Identifying Mechanisms by which Escherichia coli O157:H7 ......Identifying Mechanisms by which Escherichia coli O157:H7 ... host defense against microbial pathogens. The aim of this

Identifying Mechanisms by which Escherichia coli O157:H7 Subverts Interferon-gamma Mediated Signal Transducer and Activator of Transcription-1 Activation

by

Nathan Koul-Lin Ho

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Laboratory Medicine and Pathobiology

University of Toronto

© Copyright by Nathan Koul-Lin Ho 2012

ii

Identifying Mechanisms by which Escherichia coli O157:H7

Subverts Interferon-gamma Mediated Signal Transducer and

Activator of Transcription-1 Activation

Nathan Koul-Lin Ho

Doctor of Philosophy

Laboratory Medicine and Pathobiology University of Toronto

2012

Abstract Enterohemorrhagic Escherichia coli (EHEC) serotype O157:H7 is a foodborne pathogen that

causes significant morbidity and mortality in developing and industrialized nations. EHEC

infection of host epithelial cells is capable of inhibiting the interferon gamma (IFNγ) pro-

inflammatory pathway through the inhibition of Stat-1 phosphorylation, which is important for

host defense against microbial pathogens. The aim of this thesis was to determine the bacterial

factors involved in the inhibition of Stat-1 tyrosine phosphorylation. Human HEp-2 and Caco-2

epithelial cells were challenged directly with either EHEC or bacterial culture supernatants,

stimulated with IFNγ, and then protein extracts were analyzed by immunoblotting. The data

showed that IFNγ-mediated Stat-1 tyrosine phosphorylation was inhibited by EHEC secreted

proteins. Using 2D-Difference Gel Electrophoresis, EHEC Shiga toxins were identified as

candidate inhibitory factors. EHEC Shiga toxin mutants were then generated, complemented in

trans, and mutant culture supernatant was supplemented with purified Stx to confirm their ability

to subvert IFNγ-mediated cell activation. I conclude that E. coli-derived Shiga toxins represent a

novel mechanism by which EHEC evades the host immune system.

iii

Acknowledgements This thesis is dedicated my family, friends, and colleagues who have supported me through this

PhD journey. You all know who you are, and how you have contributed to my life in and outside

of the laboratory. I would not have been able to progress this far as a person without every one of

you, and I thank you all from the bottom of my heart.

Family Millie Ho Desmond Ho Serena Park-Ho Grandma Stanley Ho Eric Ho Connie Ho Kimberley Ho Hillary Ho Eddy Ho Jocelyn Ho Julius Ho Elizabeth Ho Kiara Ho Raymond Chan Anne Chan Chloe Chan Ellie Chan Sherman Group Philip Sherman Kathene Johnson-Henry Melanie Gareau Eytan Wine Juan Ossa Kevin Donato Grace Shen-Tu David Rodrigues Andrew Sousa Robert Lorentz Steve Hawley

Linköping Group Johan Söderholm Anders Carlsson Linda Gerdin Åsa Keita Ylva Braaf Maria Jönsson Cellsignals Group Richard Ellen Najib Yourish Science Rendezvous Lauren Kilgour Linda Vong Songyi Xu Ron Ammar Christopher Smith Gladys Wong Robert Lorentz Grace Shen-Tu Claire Scherzinger Yifang Liu Steve Hawley Gursonika Binepal Iwona Wenderska Kamna Singh Maher Bourbia Maisha Syeda Kelly Thickett Cherry Leung Kelsey Miller

LSCDS Group Chan-mi Lee SickKids Administration Margaret Johnson Suzanne Shek UofT Staff and Administrators Ian Crandall Martha Brown Ken Greaves Raul Cunha Peter Hurley Elissa Strome Emanuel Istrate Cynthia Goh Dwayne Miller CIHR Administrator Mary-Jo Makarchuk

Linda Vong

iv

Table of Contents Title Page ......................................................................................................................................... i

Abstract ........................................................................................................................................... ii

Acknowledgements ........................................................................................................................ iii

Table of Contents ........................................................................................................................... iv

Dissemination of Work Arising from this Thesis .......................................................................... vi

List of Tables ............................................................................................................................... viii

List of Figures ................................................................................................................................ ix

Chapter 1: Introduction ................................................................................................................1

1.1 Epidemiology of E. coli O157:H7 (EHEC) .........................................................................4

1.2 Evolution of E. coli O157:H7 ..............................................................................................8

1.3 Virulence Factors of E. coli O157:H7 .................................................................................8

1.3.1 Shiga toxins ............................................................................................................11

1.3.2 Locus of Enterocyte Effacement Pathogenicity Island (LEE PAI) and the Type 3 Secretion System (T3SS) ....................................................................................12

1.3.3 Escherichia coli O157:H7 pO157 plasmid ............................................................16

1.4 Innate immune responses to EHEC O157:H7 infection ....................................................18

1.4.1 Interferons and the Interferon-gamma (IFNγ) Pathway .........................................18

1.4.2 Health Implications Arising from Defects in IFNγ Signaling ...............................24

1.4.3 Pathogen Inhibition of the IFNγ Signaling Pathway .............................................24

1.5 Management of EHEC Infections ......................................................................................25

1.6 Probiotics ...........................................................................................................................26

1.7 Summary ............................................................................................................................28

Chapter 2: Hypothesis and Objectives .......................................................................................29

Chapter 3: Identifying Mechanisms by which Escherichia coli O157:H7 Subverts Interferon-γ Mediated Signal Transducer and Activator of Transcription-1 Activation ............................................................................................................30

v

3.1 ABSTRACT ........................................................................................................................31

3.2 INTRODUCTION ..............................................................................................................32

3.3 MATERIALS AND METHODS ........................................................................................33

3.4 RESULTS ...........................................................................................................................39

3.5 DISCUSSION .....................................................................................................................54

3.6 ACKNOWLEDGEMENTS ................................................................................................58

Chapter 4: Enterohemorrhagic Escherichia coli O157:H7 Shiga Toxins Inhibit Interferon-gamma Mediated Cellular Activation .............................................59

4.1 ABSTRACT ........................................................................................................................60

4.2 INTRODUCTION ...............................................................................................................61


4.4 RESULTS ............................................................................................................................73

4.5 DISCUSSION .....................................................................................................................88

4.6 ACKNOWLEDGEMENTS ................................................................................................92

Chapter 5: Immune Signaling Responses in Intestinal Epithelial Cells Exposed to Pathogenic Escherichia coli and Lactic Acid-Producing Probiotics .................93

5.1 ABSTRACT ........................................................................................................................94

5.2 INTRODUCTION ...............................................................................................................95


5.4 RESULTS ..........................................................................................................................100

5.5 DISCUSSION ...................................................................................................................127

5.6 ACKNOWLEDGEMENTS ..............................................................................................128

Chapter 6: Discussion, Future Directions, and Significance ..................................................129

6.1 DISCUSSION ...................................................................................................................130

6.2 FUTURE DIRECTIONS ...................................................................................................135

6.3 SIGNIFICANCE ...............................................................................................................137

References ....................................................................................................................................138

vi

Dissemination of Work Arising from this Thesis Publications:

Ho NK, Crandall I, Sherman PM (2012) Identifying Mechanisms by which Escherichia coli

O157:H7 Subverts Interferon-γ Mediated Signal Transducer and Activator of

Transcription-1 Activation. PLoS ONE. 4(1):e30145.

Ho NK, Ossa JC, Silphaduang U, Johnson R, Johnson-Henry KC, Sherman PM (2012)

Enterohemorrhagic Escherichia coli O157:H7 Shiga Toxins Inhibit Interferon-gamma

Mediated Cellular Activation. Infect Immun. 80(7):2307-15.

Ho NK, Ossa JC, Hawley S, Mathieu O, Tompkins TA, Johnson-Henry KC, Sherman PM.

Immune Signaling Responses in Intestinal Epithelial cells Exposed to Pathogenic

Escherichia coli and Lactic Acid-Producing Probiotics. Manuscript accepted pending

revision. Journal of Beneficial Microbes

Other publications arising from this work

Jandu N, Ho NK, Donato K, Karmali M, Mascarenhas M, Duffy S. P, Tailor C, Sherman PM,

(2009) Enterohemorrhagic Escherichia coli O157:H7 gene expression profiling in

response to growth in the presence of host epithelia. PLoS One. 4(3):e4889.

Gareau MG, Ho NK, Brenner D, Sousa AJ, LeBourhis L, Mak TW, Girardin SE, Philpott DJ,

Sherman PM, (2011) Enterohemorrhagic, but not enteropathogenic, Escherichia coli

infection of epithelial cells disrupts signaling responses to tumor necross factor-alpha.

Microbiology. 157:2963-2973.

Ossa JC, Ho NK, Wine E, Leung N, Gray-Owen SD, Sherman PM, (2012) Adherent-Invasive

Escherichia coli Blocks Interferon-Gamma Induced Signal Transducer and Activation of

Transcription (STAT)-1 in Human Intestinal Epithelial Cells. Cellular Microbiology.

Under second review. Cellular Microbiology.

vii

Oral Presentations:

Ho N, Sherman PM. (2011) Bacterial subversion of host signaling: How Escherichia coli

O157:H7 suppresses Interferon-gamma mediated Stat-1 phosphorylation. The Hospital

for Sick Children Cell Biology Research Day. Old Mill Inn, Toronto.

Ho N, Sherman PM. (2011) Ph.D. training in the Life Sciences. Cellsignals CIHR Strategic

Training Initiative in Health Research. Old Mill Inn, Toronto.

Ho N, Crandall I, Sherman PM. (2011) Defining mechanisms by which Escherichia coli

O157:H7 subverts Interferon-γ mediated host epithelial cell activation. Cellsignals

Webinar.

Ho N, Crandall I, Sherman PM. (2010) Elucidating the Mechanisms by which Escherichia coli

O157:H7 subverts Interferon-γ mediated cell activation. Farncombe-Toronto Research

Day. Toronto, Canada

Ho N (2010) International Relations in Health Research Training. The Gastro-Intestinal Mucosal

Inflammation and Infection Centre Research Program. Linköping, Sweden.

http://vimeo.com/15525784

Ho N, Sherman PM. (2010) Elucidating the Mechanisms by which Escherichia coli O157:H7

subverts Interferon-γ mediated cell activation. Annual Regenerative Medicine

Symposium. CIHR Training Program in Regenerative Medicine. Toronto, Canada.

Ho N, Sherman PM. (2009) Defining mechanisms by which Escherichia coli O157:H7 subverts

host epithelial cell activation of signal transducers and activators of transcription (Stat)-1

by Interferon-γ. Research Topics in GI Disease IX. The Canadian Association of

Gastroenterology. King City, Ontario, Canada.

viii

List of Tables Chapter 1: Introduction

Table 1.1: Clinical and epidemiological characteristics of pathogenic Escherichia coli ... 2

Table 1.2: Shiga Toxin producing E. coli (STEC) seropathotype classification ................ 7

Table 1.3: LEE and non-LEE encoded EHEC virulence factors ...................................... 14

Table 1.4: pO157 encoded virulence factors .................................................................... 17

Table 1.5: STAT proteins, triggering factors, and association functions ......................... 21

Chapter 3: Identifying Mechanisms by which Escherichia coli O157:H7 Subverts

Interferon-γ Mediated Signal Transducer and Activator of Transcription-1

Activation

Table 3.1: Primers employed in this study ........................................................................ 37

Chapter 4: Enterohemorrhagic Escherichia coli O157:H7 Shiga Toxins Inhibit Interferon-

gamma Mediated Cellular Activation

Table 4.1: Primers employed in this study ........................................................................ 64

Table 4.2: List of bacterial strains and plasmids used in this study .................................. 82

Table 4.3: Quantification of Stx1 and Stx2 present in culture supernatants. .................... 87

Chapter 5: Immune Signaling Responses in Intestinal Epithelial Cells Exposed to

Pathogenic Escherichia coli and Lactic Acid-Producing Probiotics

Table 5.1: Genes modified significantly in the ImmuneArray analysis ......................... 103

Table 5.2: Primer pairs used in the qRT-PCR analysis. ................................................. 117

ix

List of Figures Chapter 1: Introduction

Figure 1.1: A brief overview of E. coli O157:H7 pathogenesis. ........................................ 9

Figure 1.2: The IFNγ signaling pathway. ......................................................................... 22

Chapter 3: Identifying Mechanisms by which Escherichia coli O157:H7 Subverts

Interferon-γ Mediated Signal Transducer and Activator of Transcription-1

Activation

Figure 3.1: EHEC, but not EPEC, inhibits IFNγ mediated Stat-1 tyrosine

phosphorylation................................................................................................................. 40

Figure 3.2: Secreted factor(s) have protein qualities. ....................................................... 43

Figure 3.3: EHEC secreted inhibitory factor identified as YodA. .................................... 46

Figure 3.4: Isogenic yodA and etpD mutants inhibit Stat-1 tyrosine phosphorylation at

levels comparable tos wild-type. ...................................................................... 49

Figure 3.5: Purified YodA failed to inhibit Stat-1 tyrosine phosphorylation as well as

wild-type culture supernatant. .......................................................................... 52

Figure 3.6: EHEC LEE and pO157 are not involved in the suppression of the IFNγ

signaling pathway. ............................................................................................ 56

Chapter 4: Enterohemorrhagic Escherichia coli O157:H7 Shiga Toxins Inhibit Interferon-

gamma Mediated Cellular Activation

Figure 4.1: EHEC, but not EPEC, inhibits IFNγ-mediated Stat-1 tyrosine

phosphorylation in a non-cytotoxic manner. .................................................... 74

x

Figure 4.2: Secreted factor(s) have protein-like qualities. ................................................ 77

Figure 4.3: Comparative proteomic profiles between EHEC- and EPEC-secreted proteins

........................................................................................................................................... 80

Figure 4.4: Shiga-like toxins from EHEC suppress IFNγ-mediated activation of Stat-1 85

Figure 4.5: Infection with an EHEC StxDKO and T3SS triple mutant suppresses IFNγ

mediated Stat-1 phosphorylation comparable to the wild-type strain .............. 90

Chapter 5: Immune Signaling Responses in Intestinal Epithelial Cells Exposed to

Pathogenic Escherichia coli and Lactic Acid-Producing Probiotics

Figure 5.1: Gene expression profiles. ............................................................................ 101

Figure 5.2: Microarray and qRT-PCR analysis of Caco-2 cells infected alone, co-

incubated, or pre-incubated with probiotics and pathogens ........................... 122

Figure 5.3: qRT-PCR analysis of Caco-2 cells incubated with either probiotics or

pathogens alone, or pre-incubated with probiotics ......................................... 125

Chapter 6: Discussion, Future Directions, and Significance

Figure 6.1.1: The results of this thesis presented as a model of EHEC O157:H7

pathogenesis ................................................................................................... 133

1

Chapter 1 Introduction

Escherichia coli was first discovered in 1885 by Theodore Escherich as a Gram-negative,

facultative anaerobe, which typically inhabits the lower intestinal tract of many warm-blooded

animals. In humans, the organism is acquired as a commensal bacterium in the colon shortly

after weaning, and persists for life as part of the gut microbiota within the lumen and mucus

layer of the large intestine (Kaper et al., 2004).

Pathogenic E. coli evolved from commensal E. coli through the acquisition of multiple virulence

determinants, such as toxins, adhesins, and secreted effector proteins that modulate multiple host

responses through the acquisition of mobile virulence plasmids, phages, and pathogenicity

islands (PAI). The combined effects of different virulence factors determine the extent of E. coli

pathogenesis and the severity of human disease. Infectious strains resulting in common diseases

are grouped as pathotypes, including: adherent-invasive E. coli (AIEC), diffusely adherent E.

coli (DAEC), enteroaggregative E. coli (EAEC), enterohemorrhagic E. coli (EHEC),

enteroinvasive E. coli (EIEC), enteropathogenic E. coli (EPEC), atypical enteropathogenic

(ATEC), enterotoxigenic E. coli (ETEC), sepsis/meningitis causing E. coli (MNEC), and

uropathogenic E. coli (UPEC) Table 1.1 (Croxen and Finlay, 2010).

Within each pathotype classification, E. coli strains are further characterized by antigenic

variants including O-antigen (lipopolysaccharide), H-antigen (flagellar), and K-antigen

(capsular) types (DebRoy et al., 2011).

2

Table 1.1: Clinical and epidemiological characteristics of pathogenic Escherichia coli

Pathogen Epidemiology Clinical Symptoms Virulence Factors

Adherent-Invasive

(AIEC)

Developed countries Crohn’s Disease Adhesion and invasion

factors

Enteroaggregative

(EAEC)

Traveller’s diarrhea

in developing and

developed countries

Watery diarrhea

with mucus or

blood

Fimbriae, Cytotoxins

Enterohemorrhagic

(EHEC)

Food-borne and

water-borne

outbreaks in

developed countries

Watery diarrhea,

Hemorrhagic

colitis, Hemolytic

uremic syndrome

Shiga-like toxins

(Verotoxins), Locus of

Enterocyte Effacement

pathogenicity island (LEE

PAI), pO157 plasmid

Enteropathogenic

(EPEC)

Food-borne and

water-borne

outbreaks in

developing countries

Diarrhea EPEC adherence factor

plasmid (EAF). Locus of

Enterocyte Effacement

pathogenicity island (LEE

PAI)

Atypical

Enteropathogenic

(A-EPEC)

Food-borne and

water-borne

Diarrhea Lacks EPEC adherence

factor plasmid (EAF)

Enteroinvasive

(EIEC)/Shigella

Food-borne

outbreaks

Dysentery Cellular invasion,

Intracellular motility, Diffuse

adherence

Enterotoxigenic

(ETEC)

Childhood diarrhea

in developing

countries, traveller’s

diarrhea

Watery diarrhea Fimbriae, Heat-labile and

heat stable enterotoxins

Diffusely adhering

(DAEC)

Food-borne and

water-borne

Diarrhea in

children, urinary

Fimbriae and afrimbrial

adhesins (Afa-Dr), toxins

3

tract infections in

adults

Meningitis-

associated

(NMEC)

Neonates Meningitis K1 capsule, S fimbriae,

Cellular invasion

Uropathogenic

(UPEC)

Sexually active

women

Cystitis,

Pyelonephritis

Type I and P fimbriae,

Hemolysin, Pathogenicity

islands

(Croxen and Finlay, 2010)

4

E. coli serotype O157:H7 is the prototypical EHEC, and was first associated with hemorrhagic

colitis in 1983 in the United States (Riley et al., 1983). This pathogen was subsequently shown to

be cytotoxic towards Vero cells (African green monkey kidney cells), and was henceforth

referred to as Verocytotoxin producing E. coli (VTEC) (Karmali et al., 1985). The parallel

discovery that this pathogen produced Shiga-like toxins gave rise to the alternate name Shiga-

like toxin-producing E. coli (STEC) (Calderwood et al., 1987). This pathogen was implicated in

pediatric cases of hemolytic-uremic syndrome in 1983 at the Hospital for Sick Children in

Toronto, Canada (Karmali et al., 1983).

While VTEC and STEC describe over 200 serotypes of cytotoxin-producing E. coli ranging in

human pathogenesis from severe disease to non-pathogenic, (Levine, 1987) first coined the term

enterohemorrhagic E. coli (EHEC) to incorporate only the E. coli serotypes known to cause

hemorrhagic colitis and the hemolytic uremic syndrome (HUS), and is classically reserved for E.

coli serotypes O157:H7 and O26:H11. Despite these efforts, a conflict in naming schema for this

pathotype of E. coli remains; the term VTEC is widely used in Canada and Europe, while the

term STEC is commonly employed in the United States and Asia. For purposes of consistency,

the term EHEC will be used throughout this thesis.

1.1 Epidemiology of E. coli O157:H7 (EHEC) Although E. coli O157:H7 (EHEC) is a human pathogen responsible for numerous infectious

outbreaks worldwide, it is also a resident commensal bacterium commonly found in the intestinal

tract of ruminants such as cattle, sheep, goats, and deer (Karch et al., 2005). Human exposure to

this pathogen is classically associated with the ingestion of undercooked ground beef, but

infections can also arise following the ingestion of fecally contaminated foodstuffs such as fruits,

vegetables, drinking water, as well as person-to-person contact (Karch et al., 2005).

EHEC outbreaks are attributed to its low infectious dose (<100 organisms), and high

transmissibility, which can either remain isolated or develop into widespread international

outbreaks. Examples of EHEC outbreaks in North America include a multi-state outbreak

resulting in ~200 cases of infection following ingestion of fecally contaminated spinach from a

single commercial vendor in the fall of 2006 (Maki, 2006). The largest EHEC outbreak in

5

Canada occurred in Walkerton, Ontario in 2000 due to inadequately chlorinated drinking water,

which resulted in ~2,300 cases of infection and 7 deaths (Schuster et al., 2005).

While individuals may be asymptomatic even though EHEC is detected in stools, others can

develop severe cases of infection characterized by abdominal cramps and bloody diarrhea within

3 days of consuming the contaminated foodstuff (Melton-Celsa et al., 2012). The most severe

cases of infection typically occur in children <5 years of age, the elderly, and immune-

compromised persons. In severe cases of infection, individuals present with hemorrhagic colitis,

hemolytic-uremic syndrome (HUS is the leading cause of acute renal failure in children),

microangiopathic hemolytic anemia (fragmented erythrocytes), and thrombocytopenia (low

platelet count) (Marshall et al., 2006). Long term complications of EHEC infection include

irritable bowel syndrome (IBS), as seen with a significant number of subjects experiencing post-

infectious IBS 8 years after the Walkerton outbreak compared to those who did not experience

acute enterocolitis (15.4% vs 5.4% p<0.0001) (Marshall et al., 2010).

In North America, approximately 75,000 cases of EHEC infections are reported annually. Of

these, 10-15% of cases develop HUS, another 5-10% result in long-term complications, and 3-

5% of HUS cases are fatal (Panos et al., 2006). EHEC infections account for roughly 250 deaths

in North America each year (Serna and Boedeker, 2008).

In addition to serotype O157:H7, multiple non-O157:H7 EHEC are also a major cause of human

infections and disease outbreaks. In North America, E. coli serotype O157:H7 accounts for

roughly 75% of all EHEC infections, while non-O157:H7 EHEC account for the remaining 25%

(Andreoli et al., 2002). For example, an outbreak of EHEC O111:H8 in Texas (June 1999)

resulted in 2 cases of HUS (Jelacic et al., 2003) and an outbreak of EHEC O104:H21 in Montana

in 1994 resulted in 8 cases of hemorrhagic colitis (Brooks et al., 2005). Nonetheless, the exact

number of non-O157:H7 infections in North America is likely to be underestimated, since

serotyping techniques are rarely used in the setting of a hospital clinical microbiology laboratory

(Werber et al., 2012).

In certain parts of Europe and Australia, non-O157:H7 E. coli is the predominant cause of

infectious outbreaks. In Germany (Misselwitz et al., 2003), Denmark (Ethelberg et al., 2007),

and the UK (Jenkins et al., 2008) EHEC O26:H11 is frequently implicated in diarrhea-associated

HUS. In Belgium, EHEC serogroups O145 and O26 were implicated in an outbreak related to

6

the ingestion of contaminated ice cream (De Schrijver et al., 2008). EHEC serotype O111:H- is

the most common isolate in Australian cases of EHEC infection (Elliott et al., 2001). In

Argentina and Brazil multiple non-O157:H7 EHEC serotypes are related to infectious disease

and outbreaks of human illness (Mora et al., 2005). EHEC serogroups O103, O111, and O91 also

are commonly implicated in non-O157:H7 infections in humans (Jelacic et al., 2003; Karch et

al., 2006).

The latest non-O157 outbreak occurred in Germany in May 2011 in which sprouts were

contaminated with a Stx2 expressing enteroaggregative E. coli of the serotype O104:H4. Over

the course of 3 months, 3,800 cases of infection were reported, including 54 fatalities, and over

800 individuals developed HUS (Werber et al., 2012).

Over 200 non-O157:H7 EHEC have been documented, and are classified based on their O-

antigen, the severity of disease, and the frequency of human outbreaks caused by the organisms.

Accordingly, EHEC strains are now categorized into five seropathotypes (A-E) Table 1.2

(Karmali et al., 2003). This seropathotype classification does not take into account the virulence

properties of these organisms. EHEC, the prototypical VTEC, is grouped into the seropathotype

A, representing the most virulent and pathogenic group. EHEC strains belonging to

seropathotype B are also associated with outbreaks and human disease, though less commonly

than those of seropathotype A. Those in seropathotype C retain the potential to cause severe

human disease (HUS), but are rarely associated with clinical outbreaks. EHEC of seropathotype

D have not been associated with disease outbreaks or HUS, but can cause diarrhea. Lastly,

seropathotype E comprises those EHEC isolates only associated with colonization of animals.

7

Table 1.2: Shiga Toxin producing E. coli (STEC) seropathotype classification

Seropathotype Relative

Incidence

Involvement in

outbreaks

Associated with

Severe Disease

Serotypes

A High Common Yes O157:H7,

O157:H-

B Moderate Uncommon Yes O26:H11,

O103:H2,

O111:H-,

O121:H19,

O145:H-

C Low Rare Yes O91:H21,

O104:H21,

O113:H21

D Low Rare No Multiple

E Non-human only Not Applicable N/A Multiple

(Karmali et al., 2003)

8

1.2 Evolution of E. coli O157:H7 Enterohemorrhagic E. coli O157:H7 is believed to have evolved from enteropathogenic E. coli

O55:H7 approximately 4.5 million years ago (Feng et al., 1998). The current model proposes that

E. coli O157:H7 evolved through a series of stepwise acquisitions of genetic markers such as

Shiga toxin-encoding stx genes; the loss of phenotypic markers such as the ability to ferment

sorbitol (SOR) or β-glucuronidase (GUD) activity; and nucleotide changes in the uidA (the gene

that encodes β-glucuronidase) and fimA and fimH fimbrial genes (Kyle et al., 2012). In addition

to these changes, there was a parallel evolution of both enteropathogenic and enterohemorrhagic

within related serogroups via multiple acquisitions of the locus of enterocyte effacement

pathogenicity island (LEE PAI), the large virulence plasmids EAF and pO157, respectively, and

stx-containing lambda-like bacteriophages in the case of EHEC (Kyle et al., 2012).

1.3 Virulence Factors of E. coli O157:H7 The pathophysiology of EHEC O157:H7 infection is attributed to the effects of multiple

virulence determinants including Shiga toxins, the Locus of Enterocyte Pathogenicity island

(LEE PAI) as well as the pO157 plasmid. A brief overview of E. coli O157:H7 pathogenesis is

illustrated in Figure 1.1.

9

Figure 1.1. Diagram summarizing the common sources of E. coli O157:H7 contamination, sites

of infection within the body, and symptoms associated with colonization.

10

Figure 1.1

11

1.3.1 Shiga toxins

One of the major virulence factors attributed to EHEC pathogenesis are its Shiga toxins. The

cytotoxic effects of these toxins were first documented on Vero cells (African green monkey

kidney epithelial cells) in 1977 (Konowalchuk et al., 1977), and later confirmed in 1983 from a

patient with an E. coli O157:H7 infection and hemolytic-uremic syndrome (Karmali et al., 1983).

Subsequent studies showed that multiple E. coli serotypes elicited the same cytotoxic effects

(Karmali et al., 1985), and further studies showed that EHEC contains two Shiga toxins encoded

by bacteriophages (Stx1 and Stx2) (Obrig, 2010).

EHEC Shiga toxins are similar to the toxin found in Shigella dysenteriae; Stx1 displays 98%

sequence homology, while Stx2 shares ~55% amino acid identity (Ethelberg et al., 2004).

Despite their related primary amino acid sequences, Stx1 and Stx2 are immunologically distinct.

Stx2 is many times more potent than Stx1 in mice, demonstrating a lethal dose (LD50) that is

400-fold lower than Stx1, resulting in greater mortality and significantly increased renal damage

and toxicity (Tesh et al., 1993). Stx2 also shows greater cell toxicity towards human vascular

endothelial cells (Louise & Obrig 1995; Jacewicz 1999), and is the toxin most commonly

associated with clinical isolates (Imamovic et al., 2009; Mora et al., 2007).

EHEC Shiga toxins are AB5 type toxins, comprised of a single 30 kDa A-subunit and a pentamer

of non-covalently attached identical 7 kDa B-subunits (Fraser et al., 2004). During infection, the

toxins are expressed and located in the periplasm of the bacterium, and are secreted by EHEC

into the extracellular milieu on cell death (Obrig, 2010). Secreted toxin traverses the intestinal

cell wall via binding to the glycosphingolipid globotriosylceramide (Gb3) receptor on the surface

of Paneth cells lining the intestinal tract(Schuller et al., 2007). It should be noted that while Stx

classically enters the host cell through binding of the Gb3 receptor, there are reports that Stx can

enter Gb3 negative cells through retrograde trafficking (Maluykova et al., 2008), and can enter

kidney and brain endothelial cells through globotetraosylceramide (Gb4) surface receptors (Betz

et al., 2011). These data suggest that Gb3 may not be the sole receptor involved in Stx

pathogenesis.

Upon internalization, the A subunit dissociates from the B5 subunits and then, via retrograde

transport, traverses the Golgi stacks to the lumen of the endoplasmic reticulum (Sandvig 2004)

where it proceeds to depurinate 28S eukaryotic rRNA thereby inhibiting protein synthesis, and

12

causing cell apoptosis (Obrig, 2010). During infection, the Shiga toxins target the Gb3 receptors

on glomerular endothelial cells, podocytes, and various tubular epithelial cells in the kidney,

thereby causing kidney damage, and leading to hemolytic-uremic syndrome in 10-15% of EHEC

infections (Ethelberg et al., 2004).

