ORIGINAL ARTICLE

Genetic analysis of SNCA coding mutation in Chinese Hanpatients with Parkinson disease

Sheng Deng • Xiong Deng • Lamei Yuan •

Zhi Song • Zhijian Yang • Wei Xiong •

Hao Deng

Received: 18 May 2014 / Accepted: 22 July 2014

� Belgian Neurological Society 2014

Abstract Parkinson disease (PD) is the second most

common progressive neurodegenerative disorder. It is

characterized by selective loss of dopamine-producing

neurons and aggregation of alpha-synuclein (SNCA) in

neurons of particular brain regions. At least 20 loci and 15

disease-causing genes have been identified. Rare missense

or multiplication mutations in the SNCA gene have been

reported to be involved in some familial and sporadic cases

of PD. More recently, two novel pathogenic missense

mutations (p.H50Q and p.G51D) were identified in the

SNCA gene. To evaluate whether mutation(s) in the coding

region of SNCA gene is related to PD in Chinese popula-

tion, we investigated the SNCA gene in 502 PD patients of

Chinese Han ethnicity from Mainland China. No patho-

genic mutation was identified in the coding region of the

gene. A known G to A transition (c.306 ? 66G[A,

rs10005233) in the intron 4, which does not potentially

change splicing, was identified. Our data indicate that

mutations in the coding region of the SNCA gene are not

likely to be a common cause of PD in Chinese population.

Keywords Parkinson disease � The SNCA gene � Coding

region � Mutation

Introduction

Parkinson disease (PD; MIM 168600) is the second most

common progressive neurodegenerative disorder after

Alzheimer disease. PD affects approximately 1 % of peo-

ple over 65 years of age [1]. It is characterized by selective

loss of dopamine-producing neurons, aggregation of alpha-

synuclein (SNCA) in neurons of particular brain regions,

including the brainstem and cortical regions, and culmi-

nation of troublesome symptoms, including rest tremor,

bradykinesia, rigidity, postural instability, and a variety of

non-motor features [1, 2]. Research in PD genetics has

been prolific over the past one and a half decades. At least

20 loci and 15 disease-causing genes have been described

to be involved in familial or sporadic parkinsonism [1, 3].

Monogenic forms of PD account for a minority of PD

cases, but they have provided crucial insights into patho-

genesis of PD. SNCA plays a central role with rare mis-

sense or multiplication mutations reported to date [4–6].

Recently, two novel missense mutations, p.H50Q and

p.G51D, in the SNCA gene, were reported in sporadic and

familial PD patients [5–7]. To determine whether muta-

tion(s) in the coding region of SNCA gene is associated

with PD in Chinese population, we conducted genetic

analysis in 502 Chinese Han patients with PD from

Mainland China.

S. Deng

Department of Pharmacy, Xiangya Hospital, Central South

University, Changsha, Hunan, People’s Republic of China

S. Deng � X. Deng � L. Yuan � Z. Yang � H. Deng (&)

Center for Experimental Medicine, The Third Xiangya Hospital,

Central South University, 138 Tongzipo Road, Changsha,

Hunan 410013, People’s Republic of China

e-mail: hdeng008@yahoo.com

Z. Song � H. Deng

Department of Neurology, The Third Xiangya Hospital, Central

South University, Changsha, Hunan, People’s Republic of China

W. Xiong

Hunan Key Laboratory of Nonresolving Inflammation and

Cancer, The Third Xiangya Hospital, Central South University,

Changsha, Hunan, People’s Republic of China

123

Acta Neurol Belg

DOI 10.1007/s13760-014-0347-2

Methods

Five hundred and two unrelated Chinese Han patients with

PD (age: 65.9 ± 10.2 years; age at onset: 62.5 ± 7.9

years; male/female: 310/192) were recruited from Main-

land China. The diagnosis of PD was made based on

common diagnostic criteria [8]. The protocol of this study

was approved by the Ethics Committee of the Third

Xiangya Hospital, Central South University, and written

informed consents were obtained from all participating

individuals. Among the 502 PD patients, 119 (23.7 %)

patients had first- or second-degree relatives affected with

PD (familial PD; male/female: 72/47), 383 patients

(76.3 %) had no family history of PD (sporadic PD; male/

female: 238/145). Mutations in some other PD-related

genes have been excluded in some of these patients.

