ORIGINAL ARTICLE
Genetic analysis of SNCA coding mutation in Chinese Hanpatients with Parkinson disease
Sheng Deng • Xiong Deng • Lamei Yuan •
Zhi Song • Zhijian Yang • Wei Xiong •
Hao Deng
Received: 18 May 2014 / Accepted: 22 July 2014
� Belgian Neurological Society 2014
Abstract Parkinson disease (PD) is the second most
common progressive neurodegenerative disorder. It is
characterized by selective loss of dopamine-producing
neurons and aggregation of alpha-synuclein (SNCA) in
neurons of particular brain regions. At least 20 loci and 15
disease-causing genes have been identified. Rare missense
or multiplication mutations in the SNCA gene have been
reported to be involved in some familial and sporadic cases
of PD. More recently, two novel pathogenic missense
mutations (p.H50Q and p.G51D) were identified in the
SNCA gene. To evaluate whether mutation(s) in the coding
region of SNCA gene is related to PD in Chinese popula-
tion, we investigated the SNCA gene in 502 PD patients of
Chinese Han ethnicity from Mainland China. No patho-
genic mutation was identified in the coding region of the
gene. A known G to A transition (c.306 ? 66G[A,
rs10005233) in the intron 4, which does not potentially
change splicing, was identified. Our data indicate that
mutations in the coding region of the SNCA gene are not
likely to be a common cause of PD in Chinese population.
Keywords Parkinson disease � The SNCA gene � Coding
region � Mutation
Introduction
Parkinson disease (PD; MIM 168600) is the second most
common progressive neurodegenerative disorder after
Alzheimer disease. PD affects approximately 1 % of peo-
ple over 65 years of age [1]. It is characterized by selective
loss of dopamine-producing neurons, aggregation of alpha-
synuclein (SNCA) in neurons of particular brain regions,
including the brainstem and cortical regions, and culmi-
nation of troublesome symptoms, including rest tremor,
bradykinesia, rigidity, postural instability, and a variety of
non-motor features [1, 2]. Research in PD genetics has
been prolific over the past one and a half decades. At least
20 loci and 15 disease-causing genes have been described
to be involved in familial or sporadic parkinsonism [1, 3].
Monogenic forms of PD account for a minority of PD
cases, but they have provided crucial insights into patho-
genesis of PD. SNCA plays a central role with rare mis-
sense or multiplication mutations reported to date [4–6].
Recently, two novel missense mutations, p.H50Q and
p.G51D, in the SNCA gene, were reported in sporadic and
familial PD patients [5–7]. To determine whether muta-
tion(s) in the coding region of SNCA gene is associated
with PD in Chinese population, we conducted genetic
analysis in 502 Chinese Han patients with PD from
Mainland China.
S. Deng
Department of Pharmacy, Xiangya Hospital, Central South
University, Changsha, Hunan, People’s Republic of China
S. Deng � X. Deng � L. Yuan � Z. Yang � H. Deng (&)
Center for Experimental Medicine, The Third Xiangya Hospital,
Central South University, 138 Tongzipo Road, Changsha,
Hunan 410013, People’s Republic of China
e-mail: [email protected]
Z. Song � H. Deng
Department of Neurology, The Third Xiangya Hospital, Central
South University, Changsha, Hunan, People’s Republic of China
W. Xiong
Hunan Key Laboratory of Nonresolving Inflammation and
Cancer, The Third Xiangya Hospital, Central South University,
Changsha, Hunan, People’s Republic of China
123
Acta Neurol Belg
DOI 10.1007/s13760-014-0347-2
Methods
Five hundred and two unrelated Chinese Han patients with
PD (age: 65.9 ± 10.2 years; age at onset: 62.5 ± 7.9
years; male/female: 310/192) were recruited from Main-
land China. The diagnosis of PD was made based on
common diagnostic criteria [8]. The protocol of this study
was approved by the Ethics Committee of the Third
Xiangya Hospital, Central South University, and written
informed consents were obtained from all participating
individuals. Among the 502 PD patients, 119 (23.7 %)
patients had first- or second-degree relatives affected with
PD (familial PD; male/female: 72/47), 383 patients
(76.3 %) had no family history of PD (sporadic PD; male/
female: 238/145). Mutations in some other PD-related
genes have been excluded in some of these patients.
