Copyright is owned by the Author of the thesis. Permission is given for a copy to be downloaded by an individual for the purpose of research and private study only. The thesis may not be reproduced elsewhere without the permission of the Author.
Epidemiological Studies of Cryptosporidiosis
A thesis presented in partial fulfilment of the requirements for the degree of
Doctor of Philosophy
in Veterinary Pathology
Massey University, Palmerston North, New Zealand
Alejandro Grinberg
2009
i i
ABSTRACT
A. G rinberg (2009). Doctoral thesis, Massey U niversity, Palmerston North, New Zealand.
An i nterpretive overview of the l iterature on intest inal cryptosporidiosis i n humans and domestic
mammals (Chapter 1 ) is fol lowed by two studies of the popu latio n genetic structure of the
protozoan parasites Cryptosporidium parvum and Cryptosporidium hominis (Chapter 2 ), f ive
epidemiological studies of cryptosporidiosis in foals, calves and humans in New Zealand
(Chapter 3) , and an i nvestigation of a serendipitous outbreak of cryptosporidiosis among a class
of veterinary students, which occurred at the end of 2006 (Chapter 4 ) .
The analysis o f the popu lation genetic structure of C. parvum and C. hominis i nd icates the
existence of a s ign if icant genetic segregat ion of geograph ically separated parasite populations,
consistent with al lopatry. The resu lts do not conform to a simpl istic model that considers al l C.
parvum as multi -host anthropozoonotic agents, and provide statistical support to the idea of the
occurrence of anthroponotic cycles that do not involve cattle. Rather than conform ing to a r igid
parad igm of either a clonal or a pan m ictic species, data are consistent with the eo-occurrence of
clonal and recombinatorial diversif ication in C. hominis, and perhaps C. parvum.
The resu lts of the epidemiological studies in New Zealand suggest cryptosporidiosis caused by
C. parvum is relatively common i n young foals and calves . I n the ti me and space frames
underlying these studies, humans, calves, and foals were i nfected with a genetically
homogeneous C. parvum population . This feature is in accordance with previous reports that
have indicated C. parvum as the dominant species in humans duri ng the peaks of i ncidence of
cryptosporidiosis in winter and spring , and support the view that the peaks are i n large part
attributable to di rect and/or ind i rect zoonotic transmission of C. parvum.
Final ly, the outbreak of cryptosporidiosis among a class of veterinary students h igh l ighted the
potential hazard for explosive large-scale outbreaks in New Zealand. The results of the
investigation were consistent with point-source exposure and zoonotic transm ission of a rare C.
parvum subtype through di rect contact with calves during a practicum .
i i i
PREFACE
With the advent of HIV-AIDS and the re-emergence of the importance of i nfectious diseases at
the end of the 20 1h century, several microorganisms not previously known to cause d isease,
i ncluding members of the genus Cryptosporidium, were recogn ised as novel aetiolog ical agents
in humans and an i mals. In the i naugural issue of the journal Emerging Infectious Diseases i n
1 995, D r . David Satcher, Di rector of the US Centers for Disease Control and Prevention,
i ncluded Cryptosporidium i n a g roup of m icroorgan isms which i n h is opin ion were the "major
etio logic agents" identified since 1 973.
Cryptosporidium i s a genus of protozoan parasites first described in animals in 1 907. Despite
the early description of these parasites, cryptosporidiosis, that is, the disease caused by
members of the genus, was i n it ia l ly described in 1 97 1 i n a heifer and then in 1976 i n a 3-year
old g i rl from a farm, both in the US. The most com mon cl in ical presentation of cryptosporidiosis
in developed countries is of self- l i m it ing d iarrhoea! i l l ness. However, in H I V-positive or otherwise
immunocompromised patients, cryptosporidiosis may man ifest as a chronic debi l itat ing o r
fu lm inant disease. Conversely, i n many deve lopi ng reg ions o f the world the infections with
Cryptosporidium are associated with persistent ch i ldhood diarrhoea, h igh mortality,
m alnour ishment, and stunted g rowth.
