Generate a DNA Barcode and Identify SpeciesIs there something fishy about what you’re eating?
Bio-Rad Biotechnology Explorer Fish DNA Barcoding Kit and DNA Barcoding Sequencing Module
Biotechnology Explorer™ | explorer.bio-rad.com2
Instructors - Bio-Rad Curriculum and Training Specialists
Damon Tighe, [email protected]
Sherri Andrews, [email protected]
Leigh Brown, M.A. [email protected]
Biotechnology Explorer™ | explorer.bio-rad.com3
Workshop Timeline
Introduction
Fish DNA extraction
Gel electrophoresis
DNA visualization with UViewTM
Bioinformatics and species identification
Inquiry Questions
Biotechnology Explorer™ | explorer.bio-rad.com4
Diversity of Life
It is estimated that there are 10 -100 million species of organisms on Earth
Only about 1.7 million species have been formally identified
Current limitation to studies of biological diversity - humans are limited in their ability to recognize and recall morphological variation
Few taxonomists can even reliably identify a collection of ~1000 species
How do we complete the task of identifying the remaining species, let alone recognizing them once they are identified?
Solution – Create a genetic based identification system (DNA barcode)
Biotechnology Explorer™ | explorer.bio-rad.com5
Visual Classification
Some distinct species are not easy to differentiate by eye…
vs
or
Biotechnology Explorer™ | explorer.bio-rad.com6
What is DNA Barcoding?
A worldwide effort (International Barcode of Life, iBOL) exists to “barcode” or generate standard genetic sequence identification of all species on Earth.
CCCTCCTA
What is a barcode?– UPC (Universal Product Code) Symbol – 11 variable positions
with 10 possible numbers– Ability to assign a unique identifier to over 100 billion items
What is a DNA barcode?– Use of a designated DNA sequence to serve as a unique species identifier– Ideal sequence is constrained by overall conservation (preserve gene function), but
still has substantial sequence variation which differentiates species
Biotechnology Explorer™ | explorer.bio-rad.com7
Barcode Of Life (BOL) iBOL
– International Barcode of Life Project– Hub is at Biodiversity Institute of Ontario (BIO) at U Guelph – Goal to generate 5 million barcodes representing 500,000 species– Currently: 2 million barcodes representing 300,000 species in the database
– Opportunity to contribute to the global initiative to barcode life on Earth!
Biotechnology Explorer™ | explorer.bio-rad.com8
Be a citizen scientist!
Participate in the largest biodiversity cataloging project ever undertaken and help build a genetic registry of life
Design a market study to look at local food supply, or local flora and fauna
Axolotl / Mexican salamander (critically endangered)
Biotechnology Explorer™ | explorer.bio-rad.com9
“Sushigate”
2008, two 11th graders in New York did a market substitution study Surveyed 60 samples collected from 4 restaurants and 10 grocery stores Of the 60 samples, 54 could be genetically identified 13 of the 54 were mislabeled (23%)! 2/4 restaurants and 6/10 grocery stores had sold mislabeled fish
Biotechnology Explorer™ | explorer.bio-rad.com10
“Sushigate”
7/9 samples listed as Red Snapper were mislabeled, and included substitutions: Acadian redfish from North Atlantic, Pinjalo from SE Asia, Lavender jobfish from So. Pacific, Nile perch from Africa, and Atlantic Cod.
Spotted Goatfish (restricted to the Caribbean) sold as Mediterranean Red Mullet White Bass (farmed freshwater fish) sold as Sea Bass Smelt Roe sold as Flying Fish Roe White (albacore) tuna sushi was Mozambique tilapia (commonly farmed)
Biotechnology Explorer™ | explorer.bio-rad.com11
Food Fraud in the News
Biotechnology Explorer™ | explorer.bio-rad.com12
DNA Barcode Region Defined
Genes Designated as Barcode Regions: Fungi
– ITS – nuclear ribosomal internal transcribed spacer region Plants – 2 genes required
– rbcL – chloroplast ribulose-1,5-bisphosphate carboxylate– matK – chloroplast maturase K
Animals– COI – mitochondrial cytochrome C oxidase subunit I
Why COI?– Mitochondrial genome lacks introns– Limited exposure to recombination– Haploid mode of inheritance– Universal primers are robust– Hundreds to thousands of mitochondria/cell – this
means many more copies of the COI gene in your sample!
