Download ppt - Genetics …in the news

Transcript

Genetics…in the news.

Mutations

…are heritable changes in base sequences that modify the information

content of DNA.

Wild-type Allelestwo definitions

• General: any allele existing at a frequency greater than 1% in a natural population,

• Experimental Geneticist: the one allele that dictates the most commonly found phenotype in a population.

• Forward mutation: any change that changes a wild-type allele to a

different allele…

A+ --> arecessive mutation

b+ --> Bdominant mutation

a --> A+ , B --> b+ reversions

• Reverse mutations: novel mutant alleles can revert back to wild-type…

Mutant Classifications…by their effect on DNA

Substitutions

Mutagenic Agents

Base Analogs

Alkylating AgentsIntercalating Agents

Deaminating Agents

To Know

Mutant Classifications…by their effect on DNA

deletions and insertions

i d1 base?2 base?3 base?etc.

Frameshifts

Mutant Classifications…by their effect on DNA

inversions translocations

Trinucleotide Repeat Expansions

FMR1

Fragile X Mental Retardation 1

cgg cgg cgg cgg cgg cgg cgg cgg

cgg

...GCGCGGCGGTGACGGAGGCGCCGCTGCCAGGGGGCGTGCGGCAGCG...

…CTGGGCCTCGAAGCGCCCGCAGCCA

cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cggcgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg

cgg cgg cgg cgg cgg cgg cgg cgg cggcgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cggcgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg ... > 230

Ames Testtesting for mutagenicity

More mutagenic?

Barbecue beefIceberg LettuceCold Beer

5’ 3’

3’ 5’

5’

5’

3’5’

N- -C

enhancer, silencer, core promoter?

? ? ? ??

AAUAAA

Transposable Elements

…a segment of DNA that can move to, or move a copy of itself to another locus on the same or a different chromosome (hopping DNA),

…may be a single insertion sequence, or a more complex structure (transposon) consisting of two insertion sequences and one or more intervening genes.

Inverted repeats.

Transcribed genes.

Transposable Elements

Transpositionnormal gene, normal RNA, normal protein,

transposon inserted in gene, abnormal RNA, abnormal protein, loss of function.

Transposons

Two transposable elements flanking other DNA, the whole complex ‘hops’.

Other genes.

5’ 3’

3’ 5’

5’

5’

3’5’

N- -C

?? ? ? ?

?AAUAAA

Assignments

• Chapter 7: Problems 7.1 - 7.12,

• Monday: Prokaryotic Genetics, 8.1 - 8.3s


Recommended