GFP FOR EXPLORING
PROTEIN-PROTEIN-INTERACTIONS
By: Giovanny Rincon-Silva1
2
CONTENT
Introduction
Protein–Protein Interactions
Types of protein–protein interactions
Methods to investigate protein-protein interactions
Green fluorescent Protein as a signal for protein-protein
interactions.
Detecting Protein-Protein Interactions with a Green
Fluorescent Protein Fragment Reassembly Trap.
Introduction3
PPIs refer to intentional physical contacts established between two or
more proteins as a result of biochemical events and/or electrostatic forces.
In fact, proteins are vital macromolecules, at both cellular and systemic levels, but
they rarely act alone.
Aberrant PPIs are the basis of multiple diseases, such as Creutzfeld-
Jacob, Alzheimer's disease, and cancer.
4
Introduction
Casado-Vela J, Matthiesen R, Sellés S, Naranjo, JR Protein-Protein Interactions: Gene Acronym Redundancies and Current Limitations
Precluding Automated Data Integration Proteomes 2013, 1(1), 3-24.
PPIs have been studied from different perspectives:
Biochemistry
Quantum Chemistry
Molecular Dynamics
Signal Transduction
This information enables the creation of large protein interaction networks
similar to metabolic or genetic/epigenetic networks.
5
Protein–protein interactions
Casado-Vela J, Matthiesen R, Sellés S, Naranjo, JR Protein-Protein Interactions: Gene Acronym Redundancies and Current Limitations
Precluding Automated Data Integration Proteomes 2013, 1(1), 3-24.
6
Protein–protein interactions
Casado-Vela J, Matthiesen R, Sellés S, Naranjo, JR Protein-Protein Interactions: Gene Acronym Redundancies and Current Limitations
Precluding Automated Data Integration Proteomes 2013, 1(1), 3-24.
PPIs have been studied from different perspectives:
Biochemistry
Quantum Chemistry
Molecular Dynamics
Signal Transduction
This information enables the creation of large protein interaction networks
similar to metabolic or genetic/epigenetic networks.
77
Cell metabolism
In many biosynthetic
processes enzymes interact with each
other to produce small compounds or
other macromolecules.
Muscle contraction
Myosin filaments act as molecular
motors and by binding
to actin enables filament sliding.
Examples of protein–protein interactions
8 Casado-Vela J, Matthiesen R, Sellés S, Naranjo, JR Protein-Protein Interactions: Gene Acronym Redundancies and Current Limitations
Precluding Automated Data Integration Proteomes 2013, 1(1), 3-24.
Signal transduction
The activity of the cell is regulated by extracellular signals.
Transport across membranes
A protein may be carrying another protein.
TYPES OF PROTEIN–PROTEIN
INTERACTIONS
9
Bacillus amyloliquefaciens
proteins in a complex
Homo-oligomers are macromolecular complexes constituted by only one type of protein
subunit.
Disruption of homo-oligomers in order to return to the initial individual monomers often
requires denaturation of the complex.
homo-oligomers complex
Several enzymes, carrier proteins and transcriptional regulatory factors carry out their
functions as homo-oligomers.
Homo-oligomers vs. hetero-oligomers
10 Joel Edt, Shoshana Wodak..Protein Modules and Protein-Protein Interaction 2002..16, 232-245
Distinct protein subunits interact in hetero-oligomers, which are essential to
control several cellular functions.
Homo-oligomers vs. hetero-oligomers
11
Hemoglobin Hb or HgbEdit by: Giovanny Rincon
Joel Edt, Shoshana Wodak..Protein Modules and Protein-Protein Interaction 2002..16, 232-245
S.I: These are usually the case of homo-
oligomers (e.g. cytochrome c).
T.I.: A protein may interact briefly and in a
reversible manner with other proteins in only
certain cellular contexts – cell type, cell cycle
stage. (biochemical cascades)
Stable interactions vs. transient interactions
12
Example, some G protein-coupled
Activation cycle of a G-protein (purple) by a G-protein-
coupled receptor (light blue) receiving a ligand (red).