1.3.2 Locus of Enterocyte Effacement Pathogenicity Island (LEE PAI) and the Type 3 Secretion System (T3SS)

Following ingestion, EHEC travels to the distal ileum and large bowel in humans where it comes

in contact with, binds intimately to, and forms actin pedestals underneath the site of attachment

with the host intestinal epithelium forming attaching and effacing (A/E) lesions. This phenotype

is afforded to EHEC by genes encoded on a 42 kb PAI known as the Locus of Enterocytes

Effacement Pathogenicity Island (LEE PAI). The LEE PAI is highly regulated and encodes a

type 3 secretion system (T3SS) that serves as a molecular syringe to translocate bacterial effector

proteins directly into the host cell cytoplasm (Croxen and Finlay, 2010; Melton-Celsa et al.,

2012).

Once EHEC comes in contact with the host epithelium, the pathogen uses the T3SS to inject at

least fifty bacterial effector proteins directly into the host cell. One of these effectors is

Translocated Intimin Receptor (Tir). Upon injection, Tir anchors itself onto the surface of the

host cell plasma membrane, and acts as a receptor for intimin, an outer membrane protein found

on the surface of the EHEC bacterium (Vingadassalom et al., 2009).

Binding of Tir to intimin triggers the indirect recruitment of another EHEC effector, EspFu,

using the host proteins IRTKS and IRSp53 as adaptors. Once this complex is formed, EspFu

binds to N-WASP (neural Wiskott-Aldrich syndrome protein), which activates the host Arp2/3

complex resulting in actin polymerization and pedestal formation (Vingadassalom et al., 2010).

Interestingly, this process differs in EPEC, where the Tir molecule is phosphorylated and recruits

the host cell protein Nck, which then binds and activates N-WASP and the Arp2/3 complex

(Campellone and Leong, 2005). In addition to experiments demonstrating that EHEC and EPEC

Tir are not functionally interchangeable (Kenny, 2001), these studies indicate that EHEC and

EPEC use slightly different mechanisms to induce actin polymerization and pedestal formation.

13

In addition to Tir and EspFu, the T3SS injects several other EHEC encoded proteins encoded by

the LEE, most of which are called E. coli secreted proteins (Esp). EspA, B, and D serve as the

structural proteins of the T3SS molecular syringe and are involved in delivery of other effectors

into the cell. Additional LEE-encoded effectors include EspG, F, H, and Map (mitochondrial

associated protein), all of which interfere with host cell signaling. The T3SS also allows for the

delivery of effectors that are not encoded within the LEE and are largely categorized as non-

LEE-encoded (Nle) effectors. The findings have highlighted the multifunctional nature of the

effectors and their ability to participate in redundant and overlapping roles in subverting host cell

processes. An overview of EHEC LEE and non-LEE effectors is presented in Table 1.3.

14

Table 1.3: LEE and non-LEE encoded EHEC virulence factors

LEE encoded

effectors

Function Reference

Tir Intimin receptor, actin pedestal formation,

downregulates Map-dependent filopodia formation,

SGLT-1 inactivation

(Vingadassalom et

al., 2009)

EspA Translocaton of effectors (Ide et al., 2001)

EspB Translocation pore component, AJ disruption, binds

myosins to inhibit phagocytosis

(Hamaguchi et al.,

2008)

EspD Translocation of effectors (Ide et al., 2001)

EspF Mitochondrial disruption, NHE3 inactivation, SGLT-1

inactivation, TJ disruption, disrupts nucleolus, disrupts

intermediate filaments, activates SNX9 to induce

membrane remodelling, binds and activates N-WASP,

inhibits PI3K-dependent phagocytosis

(Dean et al., 2010)

EspG Disrupts microtubules, blocks ARF GTPase signaling

and stimulates PAKs to inhibit endomembrane

trafficking

(Selyunin et al.,

2011)

EspH Blocks Rho GTPase signaling and FCγR-mediated

phagocytosis, promotes actin pedestal length

(Dong et al., 2010)

EspZ Enhances β1-integrin and FAK signaling to inhibit

apoptosis and cellular cytotoxicity

(Shames et al.,

2010)

Map Cdc42 GEF that induces transient filopodia formation,

mitochondrial disruption, SGLT-1 inactivation, TJ

disruption

(Martinez et al.,

2010)

Non-LEE

encoded

effectors

15

EspI/NleA Inhibits COPII-dependent protein export from ER, TJ

disruption

(Thanabalasuriar et

al., 2010)

EspJ Inhibits FCγR-mediated and CR3-mediated trans-

phagocytosis

(Kurushima et al.,

2010)

EspL Enhances F-actin bundling activity of Annexin 2 (Miyahara et al.,

2009)

EspM RhoA GEF that induces stress fibre formation (Arbeloa et al.,

2010)

EspO Unknown (Kim et al., 2009)

EspT Activates Cdc42 and Rac1 that induces membrane

ruffles and lammelipodia, promotes intracellular

bacterial uptake via trigger mechanism

(Bulgin et al., 2010)

EspV Modulates cytoskeleton (Arbeloa et al.,

2011)

NleB Inhibits TNF-induced NF-κB activation (Nadler et al., 2010)

NelC Metalloprotease that cleaves p65 (RelA), c-Rel, p50

and IκB to inhibit NF-κB activation

(Pearson et al.,

2011)

NleD Metalloprotease that cleaves JNK to inhibit AP-1

activation

(Baruch et al.,

2011)

NleE Blocks IκB degradation to inhibit NF-κB activation (Nadler et al., 2010)

NleG/NleI U-box E3 ubiquitin ligase (Wu et al., 2010)

NleH Binds Bax-inhibitor 1 to block apoptosis, sequesters

RPS3 to inhibit NF-κB signaling

(Wan et al., 2011)

EspFu/TccP Relieves N-WASP autoinhibition to trigger actin

pedestal formation

(Vingadassalom et

al., 2010)

(Wong et al., 2011)

16

1.3.3 Escherichia coli O157:H7 pO157 plasmid

E. coli O157:H7 contains a highly conserved, nonconjugative F-like plasmid, pO157 that ranges

in size between 92 to 104 kb (Caprioli et al., 2005). Sequence analysis shows a heterogeneous

mixture of genetic elements, transposons, and prophages as well as parts of other plasmids

indicating its mottled evolution (Lim et al., 2010).

The complete sequence of pO157 reveals 100 open reading frames; among them, 43 ORFs show

similarities to known proteins. Unfortunately, the role of pO157 in disease pathogenesis is not

well defined, as current studies report conflicting results of its role in vivo (Lim et al., 2010). A

summary of the proposed virulence proteins expressed by genes contained in pO157 are listed in

Table 1.4.

17

Table 1.4: pO157 encoded virulence factors

pO157 encoded

effector

Function Reference

EhxA Hemolysin (Schmidt et al., 1994)

KatP Catalase-peroxidase: Aids in EHEC colonization of

host intestine by reducing oxidative stress

(Brunder et al., 1996)

EspP Serine Protease: Cleaves pepsin A and human

coagulation factor V; contributes to mucosal

hemorrhage in HC patients

(Brunder et al., 1997)

ToxB Adhesin (Tatsuno et al., 2001)

StcE Zinc metalloprotease: Inhibits the regulation of host

inflammation pathways, complement

(Lathem et al., 2002)

T2SS Type II secretion system (Schmidt et al., 1997)

(Lim et al., 2010)

18

1.4 Innate immune responses to EHEC O157:H7 infection One of the first lines of defense against EHEC infection is through the activation of the innate

immune system, which uses pattern recognition receptors (PRRs) to detect pathogen-associated

molecular patterns (PAMPs) associated with invading microbes to elicit an immune response

(Jones and Neish, 2011). Of the many host PRR’s, Toll-like receptors (TLRs) and Nod-like

receptors (NLRs) are the principal pathogen recognition receptors involved in bacterial

recognition. TLRs are a family of membrane bound receptors which recognize specific microbial

components such as bacterial lipopolysaccharide (TLR 4) and flagellin (TLR 5) present in the

extracellular milieu (Trinchieri and Sher, 2007), while NLRs sense microbial products such as

peptidoglycan (Nod-2) in the cytoplasm of the host cell (Saleh, 2011). The activation of

leukocytes surrounding the intestine by E. coli leads to their general activation and secretion of

interleukin-12, which activates nearby macrophages, T cells, and NK T cells to secrete IFNγ

(Zhang et al., 2008). IFNγ then binds to the IFNγ receptors ubiquitously expressed in all host

cells and activates the Jak 1, 2, Stat1 signal transduction pathway to initiate an anti-microbial

state in the body (Zhang et al., 2008). As a successful human pathogen, however, E. coli

O157:H7 has evolved various mechanisms to subvert specific host innate immune responses (Ho

et al., 2012a; Ho et al., 2012b). In fact, it has been demonstrated by our laboratory previously

that all EHEC seropathotypes (Table 1.2), including the EHEC precursor (O55:H7), are capable

of suppressing the IFNγ pathway (Jandu et al., 2007).

1.4.1 Interferons and the Interferon-gamma (IFNγ) pathway

Interferons are a family of structurally related cytokines found only in vertebrates that modulate

the immune system. Interferons are categorized into 3 main types: Type I, II, and III (Stark and

Darnell, 2012). Type I interferons, of which there are 17 subtypes, bind to the IFNα receptor

complex consisting of INFAR1 and IFNAR2, and have anti-viral and anti-tumor abilities (Zhang

et al., 2008). Type III interferons are similar to Type I interferons, because they also elicit anti-

viral responses, but are structurally distinct and utilize a distinct combination of receptor

subunits: IFN-λR1 and IL-10Rβ (Zhang et al., 2008). Type II interferons, of which IFNγ is the

only member, has the distinct ability to trigger an anti-bacterial response in the host, and binds to

the ubiquitously expressed surface heterocomplex IFNGR1 and IFNGR2 (Commins et al., 2010).

19

Following EHEC infection, pro-inflammatory cytokines including IFNγ are secreted into the

extracellular environment by macrophages, Natural Killer (NK) T cells, and activated T cells.

IFNγ then binds to IFNGR1 and IRNGR2 receptors expressed on the outer plasma membrane on

the surface of host cells (Shea-Donohue et al., 2010). IFNGR1 and IFNGR2 are transmembrane

receptors belonging to the class II family of cytokine receptors, and associate with each other in

an anti-parallel and non-covalent manner (Bach et al., 1997; Renauld, 2003). With IFNγ binding,

the IFNGR1/2 associated Janus family of tyrosine kinases, Jak1 and Jak2, become tyrosine

phosphorylated, which leads to Jak1 phosphorylating both IFNGR subunits at tyrosine 440 and

exposing two adjacent SRC homology 2 (SH-2) domains within each IFNGR (Schroder et al.,

2004). Latent cytoplasmic Stat-1 (Signal transducers and activation of transcription 1) proteins

subsequently bind to these IFNGR SH-2 domains and become activated by tyrosine

phosphorylation (Heim et al., 1995).

Stat-1 is one of 7 members in the Stat family of proteins: Stat-1, Stat-2, Stat -3, Stat-4, Stat-5a,

Stat-5b, and Stat-6 (Table 1.5). Stat proteins each contain a SRC homology 2 (SH-2) domain, a

DNA binding domain, and a transactivation domain at the C terminus (Mao and Chen, 2005).

Activation of the IFNγ pathway leads to the phosphorylation and association of Stat-1

homodimers at tyrosine residue 701, whereas type I interferon signaling leads to the formation of

multiple homo and heterodimer complexes of Stat-1, Stat-2, Stat-3, and Stat-4 molecules (Levy

and Darnell, 2002).

Upon Stat-1 tyrosine phosphorylation, two molecules homodimerize in the cell cytosol and then

translocate to the nucleus via nuclear translocation sequences (McBride et al., 2002). In the

nucleus, Stat-1 binds to gamma activation sequence (GAS) elements to promote transcriptional

activation of up to 2,000 IFNγ-stimulated genes (ISGs) which together mount a defense against

infecting microbes. Activated genes include, for example, inducible nitric oxide synthase

(iNOS), monocyte chemoattractant protein-1 (MCP-1), lymphocyte adhesion protein ICAM-1,

and Interferon regulatory factor (IRF)-1, as well as increased MHC II expression (Saha et al.,

2010; Schroder et al., 2004). The IFNγ pathway is illustrated in Figure 1.2. It has been

demonstrated in a mouse model of infection with Citrobacter rodentium, a murine-specific

homologue of EHEC (Higgins et al., 1999), that iNOS is locally suppressed at sites of

colonization (Vallance et al., 2002) indicating that the IFNγ signal transduction pathway plays an

20

important role in defense against infection, and that it can be subverted by an enteric bacterial

pathogen in vivo.

21

Table 1.5: STAT proteins, triggering factors, and associated functions

STAT

protein

Cytokine or triggering

factor

Phenotype in knockout mice

STAT1 IL-2, IL-6, IL-10, IFN-α,

IFN-β, IFN-γ, IL-27

Impaired responses to interferons; increased

susceptibility to tumors; impaired growth control

STAT2 IFN-α, IFN-β Impaired responses to interferons

STAT3 LIF, IL-10, IL-6, IL-27,

Growth hormone

Embryonic lethality; multiple defects in adult tissues

including impaired cell survival; impaired response to

pathogens

STAT4 IL-12 Impaired TH1 differentiation owing to loss of IL-12

responsiveness

STAT5a/b Prolactin, Growth

hormone, Thrombopoietin

Impaired mammary gland development owing to loss

of prolactin responsiveness; impaired growth owing to

loss of growth hormone responsiveness

STAT6 IL-4, IL-13 Impaired TH1 differentiation owing to loss of Il-4

responsiveness

Adapted from Saha et al. (2010) and Levy and Darnell, (2002)

22

Figure 1.2: The IFNγ signaling pathway. Binding of IFNγ results in receptor oligomerization

followed by trans-phosphorylation and activation of JAK1 and JAK2. Activated JAKs

phosphorylate IFNGR1 and IFNGR2 resulting in docking and phosphorylation of STAT1.

Phosphorylated STAT1 homodimerizes and translocates to the nucleus to bind GAS (gamma

activation sequences) located in the promoters of several primary response genes. Upon binding,

several genes are expressed, including iNOS, MCP-1, ICAM-1, and IRF-1. Figure adapted from

Saha et al. (2010).

23

24

1.4.2 Health Implications Arising from Defects in IFNγ Signaling

As reviewed by Zhang et al. (2008) and Casanova et al. (2012), multiple studies demonstrate the

biological significance of the IFNγ signal transduction pathway in response to various microbial

infections. For instance, mouse IFNγ is critical for protective immunity against viruses, bacteria,

fungi, and parasites (Muller et al., 1994; Schroder et al., 2004). In humans, gene mutations

resulting in structural defects in the IFNγ receptors lead to clinical disease caused by normally

weakly virulent mycobacterial species, such as bacilli Calmette-Guérin (BCG) vaccines, and

non-tuberculous environmental mycobacteria (Zhang et al., 2008).

Patients with Stat-1 gene mutations resulting in a dysfunctional protein present with even more

severe clinical symptoms since Stat-1 is a downstream molecule of both the IFNα and IFNγ

signaling pathways, and do not mount an effective anti-viral response against vesicular stomatitis

virus (VSV), encephalomyocarditis virus, and herpes simplex virus 1 (HSV-1). In addition,

recurrent bacterial infections are experienced by IFNGR deficient patients (Casanova et al.,

2012). Taken together, these findings indicate that an intact IFNγ signaling pathway is essential

to fight off infections initiated from a wide range of microbial pathogens, with patients harboring

genetic defects in any part of the IFNγ signal transduction pathway being prone to recurrent,

severe, and often life threatening infections (Averbuch et al., 2011; Casanova et al., 2012; Zhang

et al., 2008).

1.4.3 Pathogen Inhibition of the IFNγ Signaling Pathway

The importance of anti-microbial aspects of the IFNγ, Jak, Stat-1 signaling pathway make it an

attractive target for pathogen subversion (Jones and Neish, 2011). In bacteria, for instance,

Mycobacterium tuberculosis secreted proteins ESAT-6 and ESAT-19 inhibit the production of

IFNγ in T cells (Peng et al., 2011) and the IFNγ signaling pathway (Gehring et al., 2003),

respectively. Mycobacterium avium inhibits IFNγ signaling by down-regulating IFNGR

expression (Hussain et al., 1999), and Listeria monocytogenes inhibits the IFNγ pathway by up-

regulating SOCS activity (suppressors of cytokine signaling; a down-regulator of IFNγ

activation) (Stoiber et al., 2001). The parasite Leishmania donovani prevents the phosphorylation

of Stat-1 (Nandan and Reiner, 1995) while influenza A (Uetani et al., 2008) and vaccinia viruses

(Mann et al., 2008) prevent Stat-1 tyrosine phosphorylation and nuclear translocation. Taken

25

together, these findings show that multiple microbial pathogens are able to exploit the IFNγ

signal transduction pathway; some pathogens modulate host factors, whereas other secrete and

express their own products that inhibit signaling.

1.5 Management of EHEC infections Hemolytic uremic syndrome (HUS) is comprised of acute renal failure, hemolysis,

thrombocytopenia, and the risk of stroke (Goldwater and Bettelheim, 2012). This syndrome,

together with the effects of Shiga toxin and complement complex formation, must be

immediately managed. Unfortunately, current treatment options for EHEC infection and HUS

are largely supportive, and consist of fluid resuscitation (Tarr et al., 2012), peritoneal dialysis

(Hickey et al., 2011), and plasma exchange (Slavicek et al., 1995).

Antibiotic treatment against E. coli O157:H7 infection is not recommended, because while they

are effective in pathogen elimination, antibiotics may also induce toxin release from the

pathogen. In fact, antibiotic usage is reported to increase the frequency of HUS occurrence in

EHEC-infected children (Wong et al., 2000) and adults (Dundas et al., 2001).

In vitro studies have shown increased Stx production (in the range of 150-400%) by various

antibiotics (ciprofloxacin, co-trimoxazole, cefiximine, and tetracycline) (Walterspiel et al.,

1992). In general, the amount of toxin production increases steadily when increasing

concentrations of antibiotics are applied (Grif et al., 1998).

Alternative strategies to sequester and limit Shiga toxin-associated pathology have been

proposed. For instance, Stx ligand mimics should theoretically sequester Stx from binding to

host cells and limit pathology. However, in the sole clinical trial of such a molecule, Synsorb Pk,

the treatment failed to diminish the severity of disease in pediatric patients with HUS (Trachtman

et al., 2003). In clinical practice, it is likely that vascular endothelial damage has already

occurred before these ligand receptors could prove to be of benefit.

Alternatively, neutralizing Shiga toxin specific antibodies have been shown to be highly

protective when administered to animals challenged with lethal doses of the toxin (Islam and

Stimson, 1990). In addition, it was shown recently that the divalent cation manganese (Mn2+)

26

blocks endosome-to-Golgi trafficking of Stx in vitro, which could potentially offer a novel

therapeutic approach for managing human disease (Mukhopadhyay and Linstedt, 2012).

Based on evidence that Shiga-toxin activates complement in hemolytic-uremic syndrome (Orth

et al., 2009; Thurman et al., 2009), a few case reports of successful treatment of severe Stx

associated HUS by employing the monoclonal antibody eculizumab (targeted against the

complement protein C5) have been described (Lapeyraque et al., 2011).

Vaccines are another therapeutic avenue currently under active investigation, and could provide

a long-term prevention approach for those at highest risk for contracting and spreading EHEC.

Many EHEC proteins are highly immunogenic (Asper et al., 2011) and promising results in

animal studies have been described using vaccines targeting Shiga toxins (Cai et al., 2011; Gu et

al., 2009). Another avenue currently under active investigation is the immunization of cattle

with a vaccine against E. coli O157:H7 to prevent bacterial shedding in these animals, as well as

animal to animal spread (Allen et al., 2011).

While it is clear that many of these therapeutic options are still quite far away from testing in

human clinical trials, the frequent outbreaks and devastating consequences of EHEC infections

serve to remind us of the urgent need to protect the population against this devastating pathogen.

1.6 Probiotics In recent years, there has been an explosion of interest regarding the potential beneficial effects

of probiotics and the implications for their use in promoting human health and preventing

clinical disease (WHO, 2002). Probiotics are defined as live, non-pathogenic microorganisms

that confer health benefits to the host, and are increasingly being employed as an option for

preventing and treating bacterial infections (Gareau et al., 2010). Probiotics include multiple

bacterial species such as Lactobacilli, Bifidobacteria, and Streptococci which have been found to

generally promote and maintain a balanced intestinal microenvironment, and may prevent active

viral and bacterial infections (Gareau et al., 2010).

Probiotics elicit their beneficial effects through a diverse array of mechanisms, ranging from

secreting antimicrobial products to modulating host immune pathways. As reviewed by Sherman

et al. (2009), certain probiotics secrete antibacterial products, such as bacteriocins, that inhibit

27

the growth and virulence of pathogenic bacteria (Corr et al., 2007), while other lactic acid

producing probiotics suppress pathogen growth by altering the pH in the local microenvironment

(Fayol-Messaoudi et al., 2005), or inhibit enteropathogenic infection through acetate production

(Fukuda et al., 2011).

With other probiotics, such as Lactobacillus helveticus R0052, direct contact with host cells act

as a protective mechanism simply by obscuring pathogen receptor mediated binding to host cells

(Johnson-Henry et al., 2007). Alternatively, probiotics such as Saccharomyces boulardii have the

potential to sequester EHEC pathogens away from host cells by binding directly to them (Gedek,

1999).

Specific probiotic strains can also modulate host cell signaling cascades in a protective manner.

For example, Lactobacillus plantarum strain 299v upregulates intestinal mucin secretion

(Caballero-Franco et al., 2007), and Lactobacillus fermentum upregulates host antibacterial

cationic peptides, called defensins, to reduce and eliminate pathogens present on the epithelial

cell surface. Lactobacillus rhamnosus GG can also upregulate the expression of intestinal

epithelial intercellular tight junction proteins and, thereby prevent pathogen-induced breaks in

intestinal barrier integrity (Seth et al., 2008).

Furthermore, other probiotics can modulate host innate and adaptive arms of the immune system.

For instance, Lactobacillus casei DN-114 001 attenuates the NFκB pro-inflammatory signal

transduction cascade that is activated by pathogen (Tien et al., 2006). Lactococcus lactis has

demonstrated the ability to upregulate regulatory T cells expressing CD4 and Foxp3 (Huibregtse

et al., 2007). In humans with irritable bowel syndrome (IBS), participants randomized to

treatment with Bifidobacterium infantis 35624 showed improvement in clinical symptoms that

correlated with normalization in cytokine profiles. In contrast, Lactobacillus salivarius

UCC4331, another probiotic used during the same study, had no effect (O'Mahony et al., 2005).

These observations serve to highlight the strain-specific effects of various agents proposed for

use as probiotics.

Taken together, these studies are cited as part of the mounting body of evidence indicating that

probiotics are capable of preventing and perhaps treating pathogen mediated dysbiosis in the gut

through a variety of complementary mechanisms. Accordingly, benefical microbies could

28

potentially be used as therapeutic options for the management of EHEC infections - particularly

in an outbreak setting.

1.7 Summary EHEC pathology is attributed to the synergistic effects of multiple virulence factors that have

been acquired by the pathogen during its evolution. EHEC mechanisms of infection include

bacterial colonization and adhesion to gut epithelial cells; toxin secretion, dissemination, and

activity; and microbial subversion of host innate immune responses. The IFNγ, Jak, Stat-1

pathway is an essential host immune response responsible for addressing microbial infection, and

EHEC mediated subversion of this pathway is a testament to its critical nature in the

pathobiology of disease.

29

Chapter 2

Hypothesis and Objectives

Overall Hypothesis

2.1 Hypothesis

Escherichia coli O157:H7 suppression of interferon-γ stimulated STAT-1 tyrosine

phosphorylation is mediated by a secreted bacterial factor.

2.2 Study Objectives

1. Identify the factor(s) by which Escherichia coli O157:H7 subverts the interferon-γ

pathway using column chromatography (Chapter 3)

2. Identify the factor(s) by which Escherichia coli O157:H7 subverts the interferon-γ

pathway using 2D-DIGE (Chapter 4)

3. Describe the effects of probiotics on enterohemorrhagic and adherent-invasive

Escherichia coli mediated host cell immune responses (Chapter 5)

30

Chapter 3

Identifying Mechanisms by which Escherichia coli O157:H7

Subverts Interferon-γ Mediated Signal Transducer and Activator

of Transcription-1 Activation

Published as:

Ho NK, Crandall I, Sherman PM (2012) Identifying Mechanisms by which Escherichia coli

O157:H7 Subverts Interferon-γ Mediated Signal Transducer and Activator of Transcription-1

Activation. PLoS ONE. 4(1):e30145.

31

3.1 ABSTRACT

Enterohemorrhagic Escherichia coli serotype O157:H7 is a food borne enteric bacterial pathogen

that causes significant morbidity and mortality in both developing and industrialized nations. E.

coli O157:H7 infection of host epithelial cells inhibits the interferon gamma pro-inflammatory

signaling pathway, which is important for host defense against microbial pathogens, through the

inhibition of Stat-1 tyrosine phosphorylation. The aim of this study was to determine which

bacterial factors are involved in the inhibition of Stat-1 tyrosine phosphorylation. Human

epithelial cells were challenged with either live bacteria or bacterial-derived culture supernatants,

stimulated with interferon-gamma, and epithelial cell protein extracts were then analyzed by

immunoblotting. The results show that Stat-1 tyrosine phosphorylation was inhibited by E. coli

O157:H7 secreted proteins. Using sequential anion exchange and size exclusion

chromatography, YodA was identified, but not confirmed to mediate subversion of the Stat-1

signaling pathway using isogenic mutants. We conclude that E. coli O157:H7 subverts Stat-1

tyrosine phosphorylation in response to interferon-gamma through a still as yet unidentified

secreted bacterial protein.

32

3.2 INTRODUCTION

Enterohemorrhagic Escherichia coli (EHEC), including the most common serotype O157:H7, is

a non-invasive enteric bacterial pathogen that causes both sporadic cases and outbreaks of

hemorrhagic colitis and hemolytic-uremic syndrome in humans (DuPont, 2009). Human zoonotic

infections with EHEC occur through the ingestion of contaminated foodstuffs and water

supplies, as well as from person-to-person transmission of the organism (Croxen and Finlay,

2010).

One of the first lines of host defense against bacterial insults is through activation of the innate

and adaptive immune systems (Jones and Neish, 2011). Pro-inflammatory cytokines, including

interferon gamma (IFNγ), are secreted into the extracellular environment and activate an anti-

microbial state in the body (Shea-Donohue et al., 2010). IFNγ production by macrophages,

Natural Killer (NK) T cells and activated T cells triggers an antimicrobial state in host cells by

binding to the IFNγ receptor, and tyrosine phosphorylation of the signal transducer and activator

of transcription-1 (Stat-1) molecule. This activation leads to Stat-1 dimerization and

translocation from the cytosol into the nucleus, where it binds to the gamma activating sequence

(GAS) and triggers the up-regulation of up to 2,000 pro-inflammatory genes, including inducible

nitric oxide synthase (iNOS), monocyte chemoattractant protein-1 (MCP-1) and lymphocyte

adhesion protein ICAM-1 (Saha et al., 2010). An intact IFNγ pathway is essential to combat

infection initiated from a wide range of microbial pathogens; therefore patients with genetic

defects in Stat-1 signaling are susceptible to microbial infections (Averbuch et al., 2011;

Chapgier et al., 2006; Dupuis et al., 2003).

Subversion of the IFNγ/Stat-1 signal transduction pathway by microbial pathogens promotes

bacterial colonization and prevents bacterial clearance from the host (Jones and Neish, 2011).

EHEC has evolved a method to subvert the IFNγ pathway, through a still unknown factor

(Ceponis et al., 2003). Therefore, the aim of this study was to determine how EHEC infection

disrupts IFNγ signal transduction in human epithelial cells. The findings revealed that the IFNγ

signal transduction pathway, important for host defense, is compromised at the level of Stat-1

tyrosine activation by an unknown EHEC secreted protein.

33

3.3 MATERIALS AND METHODS

Tissue culture

HEp-2 epithelial cells (ATCC CCL-23) were used as a model epithelial cell line, as previously

described (Jandu et al., 2009a). Briefly, cells were grown in minimal essential medium (MEM)

containing 15% (v/v) fetal bovine serum (FBS), 2% (v/v) sodium bicarbonate, 2.5% (v/v)

penicillin streptomycin and 1% (v/v) amphotericin B (all from Invitrogen, Burlington, Ontario,

Canada). Cells were grown in T75 flasks (Corning Inc., Corning, NY) at 37°C in 5% CO2 until

confluent (8×106 cells/flask). Confluent cells were trypsinized using 0.05% trypsin (Invitrogen)

for 5 min at 37°C in 5% CO2. Trypsinized cells were then pelleted by centrifugation at 40g for 5

min (Beckman Coulter, Mississauga, ON, Canada), resuspended in MEM and re-seeded into

either 6 well (Becton Dickinson Labware, NJ) or 24 well dishes (Corning Inc.) and grown at

37°C in 5% CO2 until confluent. Prior to bacterial infection, cells were incubated in MEM

without antibiotics for 16h at 37°C in 5% CO2.

Bacterial strains and growth conditions

Enterohemorrhagic E. coli O157:H7, strain EDL933 (EHEC) (accession: AE005174.2) and

enteropathogenic E. coli O127:H6 strain E2348/69 (EPEC) (accession: NC_011601.1) were used

in this study. Strains were cultured on 5% sheep blood agar plates (Becton, Dickinson and

Company, Sparks, MD) at 37°C for 16h and stored at 4°C until use. Prior to infecting epithelial

cells, bacteria were grown in 10 ml of static, non-aerated Penassay broth (Becton, Dickinson

Co.) overnight at 37°C.

Bacterial culture supernatants

To collect bacteria culture supernatants, ~1x109 CFU/ml of EHEC O157:H7 culture was

centrifuged (3,000g, 15 min) and resuspended in 10 ml of serum free MEM without antibiotics.