40.2 % (202/502) of the patients were screened and were

negative for any mutation in the vacuolar protein sorting 35

gene (VPS35) [9]. 67.5 % (339/502) had no evidence of

mutation in the F-box only protein 48 gene (FBXO48) [10].

All were excluded for any mutation in the S100 calcium-

binding beta gene (S100B) [11]. 80.3 % (403/502) were

negative for either p.A502V or p.R1205H point mutations

in the eukaryotic translation initiation factor 4-gamma 1

gene (EIF4G1) [2].

Genomic DNA was extracted from peripheral blood

using a standard phenol–chloroform extraction method.

Genetic analysis of the SNCA gene was performed in 502

PD patients with the method described previously [10]. The

primers used for PCR amplification, covering the coding

region and intron/exon boundaries of the SNCA gene, were

designed using primer design program Primer3 (http://

primer3.ut.ee/) based on the genomic DNA sequences,

and checked for specificity using Primer-BLAST (http://

www.ncbi.nlm.nih.gov/tools/primer-blast/) (Table 1). PCR

amplification for the coding region of the SNCA gene was

performed using a 9700 Thermal cycler System (Applied

Biosystems Inc.) for 35 cycles at 95 �C for 35 s, 57 �C for

30 s, 72 �C for 35 s, and a final elongation step at 72 �C

for 5 min. 100 ng of gDNA and 10 pmol primers were

used in a 25-ll reaction volume. 8.5 ll PCR products were

digested by 0.8 U shrimp alkaline phosphatase (SAP) and

8 U exonuclease I (Thermo Scientific) in a 10-ll reaction

volume for purification. Then, the products were sequenced

directionally by an 8-capillary 3500 genetic analyzer

(Applied Biosystems Inc.) using standard methods [11].

Results

We did not detect any mutation in the coding region of the

SNCA gene among the 502 PD patients, consistent with the

low variant frequency in SNCA coding region in Asian

population (http://www.ncbi.nlm.nih.gov/snp/). We identi-

fied only a G[A variant in the intron 4 (rs10005233,

NM_001146055.1:c.306?66G[A), which does not poten-

tially change splicing (predicted by http://www.fruitfly.org/

seq_tools/splice.html), indicating that it is not a pathogenic

mutation.

Discussion

The SNCA gene, mapped to chromosome 4q22.1, contains

six exons spanning about 114 kb. SNCA contains seven

imperfect repeats of an 11-amino acid sequence, which

may mediate multimerization [12]. In an in vitro study,

wild-type and mutant SNCA form insoluble fibrillar

aggregates with antiparallel beta-sheet structure [13].

Recently, a p.H50Q mutation in the SNCA gene was

observed in a Caucasian English female PD patient with an

age of onset at 71 years [5], and a p.G51D mutation was

found in a French family with a parkinsonian-pyramidal

syndrome [6]. To date, five point mutations, duplications

and triplications have been identified in at least 57 SNCA-

related pedigrees with parkinsonism [14]. Point mutations

and multiplications of the SNCA gene cause cognitive or

psychiatric symptoms, parkinsonism, dysautonomia and

myoclonus with widespread SNCA pathology in the central

and peripheral nervous system in these families [15].

