchie, J.M., and Waldor, M.K. (2008). Type 2 secretion promotes enterohemorrhagic Escherichia coli adherence and intestinal colonization. Infect Immun 76, 1858-1865.
Holmes, A., Muhlen, S., Roe, A.J., and Dean, P. (2010). The EspF effector, a bacterial pathogen's Swiss army knife. Infect Immun 78, 4445-4453.
Hooper, L.V., and Macpherson, A.J. (2010). Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol 10, 159-169.
Huang, A., de Grandis, S., Friesen, J., Karmali, M., Petric, M., Congi, R., and Brunton, J.L. (1986). Cloning and expression of the genes specifying Shiga-like toxin production in Escherichia coli H19. J Bacteriol 166, 375-379.
Huibregtse, I.L., Snoeck, V., de Creus, A., Braat, H., De Jong, E.C., Van Deventer, S.J., and Rottiers, P. (2007). Induction of ovalbumin-specific tolerance by oral administration of Lactococcus lactis secreting ovalbumin. Gastroenterology 133, 517-528.
Hussain, S., Zwilling, B.S., and Lafuse, W.P. (1999). Mycobacterium avium infection of mouse macrophages inhibits IFN-gamma Janus kinase-STAT signaling and gene induction by down-regulation of the IFN-gamma receptor. J Immunol 163, 2041-2048.
Ide, T., Laarmann, S., Greune, L., Schillers, H., Oberleithner, H., and Schmidt, M.A. (2001). Characterization of translocation pores inserted into plasma membranes by type III-secreted Esp proteins of enteropathogenic Escherichia coli. Cell Microbiol 3, 669-679.
145
Imamovic, L., Jofre, J., Schmidt, H., Serra-Moreno, R., and Muniesa, M. (2009). Phage-mediated Shiga toxin 2 gene transfer in food and water. Appl Environ Microbiol 75, 1764-1768.
Islam, M.S., and Stimson, W.H. (1990). Production and characterization of monoclonal antibodies with therapeutic potential against Shiga toxin. J Clin Lab Immunol 33, 11-16.
Jandu, N., Ceponis, P.J., Kato, S., Riff, J.D., McKay, D.M., and Sherman, P.M. (2006). Conditioned medium from enterohemorrhagic Escherichia coli-infected T84 cells inhibits signal transducer and activator of transcription 1 activation by gamma interferon. Infect Immun 74, 1809-1818.
Jandu, N., Ho, N.K., Donato, K.A., Karmali, M.A., Mascarenhas, M., Duffy, S.P., Tailor, C., and Sherman, P.M. (2009a). Enterohemorrhagic Escherichia coli O157:H7 gene expression profiling in response to growth in the presence of host epithelia. PLoS One 4, e4889.
Jandu, N., Shen, S., Wickham, M.E., Prajapati, R., Finlay, B.B., Karmali, M.A., and Sherman, P.M. (2007). Multiple seropathotypes of verotoxin-producing Escherichia coli (VTEC) disrupt interferon-gamma-induced tyrosine phosphorylation of signal transducer and activator of transcription (Stat)-1. Microb Pathog 42, 62-71.
Jandu, N., Zeng, Z.J., Johnson-Henry, K.C., and Sherman, P.M. (2009b). Probiotics prevent enterohaemorrhagic Escherichia coli O157:H7-mediated inhibition of interferon-gamma-induced tyrosine phosphorylation of STAT-1. Microbiology 155, 531-540.
Jelacic, J.K., Damrow, T., Chen, G.S., Jelacic, S., Bielaszewska, M., Ciol, M., Carvalho, H.M., Melton-Celsa, A.R., O'Brien, A.D., and Tarr, P.I. (2003). Shiga toxin-producing Escherichia coli in Montana: bacterial genotypes and clinical profiles. J Infect Dis 188, 719-729.
Jenkins, C., Evans, J., Chart, H., Willshaw, G.A., and Frankel, G. (2008). Escherichia coli serogroup O26--a new look at an old adversary. J Appl Microbiol 104, 14-25.
Johnson-Henry, K.C., Hagen, K.E., Gordonpour, M., Tompkins, T.A., and Sherman, P.M. (2007). Surface-layer protein extracts from Lactobacillus helveticus inhibit enterohaemorrhagic Escherichia coli O157:H7 adhesion to epithelial cells. Cell Microbiol 9, 356-367.