Joel Edt, Shoshana Wodak..Protein Modules and Protein-Protein Interaction 2002..16, 232-245
C: Are those with the strongest association and are formed by disulphide
bonds or electron sharing.
Although being rare, these interactions are determinant in some post
translational modifications, as ubiquitination and SUMOylation
(Small Ubiquitin-like Modifier (or SUMO)).
Non-covalent bonds are usually established during transient interactions by the
combination of weaker bonds:
Hydrogen bonds
Ionic interactions
Van der Waals forces
Hydrophobic bonds
Covalent vs. non-covalent
13 Joel Edt, Shoshana Wodak..Protein Modules and Protein-Protein Interaction 2002..16, 232-245
Protein concentration, which in turn are affected by expression levels and
degradation rates.
Protein affinity for proteins or other binding ligands.
Presence of other proteins, nucleic acids, and ions.
Ligands concentrations (substrates, ions, etc.).
Electric fields around proteins.
Factors that regulate protein–protein
interactions
14 Joel Edt, Shoshana Wodak..Protein Modules and Protein-Protein Interaction 2002..16, 232-245
The molecular structures of many protein complexes have been unlocked by the
technique of X-ray crystallography.
The first structure to be solved by this method by Sir John Cowdery Kendrew.
Techniques to study the molecular structure of
protein complexes
15
Crystal structure of modified Gramicidin S
horizontally determined by X-ray
crystallography
Stephen W Michnick. Exploring protein interactions by interaction-induced folding of proteins from complementary peptide fragments.
Prorein Science, Cambridge University Press. 2011, 8: 1256 -1265
NMR also started to be applied with the aim of unravelling the molecular
structure of protein complexes.
Techniques to study the molecular structure of
protein complexes
16
NMR structure of cytochrome C
illustrating its dynamics in solution
Stephen W Michnick. Exploring protein interactions by interaction-induced folding of proteins from complementary peptide fragments.
Prorein Science, Cambridge University Press. 2011, 8: 1256 -1265
Yeast two-hybrid screening
Investigating interactions of proteins within the yeast nucleus. (transfected with two
plasmids; Bait and Prey).
Tandem affinity purification (TAP):
Detects cell interactions in the real environment (eg in the cytosol of a mammalian cell).
Methods to investigate protein-protein
interactions
17 Stephen W Michnick. Exploring protein interactions by interaction-induced folding of proteins from complementary peptide fragments.
Prorein Science, Cambridge University Press. 2011, 8: 1256 -1265
Coimmunoprecipitation:
Is considered the best assay
for detecting PPIs.
Endogenous proteins
Edit: by Giovanny Rincon
Quantitative immunoprecipitation combined with knock-out:
(QUICK is based on the co-immunoprecipitation, quantitative mass
spectrometry (SILAC) and RNA interference (RNA interference - RNAi).
Dual Polarization Interferometry (DPI):
Provides measurements of molecular size, density and mass, in real time
and with high resolution.
Blue Native Polyacrylamide Gel Electrophoresis (BN-PAGE):
Based on the migration of the protein complexes in polyacrylamide gels
according to their molecular weight.
18 Stephen W Michnick. Exploring protein interactions by interaction-induced folding of proteins from complementary peptide fragments.
Prorein Science, Cambridge University Press. 2011, 8: 1256 -1265
Methods to investigate protein-protein
interactions
Green fluorescent Protein as a signal for
protein-protein interactions.
19
From the jelly fish Aequorea victoria has exceptional physical and
chemical properties:
Spontaneous fluorescence
High thermal stability
Resistance to detergents
Organic solvents and proteases
Methods to investigate protein-protein
interactions
20 Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science,
Cambridge University Press. 1997, 6: 2344 &2349.