40.2 % (202/502) of the patients were screened and were
negative for any mutation in the vacuolar protein sorting 35
gene (VPS35) [9]. 67.5 % (339/502) had no evidence of
mutation in the F-box only protein 48 gene (FBXO48) [10].
All were excluded for any mutation in the S100 calcium-
binding beta gene (S100B) [11]. 80.3 % (403/502) were
negative for either p.A502V or p.R1205H point mutations
in the eukaryotic translation initiation factor 4-gamma 1
gene (EIF4G1) [2].
Genomic DNA was extracted from peripheral blood
using a standard phenol–chloroform extraction method.
Genetic analysis of the SNCA gene was performed in 502
PD patients with the method described previously [10]. The
primers used for PCR amplification, covering the coding
region and intron/exon boundaries of the SNCA gene, were
designed using primer design program Primer3 (http://
primer3.ut.ee/) based on the genomic DNA sequences,
and checked for specificity using Primer-BLAST (http://
www.ncbi.nlm.nih.gov/tools/primer-blast/) (Table 1). PCR
amplification for the coding region of the SNCA gene was
performed using a 9700 Thermal cycler System (Applied
Biosystems Inc.) for 35 cycles at 95 �C for 35 s, 57 �C for
30 s, 72 �C for 35 s, and a final elongation step at 72 �C
for 5 min. 100 ng of gDNA and 10 pmol primers were
used in a 25-ll reaction volume. 8.5 ll PCR products were
digested by 0.8 U shrimp alkaline phosphatase (SAP) and
8 U exonuclease I (Thermo Scientific) in a 10-ll reaction
volume for purification. Then, the products were sequenced
directionally by an 8-capillary 3500 genetic analyzer
(Applied Biosystems Inc.) using standard methods [11].
Results
We did not detect any mutation in the coding region of the
SNCA gene among the 502 PD patients, consistent with the
low variant frequency in SNCA coding region in Asian
population (http://www.ncbi.nlm.nih.gov/snp/). We identi-
fied only a G[A variant in the intron 4 (rs10005233,
NM_001146055.1:c.306?66G[A), which does not poten-
tially change splicing (predicted by http://www.fruitfly.org/
seq_tools/splice.html), indicating that it is not a pathogenic
mutation.
Discussion
The SNCA gene, mapped to chromosome 4q22.1, contains
six exons spanning about 114 kb. SNCA contains seven
imperfect repeats of an 11-amino acid sequence, which
may mediate multimerization [12]. In an in vitro study,
wild-type and mutant SNCA form insoluble fibrillar
aggregates with antiparallel beta-sheet structure [13].
Recently, a p.H50Q mutation in the SNCA gene was
observed in a Caucasian English female PD patient with an
age of onset at 71 years [5], and a p.G51D mutation was
found in a French family with a parkinsonian-pyramidal
syndrome [6]. To date, five point mutations, duplications
and triplications have been identified in at least 57 SNCA-
related pedigrees with parkinsonism [14]. Point mutations
and multiplications of the SNCA gene cause cognitive or
psychiatric symptoms, parkinsonism, dysautonomia and
myoclonus with widespread SNCA pathology in the central
and peripheral nervous system in these families [15].