After growth for 24h at 37°C in 5% CO2, the medium was centrifuged (3,000g, 15 min), filtered

(0.22 μm) and stored at 4°C. Sterility was confirmed by lack of bacterial growth of 0.1 ml of

culture supernatant plated onto 5% sheep blood agar plates and then incubated overnight at 37°C.

Proteinase K and heat inactivation treatment of culture supernatants

34

Bacterial culture supernatants from EHEC were incubated with proteinase K conjugated to

agarose beads (10 to 1000 µg/ml, 1h shaking, 37°C) (Sigma Aldrich, Oakville, Ontario, Canada).

Culture supernatants incubated with agarose beads and pre-incubated with bovine serum albumin

(5% BSA) were used as a negative control. After incubation, agarose beads were removed from

the solution by centrifugation (3,000g, 1 min) before incubation with HEp-2 cells. Culture

supernatants from EHEC were also heat inactivated by boiling (100°C, 0.5h) and cooled to 37°C

before incubation with HEp-2 cells.

Epithelial cell infection

Infection of HEp-2 cells was performed at a multiplicity of infection (MOI) of 100:1. Overnight

bacterial culture (10mL) was centrifuged (3,000g, 10 min), the supernatant decanted, and

bacterial pellets resuspended in 1.0 ml of antibiotic and serum-free MEM. An aliquot of this

bacterial suspension (~1×108 CFU in 0.1 ml) was then used to infect confluent HEp-2

monolayers grown in 6 well plates (~1x106 cells/well). The cells were infected with either EHEC

or EPEC for 6h at 37°C in 5% CO2. Cells were then washed with PBS and stimulated with IFNγ

(50 ng/ml; 0.5h at 37°C in 5% CO2), followed by whole cell protein extracts for immunoblotting.

To determine if active bacterial protein synthesis was required to inhibit the phosphorylation of

Stat-1, in a subset of experiments epithelial cells and EHEC were incubated with

chloramphenicol (100 μg/ml) at 0 to 4h after infectious challenge with (MOI 100:1, 6h).

Immunoblotting

Whole cell protein extracts were collected by resuspending epithelial cells in RIPA buffer (1%

Nonidet P-40, 0.5% sodium deoxylate, 0.1% sodium dodecyl sulfate [SDS] in PBS)

supplemented with 150 mM NaCl, 50 mM sodium fluoride, 1 mM sodium orthovanadate, 20

µg/ml phenylmethylsulfonyl fluoride, 15 µg/ml aprotinin, 2 µg/ml leupeptin, and 2 µg/ml

pepstatin A (all from Sigma Aldrich). Aliquots were applied directly onto cells, mixed and left

on ice for 0.5h. Re-suspended pellets were centrifuged at 20,000g for 1 min at 4°C. Supernatants

were collected and stored at −80°C until further analysis by western blotting.

Immunoblotting was conducted by combining whole cell protein extracts with SDS-PAGE

loading buffer in a 1:1 (v/v) ratio, incubation at 100°C for 3 min, followed by loading into

precast 10% polyacrylamide gels (Ready Gel®; BioRad Laboratories, Hercules, CA). Gels were

electrophoresed (150 V, 1h at room temperature), followed by protein transfer onto nitrocellulose

35

membranes (BioTrace NT; Pall Corporation, Ann Arbor, MI) (110 V, 1h at 4°C). Membranes

were incubated in Odyssey blocking buffer (Mandel Scientific Company Inc., Guelph, Ontario,

Canada) for 0.5h at room temperature on a shaker, followed by incubation with primary

antibodies (4°C overnight on a shaker). Primary antibodies included rabbit anti-native-Stat-1 (1

in 1,000 dilution; Cell Signaling, Beverly, MA), rabbit anti-phospho-Stat-1 (1 in 1,000 dilution;

Cell Signaling), rabbit anti-IRF1 (1 in 2,000 dilution; Sigma-Aldrich), and mouse anti-β-actin (1

in 5,000 dilution; Sigma). Membranes were washed 3 times with PBS+0.1% Tween (5 min per

wash) and then incubated with secondary antibodies (1h at RT on a shaker). Secondary

antibodies included IRDye 800 goat anti-rabbit IgG (1 in 20,000 dilution; Rockland

Immunochemicals, Gilbertsville, PA) and Alexa Fluor® 680 goat anti-mouse IgG (1 in 20,000

dilution; Molecular Probes, Eugene, OR).

Immunoblots were scanned into an infrared imaging system (Odyssey, LI-COR Biosciences,

Lincoln, NE), using both the 700 nm and 800 nm channels, at a resolution of 169 µm. Using

automated software (LI-COR Biosciences) densitometry was performed to obtain the integrative

intensity of positively stained bands. Integrative intensity values for each of the phospho-Stat-1

and native-Stat-1 bands were normalized to the integrative intensity values obtained for the

corresponding β-actin bands. Uninfected cells stimulated with IFNγ were used as positive

controls, and standardized to 100%. Densitometry values obtained from samples incubated with

live bacteria, or sterile culture supernatants, were then calculated as a percentage of the positive

uninfected control.

Column chromatography

Bacterial culture supernatants were diluted 1 in 3 with 10 mM Tris-HCL buffer (pH 8.0) and

applied onto a DEAE Sephacel anion exchange column (Sigma Aldrich, Oakville, Ontario,

Canada), and proteins eluted with increasing concentrations of sodium chloride (0 to 1 M).

Protein fractions were dialyzed in 10 mM Tris-HCL buffer (pH 8.0) overnight at 4°C, and further

separated using a size exclusion column containing Sepharose CL-6B (Sigma-Aldrich).

Fractions were screened for activity in inhibiting IFNγ mediated Stat-1-phosphorylation. Active

fractions were analyzed by 18% SDS-PAGE followed by silver staining. Candidate proteins

were excised and identified using Mass Spectrometry (Advanced Protein Technology Centre at

The Hospital for Sick Children, Toronto, Ontario, Canada).

36

Isogenic mutant strains

Isogenic etpD (1.9Kb), yodA (672bp), and escN (1.3Kb) mutants were generated from EHEC

O157:H7 strain EDL933 using a one-step inactivation technique and primers detailed in Table

3.1 (Datsenko and Wanner, 2000). Briefly, EDL933 was transformed with pKD46, and λ-red

recombinase expression induced with L-arabinose at 30°C on a shaker until the OD600 reached

0.6. etpD mutants were generated by electroporating linear DNA fragments containing a

kanamycin resistance cassette with 5’ and 3’ flanking regions homologous to etpD using primers

etpDKOP1 and etpDKOP2 on plasmid pKD4 (template plasmid with FLP recognition target sites

flanking a 1.6Kb kanamycin resistance gene). yodA mutants were generated in the same fashion,

except with primers yodAKOP1 and yodAKOP2, and escN mutants with primers escNKOP1 and

escNKOP2. All mutants generated were verified by PCR.

37

Table 3.1. Primers employed in this study.

Name Sequence (5’->3’)

etpDKOP1 GTGTTCACTACAGTAATTTTGGGGGCCATTCCAGGGTGGGGGGCTGA

ATTGTGTAGGCTGGAGCTGCTTC

etpDKOP2 TTACATCTCCTGCGCATAAAACGCAGCAATCGCCGCTTTCACCTTCC

GGACATATGAATATCCTCCTTAG

escNKOP1 ATGATTTCAGAGCATGATTCTGTATTGGAAAAATACCCACGTGTAGG

CTGGAGCTGCTTC

escNKOP2 GGCAACCACTTTGAATAGGCTTTCAATCGTTTTTTCGTAACATATGA

ATATCCTCCTTAG

YodAKOP1 TTGGCGATTCGTCTTCACAAACTGGCTGTTGCTTTAGGTGTCTTTATT

GTGTGTAGGCTGGAGCTGCTTC

YodAKOP2 TCAATGAGACATCATTTCCTCGACCACTTCTTCGCTACTCAACTGATA

TGCATATGAATATCCTCCTTAG

yodA-C’P1 GAGGAATAATAAATGACTCTGGAGGAAACTGTTTTGG

yodA-C’P2 ATGAGACATCATTTCCTCGACCAC

38

EHEC pO157 plasmid removal

The pO157 plasmid was cured from EHEC using the pCURE2 kit from Plasgene (Plasgene,

Birmingham UK) (Hale et al., 2010). Briefly, Escherichia coli O157:H7 strain EDL933 was

transformed with the pCURE2 plasmid which displaces the pO157 plasmid, and transformants

were selected for resistance on LB kanamycin plates (50µg/ml). Transformants were then

counter-selected for sucrose sensitivity (sacB) by incubation on LB plates supplemented with 5%

sucrose, and colonies recovered were verified for their loss of the pO157 and pCURE2 plasmids

by PCR.

YodA cloning, over-expression and purification

To over-express and purify the YodA protein (24.6kDa), the yodA gene was cloned into the

pBAD-TOPO TA cloning kit (Invitrogen) under control of the arabinose promoter. Briefly, the

yodA gene was PCR amplified using primers yodA-C’P1 and yodA-C’P2, cloned upstream of a

6x-His tag to generate pBAD-yodA-His, and verified using PCR and DNA sequencing (Centre

for Applied Genomics, Hospital for Sick Children, Toronto, Ontario, Canada). YodA over-

expression was induced in Escherichia coli DH5α with 0.2% arabinose and purified using nickel

column chromatography employing a Qiagen His-tagged purification kit (Qiagen, Toronto).

Statistics

Results are expressed as means, ± standard error (SE). Levels of Stat-1 tyrosine phosphorylation

were compared by using one-way analysis of variance (ANOVA), with Tukey’s multiple

comparison test. Analyses were performed using Prism4 (GraphPad, San Diego, California,

USA). Differences of p<0.05 were considered significant.

39

3.4 RESULTS

EHEC, but not EPEC, inhibits IFNγ mediated Stat-1 tyrosine phosphorylation via secreted

factors.

To demonstrate that EHEC, but not EPEC, was able to subvert the IFNγ pathway, we assessed

the tyrosine phosphorylation state of Stat-1 in cell protein extracts. In un-stimulated epithelia,

Stat-1 is normally not tyrosine phosphorylated, but becomes activated in response to IFNγ

stimulation (Ceponis et al., 2003; Saha et al., 2010). Infection with either pathogen does not

affect native Stat-1 expression (Figure 3.1A), however EHEC prevented Stat-1 tyrosine

phosphorylation in response to IFNγ stimulation (Figure 3.1A). By contrast, EPEC did not

inhibit IFNγ mediated Stat-1 tyrosine phosphorylation (Ceponis et al., 2003; Ho et al., 2011-

Submitted), indicating that the ability to subvert IFNγ signaling is a specific ability of EHEC,

and not all pathogenic E. coli.

Incubation of HEp-2 cells with sterile culture supernatants showed that EHEC, but not EPEC,

culture supernatants are able to inhibit IFNγ mediated Stat-1 tyrosine phosphorylation, with no

affect on native Stat-1 levels (Figure 3.1B) (Ho et al., 2011-Submitted). The addition of

chloramphenicol within 1h of EHEC infection prevented bacterial inhibition of Stat-1 tyrosine

phosphorylation in response to IFNγ (Figure 3.1C), suggesting that subversion of IFNγ mediated

Stat-1 tyrosine phosphorylation is time dependent, and requires new and active bacterial protein

synthesis (Ho et al., 2012b).

40

Figure 3.1. EHEC, but not EPEC, inhibits IFNγ mediated Stat-1 tyrosine phosphorylation.

Whole-cell protein extracts from HEp-2 cells analyzed by immunoblotting showed that (A) IFNγ

mediated (50ng/ml, 0.5h) Stat-1 tyrosine phosphorylation is suppressed by enterohemorrhagic

Escherichia coli O157:H7, strain EDL933 (EHEC), but not by enteropathogenic Escherichia coli

O127:H6, strain E2348/69 (EPEC) (MOI of 100:1; 6h). (B) Incubation with sterile culture

supernatants (6h) from EHEC, but not EPEC, suppressed IFNγ-mediated tyrosine

phosphorylation of Stat-1. (C) Incubation with chloramphenicol (100 µg/ml) up to 1h after

infection with EHEC (MOI 100:1; 6h) prevented EHEC suppression of IFNγ mediated Stat-1

tyrosine phosphorylation.

41

Figure 3.1

42

Secreted inhibitory factor(s) have protein-like qualities

To verify that the inhibitory effects of EHEC were not due to heat resistant factors, such as

lipopolysaccharide (Rietschel and Brade, 1992; Rietschel et al., 1993), culture supernatants were

incubated at 100°C for 30 min and then assessed for the ability to inhibit Stat-1 tyrosine

phosphorylation. As observed previously in our laboratory (Ho et al., 2011-Submitted), boiled

culture supernatants did not inhibit Stat-1 tyrosine phosphorylation, even after 6h of incubation

with tissue culture epithelial cells (Figure 3.2A).

To confirm that the inhibitory factor(s) were protein in nature, bacterial culture supernatants

were treated with proteinase K, and then tested for their ability to inhibit Stat-1 tyrosine

phosphorylation. Culture supernatants treated with agarose beads as a negative control still

blocked signaling responses to IFNγ, while those treated with increasing concentrations of

proteinase K progressively lost the ability to subvert IFNγ mediated Stat-1 tyrosine

phosphorylation (Figure 3.2B) (Ho et al., 2012b).

43

Figure 3.2. Secreted factor(s) have protein qualities. Whole cell protein extracts from HEp-2

cells analyzed by immunoblotting showed that (A) Incubation with heat treated (100°C, 0.5h)

EHEC CS did not suppress IFNγ mediated Stat-1 tyrosine phosphorylation, and (B) incubation

with EHEC CS (6h) pre-treated with proteinase K conjugated to agarose beads (0 – 1,000mg/ml,

37°C, 1h) did not suppress IFNγ induced tyrosine phosphorylation of Stat-1 (n=3, one-way

ANOVA ,* p < 0.05).

44

Figure 3.2

45

EHEC secreted inhibitory factor identified as YodA

In order to identify the secreted inhibitory factor(s), we separated the protein contents of EHEC

culture supernatants based on charge density differences using anion exchange chromatography.

After an initial loading and low salt rinsing step, bound material was eluted using a linear salt

gradient, and fractions were collected at regular intervals and analyzed for their protein

concentration using the Bradford assay (Figure 3.3A). Fractions from distinct regions of the

anion exchange profile were pooled into 4 groups, dialyzed, and incubated with HEp-2 cells.

Only fractions 32-43 inhibited IFNγ mediated Stat-1 tyrosine phosphorylation (Figure 3.3B). In

order to further identify the inhibitory factor(s), fractions 32-43 from the DEAE column were

pooled and separated using size exclusion chromatography to separate the proteins based on

molecular mass. Fractions from the size exclusion column were then retested for protein

concentration using the Bradford assay (Figure 3.3C), and tested for their ability to inhibit IFNγ

mediated Stat-1 tyrosine phosphorylation (Figure 3.3D). According to western blotting, fractions

13-16 showed inhibitory qualities, which appeared to correspond to the presence of a single band

present in fractions 14-16 when separated by SDS-PAGE (Figure 3.3E). The band was excised,

digested by trypsin, and identified as YodA by standard methods of peptide fingerprint analysis

using mass spectrometry (Advanced Protein Technology Centre at The Hospital for Sick

Children, Toronto, Ontario, Canada).

46

Figure 3.3. EHEC secreted inhibitory factor identified as YodA. A Bradford assay was

performed on EHEC culture supernatants separated by anion exchange (A). A 1.2cm by 50cm

column containing DEAE Sephacel that had been mixed with 0.5L of culture supernatant was

initially rinsed with low salt buffer prior to being eluted with a 0 to 1M gradient of NaCl. Three

mL fractions were collected and protein content was determined by Bradford assay. Fraction 60

represents a NaCl concentration of ~200mM and no further protein elution at higher salt

concentrations was observed. Fractions of interest were pooled and dialyzed before incubation

with HEp-2 cells, and tested for their ability to inhibit IFNγ mediated Stat-1 tyrosine

phosphorylation (B). Pooled fractions 32-43 from the DEAE Sephacel column were concentrated

by membrane filtration prior to being subjected to size exclusion chromatography using a 1.2cm

by 50cm Sepharose CL-6B column equilibrated with 10 mM Tris-HCL buffer (pH 8.0). Three

mL fractions were collected and the protein concentration present was determined by Bradford

assay (C). Select fractions from size exclusion chromatography were tested for their ability to

inhibit IFNγ mediated Stat-1 tyrosine phosphorylation (D). Fractions of interest were separated

using 18% SDS-PAGE and stained with silver (E).

47

Figure 3.3

48

YodA is a metal binding protein of unknown function (David et al., 2002; David et al., 2003). To

determine if YodA played a role in Stat-1 suppression, isogenic yodA mutants in E. coli

O157:H7 strain EDL933 were created using the λ-red knockout system (Datsenko and Wanner,

2000) along with the E. coli Type-2 Secretion system (etpD) which is required for YodA

excretion (Ho et al., 2008). Both isogenic mutants were verified by PCR (Figure 3.4A, B), and

then assessed for their ability to inhibit Stat-1-phosphorylation (Figure 3.4C, D).

49

Figure 3.4. Isogenic yodA and etpD mutants inhibit Stat-1 tyrosine phosphorylation at

levels comparable to wild-type. Isogenic yodA and etpD mutants were verified by PCR (panels

A and B, respectively). Whole-cell protein extracts from HEp-2 cells were incubated with sterile

culture supernatants from WT, yodA and etpD mutants and then tested for their ability to inhibit

IFNγ mediated Stat-1 tyrosine phosphorylation; representative immunoblot (C) and repeated

experiments analyzed by densitometry (n=3) (D).

50

Figure 3.4

51

Contrary to expectations, both isogenic mutants inhibited Stat-1-phosphorylation at levels

comparable to the wild-type EHEC strain, indicating that neither yodA nor etpD was involved in

EHEC subversion of IFNγ/Stat-1 signaling. To verify the mutation experiments, the yodA gene

was cloned into the pBAD-TOPO protein expression system with a C-terminal histidine tag

(Figure 3.5A), and verified by PCR (Figure 3.5B) and sequencing. Protein over-expression and

solubility was verified using western blotting (Figure 3.5C) and then purified by nickel column

chromatography (Figure 3.5D). Varying concentrations of the eluted and dialyzed YodA-His

protein (Figure 3.5E, F, respectively) were then tested directly on HEp-2 cells; however,

purified YodA did not inhibit IFNγ mediated Stat-1 tyrosine phosphorylation.

52

Figure 3.5. Purified YodA failed to inhibit Stat-1 tyrosine phosphorylation as well as wild-

type culture supernatant. EHEC yodA gene was cloned into the pBAD protein expression

vector (A) and verified by PCR (B). Over-expressed YodA-His was detected in the soluble

fraction, but not in the insoluble or supernatant fraction, by western blot (C) and purified using

nickel column chromatography (D). Varying concentrations of eluted and dialyzed YodA-His

were tested for the ability to inhibit IFNγ mediated Stat-1 tyrosine phosphorylation (panels E and

F, respectively).

53

Figure 3.5

54

3.5 DISCUSSION

In the present study, we have shown that EHEC, but not EPEC, subverts the IFNγ signaling

pathway at the level of Stat-1 tyrosine phosphorylation. Direct contact of the non-invasive

enteric pathogen with host cells is not required to mediate this effect, as extracellular bacterial

culture medium was able to produce the effect associated with the subversion factor in the

absence of intact bacteria. Through a series of biochemical tests, we establish in this report that

the secreted bacterial factor has properties consistent with it being a protein (Figure 2), but it is

not secreted via the type two secretion protein export system.

Recent studies have found that subversion of innate immune pathways is a theme common to

multiple pathogens, illustrating the important role of the IFNγ signal transduction pathway in

combating microbial infections (Jones and Neish, 2011). For example, viruses of the

Paramyxoviridae family subvert the IFNγ pathway by degrading intracellular Stat-1 (Didcock et

al., 1999), while the parasite Leishmania donovani prevents tyrosine-phosphorylation of Stat-1

(Nandan and Reiner, 1995). The ability of EHEC O157:H7 to suppress the IFNγ pathway could

promote its ability to colonize the gut of the infected host by reducing immune surveillance

(Jones and Neish, 2011).

EHEC and EPEC both contain an array of virulence factors that aid in infection, of which the

LEE (Locus of Enterocyte Effacement) pathogenicity island encoded type three secretion system

(T3SS) is common to both; allowing the bacterium to adhere intimately onto host cells. The

LEE’s of EHEC and EPEC were acquired through horizontal gene transfer and provide these

non-invasive pathogens the ability to deliver effector proteins directly into host cells (Schmidt,

2010). These effectors allow the bacterium to subvert host cytoskeleton processes, destroy brush

border microvilli, and cause rearrangements of F-actin resulting in attaching and effacing (A/E)

lesions on epithelial cell surfaces (Frankel and Phillips, 2008; Garmendia et al., 2005; Kaper et

al., 2004).

Studies on the T3SS and its protein effectors have shown that many of these bacterial-derived

proteins have redundant and overlapping functions, each of which appears to have multiple roles

in subverting eukaryotic cellular processes, and thereby aid in disease pathogenesis (Dean and

Kenny, 2009). Despite both pathogens having a LEE, they are not identical, and many of the

effectors, while having similar effects on host cells, can vary between the two enteric pathogens

55

(Castillo et al., 2005; Muller et al., 2009). However, the EHEC LEE is not involved in subverting

the IFNγ signaling pathway, as demonstrated in this report by showing that an isogenic escN

mutant suppresses Stat-1 tyrosine phosphorylation comparable to the parental wild-type strain

(Figure 3.6A).

EHEC also contains other virulence factors distinct from EPEC, which gives this enteric

pathogen the ability to inhibit Stat-1 tyrosine phosphorylation. For instance, EHEC contains

phage encoded Shiga toxins, which are responsible for causing hemorrhagic colitis and

hemolytic-uremic syndrome (Lingwood, 1996; Obrig, 2010). EHEC also harbors the pO157

virulence plasmid that encodes a metalloprotease (stcE) (Lathem et al., 2002), a serine protease

(espP) (Brockmeyer et al., 2007), a hemolysin (ehxA) (Schmidt et al., 1994), a catalase-

peroxidase (katP) (Brunder et al., 1996), a putative adhesion (toxB) (Tatsuno et al., 2001), as

well as 22 other open reading frames that have no strong similarity with any known proteins

(Lim et al., 2010). However, the EHEC pO157 plasmid is also not involved in subverting the

IFNγ signal transduction pathway, because a pO157 plasmid cured mutant suppressed Stat-1

tyrosine phosphorylation comparable to the parental wild-type strain (Figure 3.6B).

56

Figure 3.6. EHEC LEE and pO157 are not involved in the suppression of the IFNγ

signaling pathway. Isogenic escN, and pO157 cured mutants were tested for their ability to

inhibit IFNγ mediated Stat-1 tyrosine phosphorylation (A and B, respectively).

57

Figure 3.6

58

The expression of the YodA protein in bacterial supernatants leads to its co-purification with the

Stat-1-P inhibitory activity that was present in the sample. Further, the relatively small size of the

protein, ~25kD, was consistent with the observed behavior of the inhibitory activity when

supernatant was passed through filters with defined molecular cut–offs. YodA therefore appeared

to match the characteristics of the inhibitor molecule, however our inability to detect Stat-1-P

suppression in the presence of overly expressed YodA (Figure 3.5C-D) suggests that this protein

is either not the inhibitor, or alternatively it is dysfunctional in the form in which it is expressed.

It’s recovery as a small molecule on the size exclusion column suggests that it does not natively

pair with another protein or entity for activity, however the resolution of the DEAE and the

Sepharose CL-6B columns may not be sufficient to detect if specific post-translational

modifications are required to create the activate form of the YodA protein. Nonetheless, the

inability of the purified YodA protein to suppress Stat-1 tyrosine phosphorylation, in addition to

the yodA mutant’s preserved ability to suppress Stat-1 tyrosine phosphorylation, indicates that

EHEC likely utilizes a different protein factor to suppress IFNγ activation.

EHEC undoubtedly contains other virulence factors which are distinct from EPEC, but which are

currently uncharacterized. Recent studies have shown that EHEC, strain EDL933 (5.62Mb;

5,312 genes) is roughly 11% larger than EPEC strain E2348/69 (5.07Mb; 4,554 genes)

(Lukjancenko et al., 2010). Further research focusing on the differences between the EHEC and

EPEC genomes will elucidate the EHEC-derived protein factor that is responsible for the

subversion of the IFNγ signaling pathway. Identification of this inhibitory factor(s) could

potentially be used to restore host cell signaling responses following EHEC infection and,

thereby, reduce the severity and spread of this infectious agent.

3.6 ACKNOWLEDGEMENTS: We thank Dr. John Brumell (University of Toronto) for the λ-

red knockout vectors pKD46, pKD3, pKD4 and pCP20 as well as for advice on E. coli

mutagenesis.

59

Chapter 4

Enterohemorrhagic Escherichia coli O157:H7 Shiga Toxins Inhibit

Interferon-gamma Mediated Cellular Activation

Published as:

Ho NK, Ossa JC, Silphaduang U, Johnson R, Johnson-Henry KC, Sherman PM (2012)

Enterohemorrhagic Escherichia coli O157:H7 Shiga Toxins Inhibit Interferon-gamma

Mediated Cellular Activation. Infect Immun. Manuscript number IAI00255-12R1. In

Press, July 2012.

60

4.1 ABSTRACT

Enterohemorrhagic Escherichia coli (EHEC) serotype O157:H7 is a foodborne pathogen that

causes significant morbidity and mortality in developing and industrialized nations. EHEC

infection of host epithelial cells is capable of inhibiting the interferon gamma (IFNγ) pro-

inflammatory pathway through the inhibition of Stat-1 phosphorylation, which is important for

host defense against microbial pathogens. The aim of this study was to determine the bacterial

factors involved in the inhibition of Stat-1 tyrosine phosphorylation. Human HEp-2 and Caco-2

epithelial cells were challenged directly with either EHEC or bacterial culture supernatants,

stimulated with IFNγ and then the protein extracts were analyzed by immunoblotting. The data

showed that IFNγ-mediated Stat-1 tyrosine phosphorylation was inhibited by EHEC secreted

proteins. Using 2D-Difference Gel Electrophoresis, EHEC Shiga toxins were identified as

candidate inhibitory factors. EHEC Shiga toxin mutants were then generated, complemented in

trans, and mutant culture supernatant was supplemented with purified Stx to confirm their ability

to subvert IFNγ-mediated cell activation. We conclude that while other factors are likely

involved in the suppression of IFNγ-mediated Stat-1 tyrosine phosphorylation, E. coli-derived

Shiga toxins represent a novel mechanism by which EHEC evades the host immune system.

61

4.2 INTRODUCTION

Enterohemorrhagic Escherichia coli (EHEC), including the most common serotype O157:H7, is

a non-invasive enteric bacterial pathogen that causes both sporadic cases and outbreaks of

diarrheal disease in humans as well as hemorrhagic colitis and hemolytic-uremic syndrome

(DuPont, 2009). Human infections with EHEC occur through the ingestion of contaminated

foodstuffs and water supplies, as well as from person-to-person transmission of the organism

(Croxen and Finlay, 2010).

One of the first lines of host defense against bacterial insult is through activation of the innate

immune system (Jones and Neish, 2011). Pro-inflammatory cytokines, including interferon

gamma (IFNγ), are secreted into the extracellular environment, and activate an anti-bacterial

state in the body (Shea-Donohue et al., 2010). IFNγ production by macrophages, Natural Killer

(NK) T cells and activated T cells triggers an antimicrobial state in host cells by tyrosine

phosphorylation of the signal transducer and activator of transcription-1 (Stat-1) molecule,

leading to dimerization, translocation to the nucleus, binding to the gamma-activating sequence

(GAS), and downstream up-regulation of up to 2,000 pro-inflammatory genes, such as inducible

nitric oxide synthase (iNOS), monocyte chemoattractant protein-1 (MCP-1), lymphocyte

adhesion protein ICAM-1, as well as increased MHC II expression (Saha et al., 2010; Schroder

et al., 2004). An intact IFNγ pathway is essential to fight off infection initiated from a wide range

of microbial pathogens, with patients harboring genetic defects in Stat-1 signaling being prone to

infection (Averbuch et al., 2011; Chapgier et al., 2006; Dupuis et al., 2003). IFNγ levels are

elevated in a mouse model of infection with Citrobacter rodentium, a murine-specific homolog

of enterohemorrhagic Escherichia coli (Higgins et al., 1999), and in humans following E. coli

infection (Long et al., 2010).

Subversion of the IFNγ pathway by microbial pathogens promotes bacterial colonization and

prevents bacterial clearance from the host (Jones and Neish, 2011; Pedron and Sansonetti, 2008).

EHEC has evolved a method to subvert the IFNγ pathway, through still unknown factor(s)

(Ceponis et al., 2003). Therefore, the aim of this study was to determine how EHEC infection

disrupts IFNγ signal transduction in human epithelial cells. The findings reveal that the IFNγ

signal transduction pathway, important for host defense, is compromised at the level of Stat-1

activation, at least in part, by EHEC-derived Shiga toxins (Stx).

62


Tissue culture

HEp-2 epithelial cells (ATCC CCL-23) were used as a model epithelial cell line, as previously

described (Jandu et al., 2009a). Briefly, cells were grown in minimal essential medium (MEM)

containing 15% (v/v) fetal bovine serum (FBS), 2% (v/v) sodium bicarbonate, 2.5% (v/v)

penicillin-streptomycin and 1% (v/v) amphotericin B (all from Invitrogen, Burlington, Ontario,

Canada). Cells were grown in T75 flasks (Corning Inc., Corning, NY) at 37°C in 5% CO2 until

confluent (8×106 cells/flask). Confluent cells were trypsinized using 0.05% trypsin (Invitrogen)

for 5 min at 37°C in 5% CO2. Trypsinized cells were then pelleted by centrifugation at 40g for 5

min (Beckman Coulter, Mississauga, ON, Canada), resuspended in MEM and re-seeded into

either 6 well (Becton Dickinson Labware, NJ) or 24 well dishes (Corning Inc.) and grown at

37°C in 5% CO2 until confluent. Prior to bacterial infection, cells were incubated in MEM

without antibiotics for 16h at 37°C in 5% CO2.