MitochondrialDNA
Biotechnology Explorer™ | explorer.bio-rad.com13
Applications of DNA Barcoding
What did I eat last night (and is it what they said it was)?
What did I catch
yesterday?
What is the genetic
signatureof this rare
species?
Biotechnology Explorer™ | explorer.bio-rad.com14
Fish DNA Barcoding Kit Start to Finish
DNA BARCODE
Biotechnology Explorer™ | explorer.bio-rad.com15
DNA Barcoding Kit Workflow
Fish sample Extract genomic DNA
Gel electrophoresis
Sequencing,Sequence Analysis
PCR amplification
Biotechnology Explorer™ | explorer.bio-rad.com16
Barcoding Overview
Biotechnology Explorer™ | explorer.bio-rad.com17
Barcoding Overview
Biotechnology Explorer™ | explorer.bio-rad.com18
Barcoding Overview
Biotechnology Explorer™ | explorer.bio-rad.com19
DNA Extraction Overview
+ Resuspension + Lysis Buffer Buffer
Incubate10 minat 55oC
Bind DNAto column
(Matrix Solution)
+ Neutralization Buffer
Wash columnwith Wash buffer
Elute DNA
Biotechnology Explorer™ | explorer.bio-rad.com20
Quick Guide – Fish Prep
Cut a piece of fish approximately the size of a pencil eraser-head, from your first fish sample. Slice it until finely minced. Transfer the sample into microcentrifuge tube 1.
Label tubes “1” for fish sample 1, “2” for fish sample 2. Also label with your initials. 1
2
1
1
2
Biotechnology Explorer™ | explorer.bio-rad.com21
Quick Guide – Fish Prep
Using a new cutting implement, cut a piece of fish approximately the size of a pencil eraser-head, from your second fish sample. Slice it until finely minced. Transfer the sample into microcentrifuge tube 2. 2
Add 200 l of Resuspension to your two tubes and flick several times to ensure full submersion of the fish in the resuspension solution.
3
4
Biotechnology Explorer™ | explorer.bio-rad.com22
Quick Guide – DNA Extraction
Add 250 µl of Lysis to each tube and mix gently by inverting tubes 10 times to mix contents.
Incubate samples at 55oC for 10 min. The samples do not need to be shaken during incubation.
5
6
Biotechnology Explorer™ | explorer.bio-rad.com23
What is happening during DNA extraction?Where is the DNA at each step?
Resuspension– buffered solution with chelating
agents to destabilize cell membranes– DNA: pellet (fish) or supernatant?
Lysis– alkaline solution that disrupts
membranes, releases DNA, denatures DNA
– DNA: pellet (fish) or supernatant? Heating
– helps to break down tissue to recover more DNA
Neutralization– solution that counteracts the effects of
alkalinity, renatures smaller pieces of DNA, helps precipitate DNA and remove detergents
– DNA: pellet (fish) or supernatant?
mitoDNA
nuclearDNA
Biotechnology Explorer™ | explorer.bio-rad.com24
What is happening during DNA extraction?Where is the DNA at each step?
Matrix– silica based suspension that binds
DNA but not RNA or proteins– DNA: column or flow through?
Wash– removes other small particles in the
prep that are nonspecifically bound to the Matrix
– DNA: column or flow through?
Elute– low ionic strength buffer or water
releases DNA from the silica– DNA: column or flow through?
mitoDNA
pelleted proteins,membranes, etc
Biotechnology Explorer™ | explorer.bio-rad.com25
Quick Guide – DNA Extraction
Add 250 l of Neutralization to each tube and mix gently by inverting tubes 10 times to mix. A visible cloudy precipitate may form.
Centrifuge the tubes for 5 min at top speed (14,000 x g) in the microcentrifuge. A compact pellet will form along the side of the tube. The supernatant contains the DNA.