Snca-/- mice were fertile, and displayed a reduction in
striatal dopamine and an attenuation of dopamine-depen-
dent locomotor response to amphetamine [16]. Transgenic
mice expressing human wild-type SNCA showed progres-
sive accumulation of SNCA- and ubiquitin-immunoreac-
tive inclusions in neurons of the neocortex, hippocampus,
and substantia nigra [17]. SNCA p.A30P or p.A53T mutant
mice exhibited abnormalities in enteric nervous system
Table 1 Primers for the SNCA
gene
SNCA alpha-synuclein
Exon Forward primer (50 ? 30) Reverse primer (50 ? 30) Product size (bp)
2 TCCCCGAAAGTTCTCATTCAA TCACTCATGAACAAGCACCA 232
3 TTGAGACTTATGTCTTGAATTTG TCTTGAATACTGGGCCACAC 148
4 CCACCCTTTAATCTGTTGTTGC TAGCCGTTCCCCACAGTAAG 289
5 CCGTGGCCAACATCCCTATA AGAGAAATGTGACAATGACAGGT 262
6 TCCTATCTCATTGGCTGTCAGT CTGGGCACATTGGAACTGAG 200
Acta Neurol Belg
123
(ENS) function and synuclein-immunoreactive aggregates
in ENS ganglia. SNCA p.A53T mutant mice also had
abnormal motor behavior [18].
Although of great interest, in our well-characterized
cohort of 502 subjects with PD, none were found to carry
any mutation(s) in the SNCA coding region except that a
known non-coding variant rs10005233 was identified. In
spite of a study showing the absence of specific mutations
in the SNCA gene for PD in a Chinese population [19], to
our knowledge, this is the first study to analyze the entire
coding region of the SNCA gene in a large cohort of Chi-
nese Han patients with PD. Point mutations in the coding
region of the SNCA gene are rare in general population
with a predicted frequency of less than 0.8 % (30/4238)
(Table 2). Of note, negative studies of small sample sizes,
specific exons or point mutations, are not included when
calculating the point mutation frequency. Therefore, the
actual frequency of point mutations in the coding region of
the SNCA gene may be even lower. SNCA point mutations
are likely to account for only a small number of PD
patients, originating from some focal localities. Further
studies focusing on early-onset autosomal dominant PD
pedigrees that have moderate response to levodopa might
help to identify new SNCA mutations and explore its role in
the pathogenesis of PD. Furthermore, utilization of massive
parallel sequencing may provide a more detailed view of
the known PD genes and other genes associated with
SNCA pathway.
Acknowledgments We thank all the individuals who participated in
this study. This study was supported by National Natural Science
Foundation of China (81101339, 81271921, 81001476), Research
Foundation for the Doctoral Program of Higher Education of China
(20110162110026), Natural Science Foundation of Hunan Province,
China (10JJ5029), Sheng Hua Scholars Program of Central South
Table 2 Point mutations detected in the SNCA coding region in PD patients
Study Case Geographic distribution/ethnic background Mutation detected Frequency
Kruger et al. [20] 192 SPD, 8 FPD German p.A30P 2/200
Farrer et al. [21] 35 ADPD Puerto Rican, Russian, Irish, African-American,
Dutch and English, Scottish-Irish and German
No 0/35
Chan et al. [22] 24 PD (3 FPD) America No 0/24
Vaughan et al. [23] 30 ADPD European and American Caucasian No 0/30
Parsian et al. [24] 20 FPD White of non-Hispanic origin No 0/20
Papadimitriou et al. [25] 6 ADPD Greek p.A53T 2/6
Markopoulou et al. [26] 8 ADPD Greek-American p.A53T 8/8
Scott et al. [27] 356 PD American and Greek p.A53T 5/356
Illarioshkin et al. [28] 9 ADPD Russia No 0/9