Caco-2bbe human colonic adenocarcinoma cells (ATCC CRL-2102) were used as a model

polarized epithelial cell line. These cells form confluent, polarized epithelial monolayers with

well-differentiated intercellular tight junction (TJ) structures and a pattern of brush border

protein expression that is comparable to that of primary human enterocytes (Peterson and

Mooseker, 1992). Briefly, cells were grown in Dulbecco's Modified Eagle Medium (DMEM),

10% FBS, 0.01 mg/ml human transferrin, 1 mM sodium pyruvate, 200 U/ml penicillin, and 200

μg/ml streptomycin (all reagents from GIBCO). Cell culture medium was changed to antibiotic-

free culture medium prior to experimental trials using equivalent conditions as those with HEp-2

cells.

Bacterial strains and growth conditions

Enterohemorrhagic E. coli O157:H7 strain EDL933 (EHEC) (accession: AE005174.2) and

enteropathogenic E. coli O127:H6 strain E2348/69 (EPEC) (accession: NC_011601.1) were used

in this study. Strains were cultured on 5% sheep blood agar plates (Becton, Dickinson and

Company, Sparks, MD) at 37°C for 16h and stored at 4°C until use. Prior to infecting epithelial

cells, bacteria were grown in 10 ml Penassay broth (Becton, Dickinson Co.) overnight at 37°C.

63

Isogenic mutant strains

Isogenic mutants were generated from EHEC O157:H7 strain EDL933 using a one-step

inactivation technique (Datsenko and Wanner, 2000) and primers in Table 4.1. Briefly, EDL933

was transformed with pKD46, and λ-red recombinase expression induced with L-arabinose at

30°C on a shaker until the OD600 reached 0.6. Mutants were generated by electroporating linear

DNA fragments containing a kanamycin or chloramphenicol resistance cassette with 5’ and 3’

flanking regions homologous to the gene target using primers targetKOP1 and targetKOP2 on

plasmid pKD4 (template plasmid with FLP recognition target sites flanking a kanamycin

resistance gene) or pKD3 containing the chloramphenicol resistance gene. Double knockouts

were generated from a previously created mutant after removal of the kanamycin resistance

cassette using pCP20. All mutants generated were verified by PCR.

64

Table 4.1. Primers employed in this study.

Name Sequence (5’->3’)

pBAD-stx2-F GCGCGAATTCGAAGAAACCAATTGTCCATATTGCATCA

pBAD-stx2-R GAATGGTACCCGCCCTTTTATTTACCCGTTGTATATA

pBAD-stx1-F GCGCGGTACCGAAGATCCTTTTTGATAATCTCATGACCA

pBAD-stx1-R GCGCGAATTCATCTAAAGTATATATGAGTAAACTTGGTCTGA

EscNKOP1 ATGATTTCAGAGCATGATTCTGTATTGGAAAAATACCCACGTGTAGG

CTGGAGCTGCTTC

EscNKOP2 GGCAACCACTTTGAATAGGCTTTCAATCGTTTTTTCGTAACATATGA

ATATCCTCCTTAG

EspAKOP1 ATGGATACATCAAATGCAACATCCGTTGTTAATGTGAGTGGTGTAGG

CTGGAGCTGCTTC

EspAKOP2 TTATTTACCAAGGGATATTGCTGAAATAGTTCTATATTGTCATATGA

ATATCCTCCTTAG

EspBKOP1 ATGAATACTATTGATAATACTCAAGTAACGATGGTTAATTGTGTAGG

CTGGAGCTGCTTC

EspBKOP2 TTACCCAGCTAAGCGACCCGATTGCCCCATACGATTCTGGCATATGA

ATATCCTCCTTAG

EspDKOP1 ATGCTTAACGTAAATAACGATACCCTGTCTGTAACGTCTGGTGTAGG

CTGGAGCTGCTTC

EspDKOP2 TTAAATTCGGCCACTAACAATACGACTATTTACCCGTGCTCATATGA

ATATCCTCCTTAG

EspFKOP1 ATGCTTAATGGAATTAGTAACGCTGCTTCTACACTAGGGCGTGTAGG

65

CTGGAGCTGCTTC

EspFKOP2 TTACCCTTTCTTCGATTGCTCATAGGCAGCTAAATGATCTCATATGAA

TATCCTCCTTAG

EspFuKOP1 ATGATTAACAATGTTTCTTCACTTTTTCCAACCGTCAACCGTGTAGGC

TGGAGCTGCTTC

EspFuKOp2 TCACGAGCGCTTAGATGTATTAATGCCATGCTCTGCAAGACATATGA

ATATCCTCCTTAG

FliCKOP1 ATGGCACAAGTCATTAATACCAACAGCCTCTCGCTGATCAGTGTAGG

CTGGAGCTGCTTC

FliCKOP2 TTAACCCTGCAGCAGAGACAGAACCTGCTGCGGTACCTGGCATATG

AATATCCTCCTTAG

Stx1KOP1 ATGAAAATAATTATTTTTAGAGTGCTAACTTTTTTCTTTGGTGTAGGC

TGGAGCTGCTTC

Stx1KOP2 TCAACTGCTAATAGTTCTGCGCATCAGAATTGCCCCCAGACATATGA

ATATCCTCCTTAG

Stx2KOP1 ATGAAGTGTATATTATTTAAATGGGTACTGTGCCTGTTACGTGTAGG

CTGGAGCTGCTTC

Stx2KOP2 TTATTTACCCGTTGTATATAAAAACTGTGACTTTCTGTTCCATATGAA

TATCCTCCTTAG

Stx1A-C’-P1 GAGGAATAATAAATGAAAATAATTATTTTTAGAGTGCTAACTTTTTT

Stx1A-C’-P2 TCAACTGCTAATAGTTCTGCGCA

Stx2A-C’-P1 GAGGAATAATAAATGAAGTGTATATTATTTAAATGGGTACTGTGC

Stx2A-C’-P2 TTATTTACCCGTTGTATATAAAAACTGTGACT

StcEKOP1 ATGAACACTAAAATGAATGAGAGATGGAGAACACCGATGAAATTAA

66

AGTAGTGTAGGCTGGAGCTGCTTC

StcEKOP2 TTATTTATATACAACCCTCATTGACCTAGGTTTACTGAAGTCCAAAT

ACTCATATGAATATCCTCCTTAG

TirKOP1 ATGCCTATTGGTAATCTTGGTCATAATCCCAATGTGAATAGTGTAGG

CTGGAGCTGCTTC

TirKOP2 TTAGACGAAACGATGGGATCCCGGCGCTGGTGGGTTATTCCATATGA

ATATCCTCCTTAG

Z1787KOP1 GTGCTTATGTGGATTGTGTTAGTACTGTCACTGTCAACTCGTGTAGG

CTGGAGCTGCTTC

Z1787KOP2 TCAATTATGTTTTAAAAATGGATAGGTAAAGAATAACAAGCATATG

AATATCCTCCTTAG

67

Bacterial complementation

The stx1A- and stx2A- mutants were complemented in trans by the introduction of the pBAD-

TOPO TA cloning kit (Invitrogen) containing either stx1A or stx2A under control of the

arabinose promoter. Briefly, the stx1A gene was PCR amplified using primers Stx1A-C’-P1 and

Stx1A-C’P2, while the stx2A gene was amplified using primers Stx2A-C’-P1 and Stx2A-C’-P2

to generate pBAD-stx1A and pBAD-stx2A plasmids, respectively. The stxDKO mutant was

complemented in trans by cloning the pBAD promoter and downstream stx2A gene from pBAD-

stx2 using primers pBAD-stx2-F and pBAD-stx2-R into the pBAD-stx1A inverse PCR product,

using primers pBAD-stx1-F and pBAD-stx1-R. All constructs were verified using PCR and

DNA sequencing (The Centre for Applied Genomics, Hospital for Sick Children, Toronto,

Ontario, Canada). Genes were induced in the complements with 0.02% arabinose while

generating bacterial cultured supernatants.

Bacterial culture supernatants

To collect sterile culture supernatants (CS), ~1x109 CFU/ml of EHEC O157:H7 strain EDL933

or EPEC O127:H6 strain E2348/69 culture were centrifuged (3,000g, 15 min) and resuspended

in 10 ml of serum free MEM without antibiotics. After 24h growth at 37°C in 5% CO2, the

medium was centrifuged (3,000g, 15 min), filtered (0.22 μm) and stored at 4°C. Sterility was

confirmed by lack of bacterial growth of 0.1 ml of culture supernatant plated onto 5% sheep

blood agar plates and incubated overnight at 37°C.

Proteinase K and heat inactivation treatment of culture supernatants

Bacterial culture supernatants from EHEC were incubated with proteinase K conjugated to

agarose beads (10 to 1000 µg/ml, 1h shaking, 37°C) (Sigma Aldrich, Oakville, Ontario, Canada).

Culture supernatants incubated with agarose beads and pre-incubated with bovine serum albumin

(5% BSA) were used as a negative control. After incubation, agarose beads were removed from

the solution by centrifugation (3,000g, 1 min) before incubation with HEp-2 cells. Culture

supernatants from EHEC were also heat inactivated by boiling (100°C, 0.5h) and cooled to 37°C

before incubation with HEp-2 cells.

68

Epithelial cell infection

Infection of HEp-2 or Caco-2 epithelial cells was performed at a multiplicity of infection (MOI)

of 100:1. Overnight bacterial culture (10 mL) was centrifuged (3,000g, 10 min), the supernatant

decanted, and bacterial pellets resuspended in 1.0 ml of antibiotic and serum-free MEM. An

aliquot of this bacterial suspension (~1×108 CFU in 0.1 ml) was then used to infect either

confluent HEp-2 or Caco-2 monolayers grown in 6 well plates (roughly 1x106 cells/well). The

cells were infected with either EHEC or EPEC for 6h at 37°C in 5% CO2. Infections at an MOI

of 10:1 required approximately 8hr for robust Stat-1 suppression. Cells were then washed with

PBS and stimulated with IFNγ (50 ng/ml; 0.5h at 37°C in 5% CO2), followed by whole cell

protein extracts for immunoblotting. To determine if active bacterial protein synthesis was

required to inhibit the phosphorylation of Stat-1, in a subset of experiments epithelial cells and

EHEC were incubated with chloramphenicol (100 μg/ml) at 0 to 4h after infectious challenge

(MOI 100:1, 6h).

Immunoblotting

Whole cell protein extracts were collected by resuspending epithelial cells in RIPA buffer (1%

Nonidet P-40, 0.5% sodium deoxylate, 0.1% sodium dodecyl sulfate [SDS] in PBS)

supplemented with 150 mM NaCl, 50 mM sodium fluoride, 1 mM sodium orthovanadate, 20

µg/ml phenylmethylsulfonyl fluoride, 15 µg/ml aprotinin, 2 µg/ml leupeptin, and 2 µg/ml

pepstatin A (all from Sigma Aldrich). Aliquots were applied directly onto cells, mixed and left

on ice for 0.5h. Re-suspended pellets were centrifuged at 20,000g for 1 min at 4°C. Supernatants

were collected and stored at −80°C until further analysis by western blotting.

Immunoblotting was conducted by combining whole cell protein extracts with SDS-PAGE

loading buffer in a 1:1 (v/v) ratio, incubation at 100°C for 3 min, followed by loading into

precast 10% polyacrylamide gels (Ready Gel®; BioRad Laboratories, Hercules, CA). Gels were

electrophoresed (150 V, 1h at room temperature), followed by protein transfer onto nitrocellulose

membranes (BioTrace NT; Pall Corporation, Ann Arbor, MI) (110 V, 1h at 4°C). Membranes

were incubated in Odyssey blocking buffer (Mandel Scientific Company Inc., Guelph, Ontario,

Canada) for 0.5h at room temperature on a shaker, followed by incubation with primary

antibodies (4°C overnight on a shaker). Primary antibodies included rabbit anti-native-Stat-1 (1

in 1,000 dilution; Cell Signaling, Beverly, MA), rabbit anti-phospho-Stat-1 (1 in 1,000 dilution;

69

Cell Signaling), rabbit anti-IRF1 (1 in 2,000 dilution; Sigma-Aldrich), and mouse anti-β-actin (1

in 5,000 dilution; Sigma). Membranes were washed 3 times with PBS+0.1% Tween (5 min per

wash) and then incubated with secondary antibodies (1h at RT on a shaker). Secondary

antibodies included IRDye 800 goat anti-rabbit IgG (1 in 20,000 dilution; Rockland

Immunochemicals, Gilbertsville, PA) and Alexa Fluor® 680 goat anti-mouse IgG (1 in 20,000

dilution; Molecular Probes, Eugene, OR).

Immunoblots were scanned into an infrared imaging system (Odyssey, LI-COR Biosciences,

Lincoln, NE), using both the 700 nm and 800 nm channels, and immunoblots scanned at a

resolution of 169 µm. Using automated software (LI-COR Biosciences) densitometry was

performed to obtain the integrative intensity of positively stained bands. Integrative intensity

values for each of the phospho-Stat-1 were normalized to the integrative intensity values

obtained for the corresponding β-actin bands as they were run on the same gel; native-Stat-1 is

presented to confirm that its levels are unaffected by incubation with EHEC, EPEC, or sterile

culture supernatants. Uninfected cells stimulated with IFNγ were used as positive controls, and

standardized to 100%. Densitometry values obtained from samples incubated with live bacteria,

or sterile culture supernatants, were then calculated as a percentage of the positive uninfected

control.

Cell cytotoxicity assay

Lactate dehydrogenase (LDH) released into the tissue culture medium from HEp-2 cells

challenged with bacteria or culture supernatants was quantified using Cytoscan (G-Biosciences,

St. Louis, MO). Briefly, HEp-2 cells were incubated with either live bacteria (MOI 100:1) or

culture supernatants for 6h. Supernatants were then transferred to a new 96-well plate, and

incubated with a commercial substrate mixture in the dark for 30 min at room temperature. A

stop solution was added to samples and absorbance at 490nm measured in a plate reader (Victor3

Reader, Perkin Elmer, Ontario, Canada). The level of LDH released from the infected cells was

calculated as a percentage, compared to LDH activity measured in total cell lysates.

2-D Gel electrophoresis

2-D Difference Gel Electrophoresis (DIGE) and protein identification was performed by Applied

Biomic Inc. (Hayward, CA). Briefly, 1 ml of 2D lysis buffer (30 mM Tris-HCl, pH 8.8, 7 M

urea, 2 M thiourea and 4% CHAPS), and EDTA (5 mM final concentration) was added to each

70

sample, and the mixtures transferred to 3K MWCO Amicon Filters (Millipore). The samples

were spun in a GS-6KR Centrifuge (Beckman Coulter) at 5,000g until the volume was

concentrated to 400 µl per sample. Samples were then transferred to 5K MWCO spin columns

(Sartorius Biolab Products, Goettingen, Germany), and spun at 15,000g until the volume was

concentrated to 50 µl per sample. The samples were precipitated with 100% methanol and

resuspended in 30 µl of 2D cell lysis buffer. The samples were sonicated at 4oC, followed by

shaking for 30 minutes at room temperature, centrifuged for 30 min at 15,000g and the

supernatants collected. Protein concentration was measured by Bradford assay (Bio-Rad).

For CyDye labeling, 30µg of protein was mixed with 1.0 µl of diluted Cy2 or Cy3 and kept in

the dark on ice for 0.5h. The labeling reaction was stopped by adding 1 µl of 10 mM lysine to

each sample and incubated in the dark on ice for an additional 15 min. The labeled samples were

then mixed together and 2X 2-D Sample buffer (8 M urea, 4% CHAPS, 20 mg/ml DTT, 2%

pharmalytes and a trace amount of bromophenol blue), destreak solution (GE Healthcare), and

rehydration buffer (7 M urea, 2 M thiourea, 4% CHAPS, 20 mg/ml DTT, 1% pharmalytes and

trace amount of bromophenol blue) were added to a final volume of 260 µl. The samples were

mixed well and spun down before loading onto a strip holder. After loading labeled samples onto

pH 3-10 linear IPG strips (GE Healthcare), isoelectric focusing was run for 12h rehydration at

20oC, followed by 500 V for 1000 VHr, 1000 V for 2000 VHr, and 8000 V for 24000 VHr. IPG

strips were then incubated in freshly made equilibration buffer-1 (50 mM Tris-HCl, pH 8.8,

containing 6 M urea, 30% glycerol, 2% SDS, trace amount of bromophenol blue and 10 mg/ml

DTT) for 15 min with gentle shaking. Strips were then rinsed in freshly made equilibration

buffer-2 (50 mM Tris-HCl, pH 8.8, containing 6 M urea, 30% glycerol, 2% SDS, trace amount of

bromophenol blue and 45 mg/ml iodacetamide) for 10 min with gentle shaking. Next, the IPG

strips were rinsed in SDS-gel running buffer before transferring into 12% SDS-gels (18 cm x 16

cm) followed by sealing with 0.5% agarose (Bio-Rad) in SDS-PAGE running buffer. The SDS-

gels were run at 15oC.

Image scan and data analysis

Gel images were scanned immediately following SDS-PAGE using Typhoon TRIO (Amersham

BioSciences). The scanned images were then analyzed by Image Quant software Version 6.0

(Amersham BioSciences), followed by in-gel analysis using DeCyder software Version 6.0

71

(Amersham BioSciences). Fold-change of protein expression levels was obtained from in-gel

DeCyder analysis, with a set cut-off of 1.5.

Shiga toxin immunoassay

The concentration of Stx1 and Stx2 present in culture supernatants of both wild-type (WT) and

mutant bacteria was determined by a Stx-capture ELISA as described previously (Atalla et al.,

2000; Chen et al., 1998; Ziebell et al., 2008) at the Laboratory for Foodborne Zoonoses, Guelph,

Ontario (LFZ). Briefly, flat-bottom wells of eight-well immunostrips (Nunc Maxisorb Immuno-

Module, Thermo Scientific) in 96-well frames were coated with 100 µl of 2 μg/ml rabbit anti-Stx

antibodies (LFZ) in carbonate-bicarbonate buffer pH 9.6, and then post-coated by the addition of

200 µl/well of a stabilizing/blocking solution (LFZ). The culture supernatants were added to

each well, incubated at 22°C for 30 min, and then washed five times with 300 µl of 0.01 M PBS

pH7.4 containing 0.1% Tween 20. Bound Stx in the wells were detected by sequential

incubations at 22°C with monoclonal antibodies directed against either Stx1 or Stx2/2c (2 µg/ml,

LFZ) for 30 min, followed by horseradish peroxidase-labeled anti-mouse IgG (Jackson

Immunoresearch, PA, USA) at 0.6 µg/ml for 30 min. Then, 100 µl of 3, 3’, 5, 5’ tetramethyl-

benzidine (Sigma Aldrich, Oakville, Ontario, Canada) was added for 10 min to induce color

development, and the reaction was stopped with 100 µl 0.2 M sulfuric acid. Plates were read in a

microplate spectrophotometer (ELx 808TM Ultra Microplate reader, Bio-Tek Instruments) at dual

wavelengths of 450/630 nm. Mean optical density of Stx standards were used to generate a

standard curve for each toxin, which was then used to calculate the amount of Stx1 and Stx2

present in the bacterial-derived culture supernatants.

Shiga toxin purification

Purified Shiga toxins were kindly provided by Dr. Clifford Lingwood, Hospital for Sick

Children. Shiga toxin 1 was purified from E. coli strain JB28 (Huang et al., 1986), as previously

described (Lingwood et al., 1987), and Shiga toxin 2 purified from E. coli R82pJES120DH5α, as

previously described (Tesh et al., 1994).

Statistics

Results are expressed as means, ± standard error (SE). One-way analysis of variance (ANOVA)

with Tukey’s multiple comparison test was performed to analyze the statistical significance of

72

the results between groups of treatments from multiple independent experiments. Analyses were

performed using Prism4 (GraphPad, San Diego, California, USA). Differences of p<0.05 were

considered significant.

73

4.4 RESULTS

EHEC, but not EPEC, inhibits IFNγ-mediated Stat-1 tyrosine phosphorylation in a non-

cytotoxic manner

To demonstrate that EHEC, but not EPEC, was able to subvert the IFNγ pathway, we assessed

the phosphorylation state of the Stat-1 molecule. In un-stimulated circumstances, Stat-1 is

normally not tyrosine phosphorylated, but becomes activated in response to IFNγ stimulation

(Saha et al., 2010). Infection with EHEC prevented Stat-1 tyrosine phosphorylation in response

to cytokine stimulation (Figure 4.1A) (Ho et al., 2012a; Jandu et al., 2007). By contrast,

infection with EPEC did not inhibit IFNγ-mediated Stat-1 tyrosine phosphorylation, indicating

that the ability to subvert IFNγ signaling is a specific ability of EHEC, and not all pathogenic E.

coli. Levels of native Stat-1 were not affected by either pathogen (Figure 4.1A). Both pathogens

have been demonstrated to adhere at similar levels to HEp-2 cells (Riff et al., 2005).

The addition of chloramphenicol, a specific bacterial protein synthesis inhibitor, prevented

bacterial inhibition of Stat-1 tyrosine phosphorylation in response to IFNγ within 1h of EHEC

infection (Figure 4.1B), suggesting that subversion of IFNγ-mediated Stat-1 tyrosine

phosphorylation is time dependent, and requires new and active bacterial protein synthesis. HEp-

2 cell cytotoxicity analysis confirmed that infection with EHEC or EPEC did not cause a

significant difference in cell death compared to uninfected controls (Figure 4.1C), indicating

that the lack of Stat-1 tyrosine phosphorylation due to IFNγ stimulation was not due to cell

death.

74

Figure 4.1. EHEC, but not EPEC, inhibits IFNγ-mediated Stat-1 tyrosine phosphorylation

in a non-cytotoxic manner. Whole-cell protein extracts from HEp-2 cells analyzed by

immunoblotting showed that (A) IFNγ-mediated (50 ng/ml, 0.5h) Stat-1 tyrosine

phosphorylation is suppressed by enterohemorrhagic Escherichia coli O157:H7, strain EDL933

(EHEC), but not by enteropathogenic Escherichia coli O127:H6, strain E2348/69 (EPEC) (MOI

of 100:1; 6h). (B) Incubation with chloramphenicol (100 µg/ml) up to 1h after infection with

EHEC (MOI 100:1; 6h) prevented EHEC suppression of IFNγ-mediated Stat-1 tyrosine

phosphorylation. (C) LDH cytotoxicity assay was performed on HEp-2 cells after infection with

EHEC or EPEC (MOI 100:1), or sterile EHEC culture supernatants (CS) for 6h (n=3, one-way

ANOVA, p>0.05). (D) Incubation with EHEC, but not EPEC, culture supernatants (6h)

suppressed IFNγ-mediated tyrosine phosphorylation of Stat-1. (E) Caco-2 bbe cells infected with

EHEC or with sterile EHEC CS, but not EPEC (MOI 100:1) suppressed IFNγ-mediated tyrosine

phosphorylation of Stat-1.

75

Figure 4.1

76

Inhibitor of IFNγ-mediated Stat-1 tyrosine phosphorylation is a secreted factor and affects

different cell lines

As shown in Figure 4.1D, EHEC, but not EPEC, culture supernatants inhibited Stat-1 tyrosine

phosphorylation in response to IFNγ stimulation. Culture supernatants harvested from bacteria

while in exponential growth phase (6h) showed less inhibitory properties than those generated at

stationary phase (24h) (data not shown). EHEC has been shown to successfully adhere and form

Attaching and Effacing (A/E) lesions with Caco-2-bbe cells, a human polarized epithelial cell

line (Tatsuno et al., 2000). Caco-2 incubation with EHEC (or culture supernatants) or EPEC

demonstrated similar results as the HEp-2 cell line (Figure 4.1E), indicating that the inhibitory

factor secreted by EHEC affects multiple cell lines. As shown in Figure 4.2A-B, the inhibitory

effects of EHEC-derived culture supernatants occurred in a time dependent manner. Taken

together, these findings demonstrate that a bacterial factor was secreted specifically from EHEC,

and that direct contact of the pathogen with host epithelia was not required for subverting IFNγ-

mediated Stat-1 tyrosine phosphorylation.

Secreted inhibitory factors are proteins

To verify that the inhibitory effects of EHEC were not due to heat resistant factors, such as

lipopolysaccharide (Rietschel and Brade, 1992; Rietschel et al., 1993), culture supernatants were

heated to 100°C for 30 min and then assessed for the ability to inhibit Stat-1 tyrosine

phosphorylation. Boiled culture supernatants did not inhibit Stat-1 tyrosine phosphorylation,

even after 6h of incubation with tissue culture epithelial cells (Figure 4.2C-D).

To confirm that the inhibitory factors were protein in nature, bacterial culture supernatants were

treated with proteinase K, and then tested for their ability to inhibit Stat-1 tyrosine

phosphorylation. Culture supernatants treated with agarose beads as a negative control still

blocked signaling responses to IFNγ, while those treated with increasing concentrations of

proteinase K progressively lost the ability to subvert IFNγ-mediated Stat-1 tyrosine

phosphorylation (Figure 4.2E- F).

77

Figure 4.2. Secreted factor(s) have protein-like qualities. Panels A, C, and E are

representative western blots of densitometry analyses shown in panels B, D, and F, respectively.

Whole cell protein extracts from HEp-2 cells analyzed by immunoblotting showed that (A, B)

incubation with sterile culture supernatants (CS) from EHEC, but not EPEC, (1, 3 and 6h)

increases suppression of IFNγ-mediated (50 ng/ml, 0.5h) Stat-1 tyrosine phosphorylation over

time (n=3, one-way ANOVA ,* p < 0.05). (C, D) Incubation with heat treated (100°C, 0.5h)

EHEC CS did not suppress IFNγ-mediated Stat-1 tyrosine phosphorylation. (E, F) incubation

with EHEC CS (6h) pre-treated with proteinase K conjugated to agarose beads (0 – 1,000 mg/ml,

37°C, 1h) did not suppress IFNγ-induced tyrosine phosphorylation of Stat-1 (n=3, one-way

ANOVA ,* p < 0.05).

78

Figure 4.2

79

Comparative proteomic profiles of EHEC- and EPEC-secreted proteins

To identify the EHEC factor involved in subverting IFNγ-mediated Stat-1 phosphorylation, the

secreted protein profile of EHEC O157:H7 (Figure 4.3A in green) was compared with EPEC

O126:H7 (Figure 4.3B in red). Secreted proteins from both enteric pathogens were differentially

labeled, separated using 2D difference gel electrophoresis (2D-DIGE), and the gels overlayed to

compare profiles between the two pathogens (Figure 4.3C). Densitometry analyses revealed

increased, decreased and no change in 124, 216 and 190 proteins, respectively in EHEC culture

supernatants compared to EPEC culture supernatants. Subsequently, proteins that were over-

expressed in the EHEC fraction compared to the EPEC fraction were identified using Mass

Spectrometry, and 14 isogenic EHEC mutants were generated using the λ-red gene deletion

technique (Datsenko and Wanner, 2000) to determine if the proteins identified were involved in

subverting the IFNγ signal transduction pathway (Table 4.2).

80

Figure 4.3. Comparative proteomic profiles between EHEC- and EPEC-secreted proteins.

Culture supernatants from EHEC (A) or EPEC (B) were separated by 2D Difference Gel

Electrophoresis (DIGE) and labeled with Cy3 and Cy2, respectively. Resulting gels were

overlayed (C), and candidate spots then picked and identified using mass spectrometry.

81

Figure 4.3

82

Table 4.2. List of bacterial strains and plasmids used in this study

Strains and

plasmids Description

Affects

IFNγ

Signaling Reference

E. coli O127:H6

strain E2348/69 Wild-type EPEC strain used in this study -

(Philpott

et al.,

1996)

E. coli O157:H7

strain EDL933 Wild-type EHEC strain used in this study +

(Karmali

et al.,

2003)

espA espA disrupted by kanamycin resistance cassette - This study

espB espB disrupted by kanamycin resistance cassette - This study

espD espD disrupted by kanamycin resistance cassette - This study

espF espF disrupted by kanamycin resistance cassette - This study

espFu espFu disrupted by kanamycin resistance cassette - This study

espF/Fu

espFu disrupted by kanamycin resistance cassette of

espF kanamycin cassette cured mutant - This study

fliC fliC disrupted by kanamycin resistance cassette - This study

pO157 cured

pO157 plasmid cured mutant using pCURE2 kit (Hale

et al., 2010) - This study

stx1A stx1A disrupted by kanamycin resistance cassette + This study

stx2A stx2A disrupted by kanamycin resistance cassette + This study

stxDKO stx1A disrupted by kanamycin resistance cassette of + This study

83

stx2A kanamycin cassette cured mutant

stxDKO + escN

StxDKO mutant with escN gene disrupted by a

chloramphenicol casette + This study

stcE stcE disrupted by kanamycin resistance cassette - This study

Tir Tir disrupted by kanamycin resistance cassette - This study

Z1787 Z1787 disrupted by kanamycin resistance cassette - This study

Plasmids

pBAD-stx1A

stx1A gene inserted downstream of the pBAD-TOPO

plasmid + This study

pBAD-stx2A

stx1A gene inserted downstream of the pBAD-TOPO

plasmid + This study

pBAD-stx12

pBAD promoter and downstream stx2A gene inserted

in the vector backbone of the pBAD-stx1A plasmid + This study

84

Stx1A and Stx2A suppress IFNγ-mediated Stat-1 tyrosine phosphorylation

Of the isogenic mutants generated, only culture supernatants from the stx1A- and stx2A- isogenic

mutants partially (n=5, p<0.05) recovered Stat-1 tyrosine phosphorylation in response to IFNγ

(Figure 4.4A-B). Culture supernatants prepared from a Stx double gene knockout (stxDKO)

completely recovered Stat-1 phosphorylation (n=5, p<0.05), compared to culture supernatants

derived from the parent strain (Figure 4.4A-C), indicating that secreted Shiga toxins mediate

EHEC suppression of the IFNγ signaling pathway. The amount of Stx1 and Stx2 present in

culture supernatants was measured using an established ELISA assay (Ziebell et al., 2008), and

the levels were confirmed to be reduced by the λ-red gene deletion technique (Table 4.3).