Jones, R.M., and Neish, A.S. (2011). Recognition of bacterial pathogens and mucosal immunity. Cell Microbiol 13, 670-676.
Kanehisa, M., and Goto, S. (2000). KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Res 28, 27-30.
Kaper, J.B., Nataro, J.P., and Mobley, H.L. (2004). Pathogenic Escherichia coli. Nat Rev Microbiol 2, 123-140.
Karch, H., Friedrich, A.W., Gerber, A., Zimmerhackl, L.B., Schmidt, M.A., and Bielaszewska, M. (2006). New aspects in the pathogenesis of enteropathic hemolytic uremic syndrome. Semin Thromb Hemost 32, 105-112.
Karch, H., Tarr, P.I., and Bielaszewska, M. (2005). Enterohaemorrhagic Escherichia coli in human medicine. Int J Med Microbiol 295, 405-418.
146
Karmali, M.A., Mascarenhas, M., Shen, S., Ziebell, K., Johnson, S., Reid-Smith, R., Isaac-Renton, J., Clark, C., Rahn, K., and Kaper, J.B. (2003). Association of genomic O island 122 of Escherichia coli EDL 933 with verocytotoxin-producing Escherichia coli seropathotypes that are linked to epidemic and/or serious disease. J Clin Microbiol 41, 4930-4940.
Karmali, M.A., Petric, M., Lim, C., Fleming, P.C., Arbus, G.S., and Lior, H. (1985). The association between idiopathic hemolytic uremic syndrome and infection by verotoxin-producing Escherichia coli. J Infect Dis 151, 775-782.
Karmali, M.A., Steele, B.T., Petric, M., and Lim, C. (1983). Sporadic cases of haemolytic-uraemic syndrome associated with faecal cytotoxin and cytotoxin-producing Escherichia coli in stools. Lancet 1, 619-620.
Kenny, B. (2001). The enterohaemorrhagic Escherichia coli (serotype O157:H7) Tir molecule is not functionally interchangeable for its enteropathogenic E. coli (serotype O127:H6) homologue. Cell Microbiol 3, 499-510.
Kim, M., Ogawa, M., Fujita, Y., Yoshikawa, Y., Nagai, T., Koyama, T., Nagai, S., Lange, A., Fassler, R., and Sasakawa, C. (2009). Bacteria hijack integrin-linked kinase to stabilize focal adhesions and block cell detachment. Nature 459, 578-582.
Kim, Y.H., and Pollack, J.R. (2009). Comparative genomic hybridization on spotted oligonucleotide microarrays. Methods Mol Biol 556, 21-32.
Konowalchuk, J., Speirs, J.I., and Stavric, S. (1977). Vero response to a cytotoxin of Escherichia coli. Infect Immun 18, 775-779.
Kuijper, E.J., Soonawala, D., Vermont, C., and van Dissel, J.T. (2011). Household transmission of haemolytic uraemic syndrome associated with Escherichia coli O104:H4 in the Netherlands, May 2011. Euro Surveill 16.
Kurushima, J., Nagai, T., Nagamatsu, K., and Abe, A. (2010). EspJ effector in enterohemorrhagic E. coli translocates into host mitochondria via an atypical mitochondrial targeting signal. Microbiol Immunol 54, 371-379.
Kyle, J.L., Cummings, C.A., Parker, C.T., Quinones, B., Vatta, P., Newton, E., Huynh, S., Swimley, M., Degoricija, L., Barker, M., et al. (2012). Escherichia coli serotype O55:H7 diversity supports parallel acquisition of bacteriophage at Shiga toxin phage insertion sites during evolution of the O157:H7 lineage. J Bacteriol 194, 1885-1896.
Landoni, V.I., de Campos-Nebel, M., Schierloh, P., Calatayud, C., Fernandez, G.C., Ramos, M.V., Rearte, B., Palermo, M.S., and Isturiz, M.A. (2010). Shiga toxin 1-induced inflammatory response in lipopolysaccharide-sensitized astrocytes is mediated by endogenous tumor necrosis factor alpha. Infect Immun 78, 1193-1201.