Pastor et al. [29] 50 FPD Spain No 0/50
Autere et al. [30] 22 FPD Finland No 0/22
Zarranz et al. [31] 5 ADPD Spanish p.E46 K 5/5
Hope et al. [32] 50 ADPD European Caucasian, Asian, African No 0/50
Michell et al. [33] 3 SPD Polish p.A53T 1/3
Hofer et al. [34] 103 EOPD European No 0/103
Berg et al. [35] 1921 PD (237 FPD) Caucasian, Asian, African p.A53T 1/1921
Xiromerisiou et al. [36] 55 ADPD Greek No 0/55
Ki et al. [37] 1 FPD Korea p.A53T 1/1
Bras et al. [38] 66 PD (39 FPD) Portugal No 0/66
Mellick et al. [39] 74 EOPD (30 FPD) Australia No 0/74
Camargos et al. [40] 8 FPD Brazilian No 0/8
Nuytemans et al. [41] 310 PD Belgian No 0/310
Yonova-Doing et al. [42] 39 PD Zambian No 0/39
Lesage et al. [6] 203 ADPD French p.G51D 3/203
Appel-Cresswell et al. [7] 110 PD (66 FPD) Canada, Norway p.H50Q 1/110
Proukakis et al. [43] 28 PD United Kingdom p.H50Q 1/28
Our study 119 FPD, 383 SPD Chinese Han No 0/502
Combined 4238 PD – – 30/4238
SNCA alpha-synuclein, PD Parkinson disease, SPD sporadic PD, FPD familial PD, ADPD autosomal dominant PD, EOPD early-onset PD
Acta Neurol Belg
123
University, China (H.D.), Construction Foundation for Key Subjects
of the Third Xiangya Hospital, Central South University, China
(H.D.), Hunan Provincial Innovation Foundation For Postgraduate,
China (7138000008), Students Innovative Pilot Scheme of Central
South University, China (YC12417), and the Fundamental Research
Funds for the Central Universities of Central South University, China
(2013zzts101).
Conflict of interest The authors declare that they have no conflict
of interest.
References
1. Deng H, Liang H, Jankovic J (2013) The F-box only protein
seven gene in parkinsonian-pyramidal disease. JAMA Neurol
70:20–24
2. Yuan L, Song Z, Xu H, Gu S, Zhu A, Gong L, Zhao Y, Deng H
(2013) EIF4G1 Ala502Val and Arg1205His variants in Chinese
patients with Parkinson disease. Neurosci Lett 543:69–71
3. Quadri M, Fang M, Picillo M, Olgiati S, Breedveld GJ, Graafland
J, Wu B, Xu F, Erro R, Amboni M, Pappata S, Quarantelli M,
Annesi G, Quattrone A, Chien HF, Barbosa ER, International
Parkinsonism Genetics Network, Oostra BA, Barone P, Wang J,
Bonifati V (2013) Mutation in the SYNJ1 gene associated with
autosomal recessive, early-onset Parkinsonism. Hum Mutat
34:1208–1215
4. Polymeropoulos MH, Lavedan C, Leroy E, Ide SE, Dehejia A,
Dutra A, Pike B, Root H, Rubenstein J, Boyer R, Stenroos ES,
Chandrasekharappa S, Athanassiadou A, Papapetropoulos T,
Johnson WG, Lazzarini AM, Duvoisin RC, Di Iorio G, Golbe LI,
Nussbaum RL (1997) Mutation in the alpha-synuclein gene
identified in families with Parkinson’s disease. Science
276:2045–2047
5. Proukakis C, Dudzik CG, Brier T, MacKay DS, Cooper JM,
Millhauser GL, Houlden H, Schapira AH (2013) A novel a-
synuclein missense mutation in Parkinson disease. Neurology
80:1062–1064
6. Lesage S, Anheim M, Letournel F, Bousset L, Honore A, Rozas
N, Pieri L, Madiona K, Durr A, Melki R, Verny C, Brice A,
French Parkinson’s Disease Genetics Study Group (2013) G51D
a-synuclein mutation causes a novel parkinsonian-pyramidal
syndrome. Ann Neurol 73:459–471
7. Appel-Cresswell S, Vilarino-Guell C, Encarnacion M, Sherman
H, Yu I, Shah B, Weir D, Thompson C, Szu-Tu C, Trinh J, Aasly
JO, Rajput A, Rajput AH, Jon Stoessl A, Farrer MJ (2013) Alpha-
synuclein p.H50Q, a novel pathogenic mutation for Parkinson’s
disease. Mov Disord 28:811–813
8. Jankovic J (2008) Parkinson’s disease: clinical features and
diagnosis. J Neurol Neurosurg Psychiatry 79:368–376