Cryptosporidiosis is a notif iable d isease I n New Zealand. According to a recent Publ ic Health
Su rveillance Report, the rate of notifications of cryptosporidiosis in the tr imester October
December 2008 was of >2 cases per 1 0 ,000 population, s im i lar to the rate of salmonellosis and
g iardiasis over the same period (http://www.surv.esr.cr i . nz/PDF _survei llance/, accessed Apri l
200 9). I n add it ion to the endem ism of cryptosporidiosis, Cryptosporidium parasites pose a
s ign ificant hazard due to the resistance of the oocysts to chlorination and the potential to cause
-massive-water=borne-disease-outbreaks;-stJeh-as-the- epieemie--iA-Mi lwaltk.ee,--W-isc-e-AsiA-iA-
1 993 , when an estimate of 400,000 people acqui red an infection through the i ngestion of
contami nated mun icipal water supply. Thus, ensur ing preparedness against outbreaks of
cryptosporidiosis i s critical.
Many Cryptosporidium taxa can infect both humans and an imals, and infections in humans are
often acquired zoonotical ly, through di rect or i ndirect contact with the faeces of i nfected
an imals. Thus, understand ing the biology and epidemiology of cryptosporidiosis in different host
species is important, to both enhance the health of animals, and also to devise strategies for the
control of the zoonotic spread of the parasites.
Th is PhD thesis i ncludes an interpretive overview of the relevant l iterature , and accounts of
e ight epidem io log ical studies of Cryptosporidium i nfections i n humans and an imals undertaken
between 2002 and 2007 by the author. A s imple search in Medl ine between 1 995-2008 using
the keyword 'Cryptosporidium' returned 2343 citations. Therefore, the overview of the l i terature
iv
reports on ly those articles that in the author's view shaped the th ink ing i n each particular area;
h owever, further articles are cited in the sections for the individual studies. Six of the eight
studies have been publ ished i n peer-reviewed journals. To integrate the i ndividual studies i nto
the whole picture and avoid corrupti ng the publ ished manuscripts, each study is preceded by an
I ntroduction . Some successive studies have been published in d i fferent years. Thus, the
l iterature cited m ay differ between studies, main ly as a reflection of the progressive
accumulation of publ ications on the same topics. The published m anuscripts have been s l ightly
m od if ied. Modif icat ions included the addit ion of cross-references and m aterial and methods that
- for conciseness - could not be included in the published m anuscripts. In addition , the
bibl iography was re-formatted according to the requirements of the New Zealand Veterinary
Journal and the relevant raw data were included i n Appendices.
V
ACKNOWLEDGMENTS
I express my frank appreciation to m y supervisors Prof. Bi l l Pom roy, Dr . N icolas Lopez
Vi l la lobos , and Prof. G iovanni Widmer, for helping me to complete the studies and write this
thesis with enjoyment. I hope this has been a gratifyi ng endeavour for them too. I am grateful to
Prof. G rant Gui lford, former Head of IVABS, Prof. Kev in Stafford, D i rector of Post-graduate
Studies, Prof. Hugh Bla i r , Di rector of Research, and all staff at IVABS, for creating a su itable
research environment that faci l itated my work.
The names of friends and colleagues who he lped me to perform the studies have been i nc luded
in the l ist of authors of the relevant publ ished papers. P rof . Andy Tait, Wellcome Centre for
Mo lecu lar Parasito logy, Glasgow, Un ited Kingdom , generously donated the raw data used in
the study presented i n Section 2 . 1 . Prof. Anne Chao, N ational Tsing Hua Un iversity, Taiwan,
calculated the 95% confidence intervals of the Chao 1 and ACE1 richness esti mates in the same
study. The molecu lar characterisat ion of the Cryptosporidium isolates used in the study
presented in Section 2.2 was performed by Dr. Sultan Tanriverd i , Divis ion of Infectious
Diseases, Cummings School of Veter inary Medic ine, Tufts Un iversity, MA, USA. The studies
performed in Chapters 3 and 4 uti l ised several molecular methods developed over the years at
the Protozoa Research Un it, Massey Un iversity, Palmerston North , and compi led in the Manual
of Methods for Genotyping Cryptosporidium Oocysts from Faecal Specimens, written i n
November 2002 by M rs K im Ebbett. Mr. Errol Kwan, Anthony Pita and the late J im Learmonth
performed some laboratory analyses reported i n Sect ions 3 . 1 -3 .4 . Assistance in the laboratory
was also provided by Mr . Yi Shi, An i m al Health Monitori n g and Disease P revent ion Uni t , U rumqi
City, X inj iang, People's Republ ic of Ch ina , dur ing h is stay in New Zealand as a vis it ing scholar
under te author's supervision in 2007-2008 . Other peop le to whom I am very g rateful are Mr.