Lapeyraque, A.L., Malina, M., Fremeaux-Bacchi, V., Boppel, T., Kirschfink, M., Oualha, M., Proulx, F., Clermont, M.J., Le Deist, F., Niaudet, P., et al. (2011). Eculizumab in severe Shiga-toxin-associated HUS. N Engl J Med 364, 2561-2563.
147
Lathem, W.W., Grys, T.E., Witowski, S.E., Torres, A.G., Kaper, J.B., Tarr, P.I., and Welch, R.A. (2002). StcE, a metalloprotease secreted by Escherichia coli O157:H7, specifically cleaves C1 esterase inhibitor. Mol Microbiol 45, 277-288.
Levine, M.M. (1987). Escherichia coli that cause diarrhea: enterotoxigenic, enteropathogenic, enteroinvasive, enterohemorrhagic, and enteroadherent. J Infect Dis 155, 377-389.
Levy, D.E., and Darnell, J.E., Jr. (2002). Stats: transcriptional control and biological impact. Nat Rev Mol Cell Biol 3, 651-662.
Lim, J.Y., Yoon, J., and Hovde, C.J. (2010). A brief overview of Escherichia coli O157:H7 and its plasmid O157. J Microbiol Biotechnol 20, 5-14.
Lingwood, C.A. (1996). Role of verotoxin receptors in pathogenesis. Trends Microbiol 4, 147-153.
Lingwood, C.A., Law, H., Richardson, S., Petric, M., Brunton, J.L., De Grandis, S., and Karmali, M. (1987). Glycolipid binding of purified and recombinant Escherichia coli produced verotoxin in vitro. J Biol Chem 262, 8834-8839.
Long, K.Z., Rosado, J.L., Santos, J.I., Haas, M., Al Mamun, A., DuPont, H.L., Nanthakumar, N.N., and Estrada-Garcia, T. (2010). Associations between mucosal innate and adaptive immune responses and resolution of diarrheal pathogen infections. Infect Immun 78, 1221-1228.
Lukjancenko, O., Wassenaar, T.M., and Ussery, D.W. (2010). Comparison of 61 sequenced Escherichia coli genomes. Microb Ecol 60, 708-720.
Maki, D.G. (2006). Don't eat the spinach--controlling foodborne infectious disease. N Engl J Med 355, 1952-1955.
Maluykova, I., Gutsal, O., Laiko, M., Kane, A., Donowitz, M., and Kovbasnjuk, O. (2008). Latrunculin B facilitates Shiga toxin 1 transcellular transcytosis across T84 intestinal epithelial cells. Biochim Biophys Acta 1782, 370-377.
Mann, B.A., Huang, J.H., Li, P., Chang, H.C., Slee, R.B., O'Sullivan, A., Anita, M., Yeh, N., Klemsz, M.J., Brutkiewicz, R.R., et al. (2008). Vaccinia virus blocks Stat1-dependent and Stat1-independent gene expression induced by type I and type II interferons. J Interferon Cytokine Res 28, 367-380.
Mao, X., and Chen, X. (2005). Crystallization and X-ray crystallographic analysis of human STAT1. Acta Crystallogr Sect F Struct Biol Cryst Commun 61, 666-668.
Marquis, J.F., Nantel, A., LaCourse, R., Ryan, L., North, R.J., and Gros, P. (2008). Fibrotic response as a distinguishing feature of resistance and susceptibility to pulmonary infection with Mycobacterium tuberculosis in mice. Infect Immun 76, 78-88.
Marshall, J.K., Thabane, M., Garg, A.X., Clark, W.F., Moayyedi, P., and Collins, S.M. (2010). Eight year prognosis of postinfectious irritable bowel syndrome following waterborne bacterial dysentery. Gut 59, 605-611.
148
Marshall, J.K., Thabane, M., Garg, A.X., Clark, W.F., Salvadori, M., and Collins, S.M. (2006). Incidence and epidemiology of irritable bowel syndrome after a large waterborne outbreak of bacterial dysentery. Gastroenterology 131, 445-450; quiz 660.
Martinez, E., Schroeder, G.N., Berger, C.N., Lee, S.F., Robinson, K.S., Badea, L., Simpson, N., Hall, R.A., Hartland, E.L., Crepin, V.F., et al. (2010). Binding to Na(+) /H(+) exchanger regulatory factor 2 (NHERF2) affects trafficking and function of the enteropathogenic Escherichia coli type III secretion system effectors Map, EspI and NleH. Cell Microbiol 12, 1718-1731.