Use of S65T GFP as the basis of two methods for exploring PPIs
21
1.) Fluorescence gel retardation assay: Based on
the electrophoretic mobility of a protein-DNA
complex being less than that of either molecule
alone.
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science,
Cambridge University Press. 1997, 6: 2344 &2349.
Methods to investigate protein-protein
interactions
2.) Fluorescence polarization assay. A complex between two molecules
rotates more slowly than do the free molecules.
22 Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science,
Cambridge University Press. 1997, 6: 2344 &2349.
Methods to investigate protein-protein
interactions
MATERIALS AND METHODS
23
Monitoring protein-protein interactions
24
System characterized interaction of the S-peptide and S-protein fragments
of bovine pancreatic ribonuclease (RNase) A
S-peptide (residues 1-20) and S-protein (residues 21-124)
Structure of RNase A
S15 was used in this study
Specifically, the generated fusion proteins in
which S15 is fused to the N or C terminus of
S65T GFP.
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science,
Cambridge University Press. 1997, 6: 2344 &2349.
25
The His6 tag and S65T mutation were introduced simultaneously into the cDNA
that codes for wild-type GFP by PCR mutagenesis using three primers:
P39
GGCATATGCACCACCACCACCACCACGGCGGTAGCAAAGGAGAAGAAC
for the His6 tag and an Nde I site
M5 CCATGGCCAACACTGGTCACCACTTTCACCTATGGTGTTCAATGCTT
for the S65T change
P36
GTGAATTCTTGTATAGTTCATCCATGCCA for an EcoRI site
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science,
Cambridge University Press. 1997, 6: 2344 &2349.
His6-GFP(S65T)-S15 construction
His6-GFP(S65T)-S15 construction
26
The resulting PCR fragment was digested with EcoR I and Nde I and inserted into an
EcoR I/Nde I site of PET-29 ª.
The crystallographic structure of restriction
Endonuclease EcoRI
The DNA fragment encoding SI5 was generated from PET-29a by PCR using P37:
GGAATTCCGGCGGCAAAGAAACCGCTGCTGCTAAA with an EcoR I site)
and P38 (TGGTCGACTTAGCTGTCCATGTGCTGG CGTTCGA with a Sal I site) and
inserted into EcoR I/Sal I site of the above plasmid to give pSH24.
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science,
Cambridge University Press. 1997, 6: 2344 &2349.
S15-GFP(S65T)-His6 Construction
27
The coding region of GFP(S65T) was amplified from pSH24:
P53 (TCAAGATCTTAGCAAAGGAGAAGAACTT with a Bgl I1 site)
P54 (GCCCTCGAGCTTGTATAGTTCATCCATGC with an Xho I site).
The PCR fragment was digested with Bgl I1 and Xho I and inserted into Bgl II/Xho I
site of PET-29 b to give pSH41.
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science,
Cambridge University Press. 1997, 6: 2344 &2349.
Gel Retardation Assay
28
Purified fusion proteins were quantified
Є= 39.2 mM-1 cm-1 at 490 nm of S65T GFPS-protein Є= 9.56 mM-1 cm-1 at 280 nm
S15-GFP(S65T)-His6 was incubated with varying
amounts of S-protein.
20´ the mixtures were loaded onto a native
polyacrylamide gel, and was subjected to
electrophoresis at 4 °C at 10 V/cm.
After the gel was scanned by a Fluorimager SI
System (490 nm for excitation and 2515 nm for
emission).
The fluorescence intensities of bound and free
S15- GFP(S65T)-His6 were quantified by using
the program Image QuaNT 4.1.
Values of R (= fluorescence intensity of bound S15-GFP(S65T)-His6/ total fluorescence
intensity) were determined from the fluorescence intensities and Kd was determined:
)6
)65(15(1
totalHisTSGFTSRtotalproteinS
RR
dK
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science, Cambridge University Press.
1997, 6: 2344 &2349.