Graham Young , former bacterio log ist at Gribbles Diagnostic Laboratories, Ham ilton , Jan Bird ,
M icrobiology Section Leader of Path Lab Waikato , and Chris Pickett , Hamilton I'VIeCITCal
Laboratory, for provid ing Cryptosporidium-positive specimens from cattle and humans. Dr .
lsobel G ibson , New Zealand Veterinary Pathology Ltd . , kindly provided Cryptosporidium
positive specimens from foals. The sym pathetic New Zealand farmers who al lowed me to take
samples from anim als under thei r care and the veterinary students who provided faecal
specimens and responded to the questionnaires reported in Chapter 4 are also thanked. Final ly ,
I thank Prof. Sau l Tzipor i and the staff of the Divis ion of Infectious Diseases, Cumm ings School
of Veter inary Medicine, Tufts Un iversity, for hosti ng me for two months in 2008 .
The Lewis Filch Veterinary Research Fund, McGeorge Research Fund, G raham Chalmers Al ien
Memorial Veter inary Scholarsh ip and the New Zealand Min istry of Health provided funding for
the projects. Addit ional funding was obtained from unrelated professional consu ltancy
assignments over the years. The studies presented in Section 3 .4 and Chapter 4 have been
approved by the An imal and Human Eth ics Committees of Massey Un iversity.
vi
For my beloved wife, Vicky
v i i
not by bread alone does man survive Deuteronomy 8:3
vi i i
LIST OF CONTENTS
1 INTESTINAL CRYPTOSPORIDIOSIS IN HUMANS AND DOMESTIC MAMMALS:
AN INTERPRETIVE OVERVIEW
1 .1 Cryptosporidiosis in the historical perspective
1 .2 Impact of cryptosporidiosis on human and animal health
1 .3 The taxonomic classification of genus Cryptosporidium
1 .4 The life cycle of the intestinal Cryptosporidium parasites
1 .5 Pathogenesis of intestinal cryptosporidiosis
1 .6 Infections with Cryptosporidium in domestic mammals
1 .6 . 1 Infections with Cryptosporidium in cattle
1 .6 .2 Infections with Cryptosporidium in small ruminants
1 .6.3 Infections with Cryptosporidium in horses
1 .6.4 Infections with Cryptosporidium in cervids
1 .6 .5 I nfections with Cryptosporidium in dogs and cats
1 .6.6 I nfections with Cryptosporidium in pigs
1 .7 Genetic typing of Cryptosporidium
1 .8 Cryptosporidium parvum and C. hominis population genetic structure
1 .9 Zoonotic cryptosporidiosis
1 .1 0 Concluding remarks
1 . 1 1 R eferences
2 STUDIES OF THE POPULATION GENETIC STRUCTURE OF
CRYPTOSPORIDIUM PARVUM AND CRYPTOSPORIDIUM HOMINIS
2
4
8
1 2
1 3
1 3
1 7
1 9
20
2 1
22
23
24
25
3 1
3 1
STUDIES O F THE POPULATION GENETIC STRUCTUR E O F CRYPTOSPOR/0/UM PARVUM 51
AND CRYPTOSPOR/0/UM HOMIN/S
2 . 1 Host-shaped segregation of the Cryptosporidium parvum multilocus genotype repertoire 52
2 . 1 .1 Summary 52
2 . 1 .2 Intra uct1on --&2--
2 . 1 .3 Materials and methods 53
2.1 .4 Results 54
2 . 1 .5 Discussion 57
2.2 Inferences about the global population structure of Cryptosporidium parvum and 60