McBride, K.M., Banninger, G., McDonald, C., and Reich, N.C. (2002). Regulated nuclear import of the STAT1 transcription factor by direct binding of importin-alpha. EMBO J 21, 1754-1763.
Melton-Celsa, A., Mohawk, K., Teel, L., and O'Brien, A. (2012). Pathogenesis of Shiga-toxin producing Escherichia coli. Curr Top Microbiol Immunol 357, 67-103.
Misselwitz, J., Karch, H., Bielazewska, M., John, U., Ringelmann, F., Ronnefarth, G., and Patzer, L. (2003). Cluster of hemolytic-uremic syndrome caused by Shiga toxin-producing Escherichia coli O26:H11. Pediatr Infect Dis J 22, 349-354.
Miyahara, A., Nakanishi, N., Ooka, T., Hayashi, T., Sugimoto, N., and Tobe, T. (2009). Enterohemorrhagic Escherichia coli effector EspL2 induces actin microfilament aggregation through annexin 2 activation. Cell Microbiol 11, 337-350.
Molloy, M.P., Phadke, N.D., Maddock, J.R., and Andrews, P.C. (2001). Two-dimensional electrophoresis and peptide mass fingerprinting of bacterial outer membrane proteins. Electrophoresis 22, 1686-1696.
Mora, A., Blanco, J.E., Blanco, M., Alonso, M.P., Dhabi, G., Echeita, A., Gonzalez, E.A., Bernardez, M.I., and Blanco, J. (2005). Antimicrobial resistance of Shiga toxin (verotoxin)-producing Escherichia coli O157:H7 and non-O157 strains isolated from humans, cattle, sheep and food in Spain. Res Microbiol 156, 793-806.
Mora, A., Leon, S.L., Blanco, M., Blanco, J.E., Lopez, C., Dahbi, G., Echeita, A., Gonzalez, E.A., and Blanco, J. (2007). Phage types, virulence genes and PFGE profiles of Shiga toxin-producing Escherichia coli O157:H7 isolated from raw beef, soft cheese and vegetables in Lima (Peru). Int J Food Microbiol 114, 204-210.
Mukhopadhyay, S., and Linstedt, A.D. (2012). Manganese blocks intracellular trafficking of Shiga toxin and protects against Shiga toxicosis. Science 335, 332-335.
Muller, D., Benz, I., Liebchen, A., Gallitz, I., Karch, H., and Schmidt, M.A. (2009). Comparative analysis of the locus of enterocyte effacement and its flanking regions. Infect Immun 77, 3501-3513.
Muller, U., Steinhoff, U., Reis, L.F., Hemmi, S., Pavlovic, J., Zinkernagel, R.M., and Aguet, M. (1994). Functional role of type I and type II interferons in antiviral defense. Science 264, 1918-1921.
149
Nadler, C., Baruch, K., Kobi, S., Mills, E., Haviv, G., Farago, M., Alkalay, I., Bartfeld, S., Meyer, T.F., Ben-Neriah, Y., et al. (2010). The type III secretion effector NleE inhibits NF-kappaB activation. PLoS Pathog 6, e1000743.
Nandan, D., and Reiner, N.E. (1995). Attenuation of gamma interferon-induced tyrosine phosphorylation in mononuclear phagocytes infected with Leishmania donovani: selective inhibition of signaling through Janus kinases and Stat1. Infect Immun 63, 4495-4500.
O'Mahony, L., McCarthy, J., Kelly, P., Hurley, G., Luo, F., Chen, K., O'Sullivan, G.C., Kiely, B., Collins, J.K., Shanahan, F., et al. (2005). Lactobacillus and bifidobacterium in irritable bowel syndrome: symptom responses and relationship to cytokine profiles. Gastroenterology 128, 541-551.
Obrig, T.G. (2010). Escherichia coli Shiga Toxin Mechanisms of Action in Renal Disease. Toxins (Basel) 2, 2769-2794.