Snca-/- mice were fertile, and displayed a reduction in

striatal dopamine and an attenuation of dopamine-depen-

dent locomotor response to amphetamine [16]. Transgenic

mice expressing human wild-type SNCA showed progres-

sive accumulation of SNCA- and ubiquitin-immunoreac-

tive inclusions in neurons of the neocortex, hippocampus,

and substantia nigra [17]. SNCA p.A30P or p.A53T mutant

mice exhibited abnormalities in enteric nervous system

Table 1 Primers for the SNCA

gene

SNCA alpha-synuclein

Exon Forward primer (50 ? 30) Reverse primer (50 ? 30) Product size (bp)

2 TCCCCGAAAGTTCTCATTCAA TCACTCATGAACAAGCACCA 232

3 TTGAGACTTATGTCTTGAATTTG TCTTGAATACTGGGCCACAC 148

4 CCACCCTTTAATCTGTTGTTGC TAGCCGTTCCCCACAGTAAG 289

5 CCGTGGCCAACATCCCTATA AGAGAAATGTGACAATGACAGGT 262

6 TCCTATCTCATTGGCTGTCAGT CTGGGCACATTGGAACTGAG 200

Acta Neurol Belg

123

(ENS) function and synuclein-immunoreactive aggregates

in ENS ganglia. SNCA p.A53T mutant mice also had

abnormal motor behavior [18].

Although of great interest, in our well-characterized

cohort of 502 subjects with PD, none were found to carry

any mutation(s) in the SNCA coding region except that a

known non-coding variant rs10005233 was identified. In

spite of a study showing the absence of specific mutations

in the SNCA gene for PD in a Chinese population [19], to

our knowledge, this is the first study to analyze the entire

coding region of the SNCA gene in a large cohort of Chi-

nese Han patients with PD. Point mutations in the coding

region of the SNCA gene are rare in general population

with a predicted frequency of less than 0.8 % (30/4238)

(Table 2). Of note, negative studies of small sample sizes,

specific exons or point mutations, are not included when

calculating the point mutation frequency. Therefore, the

actual frequency of point mutations in the coding region of

the SNCA gene may be even lower. SNCA point mutations

are likely to account for only a small number of PD

patients, originating from some focal localities. Further

studies focusing on early-onset autosomal dominant PD

pedigrees that have moderate response to levodopa might

help to identify new SNCA mutations and explore its role in

the pathogenesis of PD. Furthermore, utilization of massive

parallel sequencing may provide a more detailed view of

the known PD genes and other genes associated with

SNCA pathway.