Polarization Assay
29
Measured with a Beacon Fluorescence Polarization System
Purified S15-GFP(S65T)-His6 was incubated with various concentrations of S-protein
in Tris-HCI buffer, pH 7.5, 8.0, or 8.5, containing NaCl (0 or 0.10 M).
Polarization measurements were made at each
S-protein concentration.
Values of Kd were determined by using the
program DeltaGraph 4.0 to fit the data with:
In Eq. 2, P is the measured polarization:
(ΔP =Pmax- Pmin). F is the concentration of free
S-protein. The fraction of bound S-protein (ƒB)
was obtained from the eq: (3)
)2(min
PF
dK
PFP
)3(min
P
PP
Bf
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science, Cambridge University
Press. 1997, 6: 2344 &2349.
Results
30
Purification and detection of S65T GFP Fusion
Proteins
31
DNA encoding SI5 and six histidine residue (His6) was added to 5' and 3' ends
of the cDNA encoding S65T GFP.
The two resulting proteins, His6-GFP-(S65T)-S15 and SI5-GFP-(S65T)-His6,
were produced in Escherichia coli strain BL21(DE3)
Escherichia coli strain BL21(DE3)
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science, Cambridge University
Press. 1997, 6: 2344 &2349.
Purification and detection of S65T GFP fusion
proteins
32
Purified by affinity chromatography using a Ni2+ -NTA column:
SDS-PAGE analysis of purified GFP fusion proteins.
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science, Cambridge University
Press. 1997, 6: 2344 &2349.
Purification and detection of S65T GFP fusion
proteins
33
Zymogram electorphoresis analysis of purified GFP fusion proteins.
Lane 1. Sl5-GFP(S65T)-His6. Lane 2. His6-GFP(S65T)-S15.
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science, Cambridge University
Press. 1997, 6: 2344 &2349.
Fluorescence gel retardation assay
34
The slower migrating isoform of His6-GFP(S65T)-
S15 was shifted upon binding to S-protein during
native PAGE, indicating that only this species has
an accessible S15.
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science, Cambridge University
Press. 1997, 6: 2344 &2349.
Fluorescence gel retardation assay
35
Fluorescence intensities of bound and free S15-GFP (S65T)-His6 were
quantified.
From the relative fluorescence intensities of the bound and free
S15-GFP-(S65 T)-His6, the binding ratio, at each concentration was obtained:
The dissociation constant (Kd) is (6 ± 3) * 10-8 M. (Average)
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science, Cambridge University
Press. 1997, 6: 2344 &2349.
36
Effect of pH.
The Kd values obtained were
1.4* 10-8 M, 1.1*10-8 M and
1.0*10-8 M.
Polarization assay
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science, Cambridge University
Press. 1997, 6: 2344 &2349.
In this assay, the formation of a complex is deduced from an increase in
fluorescence polarization.
37
Effect of salt concentration on complex formation. The value of Kd increased by
3.8-fold when NaCl was added to a final concentration of 0.10 M.
Polarization assay
At pH 8.0. Values of Kd in the presence
of 0 and 0.10 M NaCl were 1.1*10-8 M
and 4.2 *10-8 M, respectively.
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science, Cambridge University Press. 1997, 6:
2344 &2349.
38
GENERAL IDEAS
In fluorescence gel retardation method the interaction between the two
proteins is evident by a decrease in the mobility of the fluorescent fusion
protein that results from complex formation.
The fluorescence polarization assay, provides a more accurate
assessment of the value of Kd.
Park, Sang-Hyun And Raines, Ronald T. Green fluorescent protein as a signal for protein-protein interactions. Prorein Science, Cambridge University Press. 1997, 6:
2344 &2349.