Orth, D., Khan, A.B., Naim, A., Grif, K., Brockmeyer, J., Karch, H., Joannidis, M., Clark, S.J., Day, A.J., Fidanzi, S., et al. (2009). Shiga toxin activates complement and binds factor H: evidence for an active role of complement in hemolytic uremic syndrome. J Immunol 182, 6394-6400.
Pak, S., Holland, N., Garnett, E.A., Mileti, E., Mahadevan, U., Beckert, R., Kanwar, B., and Heyman, M.B. (2012). Cytokine profiles in peripheral blood of children and adults with crohn disease. J Pediatr Gastroenterol Nutr 54, 769-775.
Panos, G.Z., Betsi, G.I., and Falagas, M.E. (2006). Systematic review: are antibiotics detrimental or beneficial for the treatment of patients with Escherichia coli O157:H7 infection? Aliment Pharmacol Ther 24, 731-742.
Pearson, J.S., Riedmaier, P., Marches, O., Frankel, G., and Hartland, E.L. (2011). A type III effector protease NleC from enteropathogenic Escherichia coli targets NF-kappaB for degradation. Mol Microbiol 80, 219-230.
Pedron, T., and Sansonetti, P. (2008). Commensals, bacterial pathogens and intestinal inflammation: an intriguing menage a trois. Cell Host Microbe 3, 344-347.
Peng, H., Wang, X., Barnes, P.F., Tang, H., Townsend, J.C., and Samten, B. (2011). The Mycobacterium tuberculosis early secreted antigenic target of 6 kDa inhibits T cell interferon-gamma production through the p38 mitogen-activated protein kinase pathway. J Biol Chem 286, 24508-24518.
Peterson, M.D., and Mooseker, M.S. (1992). Characterization of the enterocyte-like brush border cytoskeleton of the C2BBe clones of the human intestinal cell line, Caco-2. J Cell Sci 102 ( Pt 3), 581-600.
Philpott, D.J., McKay, D.M., Sherman, P.M., and Perdue, M.H. (1996). Infection of T84 cells with enteropathogenic Escherichia coli alters barrier and transport functions. Am J Physiol 270, G634-645.
150
Rasko, D.A., Webster, D.R., Sahl, J.W., Bashir, A., Boisen, N., Scheutz, F., Paxinos, E.E., Sebra, R., Chin, C.S., Iliopoulos, D., et al. (2011). Origins of the E. coli strain causing an outbreak of hemolytic-uremic syndrome in Germany. N Engl J Med 365, 709-717.
Renauld, J.C. (2003). Class II cytokine receptors and their ligands: key antiviral and inflammatory modulators. Nat Rev Immunol 3, 667-676.
Resta-Lenert, S., and Barrett, K.E. (2006). Probiotics and commensals reverse TNF-alpha- and IFN-gamma-induced dysfunction in human intestinal epithelial cells. Gastroenterology 130, 731-746.
Rietschel, E.T., and Brade, H. (1992). Bacterial endotoxins. Sci Am 267, 54-61.
Rietschel, E.T., Kirikae, T., Schade, F.U., Ulmer, A.J., Holst, O., Brade, H., Schmidt, G., Mamat, U., Grimmecke, H.D., Kusumoto, S., et al. (1993). The chemical structure of bacterial endotoxin in relation to bioactivity. Immunobiology 187, 169-190.
Riff, J.D., Callahan, J.W., and Sherman, P.M. (2005). Cholesterol-enriched membrane microdomains are required for inducing host cell cytoskeleton rearrangements in response to attaching-effacing Escherichia coli. Infect Immun 73, 7113-7125.
Riley, L.W., Remis, R.S., Helgerson, S.D., McGee, H.B., Wells, J.G., Davis, B.R., Hebert, R.J., Olcott, E.S., Johnson, L.M., Hargrett, N.T., et al. (1983). Hemorrhagic colitis associated with a rare Escherichia coli serotype. N Engl J Med 308, 681-685.
Rodrigues, D.M., Sousa, A.J., Johnson-Henry, K.C., Sherman, P.M., and Gareau, M.G. (2012). Probiotics Are Effective for the Prevention and Treatment of Citrobacter rodentium-Induced Colitis in Mice. J Infect Dis 206, 99-109.