Acknowledgments We thank all the individuals who participated in

this study. This study was supported by National Natural Science

Foundation of China (81101339, 81271921, 81001476), Research

Foundation for the Doctoral Program of Higher Education of China

(20110162110026), Natural Science Foundation of Hunan Province,

China (10JJ5029), Sheng Hua Scholars Program of Central South

Table 2 Point mutations detected in the SNCA coding region in PD patients

Study Case Geographic distribution/ethnic background Mutation detected Frequency

Kruger et al. [20] 192 SPD, 8 FPD German p.A30P 2/200

Farrer et al. [21] 35 ADPD Puerto Rican, Russian, Irish, African-American,

Dutch and English, Scottish-Irish and German

No 0/35

Chan et al. [22] 24 PD (3 FPD) America No 0/24

Vaughan et al. [23] 30 ADPD European and American Caucasian No 0/30

Parsian et al. [24] 20 FPD White of non-Hispanic origin No 0/20

Papadimitriou et al. [25] 6 ADPD Greek p.A53T 2/6

Markopoulou et al. [26] 8 ADPD Greek-American p.A53T 8/8

Scott et al. [27] 356 PD American and Greek p.A53T 5/356

Illarioshkin et al. [28] 9 ADPD Russia No 0/9

Pastor et al. [29] 50 FPD Spain No 0/50

Autere et al. [30] 22 FPD Finland No 0/22

Zarranz et al. [31] 5 ADPD Spanish p.E46 K 5/5

Hope et al. [32] 50 ADPD European Caucasian, Asian, African No 0/50

Michell et al. [33] 3 SPD Polish p.A53T 1/3

Hofer et al. [34] 103 EOPD European No 0/103

Berg et al. [35] 1921 PD (237 FPD) Caucasian, Asian, African p.A53T 1/1921

Xiromerisiou et al. [36] 55 ADPD Greek No 0/55

Ki et al. [37] 1 FPD Korea p.A53T 1/1

Bras et al. [38] 66 PD (39 FPD) Portugal No 0/66

Mellick et al. [39] 74 EOPD (30 FPD) Australia No 0/74

Camargos et al. [40] 8 FPD Brazilian No 0/8

Nuytemans et al. [41] 310 PD Belgian No 0/310

Yonova-Doing et al. [42] 39 PD Zambian No 0/39

Lesage et al. [6] 203 ADPD French p.G51D 3/203

Appel-Cresswell et al. [7] 110 PD (66 FPD) Canada, Norway p.H50Q 1/110

Proukakis et al. [43] 28 PD United Kingdom p.H50Q 1/28

Our study 119 FPD, 383 SPD Chinese Han No 0/502

Combined 4238 PD – – 30/4238

SNCA alpha-synuclein, PD Parkinson disease, SPD sporadic PD, FPD familial PD, ADPD autosomal dominant PD, EOPD early-onset PD

Acta Neurol Belg

123

University, China (H.D.), Construction Foundation for Key Subjects

of the Third Xiangya Hospital, Central South University, China

(H.D.), Hunan Provincial Innovation Foundation For Postgraduate,

China (7138000008), Students Innovative Pilot Scheme of Central

South University, China (YC12417), and the Fundamental Research

Funds for the Central Universities of Central South University, China

(2013zzts101).

Conflict of interest The authors declare that they have no conflict

of interest.

