Upload
lars-barton
View
23
Download
1
Tags:
Embed Size (px)
DESCRIPTION
Genetics …in the news. Mutations. …are heritable changes in base sequences that modify the information content of DNA. Reverse mutations: novel mutant alleles can revert back to wild-type…. a --> A + , B --> b + reversions. Wild-type Alleles two definitions. - PowerPoint PPT Presentation
Citation preview
Wild-type Allelestwo definitions
• General: any allele existing at a frequency greater than 1% in a natural population,
• Experimental Geneticist: the one allele that dictates the most commonly found phenotype in a population.
• Forward mutation: any change that changes a wild-type allele to a
different allele…
A+ --> arecessive mutation
b+ --> Bdominant mutation
a --> A+ , B --> b+ reversions
• Reverse mutations: novel mutant alleles can revert back to wild-type…
Trinucleotide Repeat Expansions
FMR1
Fragile X Mental Retardation 1
cgg cgg cgg cgg cgg cgg cgg cgg
cgg
...GCGCGGCGGTGACGGAGGCGCCGCTGCCAGGGGGCGTGCGGCAGCG...
…CTGGGCCTCGAAGCGCCCGCAGCCA
cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cggcgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg
cgg cgg cgg cgg cgg cgg cgg cgg cggcgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cggcgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg ... > 230
Transposable Elements
…a segment of DNA that can move to, or move a copy of itself to another locus on the same or a different chromosome (hopping DNA),
…may be a single insertion sequence, or a more complex structure (transposon) consisting of two insertion sequences and one or more intervening genes.
Transpositionnormal gene, normal RNA, normal protein,
transposon inserted in gene, abnormal RNA, abnormal protein, loss of function.