Culture supernatants from the complemented mutants returned Stat-1 tyrosine phosphorylation to

levels comparable to wild-type, indicating that each of the Shiga toxins contribute to the

suppression of IFNγ-mediated Stat-1 tyrosine phosphorylation (Figure 4.4A-C). To further

confirm that Shiga toxins are involved in the suppression of IFNγ-mediated Stat-1 tyrosine

phosphorylation, epithelial cells were incubated with mutant culture supernatants supplemented

with purified Stx1 and Stx2. Incubation with these supernatants showed suppressive effects that

were comparable to wild-type culture supernatant (Figure 4.4B-C). However, experiments with

purified Stx alone did not inhibit Stat-1 tyrosine phosphorylation (data not shown). These results

indicate that while Stx1 and Stx2 play a role in inhibiting Stat-1 phosphorylation, it is possible

that other bacterial-derived factors are also involved.

To confirm that the IFNγ signaling pathway is subverted due to EHEC Stx, IRF1 expression was

assessed. IRF1 expression is induced only after IFNγ stimulation (Saha et al., 2010). Similar to

Stat-1 tyrosine phosphorylation, incubation of cells with EHEC culture supernatants prior to

IFNγ stimulation suppressed IRF1 expression, whereas incubation with EPEC or the stxDKO

culture supernatants did not have an inhibitory effect (Figure 4.4D).

85

Figure 4.4. Shiga-like toxins from EHEC suppress IFNγ-mediated activation of Stat-1.

Whole cell protein extracts from HEp-2 cells analyzed by immunoblotting showed that

incubation with sterile culture supernatants (CS) from EHEC Shiga-like toxin single mutants

partially suppressed IFNγ-mediated (50 ng/ml, 0.5h) tyrosine phosphorylation of Stat-1, while

the suppressive ability from the stxDKO mutant was completely ablated. (A) A representative

western blot showing CS from single and double mutants inhibiting Stat-1 tyrosine

phosphorylation less than WT CS, and CS from bacterial complements returning suppression to

WT levels. (B) A representative western blot showing CS from single and double mutants

supplemented with either purified Stx1 (5 ng/ml), Stx2 (50 ng/ml) or both suppressing IFNγ-

mediated Stat-1 tyrosine phosphorylation at levels comparable to WT CS. (C) Densitometry

analysis of western blotting (n=3-5, one-way ANOVA, * p<0.05). (D) Whole cell protein

extracts from HEp-2 cells analyzed by immunoblotting showed that incubation with EHEC, but

not EPEC or EHEC stxDKO, culture supernatants (6h) suppressed IFNγ-mediated (50 ng/ml, 2h)

expression of IRF1.

86

Figure 4.4

87

Table 4.3. Quantification of Stx1 and Stx2 present in culture supernatants obtained from

WT E. coli O157:H7 strain EDL933, and corresponding isogenic mutants. Results are

expressed as means, +/- SD (n=3).

Bacterial

strain

Stx1 (ng/ml) Stx2 (ng/ml)

WT 3.84 ± 0.28 33.59 ± 1.58

stx1A- 1.21 ± 0.05 28.66 ± 0.93

stx2A- 0.96 ± 0.11 5.60 ± 0.23

stxDKO 0.32 ± 0.01 5.06 ± 0.46

88

4.5 DISCUSSION

In the present study, we show that EHEC, but not EPEC, subverts the IFNγ signaling pathway at

the level of Stat-1 tyrosine phosphorylation in different human epithelial cell lines. Direct contact

of this pathogen with host cells is not required to mediate the effect, and the subversive factor is

secreted into the extracellular culture medium. Through a series of complementary biochemical

tests, we have now established that at least one of the secreted factors is protein in nature, and

through genetic manipulation of the EHEC chromosome and the use of purified Stx, we show

that EHEC suppresses IFNγ-mediated Stat-1 phosphorylation at least in part through elaboration

of Shiga toxins.

While EHEC produces an array of virulence factors that aid in infection such as

lipopolysaccharide (Landoni et al., 2010) and flagella (Bellmeyer et al., 2009), one of the

virulence factors classically associated with EHEC infection are its Shiga toxins, which can

cause systemic complications including hemorrhagic colitis and the hemolytic-uremic syndrome

(Obrig, 2010). The German E. coli O104:H4 outbreak in May 2011, where approximately 4000

cases of infection and 50 deaths were reported, was due to an enteroaggregative E. coli that

acquired the ability to produce Stx2 (Bielaszewska et al., 2011; Rasko et al., 2011). The

importance of Stx2 mediating infection severity stems from the fact that E. coli O104:H4 without

Stx2 was previously associated with sporadic cases of human disease, but not with large-scale

outbreaks (Frank et al., 2011; Kuijper et al., 2011).

Another EHEC virulence factor is its pathogenicity island encoded type three secretion system

(T3SS), which allows the bacterium to disrupt host processes by injecting protein effectors

directly into the host cell (Spears et al., 2006). Studies on the T3SS and its effectors have found

that many of these bacterial-derived proteins have redundant and overlapping functions, each of

which appears to have multiple roles in subverting eukaryotic cellular processes, and thereby aid

in EHEC-mediated pathogenesis (Dean and Kenny, 2009). For example, EspF in EHEC and

EPEC plays multiple roles in the subversion of host cellular pathways, such as effacing the

microvilli of infected cells, disrupting the nucleolus, and preventing phagocytosis to name a few

(Holmes et al., 2010). Furthermore, EspF, along with Tir and Map, all contribute to SGLT-1

inactivation (Wong et al., 2011). Our novel finding that EHEC Shiga toxins possess the ability

89

to subvert IFNγ-mediated Stat-1 tyrosine phosphorylation, supports previous findings that EHEC

virulence proteins can be multifunctional, cooperative and redundant (Dean and Kenny, 2009).

Recent studies have found that subversion of innate immune pathways is a theme common to

multiple pathogens, illustrating the important role of the IFNγ signal transduction pathway in

fighting off microbial infections (Jones and Neish, 2011). For example, viruses of the

Paramyxoviridae family subvert the IFNγ pathway by degrading intracellular Stat-1 (Didcock et

al., 1999), while the parasite Leishmania donovani prevents the phosphorylation of Stat-1


promote its ability to colonize the gut (Jones and Neish, 2011).

While previous studies from our laboratory suggested that culture supernatants were not capable

of suppressing IFNγ-mediated Stat-1 tyrosine phosphorylation (Jandu et al., 2006), it has been

demonstrated that bicarbonate ions stimulate gene expression in EHEC (Abe et al., 2002), and

we were able to induce expression of the inhibitory factors through the supplementation of

sodium bicarbonate in the media (Ho et al., 2012a). Furthermore, our laboratory has also

published studies that Shiga toxins were not involved in the suppression of IFNγ-mediated Stat-1

tyrosine phosphorylation (Ceponis et al., 2003; Jandu et al., 2006). In the present study, we show

through the use of knockout mutagenesis, genetic complementation in trans, as well as

supplementation with purified Stx that these toxins are involved in the suppression of Stat-1

activation. While Stx classically enters the cell through the globotriaosylceramide (Gb3) receptor

present in HEp-2 cells (Ching et al., 2002), the role of the glycolipid receptor in mediating the

suppression of Stat-1 tyrosine phosphorylation is uncertain, because EHEC O157:H7 also

suppresses IFNγ-mediated Stat-1 activation in Gb3-negative T84 epithelial cells (Jandu et al.,

2006) in which Stx still undergoes retrograde trafficking (Maluykova et al., 2008). Furthermore,

no suppression of Stat-1 activation was observed when purified Stx was added without culture

supernatant (data not shown). Indeed, direct infection of the stxDKO mutant, or even a triple

mutant with an inactivated T3SS (stxDKO + escN) (Golan et al., 2011) suppressed IFNγ-

mediated Stat-1 tyrosine phosphorylation completely (Figure 4.5), indicating that there are likely

to be additional factors involved in the suppression of Stat-1 tyrosine phosphorylation, and which

may explain why WT culture supernatants did not fully suppress Stat-1 tyrosine phosphorylation.

90

Figure 4.5. Infection with an EHEC StxDKO and T3SS triple mutant suppresses IFNγ

mediated Stat-1 phosphorylation comparable to the wild-type strain. Whole-cell protein

extracts from HEp-2 cells showed that Stat-1 tyrosine phosphorylation is suppressed equally

between enterohemorrhagic Escherichia coli O157:H7 strain EDL933, and a triple mutant with

gene knockouts in Stx1, 2, and the type 3 secretion system (escN-).

91

Figure 4.5

92

To our knowledge, this is the first study to show that Shiga toxins modulate IFNγ signaling, and

supports recent findings that each of EHEC’s many effectors has multiple and overlapping roles

in subverting host cell processes (Dean and Kenny, 2009; Hamada et al., 2010). Further research

should elucidate the mechanisms by which these Shiga toxins are able to suppress Stat-1 tyrosine

phosphorylation. Such information then could be used to restore host signaling responses to

EHEC infection and, thereby, reduce the severity and spread of this infectious agent.

4.6 Acknowledgments: We thank Dr. John Brumell (University of Toronto, Toronto, Ontario,

Canada) for the λ-red knockout vectors pKD46, pKD3, pKD4 and pCP20 as well as for advice

on E. coli mutagenesis. We also thank Drs. Clifford Lingwood and Beth Binnington (The

Hospital for Sick Children, Toronto, Ontario, Canada) for purified Shiga toxins. 2D-gel analyses

were done by Applied Biomics (Hayward, CA). This work was supported by an operating grant

from the Canadian Institutes of Health Research (MOP-89894). NH was supported by a doctoral

research award from the Canadian Institutes of Health Research (JDD-95413). PMS was

supported by a Canada Research Chair in Gastrointestinal Disease.

93

Chapter 5

Immune Signaling Responses in Intestinal Epithelial Cells

Exposed to Pathogenic Escherichia coli and Lactic Acid-

Producing Probiotics

Manuscript submitted:

Ho NK, Ossa JC, Hawley S, Mathieu O, Tompkins TA, Johnson-Henry KC, Sherman PM.

Immune Signaling Responses in Intestinal Epithelial cells Exposed to Pathogenic Escherichia

coli and Lactic Acid-Producing Probiotics. Manuscript Accepted Pending Revision. Journal

of Beneficial Microbes

94

5.1 ABSTRACT

Enterohemorrhagic Escherichia coli O157:H7 and adherent-invasive Escherichia coli are two

groups of enteric bacterial pathogens associated with hemorrhagic colitis and Crohn’s Disease,

respectively. Bacterial contact with host epithelial cells stimulates an immediate innate immune

response designed to combat infection. In this study, immune responses of human epithelial cells

to pathogens, either alone or in combination with probiotic bacteria Lactobacillus helveticus

strain R0052 and Lactobacillus rhamnosus strain GG (LGG), were evaluated using

complementary microarray and qRT-PCR approaches. Results showed host immune activation

responses induced following pathogen exposure, which were ameliorated using probiotics, with

the effect dependent on both the preparation employed and conditions of exposure. These

findings provide additional support for the concept that specific probiotic strains serve as a

promising option for use in preventing the risk of enteric bacterial infections.

95

5.2 INTRODUCTION

Enterohemorrhagic and Adherent-invasive Escherichia coli (EHEC and AIEC, respectively), are

two bacterial enteric pathogens associated with human intestinal diseases (Croxen and Finlay,

2010). While EHEC is non-invasive and causes sporadic outbreaks of diarrhea as well as

hemorrhagic colitis (HC) and hemolytic-uremic syndrome (HUS) in humans (DuPont, 2009),

AIEC is invasive and is associated with Crohn’s Disease, a chronic inflammatory condition of

the gastrointestinal tract (Darfeuille-Michaud et al., 1998).

Following ingestion and gut colonization, epithelial cell contact with bacterial pathogens triggers

an innate immune response through pathogen-recognition receptors (PRRs) present both on the

cell surface and in the cytosol. PRRs are typically transmembrane proteins that detect pathogen-

associated molecular patterns (PAMPs), which activate an inflammatory response characterized

by the activation of pro-inflammatory and anti-microbial pathways leading to cytokine

production and chemokine-mediated recruitment of acute inflammatory cells (Dalpke et al.,

2003; Shang et al., 2008). Current treatment regimens against EHEC infections are limited to

supportive therapies (such as fluids to prevent dehydration), because the use of antibiotics may

increase the development of HUS both in children (Wong et al., 2000) and adults (Dundas et al.,

2001).

Probiotics are live, non-pathogenic micro-organisms that confer health benefits to the host, and

are increasingly being employed as an option for preventing and treating bacterial infections

(Gareau et al., 2010). For instance, probiotic bacteria alter the activation, expression and

secretion of pro-inflammatory cytokines (like TNFα) and chemokines (CXCL-8) caused by

enteric pathogens (Gareau et al., 2011). Specifically, Lactobacillus helveticus R0052 and

Lactobacillus rhamnosus GG are two probiotic strains of bacteria that can alter host cell gene

expression responses to pathogens (Donato et al., 2010; Jandu et al., 2009b).

The aim of the current study was to characterize the effects of EHEC O157:H7- and AIEC LF82-

mediated innate immune activation of infected epithelial cells by employing a reductionist tissue

culture cell model in the absence and presence of probiotic bacteria. The findings show that

probiotics modulate pathogen-induced immune responses in epithielia in a preparation, duration

and strain specific manner.

96


Tissue culture: Caco-2bbe human colonic adenocarcinoma cells (ATCC CRL-2102) were used

as a model polarized epithelial cell line. These cells form confluent, polarized epithelial

monolayers with well-differentiated intercellular tight junctions (TJ) and a pattern of brush

border protein expression comparable to that of primary human enterocytes (Peterson and

Mooseker, 1992). Briefly, cells were grown in Dulbecco's Modified Eagle Medium (DMEM),

10% fetal bovine serum (FBS), 0.01 mg human transferrin ml−1, 1 mM sodium pyruvate, 200 U

penicillin ml−1 and 200 μg streptomycin ml−1 (all reagents from Gibco, Burlington, Ontario,

Canada). Tissue culture medium was changed to antibiotic-free culture medium prior to

experimental trials.

Bacterial strains and growth conditions: Enterohemorrhagic E. coli (EHEC) O157:H7, strain

EDL933 (accession: AE005174.2) and Adhesive-Invasive E. coli (AIEC) O83:H1, strain LF82

(courtesy of Dr. A. Darfaud-Michaud, Clermont-Ferrand, France) were cultured on 5% sheep

blood agar plates (Becton, Dickinson Co., Sparks, MD) at 37°C for 16h and stored at 4°C until

use. Prior to infecting epithelial cells, bacteria were grown in 10 ml of static Penassay broth

(Becton, Dickinson Co.) overnight at 37°C. Probiotic bacteria, Lactobacillus helveticus strain

R0052 (Lallemand Human Nutrition, Montreal, Quebec, Canada), and Lactobacillus rhamnosus

strain GG (LGG) (ATCC Accession #53103) were cultured on MRS agar plates (Becton,

Dickinson Co.) at 37°C for 16h and then stored at 4°C until use. Prior to challenge of epithelial

cells, bacteria were grown in 10 ml MRS broth (Becton, Dickinson Co.) overnight at 37°C. For

comparative purposes, an industrially prepared and lyophilized sample of L. helveticus strain

R0052 was tested (Lallemand Human Nutrition). For rehydration, 1g of lyophilized bacteria was

mixed for 15 min at room temperature in phosphate buffer (0.1 % soy peptone (w/v), 0.121 %

K2HPO4 (w/v), 0.034 % KH2PO4 (w/v)) prior to incubation with epithelial cells.

Epithelial cell infection and RNA extraction: Microbial challenge of Caco-2-bbe cells was

performed at a multiplicity of infection (MOI) of 100:1 for probiotic bacteria and 10:1 for

pathogenic bacteria. Bacterial cultures grown overnight (10 mL) were centrifuged (3,000g, 10

min), the supernatant decanted and bacterial pellets resuspended in 1.0 ml of antibiotic and

serum-free MEM. An aliquot of the bacterial suspension was then applied to the apical

compartment of confluent Caco-2 monolayers grown in T25 flasks (roughly 1x108 pathogens and

97

1x109 probiotics per flask). Polarized cells were exposed to probiotics or pathogens for 3h at

37°C in 5% CO2 either independently or in co-challenge experiments. In some instances, the

Caco-2 epithelial cells were pre-incubated for 3h with a probiotic and then for an additional 3h

with the enteropathogen. Cells were then washed with PBS and resuspended in Trizol reagent

(Invitrogen, Burlington, Ontario, Canada).

RNA was collected and purified using a Qiagen RNeasy Kit, following the manufacturer’s

instructions, and verified for concentration using a Nanodrop 2000c spectrophotometer (Thermo

Scientific, New York, NY) and quality using an Agilent 2100 bioanalyzer at the Centre for

Applied Genomics at the Hospital for Sick Children (Toronto, Ontario, Canada). All RNA

samples were verified to have a RIN value of 9.7 or greater and an A260/280 ratio between 1.9

and 2.1.

Immune Microarray: As previously described (Kanehisa and Goto, 2000), ImmuneArray2 is a

custom-designed two-color, long oligonucleotide DNA microarray detecting 1,354 specific

genes in 17 pathways related to innate immune function and barrier defense. Eleven genes to be

used for q-RT-PCR were added to confirm gene expression: B2M, GAPDH, HPRT1, MAN1B1,

MTR, MYC, POLR2A, RPLP0, RPS14 and SI (Dydensborg et al., 2006). These genes were

selected from the Kyoto Encyclopedia of Genes and Genomes (KEGG) database and the gene

specific long oligonucleotides sequences (70-mers) recovered from the Human Exonic Evidence

Based Oligonucleotide (HEEBO) database (Kim and Pollack, 2009). Oligonucleotides were

synthesized (IDT Integrated Technology Inc., IA) at a normalized concentration of 25 mM and

spotted onto Corning UltraGAPS Coated Slides using a PBI robot from Vertex. The

ImmuneArray2 was repeated twice per slide in six subgrids and each gene was spotted in

duplicate. Microarray slides were printed in the Microarray Laboratory at the National Research

Council Biotechnology Research Institute (Montreal, Quebec, Canada). Additional information

regarding the microarray platform can be found at the NCBI Gene Expression Omnibus (GEO;

http://www.ncbi.nlm.nih.gov/geo/) under GEO platform no. GPL6366.

After extraction and purification from Caco-2-bbe cells, 15 μg of total RNA was converted into

cDNA by using Super Script III (200 U; Invitrogen) and either Cy5- or Cy3-labeled dCTP (1

mM; GE Healthcare Life Sciences, Buckinghamshire, England), as previously described

(Marquis et al., 2008), except that 1.5 µL of Oligo dT23 primers (3.0 µg µl-1) was used. cDNA

was purified with QIAquick PCR Purification Kit (Qiagen, Toronto, Ontario, Canada), according

98

to manufacturer’s instructions and then concentrated by evaporation under vacuum. Labeled

cDNA was then used to hybridize to the Immune Array. The prehybridization and hybridization

at 50°C were performed, as described previously (Marquis et al., 2008). The arrays were washed

twice for 5 min with 1X saline sodium citrate (SSC; 20× SSC is: 3 M sodium chloride, 0.3 M

sodium citrate, pH 7.0) and 0.1 % sodium dodecyl sulfate (SDS) at 42°C and then at room

temperature for 2 min with 1X SSC and one time with 0.1X SSC. Slides were then scanned,

digitized images acquired using a ScanArray 5000 (Perkin-Elmer, Waltham, MA) and the

intensities of individual spots from 16-bit TIFF images quantified using QuantArray software

package (Perkin-Elmer).

Microarray Analyses: Assessment of slide quality, LOWESS normalization within slide,

Aquantile normalization between slides, and statistical analyses were conducted using the

Limma Package from BioConductor in R software (version 2.8.1). The comparative analysis

consisted of a minimum of four dye-swap hybridizations of Caco-2-bbe cells treated with

pathogens or probiotics compared to unchallenged Caco-2-bbe. For each treatment, biological

replicates consisted of Caco-2-bbe RNA extracted on different days. Genes with significant

changes in transcript abundance were selected with two criteria: a t-test p value below 0.05 and a

change in transcript abundance of at least 1.3-fold. Cluster and principal component analyses

were carried out with the MultiExperiment Viewer, which is part of the TM4 Microarray

Software from J. Craig Venter Institute (Saeed et al., 2003).

Relative q-RT-PCR: Measurement of transcript abundance of differentially expressed and

reference genes were confirmed by quantitative Real-Time PCR (qRT-PCR) on cDNA. Samples

were standardized to 1 µg of mRNA using a Nanodrop 2000c spectrophotometer (Thermo

Scientific, New York, NY) and then treated with DNaseI (Invitrogen) and converted to cDNA

using an iScript cDNA synthesis kit (Bio-Rad). Resulting cDNA was diluted 1:5 prior

amplification and 2 µl of diluted cDNA used as template in qPCR with 300 nmol of gene

specific primers in a 10 µl reaction volume in Ssofast Evagreen supermix (Bio-Rad). Primers

were designed using the online QPrimerDepot tool (http://primerdepot.nci.nih.gov/) (Cui et al.,

2007). qRT-PCR quality control and primer standardization were conducted as outlined by the

Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE)

guidelines adapted by Bio-Rad (Taylor et al., 2010). Initial incubation of 5 min at 95°C was

performed followed with forty cycles consisting of template denaturation (15s at 95°C) and by

99

one-step annealing and elongation (30s at 60°C) with a CFX1000 thermocycler (Bio-Rad).

Changes in gene expression were quantified using the Bio-Rad CFX qRT-PCR software

normalized to the geometric mean of three reference genes: β-actin, RPLP0, and β2-

microglobulin.

Statistical analyses: For qRT-PCR, results were expressed as means, ± standard error (SE). Two-

way analysis of variance (ANOVA) with a Bonferroni post-test was performed to analyze the

statistical significance of results between groups of treatments from multiple independent

experiments. Analyses were performed using Prism4 (GraphPad, San Diego, California, USA).

Differences of p<0.05 were considered significant.

100

5.4 RESULTS

Enteric pathogens and probiotics are dramatically different in inducing host gene

responses. Principal Component Analysis (PCA), Non-Negative Matrix Factorization (NMF),

and genetic heat map analyses of the gene expression profiles of Caco-2 cells showed distinct

differences when incubated with either pathogens or probiotics (Figure 5.1). By contrast, under

the experimental conditions employed, co-challenge with both a pathogen and a probiotic

showed little deviation away from pathogen-infected Caco-2 cells only.

According to microarray analysis, 131 genes were significantly affected by at least one of the

infection conditions (p<0.05, fold difference ≥ 1.3), and were combined into 7 groups based on

their cellular effects: pro-inflammatory, anti-inflammatory, cellular growth/protection, cell

death/arrest, tight junctions, cytoskeletal genes, and other (Table 5.1). Of these 131 genes, a

sample of 17 representative genes in each of the 7 groups were selected for qRT-PCR analysis,

and then compared to three reference genes: ACTB, B2M, and RPLP0. The 11 genes with primer

sets meeting qPCR quality control (Table 5.2) were then used to confirm the microarray

analysis.

101

Figure 5.1. Gene expression profiles of Caco-2-bbe cells incubated with either Escherichia coli

O157:H7 strain EDL933 (EDL933), Escherichia coli O83:H1 strain LF82 (LF82), Lactobacillus

helveticus strain R0052 (R0052) or in combination for 3h were analyzed by (A) Principle

component Analysis (PCA), or (B) Non-Negative Matrix Factorization (NMF) to separate them

in a two-dimensional space according to genes modified significantly. Heat map analysis (C)

showed 131 out of 1,354 genes present on the ImmuneArray were modulated significantly by at

least 1.3-fold by one of the microbes. Transcriptional profiles were organized by two-

dimensional hierarchical clustering where more abundant transcripts in Caco-2 cells treated with

bacteria compared to untreated Caco-2 cells are shown in red, and less abundant transcripts are

shown in green. All analyses were done using independently collected samples (n=6, p < 0.05,

fold difference ≥ 1.3).

102

103

Table 5.1: Genes modified significantly in the ImmuneArray analysis.

Function EDL933 LF82 EDL933

+

R0052

LF82+

R0052

R0052

Pro-inflammation

AICDA – involved in IG class switching No

change

No

change

No

change

No

change

up

ATF4 camp response element binder. Pro-

inflammatory.

No

change

No

change

Up No

change

No

change

BCL3 NFKB associated – pro-inflamation Up Up Up Up No

change

BMP2 TGFb family of proteins – involved

in cytokine-cytokine receptor

interactions

Up Up Up Up No

change

C3 complement component C3 No

change

No

change

No

change

up up

CCL3 CC type chemokine that activates

PMN’s – pro-inflammatory

chemokine

No

change

No

change

No

change

No

change

No

change

CCL20 CC type chemokine that activates

PMN’s – pro-inflammatory

chemokine

Up Up Up Up No

change

CD1D - Antigen-presenting protein that binds

self and non-self glycolipids and

presents them to T-cell receptors on

natural killer T-cells

No

change

up No

change

No

change

No

change

CD276 – costimulatory B-cell molecule No

change

up No

change

No

change

No

change

CEBPB - transcriptional activator in the Up No Up No No

104

regulation of genes involved in

immune and inflammatory responses

– pro-inflammatory

change change change

CKLFSF4 AKA CMTM4. Chemokine like

protein – proinflammatory.

No

change

No

change

down No

change

No

change

CLCF1 cytokine of IL6 family. Phospho’s

Stat-3. Induces IL-1.

Up No

change

Up No

change

No

change

CSF1 secreted cytokine which influences

hemopoietic stem cells to

differentiate into macrophages

up No

change

Up up No

change

CSF3 Granulocyte colony-stimulating

factors – stimulates maturation of

granulocytes – pro-inflammatory

mediator.

Up No

change

Up Up No

change

CX3CL1 chemokine – pro-inflammatory No

change

No

change

Up Up No

change

CXCL1 Chemokine up up Up up no

change

CXCL2 Chemokine Up Up Up Up No

change

CXCL3 Chemokine Up Up Up Up No

change

CXCL10 Chemokine – neutrophil

chemoattractant

up No

change

Up up No

change

CXCL11 Chemokine – neutrophil

chemoattractant

No

change

No

change

Up No

change

No

change

ELF3 E74-like factor 3 (ets domain

transcription factor, epithelial-

specific Involved in mediating

vascular inflammation

Up Up Up Up No

change

105

FOS part of AP-1 complex. Pro-

inflammation

Up Up Up Up No

change

G1P2 a ubiquitin-like protein that becomes

conjugated to many cellular proteins

upon activation by interferon-alpha –

pro-inflammatory

up No

change

Up No

change

No

change

Hla-A/B MHC gene No

change

up No

change

up No

change

ICAM1 intercellular adhesion molecule for

leukocyte mediated transmigration –

pro-inflammatory

up No

Change

Up up No

Change

ICAM3 intercellular adhesion molecule for

leukocyte mediated transmigration –

pro-inflammatory

No

change

No

change

Down No

change

No

change

ICOSLG Acts as a costimulatory signal for T-

cell proliferation and cytokine

secretion

No

change

No

change

Up No

change

No

change

IFNA5

- Produced by macrophages, IFN-

alpha have antiviral activities.

Interferon stimulates the production

of two enzymes: a protein kinase and

an oligoadenylate synthetase pro-

inflammatory

No

change

No

change

No

change

No

change

down

IFNGR1 Interferon gamma receptor 1 – pro-

inflammatory

up No

change

Up up No

change

IFNGR2 Interferon gamma receptor 2 – pro-

inflammatory

No

change

No

change

Up up No

change

IFRD1 This gene is an immediate early gene

that encodes a protein related to

interferon-gamma

No

change

No

change

Up No

change

No

change

IKBKE dissociates inhibitors of NFkappaB up up Up up No

106

complex – pro-inflammatory change

IL1R1 IL1 cytokine receptor No

change

No

change

No

change

down No

change

IL2RG – Interleukin 2 receptor – pro-

inflammatory

No

change

No

change

No

change

up No

change

IL28RA proinflammatory cytokine No

change

No

change

Up No

change

No

change

IL8 Cytokine Up Up Up Up No

change

Il32 – cytokine that induces expression of

TNFa, il8

Up Up Up Up No

change

ILF3 Nuclear factor of activated T-cells

(NFAT) is a transcription factor

required for T-cell expression of

interleukin 2

No

change

No

change

down No

change

No

change

IRF-1 serves as an activator of interferons

alpha and beta transcription

up No

change

Up Up No

change

IRAK2 upregulates NfkappaB pro-

inflammatory

Up No

change

Up No

change

No

change

ISG20 degrades RNA – anti-viral function

of IFN against RNA viruses

No

change

No

change

Up No

change

No

change

ISGF3G – AKA IRF9 – Transcription

regulatory factor that mediates

signaling by type I IFNs (IFN-alpha

and IFN-beta). Following type I IFN

binding to cell surface receptors –

pro-inflammatory

No

change

No

change

No

change

down No

change

JUN associated with FOS to make AP-1

complex

Up Up Up Up No

change

JUNB same as JUN, associated with FOS to Up Up Up Up No

107

make AP-1 complex change

JUND same as JUN, associated with FOS to

make AP-1 complex

Up Up Up Up No

change

LIF cytokine – mitogenic - growth

promotion and cell differentiation of

different types of target cells

Up No

change

Up No

change

No

change

LTB lymphotoxin Beta – inducer of

inflammatory response system

Up Up Up Up No

change

LTBR protein encoded by this gene is a

member of the tumor necrosis factor

(TNF) family of receptors. Pro-

inflammatory

No

change

No

change

No

change

down No

change

MAP3k1 activates MAPK and JNK pathways.