References

1. Deng H, Liang H, Jankovic J (2013) The F-box only protein

seven gene in parkinsonian-pyramidal disease. JAMA Neurol

70:20–24

2. Yuan L, Song Z, Xu H, Gu S, Zhu A, Gong L, Zhao Y, Deng H

(2013) EIF4G1 Ala502Val and Arg1205His variants in Chinese

patients with Parkinson disease. Neurosci Lett 543:69–71

3. Quadri M, Fang M, Picillo M, Olgiati S, Breedveld GJ, Graafland

J, Wu B, Xu F, Erro R, Amboni M, Pappata S, Quarantelli M,

Annesi G, Quattrone A, Chien HF, Barbosa ER, International

Parkinsonism Genetics Network, Oostra BA, Barone P, Wang J,

Bonifati V (2013) Mutation in the SYNJ1 gene associated with

autosomal recessive, early-onset Parkinsonism. Hum Mutat

34:1208–1215

4. Polymeropoulos MH, Lavedan C, Leroy E, Ide SE, Dehejia A,

Dutra A, Pike B, Root H, Rubenstein J, Boyer R, Stenroos ES,

Chandrasekharappa S, Athanassiadou A, Papapetropoulos T,

Johnson WG, Lazzarini AM, Duvoisin RC, Di Iorio G, Golbe LI,

Nussbaum RL (1997) Mutation in the alpha-synuclein gene

identified in families with Parkinson’s disease. Science

276:2045–2047

5. Proukakis C, Dudzik CG, Brier T, MacKay DS, Cooper JM,

Millhauser GL, Houlden H, Schapira AH (2013) A novel a-

synuclein missense mutation in Parkinson disease. Neurology

80:1062–1064

6. Lesage S, Anheim M, Letournel F, Bousset L, Honore A, Rozas

N, Pieri L, Madiona K, Durr A, Melki R, Verny C, Brice A,

French Parkinson’s Disease Genetics Study Group (2013) G51D

a-synuclein mutation causes a novel parkinsonian-pyramidal

syndrome. Ann Neurol 73:459–471

7. Appel-Cresswell S, Vilarino-Guell C, Encarnacion M, Sherman

H, Yu I, Shah B, Weir D, Thompson C, Szu-Tu C, Trinh J, Aasly

JO, Rajput A, Rajput AH, Jon Stoessl A, Farrer MJ (2013) Alpha-

synuclein p.H50Q, a novel pathogenic mutation for Parkinson’s

disease. Mov Disord 28:811–813

8. Jankovic J (2008) Parkinson’s disease: clinical features and

diagnosis. J Neurol Neurosurg Psychiatry 79:368–376

9. Deng H, Xu H, Deng X, Song Z, Zheng W, Gao K, Fan X, Tang J

(2012) VPS35 mutation in Chinese Han patients with late-onset

Parkinson’s disease. Eur J Neurol 19:e96–e97

10. Xiu X, Song Z, Gao K, Deng X, Qi Y, Zhu A, Gong L, Deng H

(2013) Genetic analysis of the FBXO48 gene in Chinese Han

patients with Parkinson disease. Neurosci Lett 541:224–226

11. Guo Y, Yang H, Deng X, Song Z, Yang Z, Xiong W, Yuan L, Xu

H, Deng S, Deng H (2013) Genetic analysis of the S100B gene

in Chinese patients with Parkinson disease. Neurosci Lett

555:134–136

12. Goedert M (1997) Familial Parkinson’s disease. The awakening

of alpha-synuclein. Nature 388:232–233

13. Narhi L, Wood SJ, Steavenson S, Jiang Y, Wu GM, Anafi D,

Kaufman SA, Martin F, Sitney K, Denis P, Louis JC, Wypych J,

Biere AL, Citron M (1999) Both familial Parkinson’s disease

mutations accelerate alpha-synuclein aggregation. J Biol Chem

274:9843–9846. Erratum in: J Biol Chem 274:13728

14. Deng H, Yuan L (2014) Genetic variants and animal models in

SNCA and Parkinson disease. Ageing Res Rev 15C:161–176

15. Puschmann A (2013) Monogenic Parkinson’s disease and par-

kinsonism: Clinical phenotypes and frequencies of known