9. Deng H, Xu H, Deng X, Song Z, Zheng W, Gao K, Fan X, Tang J
(2012) VPS35 mutation in Chinese Han patients with late-onset
Parkinson’s disease. Eur J Neurol 19:e96–e97
10. Xiu X, Song Z, Gao K, Deng X, Qi Y, Zhu A, Gong L, Deng H
(2013) Genetic analysis of the FBXO48 gene in Chinese Han
patients with Parkinson disease. Neurosci Lett 541:224–226
11. Guo Y, Yang H, Deng X, Song Z, Yang Z, Xiong W, Yuan L, Xu
H, Deng S, Deng H (2013) Genetic analysis of the S100B gene
in Chinese patients with Parkinson disease. Neurosci Lett
555:134–136
12. Goedert M (1997) Familial Parkinson’s disease. The awakening
of alpha-synuclein. Nature 388:232–233
13. Narhi L, Wood SJ, Steavenson S, Jiang Y, Wu GM, Anafi D,
Kaufman SA, Martin F, Sitney K, Denis P, Louis JC, Wypych J,
Biere AL, Citron M (1999) Both familial Parkinson’s disease
mutations accelerate alpha-synuclein aggregation. J Biol Chem
274:9843–9846. Erratum in: J Biol Chem 274:13728
14. Deng H, Yuan L (2014) Genetic variants and animal models in
SNCA and Parkinson disease. Ageing Res Rev 15C:161–176
15. Puschmann A (2013) Monogenic Parkinson’s disease and par-
kinsonism: Clinical phenotypes and frequencies of known
mutations. Parkinsonism Relat Disord 19:407–415
16. Abeliovich A, Schmitz Y, Farinas I, Choi-Lundberg D, Ho WH,
Castillo PE, Shinsky N, Verdugo JM, Armanini M, Ryan A,
Hynes M, Phillips H, Sulzer D, Rosenthal A (2000) Mice lacking
alpha-synuclein display functional deficits in the nigrostriatal
dopamine system. Neuron 25:239–252
17. Masliah E, Rockenstein E, Veinbergs I, Mallory M, Hashimoto M,
Takeda A, Sagara Y, Sisk A, Mucke L (2000) Dopaminergic loss
and inclusion body formation in alpha-synuclein mice: implications
for neurodegenerative disorders. Science 287:1265–1269
18. Kuo YM, Li Z, Jiao Y, Gaborit N, Pani AK, Orrison BM,
Bruneau BG, Giasson BI, Smeyne RJ, Gershon MD, Nuss-
baum RL (2010) Extensive enteric nervous system abnormal-
ities in mice transgenic for artificial chromosomes containing
Parkinson disease-associated alpha-synuclein gene mutations
precede central nervous system changes. Hum Mol Genet
19:1633–1650
19. Lin JJ, Yueh KC, Chang DC, Lin SZ (1999) Absence of G209A
and G88C mutations in the alpha-synuclein gene of Parkinson’s
disease in a Chinese population. Eur Neurol 42:217–220
20. Kruger R, Kuhn W, Muller T, Woitalla D, Graeber M, Kosel S,
Przuntek H, Epplen JT, Schols L, Riess O (1998) Ala30Pro
mutation in the gene encoding alpha-synuclein in Parkinson’s
disease. Nat Genet 18:106–108
21. Farrer M, Wavrant-De Vrieze F, Crook R, Boles L, Perez-Tur J,
Hardy J, Johnson WG, Steele J, Maraganore D, Gwinn K, Lynch
T (1998) Low frequency of alpha-synuclein mutations in familial
Parkinson’s disease. Ann Neurol 43:394–397
22. Chan P, Jiang X, Forno LS, Di Monte DA, Tanner CM, Langston
JW (1998) Absence of mutations in the coding region of the
alpha-synuclein gene in pathologically proven Parkinson’s dis-
ease. Neurology 50:1136–1137
23. Vaughan JR, Farrer MJ, Wszolek ZK, Gasser T, Durr A, Agid Y,
Bonifati V, DeMichele G, Volpe G, Lincoln S, Breteler M, Meco
G, Brice A, Marsden CD, Hardy J, Wood NW (1998) Sequencing
of the alpha-synuclein gene in a large series of cases of familial
Parkinson’s disease fails to reveal any further mutations. Hum
Mol Genet 7:751–753
24. Parsian A, Racette B, Zhang ZH, Chakraverty S, Rundle M,
Goate A, Perlmutter JS (1998) Mutation, sequence analysis, and
association studies of alpha-synuclein in Parkinson’s disease.