Induce production of NFKappaB

up No

change

Up Up No

change

MAP3k8 activates MAPK and JNK pathways.

Induce production of NFKappaB

up No

change

Up No

change

No

change

MAP3K13 activates nfkb pathway – pro-

inflammatory.

No

change

No

change

Up No

change

No

change

MAP3K14 activates nfkb pathway – pro-

inflammatory.

No

change

No

change

Up No

change

No

change

NFATC2 member of the nuclear factors of

activated T cells transcription

complex

No

change

No

change

Up No

change

No

change

NFKB2 NF-kappa-B is a pleiotropic

transcription factor which is present

in almost all cell types and is

involved in many biological

processed such as inflammation,

immunity, differentiation, cell

growth, tumorigenesis and apoptosis

Up Up Up Up No

change

108

NR4A1 The NGFIB protein plays a key role

in mediating inflammatory responses

in macrophages

Up No

change

Up Up No

change

PELI1 Scaffold protein involved in the IL-1

signaling pathway via its interaction

with the complex containing IRAK

kinases and TRAF6. Required for

NF-kappa-B activation and IL-8 gene

expression in response to IL-1

Up No

change

Up No

change

No

change

PIM1 regulates cytokine pathwyas - These

include interleukins (IL-2, IL-3,IL-5,

IL-6, IL-7, IL12, IL-15), prolactin,

TNFα, EGF and IFNγ, among others

Up Up Up Up Up

PLA2G2A Phospholipases are a group of

enzymes that hydrolyze

phospholipids into fatty acids and

other lipophilic molecules.

Phospholipases are ubiquitously

expressed and have diverse

biological functions including roles

in inflammation, cell growth,

signaling and death and maintenance

of membrane phospholipids.

No

change

No

change

Down No

change

No

change

PTGS2 codes for cycloxygenase-2 –

upregulated during inflammation –

produces prostaglandins – pro-

inflammatory

Up Up Up Up No

change

RELB protein binds to NFKappaB to form

complex – pro-inflammatory

Up No

change

Up No

change

No

change

RIPK1 Essential adapter molecule for the

activation of NF-kappa-B – pro-

inflammatory

No

change

No

change

No

change

down No

change

SOCS3 cytokine-inducible negative Up Up Up Up No

109

regulators of cytokine signaling. Pro-

inflammatory

change

SMAD7 blocks TGFbeta – cAMP response

element binders – pro-inflammation

Up No

change

Up No

change

No

change

TNF (AKA TNF-a) pro-inflammatory

cytokine that induces cell apoptosis.

Up No

change

Up Up No

change

TNFRSF21 This receptor has been shown to

activate NF-kappaB and

MAPK8/JNK, and induce cell

apoptosis

No

change

No

change

Up No

change

No

change

TRIP associated with TLR3/TLR4.

Activates IFNa and IFNb in

inflammatory immune response

Up Up Up Up No

change

Anti-

inflammation


+

R0052

LF82+

R0052

R0052

CD55 – AKA DAF – stops complement

cascade

No

change

No

change

Up No

change

No

change

DUSP2 negatively regulates MAPK pathway No

change

No

change

No

change

down No

change

DUSP1 negatively regulates MAPK pathway Up Up Up Up No

change

DUSP5 negatively regulates MAPK pathway Up Up Up Up No

change

DUSP6 negatively regulates MAPK pathway No

change

No

change

Up No

change

No

change

DUSP8 negatively regulates MAPK pathway Up No

change

Up No

change

No

change

110

DUSP16 negatively regulates MAPK pathway Up No

change

Up Up No

change

NFKBIA NF-kB-pathway signaling up up Up Up No

change

NFKBIE NF-kB-pathway signaling up up Up Up No

change

SIGIRR Acts as a negative regulator of the

Toll-like and IL-1R receptor

signaling pathways

No

change

No

change

No

change

down No

change

TNFAIP3 induced by TNF. Limits

inflammation by inhibiting NFKB

activation and TNF mediated

apoptosis. – anti-inflammation

Up Up Up Up No

change

TOLLIP

– ubiquitin binding protein that

interacts with TLR signal cascade

proteins. Anti-inflammatory

No

change

No

change

No

change

down No

change

Tight

Junctions


+

R0052

LF82+

R0052

R0052

CLDN4 Tight junction Up Up Up Up No

change

CLDN10 Claudin 10 – Tight Junction Protein No

change

No

change

No

change

up Up

CLDN17 Claudin 17 – Tight Junction Protein No

change

No

change

down No

change

No

change

Jam1 regulates tight junction assembly in

epithelia

No

change

No

change

No

change

up No

change

MGC16207 This gene encodes an adhesion No No Down No No

111

protein that plays a role in the

organization of adherens junctions

and tight junctions in epithelial and

endothelial cells.

change change change change

PVRL2 This protein is one of the plasma

membrane components of adherens

junctions

No

change

No

change

Up No

change

No

change

THBS1 adhesive glycoprotein that mediates

cell-cell and cell-matrix interactions

Up No

change

Up No

change

No

change

VCL Actin filament (F-actin)-binding

protein involved in cell-matrix

adhesion and cell-cell adhesion

No

change

No

change

Up No

change

No

change

Cytoskeletal

Genes


+

R0052

LF82+

R0052

R0052

TUBB2B Tubulin Up No

change

Up No

change

No

change

TUBB2C Tubulin No

change

No

change

No

change

down No

change

VAV3 – Guanine nucleotide exchange

factor – involved in actin cytoskeletal

rearrangements

No

change

up No

change

No

change

No

change

Cellular

Growth/Prote

ction


+

R0052

LF82+

R0052

R0052

ADM Pro cell survival – increase tolerance

of cells to stress, injury, promotes

angiogenesis

up up Up Up No

change

112

AKT2 kinase – pro-cell survival No

change

No

change

No

change

down No

change

AREG part of epidermal growth factor

family

up up Up Up up

ASH1L associated to tight junctions No

change

No

change

down No

change

No

change

ATF1 encodes transcription factor that is

involved in growth, survival, and

other cellular activities

No

change

down No

change

No

change

No

change

BIRC3 inhibits apoptosis by inhibiting

capases

up up Up Up No

change

BNIP3 an apoptotic protector No

change

No

change

Up No

change

No

change

CCND1 Cell growth No

change

No

change

Up No

change

No

change

CCND3 Cell growth No

change

No

change

Up No

change

No

change

EVI1 AKA MECOM – anti apoptosis. No

change

No

change

Down No

change

No

change

EPHA2 encodes receptor involved in

angiogenesis

Up No

change

Up No

change

No

change

GADD45A activated by environmental stresses

and activates p38/JNK pathway. Cell

protection

Up Up Up Up No

change

GADD45B activated by environmental stresses

and activates p38/JNK pathway. Cell

protection

Up No

change

Up Up No

change

GDF15 regulating inflammatory and

apoptotic pathways in injured tissues

Up Up Up Up No

change

113

and during disease processes

GPR109B counteracts prolipolytic influences

due to oxidation stress

Up Up Up Up No

change

HBEGF cell growth No

change

No

change

Up No

change

No

change

HSPA8 Heatshock protein 8 No

change

No

change

Down No

change

No

change

ID1 This protein may play a role in cell

growth, senescence, and

differentiation

No

change

down Up Down No

change

ID3 This protein may play a role in cell

growth, senescence, and

differentiation

No

change

No

change

Up No

change

No

change

ITIH2 a family of structurally related

plasma serine protease inhibitors

involved in extracellular matrix

stabilization

No

change

Down Down Down No

change

PLK2 – involved in cell division No

change

No

change

Up No

change

No

change

MAP3K3 – activates SEK, MEK1/2, not p38. No

change

No

change

No

change

down No

change

MNT This protein is likely a transcriptional

repressor and an antagonist of Myc-

dependent transcriptional activation

and cell growth.

No

change

No

change

Up Down No

change

NDRG1 The protein encoded by this gene is a

cytoplasmic protein involved in

stress responses, hormone responses,

cell growth, and differentiation

No

change

No

change

Up No

change

No

change

PDGFA Platelet derived growth factor – Up No Up No No

114

mitogen for cells- wound healing change change change

PDGFRA

Platelet derived growth factor –

mitogen for cells- wound healing

No

change

No

change

No

change

down No

change

PIK3R1 proliferation, cell survival,

degranulation, vesicular trafficking

and cell migration. Anti-apoptosis

No

change

No

change

down No

change

No

change

PTPNS1 AKA SIRPA – his protein was found

to participate in signal transduction

mediated by various growth factor

receptors -

No

change

No

change

down No

change

No

change

PTPRB phosphatase involved in cell growth No

change

No

change

No

change

up No

change

RPS6KA4 regulate diverse cellular processes

such as cell growth, motility, survival

and proliferation

No

change

No

change

down No

change

No

change

TGFBR2 This receptor/ligand complex

phosphorylates proteins, which then

enter the nucleus and regulate the

transcription of a subset of genes

related to cell proliferation

No

change

No

change

down down No

change

TNFRSF21A Promotes angiogenesis and the

proliferation of endothelial cells

No

change

No

change

Up No

change

No

change

VEGF stimulates angiogenesis Up Up Up Up No

change

Cell Death Function EDL933 LF82 EDL933

+

R0052

LF82+

R0052

R0052

DDIT3 pro-apoptotic factor Up No

change

Up No

change

No

change

115

FADD pro-apoptosis signal. No

change

No

change

No

change

down No

change

TAOK2 involved in apoptotic morphological

changes – pro-apoptosis

down No

change

No

change

down No

change

Cell Arrest Function EDL933 LF82 EDL933

+

R0052

LF82+

R0052

R0052

CDKN1A cell cycle inhibitor No

change

No

change

Up Up No

change

CDKN1B cell cycle inhibitor up No

change

Up up No

change

INHBB inhibin – inhibits cell growth and

differentiation

No

change

No

change

Up No

change

No

change

KLF10 inhibits cell growth Up No

change

Up No

change

No

change

Other Genes Function EDL933 LF82 EDL933

+

R0052

LF82+

R0052

R0052

ADCY3 enzyme that makes cAMP. No

change

No

change

Down No

change

No

change

CACNA1A calcium channel, voltage-dependent,

P/Q type, alpha 1A subunit

up No

change

Up No

change

No

change

EGR1 – transcription factor – target genes

involved in differentiation and

mitogenesis

Up No

change

Up Down No

change

EMP3 epithelial membrane protein 3 up No No No No

116

change change change change

ENDOG encodes a DNAse/RNAse protein No

change

No

change

down No

change

No

change

GRM1 – activates phospholipase C - No

change

No

change

Up No

change

No

change

KLF6 functions as a tumor suppressor Up Up Up Up No

change

MUC13

produce mucins. No

change

up Up No

change

up

MUC12 No

change

up No

change

No

change

No

change

NTRK1 – encodes receptor that binds to

neutrophin, activates MAPK pathway

No

change

No

change

No

change

up Up

RGS3 - inhibits G-protein mediated signal

transduction

No

change

No

change

No

change

down No

change

SNAI1 downregulates expression of

ectodermal genes within mesoderm.

Up No

change

Up No

change

No

change

117

Table 5.2: Primer pairs used in the qRT-PCR analysis.

Gene

Name

Function GenBank

Accession

Number

Primer Sequence

Normalizing Genes

ACTB

Involved in various types of cell

motility and ubiquitously expressed

in all eukaryotic cells used as a

reference gene

NM_00110

1

F: GTTGTCGACGACGAGCG

R: GCACAGAGCCTCGCCTT

B2M

Serum protein involved in a

complex with another protein on the

surface of nearly all nucleated cells

used as a reference gene

NM_00404

8

F: TCTCTGCTGGATGACGTGAG

R: TAGCTGTGCTCGCGCTACT

RPLP0 Ribosomal protein P0 used as a

reference gene

NM_00100

2

F: GGCGACCTGGAAGTCCAACT

R: CCATCAGCACCACAGCCTTC

Pro-inflammation

PIM1 regulates cytokine pathways such as

interleukins, prolactin, TNFα, EGF

and IFNγ. Plays a role in signal

transduction in blood cells.

Contributes to both cell proliferation

and survival

NM_00264

8.3 F: ATGGTAGCGGATCCACTCTG

R: CTCAAGCTCATCGACTTCGG

CXCL1 Chemokine NM_00151

1.2

F: CTTCCTCCTCCCTTCTGGTC

R: GAAAGCTTGCCTCAATCCTG

IL8 One of the major mediators of the NM_00058 F: AAATTTGGGGTGGAAAGGTT

118

inflammatory response 4 R: TCCTGATTTCTGCAGCTCTGT

JUN associated with FOS to make AP-1

complex

Transcription factor that regulates

gene expression

NM_00222

8.3

F: TCTCACAAACCTCCCTCCTG

R: GAGGGGGTTACAAACTGCAA

Anti-inflammation

DUSP1 negatively regulates MAPK pathway NM_00441

7

F: GGCCCCGAGAACAGACAAA

R: GTGCCCACTTCCATGACCAT

NFKBI

A

Inhibits the activity of the NF-

kappa-B (NFKB) protein complex

NM_02052

9

F: CCGCACCTCCACTCCATCC

R:

ACATCAGCACCCAAGGACACC

TNFAI

P3

induced by TNF. Limits

inflammation by inhibiting NFKB

activation and TNF mediated

apoptosis. – anti-inflammation

NM_00629

0.2

F: TCACAGCTTTCCGCATATTG

R: GGACTTTGCGAAAGGATCG

Tight Junctions

CLDN4 Tight junction NM_00130

5.3

F: ATAAAGCCAGTCCTGATGCG

R: TAACTGCTCAACCTGTCCCC

CLDN1

0

Tight Junction Protein NM_18284

8.3

F: GCTGACAGCAGCGATCATAA

R: AGGGTCTGTGGATGAACTGC

THBS1 adhesive glycoprotein that mediates

cell-cell and cell-matrix interactions

NM_00324

6.2

F:

CACAGCTCGTAGAACAGGAGG

R: CAATGCCACAGTTCCTGATG

119

Cellular Growth/Protection

AREG part of epidermal growth factor

family

NM_00165

7.2

F:

TGGAAGCAGTAACATGCAAATG

TC

R:

GGCTGCTAATGCAATTTTTGATA

A

ADM Pro cell survival – increase tolerance

of cells to stress, injury, promotes

angiogenesis

NM_00112

4.1

F: ACGGAAACCAGCTTCATCC

R: GCCAGTGGGACGTCTGAG

BIRC3 inhibits apoptosis by inhibiting

capases

NM_00116

5.3

F: TGTTGGGAATCTGGAGATGA

R: CGGATGAACTCCTGTCCTTT

Cell Death

DDIT3 pro-apoptotic factor NM_00408

3.5

F: TGGATCAGTCTGGAAAAGCA

R: AGCCAAAATCAGAGCTGGAA

FADD pro-apoptosis signal NM_00382

4.3

F: TCTCCAATCTTTCCCCACAT

R: GAGCTGCTCGCCTCCCT

Cell Arrest

CDKN

1A

cell cycle inhibitor NM_07846

7.2

F:

TGGAGACTCTCAGGGTCGAAA

R:

GGCGTTTGGAGTGGTAGAAATC

120

CDKN

1B

cell cycle inhibitor NM_00406

4.3

F: CGCCATATTGGGCCACTAA

R: CGCAGAGCCGTGAGCAA

121

Industrially prepared probiotics do not alter pathogen mediated genetic responses. qRT-

PCR analysis of the 11 genes generally showed higher fold changes compared to microarray

analysis (Figure 5.2). qRT-PCR also showed that both enteric pathogens (EHEC O157:H7,

strain EDL933 and AIEC, strain LF82) induced higher gene expression changes in Caco-2 cells

compared to the probiotic L. helveticus R0052. Co-incubation or pre-incubation with the

probiotics did not affect changes in gene expression caused by the pathogens (Figure 5.2).

122

Figure 5.2. Microarray and qRT-PCR analysis of Caco-2 cells infected alone, co-incubated, or

pre-incubated with probiotics and pathogens. Caco-2 cells were incubated with either probiotics

or pathogens alone for 3h, co-incubated with probiotic and pathogen for 3h, or pre-incubated

with probiotics for 3h before the addition of a pathogen for 3h. Pro-inflammatory genes (Panels

A to C), anti-inflammatory genes (Panels D and E), cellular growth/protection genes (Panels F

to H), cell arrest/death genes (Panels I and J) and tight junction genes (Panel K) were analyzed

by both microarray and qRT-PCR. qRT-PCR fold expression were normalized to three reference

genes: ACTB, B2M, and RPLP0. All analyses were performed using independently collected

samples (n=6).

123

124

Growth of probiotics in MRS medium enables the suppression of pathogen gene mediated

effects. Previous studies demonstrated that preparation conditions can affect probiotic activity

(Sherman et al., 2005). Therefore, the effects of L. helveticus R0052 and L. rhamnosus GG

cultured in MRS broth on gene expression changes in Caco-2 cells either alone or as a 3h

pretreatment before challenge with E. coli EDL933 and E. coli LF82 was tested. As shown in

Figure 5.3, probiotics grown in MRS broth affected Caco-2 gene expression in a manner

distinctly different from the same strain prepared by using industrial means. Furthermore, MRS

cultured probiotics also prevented pathogen mediated changes in Caco-2 cell gene expression

(Figure 5.3).

125

Figure 5.3. qRT-PCR analysis of Caco-2 cells incubated with either probiotics or pathogens

alone, or pre-incubated with probiotics. Probiotics were prepared either industrially or

cultured in MRS broth, while E. coli enteropathogens were cultured in LB broth. Expression of

pro-inflammatory genes (Panels A to C), anti-inflammatory genes (Panels D and E), cellular

growth/protection genes (Panels F to H), Cell arrest/death genes (Panels I and J) and tight

junction gene (Panel K) were analyzed by qRT-PCR. Fold expression changes were normalized

to three reference genes: ACTB, B2M, and RPLP0. All analyses were performed using

independently collected samples (n=3-6, Two-way ANOVA,* p < 0.05 compared to EDL933, &

p <0.05 compared to LF82).

126

127

5.5 DISCUSSION

This is the first study, at least to our knowledge, that has analyzed using microarray and qRT-

PCR the human immune pathways affected by the pathogenic E. coli strain EDL933 and LF82 in

combination with the probiotics L. helveticus R0052 and L. rhamnosus GG. In the present study,

we show through a series of complementary microarray and qRT-PCR analyses that two enteric

bacterial pathogens (EHEC O157:H7, strain EDL933 and AIEC, strain LF82) alter gene

expression changes in Caco-2 cells in a distinct manner compared to the probiotic bacteria L.

helveticus R0052 and L. rhamnosus GG alone. Moreover, probiotics prepared in MRS broth

prevented pathogen-mediated changes in Caco-2 cell gene expression in a co-infection model.

EHEC and AIEC are both human pathogens that modulate immune pathways upon contact with

the host cell. Their pathogen-associated molecular patterns (PAMPs) are recognized by host

pathogen-recognition receptors (PRRs) leading to the activation of an inflammatory response.

For example, Toll-like receptor signaling in the intestine activates cytokine production (Dalpke

et al., 2003), chemokine-mediated recruitment of acute inflammatory cells and immunoglobulin

A (IgA) production (Shang et al., 2008), epithelial cell proliferation (Fukata et al., 2009),

maintenance of the integrity of intercellular tight junctions and antimicrobial peptide expression

(Hooper and Macpherson, 2010).

Probiotics are live, non-pathogenic microorganisms that confer health benefits to the host, and

are increasingly being employed to prevent and treat bacterial infection (Gareau et al., 2010). For

instance, probiotic bacteria have been shown to inhibit pathogen adhesion and invasion, and

changes in epithelial cell permeability induced by enteroinvasive E. coli (Resta-Lenert and

Barrett, 2006), Salmonella typhimurium (Gill et al., 2001) and Shigella flexneri (Tien et al.,

2006). Probiotics also mediate the activation, expression and secretion of pro-inflammatory

cytokines (TNFα) and chemokines (CXCL-8) caused by enteric pathogen infection (Gareau et

al., 2011).

In the present study, we have shown that pre-incubation of Caco-2 cells with probiotics L.

helveticus R0052 and L. rhamnosus GG grown in MRS broth were able to significantly

ameliorate E. coli EDL933 and LF82-induced modulation of genes involved in pro-

inflammatory, anti-inflammatory, cellular growth/protection and cellular arrest/death signaling

pathways (Figure 5.3).

128

The results of this study raise several issues with regards to the use of probiotics as a

management option for intestinal infections. In a previous study, we observed a more beneficial

effect from industrially versus MRS broth grown probiotics in modulating epithelial cell barrier

function in T84 cells (Sherman et al., 2005). In the present study, we confirm that the specific

methods used to prepare probiotics can dramatically affect their biological effects. However, in

this case MRS grown probiotics were more efficacious in mediating host immune pathways

compared to industrially prepared L. helveticus R0052. As reviewed by (Foster et al., 2011), it

has been observed that the probiotics Lactobacillus rhamnosus R0011 can reduce the

pathogenicity of Campylobacter jejuni in HT-29 cells (Alemka et al., 2010), but not when using

T84 cells (Wine et al., 2009). These findings suggest that there is specificity to the interactions

between probiotics and human cells. Furthermore, while it is not currently known precisely how

preparation conditions affect probiotic effectiveness, this area of research is currently under

active investigation (Grzeskowiak et al., 2011).

The results arising from this study also show the benefits of employing probiotics as a

prevention, strategy, rather than as an intervention option, as pre-incubation with probiotics

prepared in MRS medium prevented pathogen-induced pro-inflammatory gene expression.

Recent findings presented from our laboratory demonstrate that probiotics can be effective in

both preventing and treating bacterial intestinal infections in vivo, but efficacy in the rodent

model of bacterial-induced colitis diminished the longer the infection goes unchecked

(Rodrigues et al., 2012).

Future work focusing on the preparation conditions mediating probiotic effectiveness, as well

experiments to determine the temporal restrictions involved in using probiotics as a therapeutic

option should now be undertaken. Such information could be used to elucidate the mechanisms

by which probiotics achieve their health benefits, and direct use as a management option for

bacterially-induced enterocolitis.

5.6 ACKNOWLEDGEMENTS:

This work was supported by an operating grant from the Canadian Institutes of Health Research

(MOP-89894). NH was supported by a doctoral research award from the Canadian Institutes of

Health Research (JDD-95413). PMS was supported by a Canada Research Chair in

Gastrointestinal Disease.

129

Chapter 6

Discussion, Future Directions, and Significance

130

6.1 DISCUSSION

The studies presented in this thesis evaluated the mechanisms by which E. coli O157:H7 is able

to subvert host IFNγ/Jak1,2/Stat-1 signaling. Through a series of complementary biochemical

and genetic techniques, I have demonstrated the ability of EHEC to subvert the IFNγ pathway by

ways that are independent of direct bacterial contact with epithelial cells, and through the use of

secreted proteins (Chapter 3). I then showed that EHEC secreted Shiga toxins play a role in the

subversion of IFNγ signaling when testing several human epithelial cell lines (Chapter 4); and

that probiotics could ameliorate host immune activation responses induced following EHEC

exposure in a manner that is dependent on both the preparation employed and the conditions of

exposure (Chapter 5).

Chapters 3 and 4 address one of the central themes of this thesis as the concept of pathogen

mediated host immune activation, and the subversion by EHEC to evade the host immune system

and thereby potentially promote pathogenesis. It is not surprising to discover that EHEC has

evolved a way to subvert the host IFNγ pathway, as subversion of the host immune system is

increasingly recognized as a common theme as an underlying strategy employed among many

human pathogens (Jones and Neish, 2011). For example, viruses of the Paramyxoviridae family

subvert the IFNγ pathway by degrading intracellular Stat-1 (Didcock et al., 1999), while the

parasite Leishmania donovani prevents tyrosine-phosphorylation and activation of Stat-1


arguably promote its ability to colonize the gut of the infected host by reducing immune

surveillance (Jones and Neish, 2011).

As EHEC contains an array of virulence factors that aid in infection pathogenicity and

subversion of host immune signaling, such as the Locus of Enterocyte Effacement (LEE)

pathogenicity island encoded type three secretion system (T3SS), its pO157 plasmid, and phage

encoded Shiga toxins, I focused on each of these virulence factors to identify potential

mechanisms by which this pathogen can subvert the host IFNγ/Jak/Stat signal transduction

pathway.

One virulence factor of primary interest was the LEE pathogenicity island and the encoded

T3SS, which allows the bacterium to inject bacterial effector proteins directly into the host cell to

subvert host cytoskeleton processes, destroy brush border microvilli, and cause rearrangements

131

of F-actin resulting in attaching and effacing (A/E) lesions on epithelial cell apical membrane

surfaces (Frankel and Phillips, 2008; Garmendia et al., 2005; Kaper et al., 2004). Studies on the

T3SS and its effectors have found that many of these bacterial-derived proteins have redundant

and overlapping functions, each of which appears to have multiple roles in subverting eukaryotic

cellular processes, thereby aiding in EHEC-mediated disease pathogenesis (Dean and Kenny,

2009). For example, the EspF protein appears to play several roles in the subversion of host

cellular signaling pathways, such as effacing the microvilli of infected cells, disrupting the

nucleolus, and preventing phagocytosis (Holmes et al., 2010). Furthermore, EspF, along with Tir

and Map, all contribute to SGLT-1 transporter inactivation (Wong et al., 2011). As a whole, it

appears that many of the virulence proteins expressed by EHEC are multifunctional, cooperative,

and redundant (Dean and Kenny, 2009). However, experiments utilizing isogenic mutants in the

T3SS system demonstrated that the LEE PAI in E. coli O157:H7 was not responsible for EHEC

mediated subversion of the IFNγ signaling pathway (Chapter 3).

EHEC O157:H7 also harbors a pO157 virulence plasmid that encodes several putative virulence

factors, such as: a metalloprotease (stcE) (Lathem et al., 2002), a serine protease (espP)

(Brockmeyer et al., 2007), a hemolysin (ehxA) (Schmidt et al., 1994), a catalase-peroxidase

(katP) (Brunder et al., 1996), and a putative adhesin (toxB) (Tatsuno et al., 2001). However,

experiments using pO157 plasmid cured strains continued to subvert the host IFNγ pathway as

well as wild-type strains (Chapter 3), indicating that this plasmid does not contain a factor

related to subverting of this signal transduction cascade.

Shiga toxins serve as a distinct marker for EHEC infections, and aid the pathogen in causing

systemic complications, including hemorrhagic colitis and the hemolytic-uremic syndrome

(HUS) (Obrig, 2010). In North America, approximately 75,000 cases of EHEC infections are

reported annually. Of these, 10-15% of cases develop HUS (Panos et al., 2006). In Chapter 5, I

demonstrate through the use of knockout mutagenesis, genetic complementation in trans, as well

as use of purified Stx that these toxins are involved in the suppression of the IFNγ/Jak 1,2/Stat-1

pathway. To our knowledge, this is the first study to show that Shiga toxins modulate IFNγ

signaling, which supports recent findings that many EHEC effectors have multiple and

overlapping roles in subverting host cell processes (Dean and Kenny, 2009; Hamada et al.,

2010).

132

The second theme of this thesis is that probiotics are a potential therapeutic option for use in the

management of EHEC infections. Studies of these beneficial microbes over recent years

demonstrate that probiotics can prevent and perhaps be used to treat enteric infections

(Rodrigues et al., 2012) through a multitude of mechanisms ranging from secreting antimicrobial

peptides (Corr et al., 2007), physical displacement of pathogenic bacteria (Johnson-Henry et al.,

2007), to modulation of host immune pathways (Seth et al., 2008). In Chapter 6, I evaluated two

such strains of probiotics, Lactobacillus helveticus R0052 and Lactobacillus rhamnosus GG, and

showed that pre-treatment with these probiotics can ameliorate host immune activation responses

to challenge of epithelial cells with two pathogenic bacteria, E. coli O157:H7, strain EDL933

and E. coli O83:H1, strain LF82, in a preparation dependent manner. The findings of this PhD

thesis can be used to form a model of EHEC O157:H7 pathogenesis, and is illustrated in Figure

6.1.1.

133

Figure 6.1.1. The results of this thesis presented as a model of EHEC O157:H7

pathogenesis. EHEC has evolved a method to subvert the IFNγ signaling pathway. The results

of Chapter 4 show that EHEC can mediate this effect through the secretion of its proteins, but

YodA does not appear to be involved. The results of Chapter 5 demonstrate that the secreted

EHEC Shiga toxins are involved, but also indicate that non-secreted proteins can play a

significant part in subverting the IFNγ signaling pathway. The results of Chapter 6 demonstrate

that probiotics could help prevent pathogen gene mediated effects on human intestinal epithelial

cells.

134

135

6.2 FUTURE DIRECTIONS

There are several areas presented in this thesis which could direct future research in the field. For

instance, YodA was identified as a candidate protein mediating the inhibition of IFNγ induced

Stat-1 phosphorylation in Chapter 3. While I demonstrated that a YodA knockout in EHEC, as

well as a purified YodA product were still able to subvert Stat-1 phosphorylation, further work

could be done to verify these results. For example, column chromatography could be repeated

using YodA CS to determine if the inhibitory protein is again observed, and subsequent isolation

experiments, using the methodologies described in Chapter 3 could then be undertaken to

identify the secreted factor.