Saeed, A.I., Sharov, V., White, J., Li, J., Liang, W., Bhagabati, N., Braisted, J., Klapa, M., Currier, T., Thiagarajan, M., et al. (2003). TM4: a free, open-source system for microarray data management and analysis. Biotechniques 34, 374-378.
Saha, B., Jyothi Prasanna, S., Chandrasekar, B., and Nandi, D. (2010). Gene modulation and immunoregulatory roles of interferon gamma. Cytokine 50, 1-14.
Saleh, M. (2011). The machinery of Nod-like receptors: refining the paths to immunity and cell death. Immunol Rev 243, 235-246.
Schmidt, H., Henkel, B., and Karch, H. (1997). A gene cluster closely related to type II secretion pathway operons of Gram-negative bacteria is located on the large plasmid of enterohemorrhagic Escherichia coli O157 strains. FEMS Microbiol Lett 148, 265-272.
Schmidt, H., Karch, H., and Beutin, L. (1994). The large-sized plasmids of enterohemorrhagic Escherichia coli O157 strains encode hemolysins which are presumably members of the E. coli alpha-hemolysin family. FEMS Microbiol Lett 117, 189-196.
Schmidt, M.A. (2010). LEEways: tales of EPEC, ATEC and EHEC. Cell Microbiol 12, 1544-1552.
151
Schroder, K., Hertzog, P.J., Ravasi, T., and Hume, D.A. (2004). Interferon-gamma: an overview of signals, mechanisms and functions. J Leukoc Biol 75, 163-189.
Schuller, S., Heuschkel, R., Torrente, F., Kaper, J.B., and Phillips, A.D. (2007). Shiga toxin binding in normal and inflamed human intestinal mucosa. Microbes Infect 9, 35-39.
Schuster, C.J., Ellis, A.G., Robertson, W.J., Charron, D.F., Aramini, J.J., Marshall, B.J., and Medeiros, D.T. (2005). Infectious disease outbreaks related to drinking water in Canada, 1974-2001. Can J Public Health 96, 254-258.
Selyunin, A.S., Sutton, S.E., Weigele, B.A., Reddick, L.E., Orchard, R.C., Bresson, S.M., Tomchick, D.R., and Alto, N.M. (2011). The assembly of a GTPase-kinase signalling complex by a bacterial catalytic scaffold. Nature 469, 107-111.
Serna, A.t., and Boedeker, E.C. (2008). Pathogenesis and treatment of Shiga toxin-producing Escherichia coli infections. Curr Opin Gastroenterol 24, 38-47.
Seth, A., Yan, F., Polk, D.B., and Rao, R.K. (2008). Probiotics ameliorate the hydrogen peroxide-induced epithelial barrier disruption by a PKC- and MAP kinase-dependent mechanism. Am J Physiol Gastrointest Liver Physiol 294, G1060-1069.
Shames, S.R., Deng, W., Guttman, J.A., de Hoog, C.L., Li, Y., Hardwidge, P.R., Sham, H.P., Vallance, B.A., Foster, L.J., and Finlay, B.B. (2010). The pathogenic E. coli type III effector EspZ interacts with host CD98 and facilitates host cell prosurvival signalling. Cell Microbiol 12, 1322-1339.
Shang, L., Fukata, M., Thirunarayanan, N., Martin, A.P., Arnaboldi, P., Maussang, D., Berin, C., Unkeless, J.C., Mayer, L., Abreu, M.T., et al. (2008). Toll-like receptor signaling in small intestinal epithelium promotes B-cell recruitment and IgA production in lamina propria. Gastroenterology 135, 529-538.
Shea-Donohue, T., Fasano, A., Smith, A., and Zhao, A. (2010). Enteric pathogens and gut function: Role of cytokines and STATs. Gut Microbes 1, 316-324.
Sherman, P.M., Johnson-Henry, K.C., Yeung, H.P., Ngo, P.S., Goulet, J., and Tompkins, T.A. (2005). Probiotics reduce enterohemorrhagic Escherichia coli O157:H7- and enteropathogenic E. coli O127:H6-induced changes in polarized T84 epithelial cell monolayers by reducing bacterial adhesion and cytoskeletal rearrangements. Infect Immun 73, 5183-5188.
Sherman, P.M., Ossa, J.C., and Johnson-Henry, K. (2009). Unraveling mechanisms of action of probiotics. Nutr Clin Pract 24, 10-14.