7
8
Biotechnology Explorer™ | explorer.bio-rad.com26
Quick Guide – DNA Extraction
Snap (do not twist!) the bottoms off of the spin columns and insert each column into a capless 2 ml microcentrifuge tube. Label columns 1 and 2 + your initials.
Transfer the entire supernatant (500–550 µl) of each fish sample into the appropriately labeled spin column. Try not to get any of the particulates into the spin column because they will clog the column and prevent you from continuing.
9
10
1 2
1 2
Biotechnology Explorer™ | explorer.bio-rad.com27
Quick Guide – DNA Extraction
Thoroughly mix the tube labeled Matrix to make sure particulates are completely resuspended before use.
Add 200 l of thoroughly resuspended Matrix to the first column and pipet up and down to mix.
Using a new pipet tip, add 200 l of thoroughly resuspended Matrix to the second column and pipet up and down to mix.
Centrifuge the columns for 30 sec at full speed.Remove flow through to waste.
11
12
13
1 2
1 2
Biotechnology Explorer™ | explorer.bio-rad.com28
Quick Guide – DNA Extraction
Repeat wash step andcentrifugation as shown above.
Add 500 µl of Wash and wash the samples by centrifugation for 30 sec.Remove flow through to waste.
14
15
Wash
1 2
Biotechnology Explorer™ | explorer.bio-rad.com29
Quick Guide – DNA Extraction
Centrifuge columns for a full 2 min to remove residual traces of Wash and dry out the samples
Remove the spin columns and discard the 2 ml microcentrifuge wash tubes. Place the spin column for each sample into a new capless 2 ml tube.
16
17
new caplesstube
1 2
1
Biotechnology Explorer™ | explorer.bio-rad.com30
Quick Guide – DNA Extraction
1 2
Using a fresh pipet tip for each sample, add 100 µl of distilled water to each spin column, being careful not to touch the resin. Elute the DNA by centrifuging for 1 min.
Label two clean 2 ml microcentrifuge tubes (with caps) Fish 1 and Fish 2 and your initials. Transfer the eluted DNA into the appropriately labeled tube.
18
19
1 2
Biotechnology Explorer™ | explorer.bio-rad.com31
PCR amplification of COI gene
Fish DNA has been extracted
Next step is to amplify a portion of the mitochondrial COI gene
– Generate enough DNA to visualize on a gel– Generate enough DNA to send for sequencing
Assemble reactions of – Template DNA– Primers– Nucleotides– Taq polymerase– Magnesium chloride
Multiple rounds of thermal cycling toamplify DNA
MitochondrialDNA
Biotechnology Explorer™ | explorer.bio-rad.com32
PCR – Degenerate primers
When trying to amplify DNA from a wide variety of samples (many different fish) using the same primer set, creating degenerate primers is a useful approach
Determine a consensus sequence derived from several species
– Pike: A-C-T-G-G-C-T-T-A-G-C– Carp: A-C-T-G-G-A-T-T-A-G-C– Tuna: A-C-T-G-G-G-T-T-A-A-C– Bass: A-C-T-G-G-T-T-T-A-G-C– Hake: A-C-T-G-G-A-T-T-T-A-C– CONS.: A-C-T-G-G-N-T-T-A-R-C
The consensus/degenerate primers bind to DNA from all of these fish, whereas regular primers would only bind to one
The primers used in our Fish DNA barcoding kit contain degenerate positions to amplify DNA from as many different fish as possible!
Biotechnology Explorer™ | explorer.bio-rad.com33
Fish Barcoding PCR Primers
Biotechnology Explorer™ | explorer.bio-rad.com34
PCR – Overview
Heat (94oC) to denature DNA strands
Cool (55oC) to anneal primers to template
Warm (72oC) to activate Taq polymerase, which extends primers and replicates DNA
Repeat 35 cycles
Your PCR products will be given to you now for electrophoresis
Biotechnology Explorer™ | explorer.bio-rad.com35
Quick Guide - Electrophoresis
Add 2 µl of UView 6x loading dye to each sample, using a new pipet tip each time. Mix samples well.