mutations. Parkinsonism Relat Disord 19:407–415

16. Abeliovich A, Schmitz Y, Farinas I, Choi-Lundberg D, Ho WH,

Castillo PE, Shinsky N, Verdugo JM, Armanini M, Ryan A,

Hynes M, Phillips H, Sulzer D, Rosenthal A (2000) Mice lacking

alpha-synuclein display functional deficits in the nigrostriatal

dopamine system. Neuron 25:239–252

17. Masliah E, Rockenstein E, Veinbergs I, Mallory M, Hashimoto M,

Takeda A, Sagara Y, Sisk A, Mucke L (2000) Dopaminergic loss

and inclusion body formation in alpha-synuclein mice: implications

for neurodegenerative disorders. Science 287:1265–1269

18. Kuo YM, Li Z, Jiao Y, Gaborit N, Pani AK, Orrison BM,

Bruneau BG, Giasson BI, Smeyne RJ, Gershon MD, Nuss-

baum RL (2010) Extensive enteric nervous system abnormal-

ities in mice transgenic for artificial chromosomes containing

Parkinson disease-associated alpha-synuclein gene mutations

precede central nervous system changes. Hum Mol Genet

19:1633–1650

19. Lin JJ, Yueh KC, Chang DC, Lin SZ (1999) Absence of G209A

and G88C mutations in the alpha-synuclein gene of Parkinson’s

disease in a Chinese population. Eur Neurol 42:217–220

20. Kruger R, Kuhn W, Muller T, Woitalla D, Graeber M, Kosel S,

Przuntek H, Epplen JT, Schols L, Riess O (1998) Ala30Pro

mutation in the gene encoding alpha-synuclein in Parkinson’s

disease. Nat Genet 18:106–108

21. Farrer M, Wavrant-De Vrieze F, Crook R, Boles L, Perez-Tur J,

Hardy J, Johnson WG, Steele J, Maraganore D, Gwinn K, Lynch

T (1998) Low frequency of alpha-synuclein mutations in familial

Parkinson’s disease. Ann Neurol 43:394–397

22. Chan P, Jiang X, Forno LS, Di Monte DA, Tanner CM, Langston

JW (1998) Absence of mutations in the coding region of the

alpha-synuclein gene in pathologically proven Parkinson’s dis-

ease. Neurology 50:1136–1137

23. Vaughan JR, Farrer MJ, Wszolek ZK, Gasser T, Durr A, Agid Y,

Bonifati V, DeMichele G, Volpe G, Lincoln S, Breteler M, Meco

G, Brice A, Marsden CD, Hardy J, Wood NW (1998) Sequencing

of the alpha-synuclein gene in a large series of cases of familial

Parkinson’s disease fails to reveal any further mutations. Hum

Mol Genet 7:751–753

24. Parsian A, Racette B, Zhang ZH, Chakraverty S, Rundle M,

Goate A, Perlmutter JS (1998) Mutation, sequence analysis, and

association studies of alpha-synuclein in Parkinson’s disease.

Neurology 51:1757–1759

25. Papadimitriou A, Veletza V, Hadjigeorgiou GM, Patrikiou A,

Hirano M, Anastasopoulos I (1999) Mutated alpha-synuclein

gene in two Greek kindreds with familial PD: incomplete pene-

trance? Neurology 52:651–654

26. Markopoulou K, Wszolek ZK, Pfeiffer RF, Chase BA (1999)

Reduced expression of the G209A alpha-synuclein allele in

familial Parkinsonism. Ann Neurol 46:374–381

27. Scott WK, Yamaoka LH, Stajich JM, Scott BL, Vance JM, Roses

AD, Pericak-Vance MA, Watts RL, Nance M, Hubble J, Koller

W, Stern MB, Colcher A, Allen FH Jr, Hiner BC, Jankovic J,

Ondo W, Laing NG, Mastaglia F, Goetz C, Pappert E, Small GW,

Masterman D, Haines JL, Davies TL (1999) The alpha-synuclein

gene is not a major risk factor in familial Parkinson disease.