Furthermore, the complete mechanisms by which EHEC O157:H7 subverts the IFNγ pathway

remains to be elucidated. I have demonstrated that Stx are involved in mediating this ability

(Chapter 5), but it is also clear that other non-secreted factors are likely to be involved, since

direct infection with StxDKO mutants retain the ability to completely suppress IFNγ mediated

Stat-1 tyrosine phosphorylation.

An interesting direction for future research would be to identify and characterize differences

between proteins expressed and localized in the outer membranes of EPEC and EHEC. As

illustrated by Molley et al. (2001), this could be accomplished by collecting total bacterial

proteins, and then use an alkaline pH wash to remove non-membrane bound proteins. The

remaining membrane bound proteins could then be solubilized using strong denaturing

conditions and analyzed using 2D Difference Gel Electrophoresis, as was previously done in

Chapter 5. Differing proteins can then be verified for their role in subverting the IFNγ pathway

by E. coli O157:H7 using knockout mutagenesis and complementation in trans.

Another prime area for future study would be to further elucidate mechanisms by which Stx

suppress IFNγ mediated Stat-1 tyrosine phosphorylation. It can be presumed that the toxin’s

effects are mediated by direct protein interaction with at least one part of the IFNγ pathway.

Hence, experiments using co-immunoprecipitation (co-IP) techniques could be employed to

determine any direct binding of Stx’s to either the IFNγ receptors (IFNGR1, IFNGR2) the Jak’s

(Jak1, Jak2), or perhaps Stat-1 itself. The scope of such experiments then could be expanded to

include other EHEC proteins that might interact with Stx, as it was observed that purified Stx

136

alone did not affect IFNγ signaling, and that culture supernatants were required for IFNγ

suppression (Chapter 5).

In parallel with these proposed studies, alternative experiments employing modified Stx could be

utilized to elucidate the active sites required for mediating IFNγ subversion. Since nothing is

known about the mechanisms by which Stx mediates effects on the IFNγ pathway, either the use

of inactive Stx toxins (Glu167 and Arg176 double mutations in their active site) (Di et al., 2011),

or employing purified Stx A and B subunits could be tested to infer the minimal requirements for

Stx mediated IFNγ subversion. Results from these experiments could potentially be applied to

developing therapeutic options for use in the treatment of chronic diseases which have elevated

IFNγ levels, such as Crohn’s disease (Pak et al., 2012).

An interesting corollary of the Stx mutations is that, despite knockouts in stx1A, stx2A or both,

there remains some residual expression of toxin activity in the isogenic mutants (Table 4.3).

Theoretically, there shouldn’t be any detected at all since 1) the genes were ablated entirely, 2)

the antibody used in the ELISA are monoclonal towards the toxins, and 3) the technique used is

sensitive to pg/ml levels of the toxin. It is likely that this is an experimental artifact. Further

inquiry to define the exact specificity of the antibodies used in the immunoassay would be of

interest in determining the robustness of the knockout mutation studies.

Future work with probiotics would also likely prove to be meaningful. Additional microarray

experiments using MRS grown probiotics would complete the data currently present in Chapter

5. It would also be of interest to determine the ineffectiveness of the industrially prepared

probiotics compared to the MRS grown variants. One hypothesis is that since the industrially

prepared R0052 is packaged for human consumption and protection from the stomach acids in

vivo, it may require more time to activate the bacteria, a possibility which was not considered

during our experiments in vitro. One way to test this hypothesis would be to perform a growth

curve experiment on both the industrially and MRS prepared probiotics. Should a significant

delay in growth be seen in the industrially prepared probiotics, this could indicate a fault with the

in vitro experimentation design, and explain why the industrially prepared R0052 was ineffective

in modulating pathogen mediate host immune responses compared to MRS prepared probiotics.

137

It would be of great interest to assess the effects of probiotic administration during and post-

infection so as to determine if these beneficial microbes could be extended to use beyond

preventative strategies, such as in the setting of an outbreak of infection or to prevent intra-

familial or nosocomial spread of the illness. The inclusion of different preparation strategies,

such as collection during different growth phases (exponential vs. stationary), as well as

experiments with varying initial dosages would also be of value in determining the optimal

preparation conditions required for creating an effective probiotic for use in a therapeutic setting.

6.3 SIGNIFICANCE

EHEC is responsible for 75,000 infections annually in North America. The hemolytic-uremic

syndrome is the most severe clinical manifestation of EHEC infections, which accounts for >200

deaths every year. Antibiotics exacerbate EHEC infection as they increase the potential for

developing systemic disease. Characterizing novel EHEC virulence factors and the mechanisms

of bacterial disruption of host cellular responses will, therefore, advance current knowledge of

EHEC immune evasion strategies. Although the results of my thesis are reductionist in nature,

the finding that EHEC can subvert the IFNγ pathway is significant and should be verified in

relevant animal models (Higgins et al., 1999) before extended to human intervention studies.

Such information could lead to the development of novel alternative strategies to prevent and

treat EHEC infections in humans.

138

References Abe, H., Tatsuno, I., Tobe, T., Okutani, A., and Sasakawa, C. (2002). Bicarbonate ion stimulates the expression of locus of enterocyte effacement-encoded genes in enterohemorrhagic Escherichia coli O157:H7. Infect Immun 70, 3500-3509.

Alemka, A., Clyne, M., Shanahan, F., Tompkins, T., Corcionivoschi, N., and Bourke, B. (2010). Probiotic colonization of the adherent mucus layer of HT29MTXE12 cells attenuates Campylobacter jejuni virulence properties. Infect Immun 78, 2812-2822.

Allen, K.J., Rogan, D., Finlay, B.B., Potter, A.A., and Asper, D.J. (2011). Vaccination with type III secreted proteins leads to decreased shedding in calves after experimental infection with Escherichia coli O157. Can J Vet Res 75, 98-105.

Andreoli, S.P., Trachtman, H., Acheson, D.W., Siegler, R.L., and Obrig, T.G. (2002). Hemolytic uremic syndrome: epidemiology, pathophysiology, and therapy. Pediatr Nephrol 17, 293-298.

Arbeloa, A., Garnett, J., Lillington, J., Bulgin, R.R., Berger, C.N., Lea, S.M., Matthews, S., and Frankel, G. (2010). EspM2 is a RhoA guanine nucleotide exchange factor. Cell Microbiol 12, 654-664.

Arbeloa, A., Oates, C.V., Marches, O., Hartland, E.L., and Frankel, G. (2011). Enteropathogenic and enterohemorrhagic Escherichia coli type III secretion effector EspV induces radical morphological changes in eukaryotic cells. Infect Immun 79, 1067-1076.

Asper, D.J., Karmali, M.A., Townsend, H., Rogan, D., and Potter, A.A. (2011). Serological response of Shiga toxin-producing Escherichia coli type III secreted proteins in sera from vaccinated rabbits, naturally infected cattle, and humans. Clin Vaccine Immunol 18, 1052-1057.

Atalla, H.N., Johnson, R., McEwen, S., Usborne, R.W., and Gyles, C.L. (2000). Use of a Shiga toxin (Stx)-enzyme-linked immunosorbent assay and immunoblot for detection and isolation of Stx-producing Escherichia coli from naturally contaminated beef. J Food Prot 63, 1167-1172.

Averbuch, D., Chapgier, A., Boisson-Dupuis, S., Casanova, J.L., and Engelhard, D. (2011). The clinical spectrum of patients with deficiency of Signal Transducer and Activator of Transcription-1. Pediatr Infect Dis J 30, 352-355.

Bach, E.A., Aguet, M., and Schreiber, R.D. (1997). The IFN gamma receptor: a paradigm for cytokine receptor signaling. Annu Rev Immunol 15, 563-591.

Baruch, K., Gur-Arie, L., Nadler, C., Koby, S., Yerushalmi, G., Ben-Neriah, Y., Yogev, O., Shaulian, E., Guttman, C., Zarivach, R., et al. (2011). Metalloprotease type III effectors that specifically cleave JNK and NF-kappaB. EMBO J 30, 221-231.

Bellmeyer, A., Cotton, C., Kanteti, R., Koutsouris, A., Viswanathan, V.K., and Hecht, G. (2009). Enterohemorrhagic Escherichia coli suppresses inflammatory response to cytokines and its own toxin. Am J Physiol Gastrointest Liver Physiol 297, G576-581.

139

Betz, J., Bielaszewska, M., Thies, A., Humpf, H.U., Dreisewerd, K., Karch, H., Kim, K.S., Friedrich, A.W., and Muthing, J. (2011). Shiga toxin glycosphingolipid receptors in microvascular and macrovascular endothelial cells: differential association with membrane lipid raft microdomains. J Lipid Res 52, 618-634.

Bielaszewska, M., Mellmann, A., Zhang, W., Kock, R., Fruth, A., Bauwens, A., Peters, G., and Karch, H. (2011). Characterisation of the Escherichia coli strain associated with an outbreak of haemolytic uraemic syndrome in Germany, 2011: a microbiological study. Lancet Infect Dis 11, 671-676.

Brockmeyer, J., Bielaszewska, M., Fruth, A., Bonn, M.L., Mellmann, A., Humpf, H.U., and Karch, H. (2007). Subtypes of the plasmid-encoded serine protease EspP in Shiga toxin-producing Escherichia coli: distribution, secretion, and proteolytic activity. Appl Environ Microbiol 73, 6351-6359.

Brooks, J.T., Sowers, E.G., Wells, J.G., Greene, K.D., Griffin, P.M., Hoekstra, R.M., and Strockbine, N.A. (2005). Non-O157 Shiga toxin-producing Escherichia coli infections in the United States, 1983-2002. J Infect Dis 192, 1422-1429.

Brunder, W., Schmidt, H., and Karch, H. (1996). KatP, a novel catalase-peroxidase encoded by the large plasmid of enterohaemorrhagic Escherichia coli O157:H7. Microbiology 142 ( Pt 11), 3305-3315.

Brunder, W., Schmidt, H., and Karch, H. (1997). EspP, a novel extracellular serine protease of enterohaemorrhagic Escherichia coli O157:H7 cleaves human coagulation factor V. Mol Microbiol 24, 767-778.

Bulgin, R., Raymond, B., Garnett, J.A., Frankel, G., Crepin, V.F., Berger, C.N., and Arbeloa, A. (2010). Bacterial guanine nucleotide exchange factors SopE-like and WxxxE effectors. Infect Immun 78, 1417-1425.

Caballero-Franco, C., Keller, K., De Simone, C., and Chadee, K. (2007). The VSL#3 probiotic formula induces mucin gene expression and secretion in colonic epithelial cells. Am J Physiol Gastrointest Liver Physiol 292, G315-322.

Cai, K., Gao, X., Li, T., Wang, Q., Hou, X., Tu, W., Xiao, L., Tian, M., Liu, Y., and Wang, H. (2011). Enhanced immunogenicity of a novel Stx2Am-Stx1B fusion protein in a mice model of enterohemorrhagic Escherichia coli O157:H7 infection. Vaccine 29, 946-952.

Calderwood, S.B., Auclair, F., Donohue-Rolfe, A., Keusch, G.T., and Mekalanos, J.J. (1987). Nucleotide sequence of the Shiga-like toxin genes of Escherichia coli. Proc Natl Acad Sci U S A 84, 4364-4368.

Campellone, K.G., and Leong, J.M. (2005). Nck-independent actin assembly is mediated by two phosphorylated tyrosines within enteropathogenic Escherichia coli Tir. Mol Microbiol 56, 416-432.

Caprioli, A., Morabito, S., Brugere, H., and Oswald, E. (2005). Enterohaemorrhagic Escherichia coli: emerging issues on virulence and modes of transmission. Vet Res 36, 289-311.

140

Casanova, J.L., Holland, S.M., and Notarangelo, L.D. (2012). Inborn Errors of Human JAKs and STATs. Immunity 36, 515-528.

Castillo, A., Eguiarte, L.E., and Souza, V. (2005). A genomic population genetics analysis of the pathogenic enterocyte effacement island in Escherichia coli: the search for the unit of selection. Proc Natl Acad Sci U S A 102, 1542-1547.

Ceponis, P.J., McKay, D.M., Ching, J.C., Pereira, P., and Sherman, P.M. (2003). Enterohemorrhagic Escherichia coli O157:H7 disrupts Stat1-mediated gamma interferon signal transduction in epithelial cells. Infect Immun 71, 1396-1404.

Chapgier, A., Wynn, R.F., Jouanguy, E., Filipe-Santos, O., Zhang, S., Feinberg, J., Hawkins, K., Casanova, J.L., and Arkwright, P.D. (2006). Human complete Stat-1 deficiency is associated with defective type I and II IFN responses in vitro but immunity to some low virulence viruses in vivo. J Immunol 176, 5078-5083.

Chen, J., Johnson, R., and Griffiths, M. (1998). Detection of verotoxigenic Escherichia coli by magnetic capture-hybridization PCR. Appl Environ Microbiol 64, 147-152.

Ching, J.C., Jones, N.L., Ceponis, P.J., Karmali, M.A., and Sherman, P.M. (2002). Escherichia coli Shiga-like toxins induce apoptosis and cleavage of poly(ADP-ribose) polymerase via in vitro activation of caspases. Infect Immun 70, 4669-4677.

Commins, S.P., Borish, L., and Steinke, J.W. (2010). Immunologic messenger molecules: cytokines, interferons, and chemokines. J Allergy Clin Immunol 125, S53-72.

Corr, S.C., Li, Y., Riedel, C.U., O'Toole, P.W., Hill, C., and Gahan, C.G. (2007). Bacteriocin production as a mechanism for the antiinfective activity of Lactobacillus salivarius UCC118. Proc Natl Acad Sci U S A 104, 7617-7621.

Croxen, M.A., and Finlay, B.B. (2010). Molecular mechanisms of Escherichia coli pathogenicity. Nat Rev Microbiol 8, 26-38.

Cui, W., Taub, D.D., and Gardner, K. (2007). qPrimerDepot: a primer database for quantitative real time PCR. Nucleic Acids Res 35, D805-809.

Dalpke, A.H., Eckerle, S., Frey, M., and Heeg, K. (2003). Triggering of Toll-like receptors modulates IFN-gamma signaling: involvement of serine 727 STAT1 phosphorylation and suppressors of cytokine signaling. Eur J Immunol 33, 1776-1787.

Darfeuille-Michaud, A., Neut, C., Barnich, N., Lederman, E., Di Martino, P., Desreumaux, P., Gambiez, L., Joly, B., Cortot, A., and Colombel, J.F. (1998). Presence of adherent Escherichia coli strains in ileal mucosa of patients with Crohn's disease. Gastroenterology 115, 1405-1413.

Datsenko, K.A., and Wanner, B.L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97, 6640-6645.

David, G., Blondeau, K., Renouard, M., and Lewit-Bentley, A. (2002). Crystallization and preliminary analysis of Escherichia coli YodA. Acta Crystallogr D Biol Crystallogr 58, 1243-1245.

141

David, G., Blondeau, K., Schiltz, M., Penel, S., and Lewit-Bentley, A. (2003). YodA from Escherichia coli is a metal-binding, lipocalin-like protein. J Biol Chem 278, 43728-43735.

De Schrijver, K., Buvens, G., Posse, B., Van den Branden, D., Oosterlynck, O., De Zutter, L., Eilers, K., Pierard, D., Dierick, K., Van Damme-Lombaerts, R., et al. (2008). Outbreak of verocytotoxin-producing E. coli O145 and O26 infections associated with the consumption of ice cream produced at a farm, Belgium, 2007. Euro Surveill 13.

Dean, P., and Kenny, B. (2009). The effector repertoire of enteropathogenic E. coli: ganging up on the host cell. Curr Opin Microbiol 12, 101-109.

Dean, P., Scott, J.A., Knox, A.A., Quitard, S., Watkins, N.J., and Kenny, B. (2010). The enteropathogenic E. coli effector EspF targets and disrupts the nucleolus by a process regulated by mitochondrial dysfunction. PLoS Pathog 6, e1000961.

DebRoy, C., Roberts, E., and Fratamico, P.M. (2011). Detection of O antigens in Escherichia coli. Anim Health Res Rev 12, 169-185.

Di, R., Kyu, E., Shete, V., Saidasan, H., Kahn, P.C., and Tumer, N.E. (2011). Identification of amino acids critical for the cytotoxicity of Shiga toxin 1 and 2 in Saccharomyces cerevisiae. Toxicon 57, 525-539.

Didcock, L., Young, D.F., Goodbourn, S., and Randall, R.E. (1999). The V protein of simian virus 5 inhibits interferon signalling by targeting STAT1 for proteasome-mediated degradation. J Virol 73, 9928-9933.

Donato, K.A., Gareau, M.G., Wang, Y.J., and Sherman, P.M. (2010). Lactobacillus rhamnosus GG attenuates interferon-{gamma} and tumour necrosis factor-alpha-induced barrier dysfunction and pro-inflammatory signalling. Microbiology 156, 3288-3297.

Dong, N., Liu, L., and Shao, F. (2010). A bacterial effector targets host DH-PH domain RhoGEFs and antagonizes macrophage phagocytosis. EMBO J 29, 1363-1376.

Dundas, S., Todd, W.T., Stewart, A.I., Murdoch, P.S., Chaudhuri, A.K., and Hutchinson, S.J. (2001). The central Scotland Escherichia coli O157:H7 outbreak: risk factors for the hemolytic uremic syndrome and death among hospitalized patients. Clin Infect Dis 33, 923-931.

DuPont, H.L. (2009). Clinical practice. Bacterial diarrhea. N Engl J Med 361, 1560-1569.

Dupuis, S., Jouanguy, E., Al-Hajjar, S., Fieschi, C., Al-Mohsen, I.Z., Al-Jumaah, S., Yang, K., Chapgier, A., Eidenschenk, C., Eid, P., et al. (2003). Impaired response to interferon-alpha/beta and lethal viral disease in human STAT1 deficiency. Nat Genet 33, 388-391.

Dydensborg, A.B., Herring, E., Auclair, J., Tremblay, E., and Beaulieu, J.F. (2006). Normalizing genes for quantitative RT-PCR in differentiating human intestinal epithelial cells and adenocarcinomas of the colon. Am J Physiol Gastrointest Liver Physiol 290, G1067-1074.

Elliott, E.J., Robins-Browne, R.M., O'Loughlin, E.V., Bennett-Wood, V., Bourke, J., Henning, P., Hogg, G.G., Knight, J., Powell, H., and Redmond, D. (2001). Nationwide study of haemolytic

142

uraemic syndrome: clinical, microbiological, and epidemiological features. Arch Dis Child 85, 125-131.

Ethelberg, S., Olsen, K.E., Scheutz, F., Jensen, C., Schiellerup, P., Enberg, J., Petersen, A.M., Olesen, B., Gerner-Smidt, P., and Molbak, K. (2004). Virulence factors for hemolytic uremic syndrome, Denmark. Emerg Infect Dis 10, 842-847.

Ethelberg, S., Smith, B., Torpdahl, M., Lisby, M., Boel, J., Jensen, T., and Molbak, K. (2007). An outbreak of Verocytotoxin-producing Escherichia coli O26:H11 caused by beef sausage, Denmark 2007. Euro Surveill 12, E070531 070534.

FAO/WHO (2002). Joint FAO/WHO Working Group Report on Drafting Guidelines for the Evaluation of Probiotics in Food (London, Canada).

Fayol-Messaoudi, D., Berger, C.N., Coconnier-Polter, M.H., Lievin-Le Moal, V., and Servin, A.L. (2005). pH-, Lactic acid-, and non-lactic acid-dependent activities of probiotic Lactobacilli against Salmonella enterica Serovar Typhimurium. Appl Environ Microbiol 71, 6008-6013.

Feng, P., Lampel, K.A., Karch, H., and Whittam, T.S. (1998). Genotypic and phenotypic changes in the emergence of Escherichia coli O157:H7. J Infect Dis 177, 1750-1753.

Foster, L.M., Tompkins, T.A., and Dahl, W.J. (2011). A comprehensive post-market review of studies on a probiotic product containing Lactobacillus helveticus R0052 and Lactobacillus rhamnosus R0011. Benef Microbes 2, 319-334.

Frank, C., Werber, D., Cramer, J.P., Askar, M., Faber, M., Heiden, M.A., Bernard, H., Fruth, A., Prager, R., Spode, A., et al. (2011). Epidemic Profile of Shiga-Toxin-Producing Escherichia coli O104:H4 Outbreak in Germany - Preliminary Report. N Engl J Med.

Frankel, G., and Phillips, A.D. (2008). Attaching effacing Escherichia coli and paradigms of Tir-triggered actin polymerization: getting off the pedestal. Cell Microbiol 10, 549-556.

Fraser, M.E., Fujinaga, M., Cherney, M.M., Melton-Celsa, A.R., Twiddy, E.M., O'Brien, A.D., and James, M.N. (2004). Structure of shiga toxin type 2 (Stx2) from Escherichia coli O157:H7. J Biol Chem 279, 27511-27517.

Fukata, M., Hernandez, Y., Conduah, D., Cohen, J., Chen, A., Breglio, K., Goo, T., Hsu, D., Xu, R., and Abreu, M.T. (2009). Innate immune signaling by Toll-like receptor-4 (TLR4) shapes the inflammatory microenvironment in colitis-associated tumors. Inflamm Bowel Dis 15, 997-1006.

Fukuda, S., Toh, H., Hase, K., Oshima, K., Nakanishi, Y., Yoshimura, K., Tobe, T., Clarke, J.M., Topping, D.L., Suzuki, T., et al. (2011). Bifidobacteria can protect from enteropathogenic infection through production of acetate. Nature 469, 543-547.

Gareau, M.G., Ho, N.K., Brenner, D., Sousa, A.J., Lebourhis, L., Mak, T.W., Girardin, S.E., Philpott, D.J., and Sherman, P.M. (2011). Enterohaemorrhagic, but not enteropathogenic, Escherichia coli infection of epithelial cells disrupts signalling responses to tumour necrosis factor-alpha. Microbiology 157, 2963-2973.

143

Gareau, M.G., Sherman, P.M., and Walker, W.A. (2010). Probiotics and the gut microbiota in intestinal health and disease. Nat Rev Gastroenterol Hepatol 7, 503-514.

Garmendia, J., Frankel, G., and Crepin, V.F. (2005). Enteropathogenic and enterohemorrhagic Escherichia coli infections: translocation, translocation, translocation. Infect Immun 73, 2573-2585.

Gedek, B.R. (1999). Adherence of Escherichia coli serogroup O 157 and the Salmonella typhimurium mutant DT 104 to the surface of Saccharomyces boulardii. Mycoses 42, 261-264.

Gehring, A.J., Rojas, R.E., Canaday, D.H., Lakey, D.L., Harding, C.V., and Boom, W.H. (2003). The Mycobacterium tuberculosis 19-kilodalton lipoprotein inhibits gamma interferon-regulated HLA-DR and Fc gamma R1 on human macrophages through Toll-like receptor 2. Infect Immun 71, 4487-4497.

Gill, H.S., Shu, Q., Lin, H., Rutherfurd, K.J., and Cross, M.L. (2001). Protection against translocating Salmonella typhimurium infection in mice by feeding the immuno-enhancing probiotic Lactobacillus rhamnosus strain HN001. Med Microbiol Immunol 190, 97-104.

Golan, L., Gonen, E., Yagel, S., Rosenshine, I., and Shpigel, N.Y. (2011). Enterohemorrhagic Escherichia coli induce attaching and effacing lesions and hemorrhagic colitis in human and bovine intestinal xenograft models. Dis Model Mech 4, 86-94.

Goldwater, P.N., and Bettelheim, K.A. (2012). Treatment of enterohemorrhagic Escherichia coli (EHEC) infection and hemolytic uremic syndrome (HUS). BMC Med 10, 12.

Grif, K., Dierich, M.P., Karch, H., and Allerberger, F. (1998). Strain-specific differences in the amount of Shiga toxin released from enterohemorrhagic Escherichia coli O157 following exposure to subinhibitory concentrations of antimicrobial agents. Eur J Clin Microbiol Infect Dis 17, 761-766.

Grzeskowiak, L., Isolauri, E., Salminen, S., and Gueimonde, M. (2011). Manufacturing process influences properties of probiotic bacteria. Br J Nutr 105, 887-894.

Gu, J., Liu, Y., Yu, S., Wang, H., Wang, Q., Yi, Y., Zhu, F., Yu, X.J., Zou, Q., and Mao, X. (2009). Enterohemorrhagic Escherichia coli trivalent recombinant vaccine containing EspA, intimin and Stx2 induces strong humoral immune response and confers protection in mice. Microbes Infect 11, 835-841.

Hale, L., Lazos, O., Haines, A., and Thomas, C. (2010). An efficient stress-free strategy to displace stable bacterial plasmids. Biotechniques 48, 223-228.

Hamada, D., Hamaguchi, M., Suzuki, K.N., Sakata, I., and Yanagihara, I. (2010). Cytoskeleton-modulating effectors of enteropathogenic and enterohemorrhagic Escherichia coli: a case for EspB as an intrinsically less-ordered effector. FEBS J 277, 2409-2415.

Hamaguchi, M., Hamada, D., Suzuki, K.N., Sakata, I., and Yanagihara, I. (2008). Molecular basis of actin reorganization promoted by binding of enterohaemorrhagic Escherichia coli EspB to alpha-catenin. FEBS J 275, 6260-6267.

144

Heim, M.H., Kerr, I.M., Stark, G.R., and Darnell, J.E., Jr. (1995). Contribution of STAT SH2 groups to specific interferon signaling by the Jak-STAT pathway. Science 267, 1347-1349.

Hickey, C.A., Beattie, T.J., Cowieson, J., Miyashita, Y., Strife, C.F., Frem, J.C., Peterson, J.M., Butani, L., Jones, D.P., Havens, P.L., et al. (2011). Early volume expansion during diarrhea and relative nephroprotection during subsequent hemolytic uremic syndrome. Arch Pediatr Adolesc Med 165, 884-889.

Higgins, L.M., Frankel, G., Connerton, I., Goncalves, N.S., Dougan, G., and MacDonald, T.T. (1999). Role of bacterial intimin in colonic hyperplasia and inflammation. Science 285, 588-591.

Ho, N.H., Ossa, J.C., Sousa, A.J., and Sherman, P.M. (2011). Enterohemorrhagic Escherichia coli O157:H7 Shiga toxins inhibit interferon-gamma mediated cellular activation. Infect Immun. Submitted.

Ho, N.K., Crandall, I., and Sherman, P.M. (2012a). Identifying mechanisms by which Escherichia coli O157:H7 subverts interferon-gamma mediated signal transducer and activator of transcription-1 activation. PLoS One 7, e30145.

Ho, N.K., Ossa, J.C., Silphaduang, U., Johnson, R., Johnson-Henry, K.C., and Sherman, P.M. (2012b). Enterohemorrhagic Escherichia coli O157:H7 Shiga Toxins Inhibit Interferon-gamma Mediated Cellular Activation. Infect Immun.

Ho, T.D., Davis, B.M., Ritchie, J.M., and Waldor, M.K. (2008). Type 2 secretion promotes enterohemorrhagic Escherichia coli adherence and intestinal colonization. Infect Immun 76, 1858-1865.

Holmes, A., Muhlen, S., Roe, A.J., and Dean, P. (2010). The EspF effector, a bacterial pathogen's Swiss army knife. Infect Immun 78, 4445-4453.

Hooper, L.V., and Macpherson, A.J. (2010). Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol 10, 159-169.

Huang, A., de Grandis, S., Friesen, J., Karmali, M., Petric, M., Congi, R., and Brunton, J.L. (1986). Cloning and expression of the genes specifying Shiga-like toxin production in Escherichia coli H19. J Bacteriol 166, 375-379.

Huibregtse, I.L., Snoeck, V., de Creus, A., Braat, H., De Jong, E.C., Van Deventer, S.J., and Rottiers, P. (2007). Induction of ovalbumin-specific tolerance by oral administration of Lactococcus lactis secreting ovalbumin. Gastroenterology 133, 517-528.

Hussain, S., Zwilling, B.S., and Lafuse, W.P. (1999). Mycobacterium avium infection of mouse macrophages inhibits IFN-gamma Janus kinase-STAT signaling and gene induction by down-regulation of the IFN-gamma receptor. J Immunol 163, 2041-2048.

Ide, T., Laarmann, S., Greune, L., Schillers, H., Oberleithner, H., and Schmidt, M.A. (2001). Characterization of translocation pores inserted into plasma membranes by type III-secreted Esp proteins of enteropathogenic Escherichia coli. Cell Microbiol 3, 669-679.

145

Imamovic, L., Jofre, J., Schmidt, H., Serra-Moreno, R., and Muniesa, M. (2009). Phage-mediated Shiga toxin 2 gene transfer in food and water. Appl Environ Microbiol 75, 1764-1768.

Islam, M.S., and Stimson, W.H. (1990). Production and characterization of monoclonal antibodies with therapeutic potential against Shiga toxin. J Clin Lab Immunol 33, 11-16.

Jandu, N., Ceponis, P.J., Kato, S., Riff, J.D., McKay, D.M., and Sherman, P.M. (2006). Conditioned medium from enterohemorrhagic Escherichia coli-infected T84 cells inhibits signal transducer and activator of transcription 1 activation by gamma interferon. Infect Immun 74, 1809-1818.

Jandu, N., Ho, N.K., Donato, K.A., Karmali, M.A., Mascarenhas, M., Duffy, S.P., Tailor, C., and Sherman, P.M. (2009a). Enterohemorrhagic Escherichia coli O157:H7 gene expression profiling in response to growth in the presence of host epithelia. PLoS One 4, e4889.

Jandu, N., Shen, S., Wickham, M.E., Prajapati, R., Finlay, B.B., Karmali, M.A., and Sherman, P.M. (2007). Multiple seropathotypes of verotoxin-producing Escherichia coli (VTEC) disrupt interferon-gamma-induced tyrosine phosphorylation of signal transducer and activator of transcription (Stat)-1. Microb Pathog 42, 62-71.