Load the agarose gel in the following lane order and volumes, using a new pipet tip each time:
Lane Sample 1 EMPTY 2 EMPTY 3 20 µl MWR 4 12 µl (+) E 5 12 µl (–) E 6 12 µl 1 E 7 12 µl 2 E 8 EMPTY
200 V20 min
0.25x TAE
Biotechnology Explorer™ | explorer.bio-rad.com36
Visualizing DNA after electrophoresis
UViewTM Ethidium Bromide Fast BlastTM
Nontoxic Toxic, Mutagen NontoxicLoading dye + Stain Stain StainInstant Instant Requires wait timeView with UV View with UV View by eyeVery sensitive Most sensitive Less sensitive
Biotechnology Explorer™ | explorer.bio-rad.com37
Use UV transilluminator to visualize UView or Ethidium Bromide
UViewTM
Ethidium bromide
1 2 3 4 5
1. MW ruler2. (+) control3. (-) control4. Fish 15. Fish 2
Biotechnology Explorer™ | explorer.bio-rad.com38
Sequencing of PCR products
Biotechnology Explorer™ | explorer.bio-rad.com39
Bioinformatics – Alignment
What is the longest run of tails I should expect for 100 tosses?
. . . . .
Run
R = log1/p (n)
R = longest runp = probability (for “fair” coins its 0.5)n = number of tosses
Paul Erdos
Paul Erdos‐Alfréd Rényi law
Biotechnology Explorer™ | explorer.bio-rad.com40
Bioinformatics – Alignment
What is the longest run of tails I should expect for 100 tosses?
. . . . .
Run
R = log1/0.5 (100) = 6.64
Paul Erdos
….so if I get more than 6.64 tails in a row when tossing 100 times, I might wonder if something besides randomness is going on
Biotechnology Explorer™ | explorer.bio-rad.com41
Bioinformatics – Alignment
If I call alignments tails. What is the longest run of tails I should expect for comparing two 10 bp sequences?
R = log1/0.25 (100) = 3.32
AATCGTACTGAACCATTCAG
¼ chance for getting same base
Sequence lengths multiplied
Biotechnology Explorer™ | explorer.bio-rad.com42
DNA is not a 4 sided Coin- Account for probability of bases being switched out for each other by a scoring matrix
Match
TransitionTransversionSame base type – Purine for Purine Change of base type – Purine for Pyrimidine
Bioinformatics – Alignment
Biotechnology Explorer™ | explorer.bio-rad.com43
DNA is not a 4 sided Coin
65555433321A55554433221G44444433221C33333333221T22222222221A
22221111111G11111111111GATTGACTTAAG
Bioinformatics – Alignment
Biotechnology Explorer™ | explorer.bio-rad.com44
DNA is not a 4 sided Coin
65555433321A5554433221G44444433221C33333333221T22222222221A
22221111111G11111111111GATTGACTTAAG
Bioinformatics – Alignment
Biotechnology Explorer™ | explorer.bio-rad.com45
Bioinformatics – BLAST tool
ATTCGCAT
Query Database
1) Break into words
2) Find Matches and let go of all the other database words that don’t match
ATTTTCTCGCGCGCACAT
3) Extend from match 1 base at a time until score falls off
4) Use two anchors to define and alignment, compare, score
E-value
Biotechnology Explorer™ | explorer.bio-rad.com46
Bioinformatics – BLAST tool
E-valueTheoretically, we could trust any result with an E-value ≤ 1
In practice – BLAST uses estimations.• E-values of 10-4 and lower indicate a significant homology.• E-values between 10-4 and 10-2 should be checked (similardomains, maybe non-homologous).• E-values between 10-2 and 1 do not indicate a good homology
Biotechnology Explorer™ | explorer.bio-rad.com47
Bioinformatics – Linking DNA Barcoding and Protein Profiler
+
Stronger Evidence for Evolutionary Relationship
Compare light chain of myosin sizes Compare E-value for CO1 gene
=
Biotechnology Explorer™ | explorer.bio-rad.com48
Bioinformatics using BOLD-SDP
Quick Start tutorial available online
BOLD-SDP = Barcode Of Life Data systems – Student Data Portal
Biotechnology Explorer™ | explorer.bio-rad.com49
Create an Instructor Account