Slavicek, J., Puretic, Z., Novak, M., Sarnavka, V., Benjak, V., Glavas-Boras, S., and Thune, S. (1995). The role of plasma exchange in the treatment of severe forms of hemolytic-uremic syndrome in childhood. Artif Organs 19, 506-510.
Spears, K.J., Roe, A.J., and Gally, D.L. (2006). A comparison of enteropathogenic and enterohaemorrhagic Escherichia coli pathogenesis. FEMS Microbiol Lett 255, 187-202.
152
Stark, G.R., and Darnell, J.E., Jr. (2012). The JAK-STAT Pathway at Twenty. Immunity 36, 503-514.
Stoiber, D., Stockinger, S., Steinlein, P., Kovarik, J., and Decker, T. (2001). Listeria monocytogenes modulates macrophage cytokine responses through STAT serine phosphorylation and the induction of suppressor of cytokine signaling 3. J Immunol 166, 466-472.
Tarr, P.I., Sadler, J.E., Chandler, W.L., George, J.N., and Tsai, H.M. (2012). Should all adult patients with diarrhoea-associated HUS receive plasma exchange? Lancet 379, 516; author reply 516-517.
Tatsuno, I., Horie, M., Abe, H., Miki, T., Makino, K., Shinagawa, H., Taguchi, H., Kamiya, S., Hayashi, T., and Sasakawa, C. (2001). toxB gene on pO157 of enterohemorrhagic Escherichia coli O157:H7 is required for full epithelial cell adherence phenotype. Infect Immun 69, 6660-6669.
Tatsuno, I., Kimura, H., Okutani, A., Kanamaru, K., Abe, H., Nagai, S., Makino, K., Shinagawa, H., Yoshida, M., Sato, K., et al. (2000). Isolation and characterization of mini-Tn5Km2 insertion mutants of enterohemorrhagic Escherichia coli O157:H7 deficient in adherence to Caco-2 cells. Infect Immun 68, 5943-5952.
Taylor, S., Wakem, M., Dijkman, G., Alsarraj, M., and Nguyen, M. (2010). A practical approach to RT-qPCR-Publishing data that conform to the MIQE guidelines. Methods 50, S1-5.
Tesh, V.L., Burris, J.A., Owens, J.W., Gordon, V.M., Wadolkowski, E.A., O'Brien, A.D., and Samuel, J.E. (1993). Comparison of the relative toxicities of Shiga-like toxins type I and type II for mice. Infect Immun 61, 3392-3402.
Tesh, V.L., Ramegowda, B., and Samuel, J.E. (1994). Purified Shiga-like toxins induce expression of proinflammatory cytokines from murine peritoneal macrophages. Infect Immun 62, 5085-5094.
Thanabalasuriar, A., Koutsouris, A., Weflen, A., Mimee, M., Hecht, G., and Gruenheid, S. (2010). The bacterial virulence factor NleA is required for the disruption of intestinal tight junctions by enteropathogenic Escherichia coli. Cell Microbiol 12, 31-41.
Thurman, J.M., Marians, R., Emlen, W., Wood, S., Smith, C., Akana, H., Holers, V.M., Lesser, M., Kline, M., Hoffman, C., et al. (2009). Alternative pathway of complement in children with diarrhea-associated hemolytic uremic syndrome. Clin J Am Soc Nephrol 4, 1920-1924.
Tien, M.T., Girardin, S.E., Regnault, B., Le Bourhis, L., Dillies, M.A., Coppee, J.Y., Bourdet-Sicard, R., Sansonetti, P.J., and Pedron, T. (2006). Anti-inflammatory effect of Lactobacillus casei on Shigella-infected human intestinal epithelial cells. J Immunol 176, 1228-1237.
Trachtman, H., Cnaan, A., Christen, E., Gibbs, K., Zhao, S., Acheson, D.W., Weiss, R., Kaskel, F.J., Spitzer, A., and Hirschman, G.H. (2003). Effect of an oral Shiga toxin-binding agent on diarrhea-associated hemolytic uremic syndrome in children: a randomized controlled trial. JAMA 290, 1337-1344.
153
Trinchieri, G., and Sher, A. (2007). Cooperation of Toll-like receptor signals in innate immune defence. Nat Rev Immunol 7, 179-190.