39
Detecting Protein-Protein Interactions with a Green
Fluorescent Protein Fragment Reassembly Trap
40
Fusing strongly interacting antiparallel
leucine zippers to the C- and N-termini of the
N-terminal and C-terminal fragments of GFP
Magliery, Thomas J. et al. Detecting Protein-Protein Interactions with a Green Fluorescent Protein Fragment Reassembly Trap: Scope and
Mechanism. CHEM. SOC. 2005, 127, 146-157
Leucine zippers
41
Compatible plasmids (e.g., pMRBAD-Z-CGFP and pET11a-Z-NGFP) were either
cotransformed or sequentially transformed into BL21(DE3) Escherichia coli by
electroporation.
Cells were screened on LB agar supplemented with anamycin, ampicillin and arabinose.
Cells were either grown for 3 days at room temperature 22 °C.
Fluorescence was observed under a hand-held long-wave UV lamp 365nm.
Screening
Magliery, Thomas J. et al. Detecting Protein-Protein Interactions with a Green Fluorescent Protein Fragment Reassembly Trap: Scope and
Mechanism. CHEM. SOC. 2005, 127, 146-157
42
To improve the utility of the GFP-based fragment complementation
Assay; two compatible vectors that can be comaintained in E. coli
Compatible Vectors for Comaintenance of
GFP Fusions.
Magliery, Thomas J. et al. Detecting Protein-Protein Interactions with a Green Fluorescent Protein Fragment Reassembly Trap: Scope and
Mechanism. CHEM. SOC. 2005, 127, 146-157
43
If the Z-NGFP or Z-CGFP plasmids are replaced with link-NGFP or link-CGFP
plasmids, respectively, then no cellular fluorescence is observed
Magliery, Thomas J. et al. Detecting Protein-Protein Interactions with a Green Fluorescent Protein Fragment Reassembly Trap: Scope and
Mechanism. CHEM. SOC. 2005, 127, 146-157
Compatible Vectors for Comaintenance of
GFP Fusions
(Middle row) GFP reassembly occurs when the
interacting peptides are fused to the GFP
fragments, with the original fusion architecture
To confirm the visual phenotypes, it also harvested cells
from the screening agar plates and examined the
fluorescence in cleared lysates for equal numbers of cells
44
Parallel and antiparallel coiled coils
associate by the interaction of
hydrophobic residues at the peptide-
peptide interface.
As well as charge-charge interactions
between “edge” positions.
Antiparallel Leucine Zipper Libraries for
Determining Interaction Requirements
Magliery, Thomas J. et al. Detecting Protein-Protein Interactions with a Green Fluorescent Protein Fragment Reassembly Trap: Scope
and Mechanism. CHEM. SOC. 2005, 127, 146-157
Helical wheel diagram
A portion of the antiparallel leucine zipper from
T. thermophilus SerRS
45
General Applicability of the Screen:
Protein-Peptide Interactions
Magliery, Thomas J. et al. Detecting Protein-Protein Interactions with a Green Fluorescent Protein Fragment Reassembly Trap: Scope and
Mechanism. CHEM. SOC. 2005, 127, 146-157
Quantified from lysates
Interaction of TPR1, TPR2A, and TPR2B on
NGFP with the Z peptide or C-terminal peptides
from Hsc70 or Hsp90 in CGFP
46
It have engineered a pair of compatible plasmids that greatly facilitate the use
of GFP fragment reassembly as a screen for protein-protein interactions in
bacteria.
The vectors allow facile subcloning of the genes of interest as fusions to the
GFP fragments, and their compatibility and independent transcriptional control
afford faithful reporting of interactions.
The screen can detect weak (KD = 1 mM) and probably transient interactions
due to irreversibility of the reassembly reaction,
Magliery, Thomas J. et al. Detecting Protein-Protein Interactions with a Green Fluorescent Protein Fragment Reassembly Trap: Scope and
Mechanism. CHEM. SOC. 2005, 127, 146-157
GENERAL IDEAS
GFP FOR EXPLORING
PROTEIN-PROTEIN-INTERACTIONS
By: Giovanny Rincon-Silva48