Neurology 51:1757–1759
25. Papadimitriou A, Veletza V, Hadjigeorgiou GM, Patrikiou A,
Hirano M, Anastasopoulos I (1999) Mutated alpha-synuclein
gene in two Greek kindreds with familial PD: incomplete pene-
trance? Neurology 52:651–654
26. Markopoulou K, Wszolek ZK, Pfeiffer RF, Chase BA (1999)
Reduced expression of the G209A alpha-synuclein allele in
familial Parkinsonism. Ann Neurol 46:374–381
27. Scott WK, Yamaoka LH, Stajich JM, Scott BL, Vance JM, Roses
AD, Pericak-Vance MA, Watts RL, Nance M, Hubble J, Koller
W, Stern MB, Colcher A, Allen FH Jr, Hiner BC, Jankovic J,
Ondo W, Laing NG, Mastaglia F, Goetz C, Pappert E, Small GW,
Masterman D, Haines JL, Davies TL (1999) The alpha-synuclein
gene is not a major risk factor in familial Parkinson disease.
Neurogenetics 2:191–192
28. Illarioshkin SN, Ivanova-Smolenskaya IA, Markova ED, Zago-
rovskaya TB, Brice A (2000) Lack of alpha-synuclein gene
mutations in families with autosomal dominant Parkinson’s dis-
ease in Russia. J Neurol 247:968–969
Acta Neurol Belg
123
29. Pastor P, Munoz E, Ezquerra M, Obach V, Martı MJ, Vallde-
oriola F, Tolosa E, Oliva R (2001) Analysis of the coding and the
5’ flanking regions of the alpha-synuclein gene in patients with
Parkinson’s disease. Mov Disord 16:1115–1119
30. Autere JM, Hiltunen MJ, Mannermaa AJ, Jakala PA, Hartikainen
PH, Majamaa K, Alafuzoff I, Soininen HS (2002) Molecular
genetic analysis of the alpha-synuclein and the parkin gene in
Parkinson’s disease in Finland. Eur J Neurol 9:479–483
31. Zarranz JJ, Alegre J, Gomez-Esteban JC, Lezcano E, Ros R,
Ampuero I, Vidal L, Hoenicka J, Rodriguez O, Atares B, Llorens
V, Gomez Tortosa E, del Ser T, Munoz DG, de Yebenes JG
(2004) The new mutation, E46K, of alpha-synuclein causes
Parkinson and Lewy body dementia. Ann Neurol 55:164–173
32. Hope AD, Myhre R, Kachergus J, Lincoln S, Bisceglio G,
Hulihan M, Farrer MJ (2004) Alpha-synuclein missense and
multiplication mutations in autosomal dominant Parkinson’s
disease. Neurosci Lett 367:97–100
33. Michell AW, Barker RA, Raha SK, Raha-Chowdhury R (2005) A
case of late onset sporadic Parkinson’s disease with an A53T
mutation in alpha-synuclein. J Neurol Neurosurg Psychiatry
76:596–597
34. Hofer A, Berg D, Asmus F, Niwar M, Ransmayr G, Rie-
menschneider M, Bonelli SB, Steffelbauer M, Ceballos-Baumann
A, Haussermann P, Behnke S, Kruger R, Prestel J, Sharma M,
Zimprich A, Riess O, Gasser T (2005) The role of alpha-synuc-
lein gene multiplications in early-onset Parkinson’s disease and