Biotechnology Explorer™ | explorer.bio-rad.com50
Fill Out Required Information
Biotechnology Explorer™ | explorer.bio-rad.com51
Receive Two Important Emails – Login and Registration Keys
Registration keys
Biotechnology Explorer™ | explorer.bio-rad.com52
Log In and Register a New Course
Biotechnology Explorer™ | explorer.bio-rad.com53
Fill in Course Info,List Students, Receive Class Login
Biotechnology Explorer™ | explorer.bio-rad.com54
Students Log In and Enter Specimen Info
Biotechnology Explorer™ | explorer.bio-rad.com55
Enter Specimen Information
Biotechnology Explorer™ | explorer.bio-rad.com56
View Class Specimen List
Biotechnology Explorer™ | explorer.bio-rad.com57
Upload Sequencing Data Files
Biotechnology Explorer™ | explorer.bio-rad.com58
Select PCR and Sequencing Primers Used
Biotechnology Explorer™ | explorer.bio-rad.com59
Class List Updates with Specimen Records Uploaded
Biotechnology Explorer™ | explorer.bio-rad.com60
View Data
Biotechnology Explorer™ | explorer.bio-rad.com61
Uploaded trace files receive data quality assessment
Biotechnology Explorer™ | explorer.bio-rad.com62
Trace files viewable
Biotechnology Explorer™ | explorer.bio-rad.com63
Quality Scores
Light blue bars in background represent assigned quality value for each nucleotide (scale on right axis)
High quality valuesExamine peaks
Low quality valueExamine peaks (mixed call – overlap)
Biotechnology Explorer™ | explorer.bio-rad.com64
Generate contig (“sequence”) from trace files
Biotechnology Explorer™ | explorer.bio-rad.com65
Examine base calls in contig
Contig sequence
Biotechnology Explorer™ | explorer.bio-rad.com66
Contig generated, trim primer sequences
Biotechnology Explorer™ | explorer.bio-rad.com67
Run contaminant check and submit contig
Contig 573 bp with no ambiguous nucleotides
Biotechnology Explorer™ | explorer.bio-rad.com68
Data summary
contig sequence
translation
barcode generatedfrom data
Biotechnology Explorer™ | explorer.bio-rad.com69
Search full database for genetic match
Biotechnology Explorer™ | explorer.bio-rad.com70
Search species database for genetic match
Biotechnology Explorer™ | explorer.bio-rad.com71
Species match!
Biotechnology Explorer™ | explorer.bio-rad.com72
Education and DNA Barcoding - Resources
www.educationandbarcoding.org Links to content to aid in classroom presentations Check out ongoing student barcoding campaigns Register your own barcoding campaign! Link to BOLD-SDP workbench (Student Data Portal) Engage in citizen science
Biotechnology Explorer™ | explorer.bio-rad.com73
Questions to consider:– How important is each step in the lab protocol?– What part of the protocol can I manipulate to see a change in the
results?– Possible variables / questions:
• How will results be affected by the use of different fish sources (fresh, frozen, dried, canned)?
• Will different fish tissue yield better results (muscle vs fin, gills, or scales)?
• Cleanliness and attention to detail during fish processing– How do I ensure the changes I make are what actually affects the
outcome (importance of controls). – Write the protocol. After approval – do it!
Student Inquiry
Biotechnology Explorer™ | explorer.bio-rad.com74
What materials and equipment do I have on hand, and what will I need to order?– Extra gels, different organisms? – Other supplies depending on student questions– Consider buying extras in bulk or as refills – many have 1
year + shelf life. What additional prep work will I need?
– Order supplies
Student Inquiry - Teacher Considerations
Biotechnology Explorer™ | explorer.bio-rad.com75
Student Inquiry - Teacher Considerations