Neurogenetics 2:191–192

28. Illarioshkin SN, Ivanova-Smolenskaya IA, Markova ED, Zago-

rovskaya TB, Brice A (2000) Lack of alpha-synuclein gene

mutations in families with autosomal dominant Parkinson’s dis-

ease in Russia. J Neurol 247:968–969

Acta Neurol Belg

123

29. Pastor P, Munoz E, Ezquerra M, Obach V, Martı MJ, Vallde-

oriola F, Tolosa E, Oliva R (2001) Analysis of the coding and the

5’ flanking regions of the alpha-synuclein gene in patients with

Parkinson’s disease. Mov Disord 16:1115–1119

30. Autere JM, Hiltunen MJ, Mannermaa AJ, Jakala PA, Hartikainen

PH, Majamaa K, Alafuzoff I, Soininen HS (2002) Molecular

genetic analysis of the alpha-synuclein and the parkin gene in

Parkinson’s disease in Finland. Eur J Neurol 9:479–483

31. Zarranz JJ, Alegre J, Gomez-Esteban JC, Lezcano E, Ros R,

Ampuero I, Vidal L, Hoenicka J, Rodriguez O, Atares B, Llorens

V, Gomez Tortosa E, del Ser T, Munoz DG, de Yebenes JG

(2004) The new mutation, E46K, of alpha-synuclein causes

Parkinson and Lewy body dementia. Ann Neurol 55:164–173

32. Hope AD, Myhre R, Kachergus J, Lincoln S, Bisceglio G,

Hulihan M, Farrer MJ (2004) Alpha-synuclein missense and

multiplication mutations in autosomal dominant Parkinson’s

disease. Neurosci Lett 367:97–100

33. Michell AW, Barker RA, Raha SK, Raha-Chowdhury R (2005) A

case of late onset sporadic Parkinson’s disease with an A53T

mutation in alpha-synuclein. J Neurol Neurosurg Psychiatry

76:596–597

34. Hofer A, Berg D, Asmus F, Niwar M, Ransmayr G, Rie-

menschneider M, Bonelli SB, Steffelbauer M, Ceballos-Baumann

A, Haussermann P, Behnke S, Kruger R, Prestel J, Sharma M,

Zimprich A, Riess O, Gasser T (2005) The role of alpha-synuc-

lein gene multiplications in early-onset Parkinson’s disease and

dementia with Lewy bodies. J Neural Transm 112:1249–1254

35. Berg D, Niwar M, Maass S, Zimprich A, Moller JC, Wuellner U,

Schmitz-Hubsch T, Klein C, Tan EK, Schols L, Marsh L, Dawson

TM, Janetzky B, Muller T, Woitalla D, Kostic V, Pramstaller PP,

Oertel WH, Bauer P, Krueger R, Gasser T, Riess O (2005) Alpha-

synuclein and Parkinson’s disease: implications from the

screening of more than 1,900 patients. Mov Disord 20:1191–1194

36. Xiromerisiou G, Hadjigeorgiou GM, Gourbali V, Johnson J,

Papakonstantinou I, Papadimitriou A, Singleton AB (2007)

Screening for SNCA and LRRK2 mutations in Greek sporadic

and autosomal dominant Parkinson’s disease: identification of

two novel LRRK2 variants. Eur J Neurol 14:7–11

37. Ki CS, Stavrou EF, Davanos N, Lee WY, Chung EJ, Kim JY,

Athanassiadou A (2007) The Ala53Thr mutation in the alpha-

synuclein gene in a Korean family with Parkinson disease. Clin

Genet 71:471–473

38. Bras J, Guerreiro R, Ribeiro M, Morgadinho A, Januario C, Dias

M, Calado A, Semedo C, Oliveira C, Hardy J, Singleton A (2008)

Analysis of Parkinson disease patients from Portugal for muta-

tions in SNCA, PRKN, PINK1 and LRRK2. BMC Neurol 8:1

39. Mellick GD, Siebert GA, Funayama M, Buchanan DD, Li Y,

Imamichi Y, Yoshino H, Silburn PA, Hattori N (2009) Screening

PARK genes for mutations in early-onset Parkinson’s disease

patients from Queensland, Australia. Parkinsonism Relat Disord

15:105–109

40. Camargos ST, Dornas LO, Momeni P, Lees A, Hardy J, Singleton

A, Cardoso F (2009) Familial Parkinsonism and early onset

Parkinson’s disease in a Brazilian movement disorders clinic:

phenotypic characterization and frequency of SNCA, PRKN,

PINK1, and LRRK2 mutations. Mov Disord 24:662–666

41. Nuytemans K, Meeus B, Crosiers D, Brouwers N, Goossens D,

Engelborghs S, Pals P, Pickut B, Van den Broeck M, Corsmit E,

Cras P, De Deyn PP, Del-Favero J, Van Broeckhoven C, Theuns J

(2009) Relative contribution of simple mutations vs. copy num-

ber variations in five Parkinson disease genes in the Belgian

population. Hum Mutat 30:1054–1061

42. Yonova-Doing E, Atadzhanov M, Quadri M, Kelly P, Shawa N,

Musonda ST, Simons EJ, Breedveld GJ, Oostra BA, Bonifati V

(2012) Analysis of LRRK2, SNCA, Parkin, PINK1, and DJ-1 in

Zambian patients with Parkinson’s disease. Parkinsonism Relat

Disord 18:567–571

43. Proukakis C, Houlden H, Schapira AH (2013) Somatic alpha-

synuclein mutations in Parkinson’s disease: hypothesis and pre-

liminary data. Mov Disord 28:705–712

Acta Neurol Belg

123