dementia with Lewy bodies. J Neural Transm 112:1249–1254
35. Berg D, Niwar M, Maass S, Zimprich A, Moller JC, Wuellner U,
Schmitz-Hubsch T, Klein C, Tan EK, Schols L, Marsh L, Dawson
TM, Janetzky B, Muller T, Woitalla D, Kostic V, Pramstaller PP,
Oertel WH, Bauer P, Krueger R, Gasser T, Riess O (2005) Alpha-
synuclein and Parkinson’s disease: implications from the
screening of more than 1,900 patients. Mov Disord 20:1191–1194
36. Xiromerisiou G, Hadjigeorgiou GM, Gourbali V, Johnson J,
Papakonstantinou I, Papadimitriou A, Singleton AB (2007)
Screening for SNCA and LRRK2 mutations in Greek sporadic
and autosomal dominant Parkinson’s disease: identification of
two novel LRRK2 variants. Eur J Neurol 14:7–11
37. Ki CS, Stavrou EF, Davanos N, Lee WY, Chung EJ, Kim JY,
Athanassiadou A (2007) The Ala53Thr mutation in the alpha-
synuclein gene in a Korean family with Parkinson disease. Clin
Genet 71:471–473
38. Bras J, Guerreiro R, Ribeiro M, Morgadinho A, Januario C, Dias
M, Calado A, Semedo C, Oliveira C, Hardy J, Singleton A (2008)
Analysis of Parkinson disease patients from Portugal for muta-
tions in SNCA, PRKN, PINK1 and LRRK2. BMC Neurol 8:1
39. Mellick GD, Siebert GA, Funayama M, Buchanan DD, Li Y,
Imamichi Y, Yoshino H, Silburn PA, Hattori N (2009) Screening
PARK genes for mutations in early-onset Parkinson’s disease
patients from Queensland, Australia. Parkinsonism Relat Disord
15:105–109
40. Camargos ST, Dornas LO, Momeni P, Lees A, Hardy J, Singleton
A, Cardoso F (2009) Familial Parkinsonism and early onset
Parkinson’s disease in a Brazilian movement disorders clinic:
phenotypic characterization and frequency of SNCA, PRKN,
PINK1, and LRRK2 mutations. Mov Disord 24:662–666
41. Nuytemans K, Meeus B, Crosiers D, Brouwers N, Goossens D,
Engelborghs S, Pals P, Pickut B, Van den Broeck M, Corsmit E,
Cras P, De Deyn PP, Del-Favero J, Van Broeckhoven C, Theuns J
(2009) Relative contribution of simple mutations vs. copy num-
ber variations in five Parkinson disease genes in the Belgian
population. Hum Mutat 30:1054–1061
42. Yonova-Doing E, Atadzhanov M, Quadri M, Kelly P, Shawa N,
Musonda ST, Simons EJ, Breedveld GJ, Oostra BA, Bonifati V
(2012) Analysis of LRRK2, SNCA, Parkin, PINK1, and DJ-1 in
Zambian patients with Parkinson’s disease. Parkinsonism Relat
Disord 18:567–571
43. Proukakis C, Houlden H, Schapira AH (2013) Somatic alpha-
synuclein mutations in Parkinson’s disease: hypothesis and pre-
liminary data. Mov Disord 28:705–712
Acta Neurol Belg
123