Jandu, N., Zeng, Z.J., Johnson-Henry, K.C., and Sherman, P.M. (2009b). Probiotics prevent enterohaemorrhagic Escherichia coli O157:H7-mediated inhibition of interferon-gamma-induced tyrosine phosphorylation of STAT-1. Microbiology 155, 531-540.

Jelacic, J.K., Damrow, T., Chen, G.S., Jelacic, S., Bielaszewska, M., Ciol, M., Carvalho, H.M., Melton-Celsa, A.R., O'Brien, A.D., and Tarr, P.I. (2003). Shiga toxin-producing Escherichia coli in Montana: bacterial genotypes and clinical profiles. J Infect Dis 188, 719-729.

Jenkins, C., Evans, J., Chart, H., Willshaw, G.A., and Frankel, G. (2008). Escherichia coli serogroup O26--a new look at an old adversary. J Appl Microbiol 104, 14-25.

Johnson-Henry, K.C., Hagen, K.E., Gordonpour, M., Tompkins, T.A., and Sherman, P.M. (2007). Surface-layer protein extracts from Lactobacillus helveticus inhibit enterohaemorrhagic Escherichia coli O157:H7 adhesion to epithelial cells. Cell Microbiol 9, 356-367.

Jones, R.M., and Neish, A.S. (2011). Recognition of bacterial pathogens and mucosal immunity. Cell Microbiol 13, 670-676.

Kanehisa, M., and Goto, S. (2000). KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Res 28, 27-30.

Kaper, J.B., Nataro, J.P., and Mobley, H.L. (2004). Pathogenic Escherichia coli. Nat Rev Microbiol 2, 123-140.

Karch, H., Friedrich, A.W., Gerber, A., Zimmerhackl, L.B., Schmidt, M.A., and Bielaszewska, M. (2006). New aspects in the pathogenesis of enteropathic hemolytic uremic syndrome. Semin Thromb Hemost 32, 105-112.

Karch, H., Tarr, P.I., and Bielaszewska, M. (2005). Enterohaemorrhagic Escherichia coli in human medicine. Int J Med Microbiol 295, 405-418.

146

Karmali, M.A., Mascarenhas, M., Shen, S., Ziebell, K., Johnson, S., Reid-Smith, R., Isaac-Renton, J., Clark, C., Rahn, K., and Kaper, J.B. (2003). Association of genomic O island 122 of Escherichia coli EDL 933 with verocytotoxin-producing Escherichia coli seropathotypes that are linked to epidemic and/or serious disease. J Clin Microbiol 41, 4930-4940.

Karmali, M.A., Petric, M., Lim, C., Fleming, P.C., Arbus, G.S., and Lior, H. (1985). The association between idiopathic hemolytic uremic syndrome and infection by verotoxin-producing Escherichia coli. J Infect Dis 151, 775-782.

Karmali, M.A., Steele, B.T., Petric, M., and Lim, C. (1983). Sporadic cases of haemolytic-uraemic syndrome associated with faecal cytotoxin and cytotoxin-producing Escherichia coli in stools. Lancet 1, 619-620.

Kenny, B. (2001). The enterohaemorrhagic Escherichia coli (serotype O157:H7) Tir molecule is not functionally interchangeable for its enteropathogenic E. coli (serotype O127:H6) homologue. Cell Microbiol 3, 499-510.

Kim, M., Ogawa, M., Fujita, Y., Yoshikawa, Y., Nagai, T., Koyama, T., Nagai, S., Lange, A., Fassler, R., and Sasakawa, C. (2009). Bacteria hijack integrin-linked kinase to stabilize focal adhesions and block cell detachment. Nature 459, 578-582.

Kim, Y.H., and Pollack, J.R. (2009). Comparative genomic hybridization on spotted oligonucleotide microarrays. Methods Mol Biol 556, 21-32.

Konowalchuk, J., Speirs, J.I., and Stavric, S. (1977). Vero response to a cytotoxin of Escherichia coli. Infect Immun 18, 775-779.

Kuijper, E.J., Soonawala, D., Vermont, C., and van Dissel, J.T. (2011). Household transmission of haemolytic uraemic syndrome associated with Escherichia coli O104:H4 in the Netherlands, May 2011. Euro Surveill 16.

Kurushima, J., Nagai, T., Nagamatsu, K., and Abe, A. (2010). EspJ effector in enterohemorrhagic E. coli translocates into host mitochondria via an atypical mitochondrial targeting signal. Microbiol Immunol 54, 371-379.

Kyle, J.L., Cummings, C.A., Parker, C.T., Quinones, B., Vatta, P., Newton, E., Huynh, S., Swimley, M., Degoricija, L., Barker, M., et al. (2012). Escherichia coli serotype O55:H7 diversity supports parallel acquisition of bacteriophage at Shiga toxin phage insertion sites during evolution of the O157:H7 lineage. J Bacteriol 194, 1885-1896.

Landoni, V.I., de Campos-Nebel, M., Schierloh, P., Calatayud, C., Fernandez, G.C., Ramos, M.V., Rearte, B., Palermo, M.S., and Isturiz, M.A. (2010). Shiga toxin 1-induced inflammatory response in lipopolysaccharide-sensitized astrocytes is mediated by endogenous tumor necrosis factor alpha. Infect Immun 78, 1193-1201.

Lapeyraque, A.L., Malina, M., Fremeaux-Bacchi, V., Boppel, T., Kirschfink, M., Oualha, M., Proulx, F., Clermont, M.J., Le Deist, F., Niaudet, P., et al. (2011). Eculizumab in severe Shiga-toxin-associated HUS. N Engl J Med 364, 2561-2563.

147

Lathem, W.W., Grys, T.E., Witowski, S.E., Torres, A.G., Kaper, J.B., Tarr, P.I., and Welch, R.A. (2002). StcE, a metalloprotease secreted by Escherichia coli O157:H7, specifically cleaves C1 esterase inhibitor. Mol Microbiol 45, 277-288.

Levine, M.M. (1987). Escherichia coli that cause diarrhea: enterotoxigenic, enteropathogenic, enteroinvasive, enterohemorrhagic, and enteroadherent. J Infect Dis 155, 377-389.

Levy, D.E., and Darnell, J.E., Jr. (2002). Stats: transcriptional control and biological impact. Nat Rev Mol Cell Biol 3, 651-662.

Lim, J.Y., Yoon, J., and Hovde, C.J. (2010). A brief overview of Escherichia coli O157:H7 and its plasmid O157. J Microbiol Biotechnol 20, 5-14.

Lingwood, C.A. (1996). Role of verotoxin receptors in pathogenesis. Trends Microbiol 4, 147-153.

Lingwood, C.A., Law, H., Richardson, S., Petric, M., Brunton, J.L., De Grandis, S., and Karmali, M. (1987). Glycolipid binding of purified and recombinant Escherichia coli produced verotoxin in vitro. J Biol Chem 262, 8834-8839.

Long, K.Z., Rosado, J.L., Santos, J.I., Haas, M., Al Mamun, A., DuPont, H.L., Nanthakumar, N.N., and Estrada-Garcia, T. (2010). Associations between mucosal innate and adaptive immune responses and resolution of diarrheal pathogen infections. Infect Immun 78, 1221-1228.

Lukjancenko, O., Wassenaar, T.M., and Ussery, D.W. (2010). Comparison of 61 sequenced Escherichia coli genomes. Microb Ecol 60, 708-720.

Maki, D.G. (2006). Don't eat the spinach--controlling foodborne infectious disease. N Engl J Med 355, 1952-1955.

Maluykova, I., Gutsal, O., Laiko, M., Kane, A., Donowitz, M., and Kovbasnjuk, O. (2008). Latrunculin B facilitates Shiga toxin 1 transcellular transcytosis across T84 intestinal epithelial cells. Biochim Biophys Acta 1782, 370-377.

Mann, B.A., Huang, J.H., Li, P., Chang, H.C., Slee, R.B., O'Sullivan, A., Anita, M., Yeh, N., Klemsz, M.J., Brutkiewicz, R.R., et al. (2008). Vaccinia virus blocks Stat1-dependent and Stat1-independent gene expression induced by type I and type II interferons. J Interferon Cytokine Res 28, 367-380.

Mao, X., and Chen, X. (2005). Crystallization and X-ray crystallographic analysis of human STAT1. Acta Crystallogr Sect F Struct Biol Cryst Commun 61, 666-668.

Marquis, J.F., Nantel, A., LaCourse, R., Ryan, L., North, R.J., and Gros, P. (2008). Fibrotic response as a distinguishing feature of resistance and susceptibility to pulmonary infection with Mycobacterium tuberculosis in mice. Infect Immun 76, 78-88.

Marshall, J.K., Thabane, M., Garg, A.X., Clark, W.F., Moayyedi, P., and Collins, S.M. (2010). Eight year prognosis of postinfectious irritable bowel syndrome following waterborne bacterial dysentery. Gut 59, 605-611.

148

Marshall, J.K., Thabane, M., Garg, A.X., Clark, W.F., Salvadori, M., and Collins, S.M. (2006). Incidence and epidemiology of irritable bowel syndrome after a large waterborne outbreak of bacterial dysentery. Gastroenterology 131, 445-450; quiz 660.

Martinez, E., Schroeder, G.N., Berger, C.N., Lee, S.F., Robinson, K.S., Badea, L., Simpson, N., Hall, R.A., Hartland, E.L., Crepin, V.F., et al. (2010). Binding to Na(+) /H(+) exchanger regulatory factor 2 (NHERF2) affects trafficking and function of the enteropathogenic Escherichia coli type III secretion system effectors Map, EspI and NleH. Cell Microbiol 12, 1718-1731.

McBride, K.M., Banninger, G., McDonald, C., and Reich, N.C. (2002). Regulated nuclear import of the STAT1 transcription factor by direct binding of importin-alpha. EMBO J 21, 1754-1763.

Melton-Celsa, A., Mohawk, K., Teel, L., and O'Brien, A. (2012). Pathogenesis of Shiga-toxin producing Escherichia coli. Curr Top Microbiol Immunol 357, 67-103.

Misselwitz, J., Karch, H., Bielazewska, M., John, U., Ringelmann, F., Ronnefarth, G., and Patzer, L. (2003). Cluster of hemolytic-uremic syndrome caused by Shiga toxin-producing Escherichia coli O26:H11. Pediatr Infect Dis J 22, 349-354.

Miyahara, A., Nakanishi, N., Ooka, T., Hayashi, T., Sugimoto, N., and Tobe, T. (2009). Enterohemorrhagic Escherichia coli effector EspL2 induces actin microfilament aggregation through annexin 2 activation. Cell Microbiol 11, 337-350.

Molloy, M.P., Phadke, N.D., Maddock, J.R., and Andrews, P.C. (2001). Two-dimensional electrophoresis and peptide mass fingerprinting of bacterial outer membrane proteins. Electrophoresis 22, 1686-1696.

Mora, A., Blanco, J.E., Blanco, M., Alonso, M.P., Dhabi, G., Echeita, A., Gonzalez, E.A., Bernardez, M.I., and Blanco, J. (2005). Antimicrobial resistance of Shiga toxin (verotoxin)-producing Escherichia coli O157:H7 and non-O157 strains isolated from humans, cattle, sheep and food in Spain. Res Microbiol 156, 793-806.

Mora, A., Leon, S.L., Blanco, M., Blanco, J.E., Lopez, C., Dahbi, G., Echeita, A., Gonzalez, E.A., and Blanco, J. (2007). Phage types, virulence genes and PFGE profiles of Shiga toxin-producing Escherichia coli O157:H7 isolated from raw beef, soft cheese and vegetables in Lima (Peru). Int J Food Microbiol 114, 204-210.

Mukhopadhyay, S., and Linstedt, A.D. (2012). Manganese blocks intracellular trafficking of Shiga toxin and protects against Shiga toxicosis. Science 335, 332-335.

Muller, D., Benz, I., Liebchen, A., Gallitz, I., Karch, H., and Schmidt, M.A. (2009). Comparative analysis of the locus of enterocyte effacement and its flanking regions. Infect Immun 77, 3501-3513.

Muller, U., Steinhoff, U., Reis, L.F., Hemmi, S., Pavlovic, J., Zinkernagel, R.M., and Aguet, M. (1994). Functional role of type I and type II interferons in antiviral defense. Science 264, 1918-1921.

149

Nadler, C., Baruch, K., Kobi, S., Mills, E., Haviv, G., Farago, M., Alkalay, I., Bartfeld, S., Meyer, T.F., Ben-Neriah, Y., et al. (2010). The type III secretion effector NleE inhibits NF-kappaB activation. PLoS Pathog 6, e1000743.

Nandan, D., and Reiner, N.E. (1995). Attenuation of gamma interferon-induced tyrosine phosphorylation in mononuclear phagocytes infected with Leishmania donovani: selective inhibition of signaling through Janus kinases and Stat1. Infect Immun 63, 4495-4500.

O'Mahony, L., McCarthy, J., Kelly, P., Hurley, G., Luo, F., Chen, K., O'Sullivan, G.C., Kiely, B., Collins, J.K., Shanahan, F., et al. (2005). Lactobacillus and bifidobacterium in irritable bowel syndrome: symptom responses and relationship to cytokine profiles. Gastroenterology 128, 541-551.

Obrig, T.G. (2010). Escherichia coli Shiga Toxin Mechanisms of Action in Renal Disease. Toxins (Basel) 2, 2769-2794.

Orth, D., Khan, A.B., Naim, A., Grif, K., Brockmeyer, J., Karch, H., Joannidis, M., Clark, S.J., Day, A.J., Fidanzi, S., et al. (2009). Shiga toxin activates complement and binds factor H: evidence for an active role of complement in hemolytic uremic syndrome. J Immunol 182, 6394-6400.

Pak, S., Holland, N., Garnett, E.A., Mileti, E., Mahadevan, U., Beckert, R., Kanwar, B., and Heyman, M.B. (2012). Cytokine profiles in peripheral blood of children and adults with crohn disease. J Pediatr Gastroenterol Nutr 54, 769-775.

Panos, G.Z., Betsi, G.I., and Falagas, M.E. (2006). Systematic review: are antibiotics detrimental or beneficial for the treatment of patients with Escherichia coli O157:H7 infection? Aliment Pharmacol Ther 24, 731-742.

Pearson, J.S., Riedmaier, P., Marches, O., Frankel, G., and Hartland, E.L. (2011). A type III effector protease NleC from enteropathogenic Escherichia coli targets NF-kappaB for degradation. Mol Microbiol 80, 219-230.

Pedron, T., and Sansonetti, P. (2008). Commensals, bacterial pathogens and intestinal inflammation: an intriguing menage a trois. Cell Host Microbe 3, 344-347.

Peng, H., Wang, X., Barnes, P.F., Tang, H., Townsend, J.C., and Samten, B. (2011). The Mycobacterium tuberculosis early secreted antigenic target of 6 kDa inhibits T cell interferon-gamma production through the p38 mitogen-activated protein kinase pathway. J Biol Chem 286, 24508-24518.

Peterson, M.D., and Mooseker, M.S. (1992). Characterization of the enterocyte-like brush border cytoskeleton of the C2BBe clones of the human intestinal cell line, Caco-2. J Cell Sci 102 ( Pt 3), 581-600.

Philpott, D.J., McKay, D.M., Sherman, P.M., and Perdue, M.H. (1996). Infection of T84 cells with enteropathogenic Escherichia coli alters barrier and transport functions. Am J Physiol 270, G634-645.

150

Rasko, D.A., Webster, D.R., Sahl, J.W., Bashir, A., Boisen, N., Scheutz, F., Paxinos, E.E., Sebra, R., Chin, C.S., Iliopoulos, D., et al. (2011). Origins of the E. coli strain causing an outbreak of hemolytic-uremic syndrome in Germany. N Engl J Med 365, 709-717.

Renauld, J.C. (2003). Class II cytokine receptors and their ligands: key antiviral and inflammatory modulators. Nat Rev Immunol 3, 667-676.

Resta-Lenert, S., and Barrett, K.E. (2006). Probiotics and commensals reverse TNF-alpha- and IFN-gamma-induced dysfunction in human intestinal epithelial cells. Gastroenterology 130, 731-746.

Rietschel, E.T., and Brade, H. (1992). Bacterial endotoxins. Sci Am 267, 54-61.

Rietschel, E.T., Kirikae, T., Schade, F.U., Ulmer, A.J., Holst, O., Brade, H., Schmidt, G., Mamat, U., Grimmecke, H.D., Kusumoto, S., et al. (1993). The chemical structure of bacterial endotoxin in relation to bioactivity. Immunobiology 187, 169-190.

Riff, J.D., Callahan, J.W., and Sherman, P.M. (2005). Cholesterol-enriched membrane microdomains are required for inducing host cell cytoskeleton rearrangements in response to attaching-effacing Escherichia coli. Infect Immun 73, 7113-7125.

Riley, L.W., Remis, R.S., Helgerson, S.D., McGee, H.B., Wells, J.G., Davis, B.R., Hebert, R.J., Olcott, E.S., Johnson, L.M., Hargrett, N.T., et al. (1983). Hemorrhagic colitis associated with a rare Escherichia coli serotype. N Engl J Med 308, 681-685.

Rodrigues, D.M., Sousa, A.J., Johnson-Henry, K.C., Sherman, P.M., and Gareau, M.G. (2012). Probiotics Are Effective for the Prevention and Treatment of Citrobacter rodentium-Induced Colitis in Mice. J Infect Dis 206, 99-109.

Saeed, A.I., Sharov, V., White, J., Li, J., Liang, W., Bhagabati, N., Braisted, J., Klapa, M., Currier, T., Thiagarajan, M., et al. (2003). TM4: a free, open-source system for microarray data management and analysis. Biotechniques 34, 374-378.

Saha, B., Jyothi Prasanna, S., Chandrasekar, B., and Nandi, D. (2010). Gene modulation and immunoregulatory roles of interferon gamma. Cytokine 50, 1-14.

Saleh, M. (2011). The machinery of Nod-like receptors: refining the paths to immunity and cell death. Immunol Rev 243, 235-246.

Schmidt, H., Henkel, B., and Karch, H. (1997). A gene cluster closely related to type II secretion pathway operons of Gram-negative bacteria is located on the large plasmid of enterohemorrhagic Escherichia coli O157 strains. FEMS Microbiol Lett 148, 265-272.

Schmidt, H., Karch, H., and Beutin, L. (1994). The large-sized plasmids of enterohemorrhagic Escherichia coli O157 strains encode hemolysins which are presumably members of the E. coli alpha-hemolysin family. FEMS Microbiol Lett 117, 189-196.

Schmidt, M.A. (2010). LEEways: tales of EPEC, ATEC and EHEC. Cell Microbiol 12, 1544-1552.

151

Schroder, K., Hertzog, P.J., Ravasi, T., and Hume, D.A. (2004). Interferon-gamma: an overview of signals, mechanisms and functions. J Leukoc Biol 75, 163-189.

Schuller, S., Heuschkel, R., Torrente, F., Kaper, J.B., and Phillips, A.D. (2007). Shiga toxin binding in normal and inflamed human intestinal mucosa. Microbes Infect 9, 35-39.

Schuster, C.J., Ellis, A.G., Robertson, W.J., Charron, D.F., Aramini, J.J., Marshall, B.J., and Medeiros, D.T. (2005). Infectious disease outbreaks related to drinking water in Canada, 1974-2001. Can J Public Health 96, 254-258.

Selyunin, A.S., Sutton, S.E., Weigele, B.A., Reddick, L.E., Orchard, R.C., Bresson, S.M., Tomchick, D.R., and Alto, N.M. (2011). The assembly of a GTPase-kinase signalling complex by a bacterial catalytic scaffold. Nature 469, 107-111.

Serna, A.t., and Boedeker, E.C. (2008). Pathogenesis and treatment of Shiga toxin-producing Escherichia coli infections. Curr Opin Gastroenterol 24, 38-47.

Seth, A., Yan, F., Polk, D.B., and Rao, R.K. (2008). Probiotics ameliorate the hydrogen peroxide-induced epithelial barrier disruption by a PKC- and MAP kinase-dependent mechanism. Am J Physiol Gastrointest Liver Physiol 294, G1060-1069.

Shames, S.R., Deng, W., Guttman, J.A., de Hoog, C.L., Li, Y., Hardwidge, P.R., Sham, H.P., Vallance, B.A., Foster, L.J., and Finlay, B.B. (2010). The pathogenic E. coli type III effector EspZ interacts with host CD98 and facilitates host cell prosurvival signalling. Cell Microbiol 12, 1322-1339.

Shang, L., Fukata, M., Thirunarayanan, N., Martin, A.P., Arnaboldi, P., Maussang, D., Berin, C., Unkeless, J.C., Mayer, L., Abreu, M.T., et al. (2008). Toll-like receptor signaling in small intestinal epithelium promotes B-cell recruitment and IgA production in lamina propria. Gastroenterology 135, 529-538.

Shea-Donohue, T., Fasano, A., Smith, A., and Zhao, A. (2010). Enteric pathogens and gut function: Role of cytokines and STATs. Gut Microbes 1, 316-324.

Sherman, P.M., Johnson-Henry, K.C., Yeung, H.P., Ngo, P.S., Goulet, J., and Tompkins, T.A. (2005). Probiotics reduce enterohemorrhagic Escherichia coli O157:H7- and enteropathogenic E. coli O127:H6-induced changes in polarized T84 epithelial cell monolayers by reducing bacterial adhesion and cytoskeletal rearrangements. Infect Immun 73, 5183-5188.

Sherman, P.M., Ossa, J.C., and Johnson-Henry, K. (2009). Unraveling mechanisms of action of probiotics. Nutr Clin Pract 24, 10-14.

Slavicek, J., Puretic, Z., Novak, M., Sarnavka, V., Benjak, V., Glavas-Boras, S., and Thune, S. (1995). The role of plasma exchange in the treatment of severe forms of hemolytic-uremic syndrome in childhood. Artif Organs 19, 506-510.

Spears, K.J., Roe, A.J., and Gally, D.L. (2006). A comparison of enteropathogenic and enterohaemorrhagic Escherichia coli pathogenesis. FEMS Microbiol Lett 255, 187-202.

152

Stark, G.R., and Darnell, J.E., Jr. (2012). The JAK-STAT Pathway at Twenty. Immunity 36, 503-514.

Stoiber, D., Stockinger, S., Steinlein, P., Kovarik, J., and Decker, T. (2001). Listeria monocytogenes modulates macrophage cytokine responses through STAT serine phosphorylation and the induction of suppressor of cytokine signaling 3. J Immunol 166, 466-472.

Tarr, P.I., Sadler, J.E., Chandler, W.L., George, J.N., and Tsai, H.M. (2012). Should all adult patients with diarrhoea-associated HUS receive plasma exchange? Lancet 379, 516; author reply 516-517.

Tatsuno, I., Horie, M., Abe, H., Miki, T., Makino, K., Shinagawa, H., Taguchi, H., Kamiya, S., Hayashi, T., and Sasakawa, C. (2001). toxB gene on pO157 of enterohemorrhagic Escherichia coli O157:H7 is required for full epithelial cell adherence phenotype. Infect Immun 69, 6660-6669.

Tatsuno, I., Kimura, H., Okutani, A., Kanamaru, K., Abe, H., Nagai, S., Makino, K., Shinagawa, H., Yoshida, M., Sato, K., et al. (2000). Isolation and characterization of mini-Tn5Km2 insertion mutants of enterohemorrhagic Escherichia coli O157:H7 deficient in adherence to Caco-2 cells. Infect Immun 68, 5943-5952.

Taylor, S., Wakem, M., Dijkman, G., Alsarraj, M., and Nguyen, M. (2010). A practical approach to RT-qPCR-Publishing data that conform to the MIQE guidelines. Methods 50, S1-5.

Tesh, V.L., Burris, J.A., Owens, J.W., Gordon, V.M., Wadolkowski, E.A., O'Brien, A.D., and Samuel, J.E. (1993). Comparison of the relative toxicities of Shiga-like toxins type I and type II for mice. Infect Immun 61, 3392-3402.

Tesh, V.L., Ramegowda, B., and Samuel, J.E. (1994). Purified Shiga-like toxins induce expression of proinflammatory cytokines from murine peritoneal macrophages. Infect Immun 62, 5085-5094.

Thanabalasuriar, A., Koutsouris, A., Weflen, A., Mimee, M., Hecht, G., and Gruenheid, S. (2010). The bacterial virulence factor NleA is required for the disruption of intestinal tight junctions by enteropathogenic Escherichia coli. Cell Microbiol 12, 31-41.

Thurman, J.M., Marians, R., Emlen, W., Wood, S., Smith, C., Akana, H., Holers, V.M., Lesser, M., Kline, M., Hoffman, C., et al. (2009). Alternative pathway of complement in children with diarrhea-associated hemolytic uremic syndrome. Clin J Am Soc Nephrol 4, 1920-1924.

Tien, M.T., Girardin, S.E., Regnault, B., Le Bourhis, L., Dillies, M.A., Coppee, J.Y., Bourdet-Sicard, R., Sansonetti, P.J., and Pedron, T. (2006). Anti-inflammatory effect of Lactobacillus casei on Shigella-infected human intestinal epithelial cells. J Immunol 176, 1228-1237.

Trachtman, H., Cnaan, A., Christen, E., Gibbs, K., Zhao, S., Acheson, D.W., Weiss, R., Kaskel, F.J., Spitzer, A., and Hirschman, G.H. (2003). Effect of an oral Shiga toxin-binding agent on diarrhea-associated hemolytic uremic syndrome in children: a randomized controlled trial. JAMA 290, 1337-1344.

153

Trinchieri, G., and Sher, A. (2007). Cooperation of Toll-like receptor signals in innate immune defence. Nat Rev Immunol 7, 179-190.

Uetani, K., Hiroi, M., Meguro, T., Ogawa, H., Kamisako, T., Ohmori, Y., and Erzurum, S.C. (2008). Influenza A virus abrogates IFN-gamma response in respiratory epithelial cells by disruption of the Jak/Stat pathway. Eur J Immunol 38, 1559-1573.

Vallance, B.A., Deng, W., De Grado, M., Chan, C., Jacobson, K., and Finlay, B.B. (2002). Modulation of inducible nitric oxide synthase expression by the attaching and effacing bacterial pathogen citrobacter rodentium in infected mice. Infect Immun 70, 6424-6435.

Vingadassalom, D., Campellone, K.G., Brady, M.J., Skehan, B., Battle, S.E., Robbins, D., Kapoor, A., Hecht, G., Snapper, S.B., and Leong, J.M. (2010). Enterohemorrhagic E. coli requires N-WASP for efficient type III translocation but not for EspFU-mediated actin pedestal formation. PLoS Pathog 6, e1001056.

Vingadassalom, D., Kazlauskas, A., Skehan, B., Cheng, H.C., Magoun, L., Robbins, D., Rosen, M.K., Saksela, K., and Leong, J.M. (2009). Insulin receptor tyrosine kinase substrate links the E. coli O157:H7 actin assembly effectors Tir and EspF(U) during pedestal formation. Proc Natl Acad Sci U S A 106, 6754-6759.

Walterspiel, J.N., Ashkenazi, S., Morrow, A.L., and Cleary, T.G. (1992). Effect of subinhibitory concentrations of antibiotics on extracellular Shiga-like toxin I. Infection 20, 25-29.

Wan, F., Weaver, A., Gao, X., Bern, M., Hardwidge, P.R., and Lenardo, M.J. (2011). IKKbeta phosphorylation regulates RPS3 nuclear translocation and NF-kappaB function during infection with Escherichia coli strain O157:H7. Nat Immunol 12, 335-343.

Werber, D., Krause, G., Frank, C., Fruth, A., Flieger, A., Mielke, M., Schaade, L., and Stark, K. (2012). Outbreaks of virulent diarrheagenic Escherichia coli - are we in control? BMC Med 10, 11.

Wine, E., Gareau, M.G., Johnson-Henry, K., and Sherman, P.M. (2009). Strain-specific probiotic (Lactobacillus helveticus) inhibition of Campylobacter jejuni invasion of human intestinal epithelial cells. FEMS Microbiol Lett 300, 146-152.

Wong, A.R., Pearson, J.S., Bright, M.D., Munera, D., Robinson, K.S., Lee, S.F., Frankel, G., and Hartland, E.L. (2011). Enteropathogenic and enterohaemorrhagic Escherichia coli: even more subversive elements. Mol Microbiol 80, 1420-1438.

Wong, C.S., Jelacic, S., Habeeb, R.L., Watkins, S.L., and Tarr, P.I. (2000). The risk of the hemolytic-uremic syndrome after antibiotic treatment of Escherichia coli O157:H7 infections. N Engl J Med 342, 1930-1936.

Wu, B., Skarina, T., Yee, A., Jobin, M.C., Dileo, R., Semesi, A., Fares, C., Lemak, A., Coombes, B.K., Arrowsmith, C.H., et al. (2010). NleG Type 3 effectors from enterohaemorrhagic Escherichia coli are U-Box E3 ubiquitin ligases. PLoS Pathog 6, e1000960.

Zhang, S.Y., Boisson-Dupuis, S., Chapgier, A., Yang, K., Bustamante, J., Puel, A., Picard, C., Abel, L., Jouanguy, E., and Casanova, J.L. (2008). Inborn errors of interferon (IFN)-mediated

154

immunity in humans: insights into the respective roles of IFN-alpha/beta, IFN-gamma, and IFN-lambda in host defense. Immunol Rev 226, 29-40.

Ziebell, K., Steele, M., Zhang, Y., Benson, A., Taboada, E.N., Laing, C., McEwen, S., Ciebin, B., Johnson, R., and Gannon, V. (2008). Genotypic characterization and prevalence of virulence factors among Canadian Escherichia coli O157:H7 strains. Appl Environ Microbiol 74, 4314-4323.

Documents

Identifying Mechanisms by which Escherichia coli O157:H7 ......Identifying Mechanisms by which Escherichia coli O157:H7 ... host defense against microbial pathogens. The aim of this