Uetani, K., Hiroi, M., Meguro, T., Ogawa, H., Kamisako, T., Ohmori, Y., and Erzurum, S.C. (2008). Influenza A virus abrogates IFN-gamma response in respiratory epithelial cells by disruption of the Jak/Stat pathway. Eur J Immunol 38, 1559-1573.
Vallance, B.A., Deng, W., De Grado, M., Chan, C., Jacobson, K., and Finlay, B.B. (2002). Modulation of inducible nitric oxide synthase expression by the attaching and effacing bacterial pathogen citrobacter rodentium in infected mice. Infect Immun 70, 6424-6435.
Vingadassalom, D., Campellone, K.G., Brady, M.J., Skehan, B., Battle, S.E., Robbins, D., Kapoor, A., Hecht, G., Snapper, S.B., and Leong, J.M. (2010). Enterohemorrhagic E. coli requires N-WASP for efficient type III translocation but not for EspFU-mediated actin pedestal formation. PLoS Pathog 6, e1001056.
Vingadassalom, D., Kazlauskas, A., Skehan, B., Cheng, H.C., Magoun, L., Robbins, D., Rosen, M.K., Saksela, K., and Leong, J.M. (2009). Insulin receptor tyrosine kinase substrate links the E. coli O157:H7 actin assembly effectors Tir and EspF(U) during pedestal formation. Proc Natl Acad Sci U S A 106, 6754-6759.
Walterspiel, J.N., Ashkenazi, S., Morrow, A.L., and Cleary, T.G. (1992). Effect of subinhibitory concentrations of antibiotics on extracellular Shiga-like toxin I. Infection 20, 25-29.
Wan, F., Weaver, A., Gao, X., Bern, M., Hardwidge, P.R., and Lenardo, M.J. (2011). IKKbeta phosphorylation regulates RPS3 nuclear translocation and NF-kappaB function during infection with Escherichia coli strain O157:H7. Nat Immunol 12, 335-343.
Werber, D., Krause, G., Frank, C., Fruth, A., Flieger, A., Mielke, M., Schaade, L., and Stark, K. (2012). Outbreaks of virulent diarrheagenic Escherichia coli - are we in control? BMC Med 10, 11.
Wine, E., Gareau, M.G., Johnson-Henry, K., and Sherman, P.M. (2009). Strain-specific probiotic (Lactobacillus helveticus) inhibition of Campylobacter jejuni invasion of human intestinal epithelial cells. FEMS Microbiol Lett 300, 146-152.
Wong, A.R., Pearson, J.S., Bright, M.D., Munera, D., Robinson, K.S., Lee, S.F., Frankel, G., and Hartland, E.L. (2011). Enteropathogenic and enterohaemorrhagic Escherichia coli: even more subversive elements. Mol Microbiol 80, 1420-1438.
Wong, C.S., Jelacic, S., Habeeb, R.L., Watkins, S.L., and Tarr, P.I. (2000). The risk of the hemolytic-uremic syndrome after antibiotic treatment of Escherichia coli O157:H7 infections. N Engl J Med 342, 1930-1936.
Wu, B., Skarina, T., Yee, A., Jobin, M.C., Dileo, R., Semesi, A., Fares, C., Lemak, A., Coombes, B.K., Arrowsmith, C.H., et al. (2010). NleG Type 3 effectors from enterohaemorrhagic Escherichia coli are U-Box E3 ubiquitin ligases. PLoS Pathog 6, e1000960.
Zhang, S.Y., Boisson-Dupuis, S., Chapgier, A., Yang, K., Bustamante, J., Puel, A., Picard, C., Abel, L., Jouanguy, E., and Casanova, J.L. (2008). Inborn errors of interferon (IFN)-mediated
154
immunity in humans: insights into the respective roles of IFN-alpha/beta, IFN-gamma, and IFN-lambda in host defense. Immunol Rev 226, 29-40.
Ziebell, K., Steele, M., Zhang, Y., Benson, A., Taboada, E.N., Laing, C., McEwen, S., Ciebin, B., Johnson, R., and Gannon, V. (2008). Genotypic characterization and prevalence of virulence factors among Canadian Escherichia coli O157:H7 strains. Appl Environ Microbiol 74, 4314-4323.