Expt. 10-1: P-elements and Enhancer Trapping
Expt. 10: P-elements and Enhancer Trapping
-Naturally occurring P-elements: Transposase gene between two inverted repeats
Transposase
Organization of the P Element
2.9 kb P Element
Transposase ORF
31 bp InvertedRepeat
Tnp BindingSite
9 or 21 bp Spacer
NNNNNNNNNCATGATGAAATAACATAAGGTGGNNNNNNNNNGTACTACTTTATTGTATTCCACC
3’ Cleavage Site
5’ Cleavage Site
NNNNNNNNNCATGATGAAATAACATANNNNNNNNN
AGGTGGGTACTACTTTATTGTATTCCACC
3’-OH
P -5’
5’-P
HO-3’
Transposase catalyzes a 17bp staggered cleavage event
P Element
+
P Element
8 bp target siteduplication
P element integration generates an 8 bp target site duplication
Taking Advantage of P-elements
-Mutagenesis
Taking Advantage of P-elements
-Mutagenesis-Insertional mutations easy
to clone.
Taking Advantage of P-elements-MutagenesisInsertional mutations (easy to clone).
-Imprecise excisions lead to frameshifts -and deletions.
Taking Advantage of P-elements
-Germline transformation
Taking Advantage of P-elements
-Mutagenesis-Germline transformation
1.Design transgene with inverted repeats.
Taking Advantage of P-elements
-Mutagenesis-Germline transformation
1.Design transgene with inverted repeats.
2.Mix with transposase gene
Taking Advantage of P-elements
-Mutagenesis-Germline transformation
1.Design transgene with inverted repeats.
2.Mix with transposase gene3.Inject into germline of embryo
Taking Advantage of P-elements
Germline transformation1.Design transgene with
inverted repeats.
2.Mix with source of transposase3.Inject into germline of embryo4.Look for transformants in F1.
YFG
Taking Advantage of P-elements
-Mutagenesis-Germline transformation-Enhancer trapping
Use regulatory informationfrom nearby genes to drive expression of a transgene
Mechanics of Enhancer Trapping:-Modified P-element contains:
-Inverted repeats-Basic promoter sequences-Molecular marker gene (e.g. -galactosidase)-Phenotypic marker (e.g. w+, ry+)
-Mobilize using transposase-Confirm hopping in F1 (phenotype)-Look for interesting/desired expression pattern in F2 with lacZ staining
lacZP w+
Mechanics of Enhancer Trapping:-Modified P-element contains:
-Inverted repeats-Basic promoter sequences-Molecular marker gene (e.g. -galactosidase)-Phenotypic marker (e.g. w+, ry+)
-Mobilize using transposase-Confirm hopping in F1 (phenotype)-Look for interesting/desired expression pattern in F2 with lacZ staining
P w+GAL4ey enhancer
lacZUAS InR(DN)UAS
Attached X females
XY X XXY^
Attached X females
XY X XXY
XXX Sterile
XXY Female
XY Male
YY Dead
^
^
^
+ P[lacZ, ry+], Cy ry + + Ki ry+
+ Sco ry Y + +X
+ P[lacZ, ry+], Cy ry + + Ki ry+
+ Sco ry Y + +X
+ P[lacZ, ry+], Cy Ki ry+ XX + ryY + ry Y + ry (phenotype=Cy, Ki, ry+)
+ P[lacZ, ry+], Cy ry + + Ki ry+
+ Sco ry Y + +X
+ P[lacZ, ry+], Cy Ki ry+ XX + ryY + ry Y + ry (phenotype Cy, Ki, ry+)
X
^
^
+ P[lacZ, ry+], Cy ry + + Ki ry+
+ Sco ry Y + +X
+ P[lacZ, ry+], Cy Ki ry+ XX + ryY + ry Y + ry (Cy, Ki, ry+)
X
+P? +P? ryP? XX + ry Y + ry Y + ry (not Cy, not Ki. If carrying a jumped P, will be ry+)
^
^
+ P[lacZ, ry+], Cy ry + + Ki ry+
+ Sco ry Y + +X
+ P[lacZ, ry+], Cy Ki ry+ XX + ryY + ry Y + ry (Cy, Ki, ry+)
X
+P? +P? ryP? XX + ry Y + ry Y + ry (not Cy, not Ki. If carrying
a jumped P, will be ry+)
X
Stain F2 for lacZLook for desired expression pattern
^
^
We want to look at enhancer traps that express in the ovaries.
The Ovariole
GermariumGermarium
The Ovariole
The Egg Chamber
Nurse Cells
Oocyte,follicle cells
Staining OvariesSchematic Summary
-Dissect ovaries out of abdomen in NaPO4 buffer (movie!).-Devitallinize with heptane-Fix ovaries and wash-Add X-GAL, the substrate for -galactosidase.-Wash when dark enough, and observe.
-We are using enhancer traps that express in-Follicle cells-Nurse cells and oocyte