Cryptosporidium hominis
2.2 . 1 Summary 60
2.2.2 Introduction 60
2.2.3 Materials and methods 61
2.2 .4 Results 64
2 .2 .5 Discussion 70
2.3 Concluding remarks 72
2.4 References 73
ix
3 EPIDEMIOLOGICAL STUDIES OF CRYPTOSPORIDIOSIS IN DOMESTIC
ANIMALS IN NEW ZEALAND
EPIDEMIOLOGICAL STUDIES OF CRYPTOSPORID IOSIS I N DOMESTIC
AN I MALS IN N EW ZEALAND
79
3.1 Identification of Cryptosporidium parvum 'cattle' genotype from a severe outbreak of neonatal 80
foal diarrhoea
3.1 . 1 Summary 80
3 . 1 .2 Introduction 80
3.1 .3 Materials and Methods 8 1
3. 1 .4 Resu lts 83
3 . 1 .5 Discussion 85
3.2 Genetic diversity and zoonotic potential of Cryptosporidium parvum causing foal diarrhoea 87
3.2. 1 Summary 87
3.2.2 Introduction 87
3.2.3 Materials and Methods 88
3.2.4 Resu lts 90
3.2.5 Discussion 92
3.3 A study of neonatal cryptosporidiosis of foals in New Zealand 94
3.3 . 1 Summary 94
3.3.2 I ntroduction 94
3.3.3 Materials and Methods 95
3.3.4 Results 97
3.3 .5 Discussion 1 0 1
3.4 The occurrence of Cryptosporidium parvum, Campylobacter and Salmonella in newborn 1 03
calves in the Manawatu region of New Zealand
3.4. 1 Summary 1 03
3.4.2 I ntroduction 1 03
3.4.3 Materials and Methods 1 05
-- 3-44---Hes�Jits. 1 07
3.4.5 Discussion 1 08
3.5 Persistent dominance of two GP60 !la al leles in diarrhoeagenic Cryptosporidium parvum from 1 1 2
man and cattle in the Waikato region of New Zealand
3 .5 . 1 Summary 1 1 2
3.5.2 Introduction 1 1 2
3.5.3 Materials and Methods 1 13
3.5.4 Results 1 1 4
3 .5 .5 Discussion 1 1 6
3.6 Conclud ing remarks 1 1 7
3. 7 References 1 1 8
X
4 AN OUTBREAK OF CRYPTOSPORIDIOSIS AMONG A COHORT OF YOUNG
ADULTS: MOLECULAR AND DESCRIPTIVE EPIDEMIOLOGY AND RISK FACTOR
ANALYSIS
4 . 1 An outbreak of cryptosporidiosis among a cohort of young adults: molecular and descriptive 1 33
epidemiology and risk factor analysis
4. 1 Summary 1 33
4.2 I ntroduction 1 33
4.3 Materials and Methods 1 34
4.4 Results 1 37
4 .5 Discussion 1 43
4.6 References 1 46
5 GENERAL DISCUSSION 1 5 1
APPENDICES 1 56
x i
LIST OF TABLES
Table 2 .1 Distribution of C. parvum multi locus g enotypes ( MLGs) i n Scotland, stratified by reg ion (Aberdeenshire or Dumfriessh i re), and host species (human or bovine C. 56 parvum)
Table 2.2 Rarefaction, Chao 1 and ACE 1 r ichness est imators, by comparison 56
Table 2.3 C. parvum and C. hominis l i nkage disequi l ibriu m and double-banded genotype 70 stat ist ics accordi ng to country of orig in
Table 3.1 Restriction fragment length polymorphisms between C. parvum 'catt le' and 84 'human' genotypes
Table 3.2 S ing le nucleotide polymorphisms and deduced amino acid changes i n the 60-kDa g lycoprote in of C. parvum isolates from foals, as compared with the or ig inal 91 sequence reported by Strong et a l . (2000)
Table 3.3 B i locus sequence types (BLST) of foal , human , and bovi ne C.parvum in New 92 Zealand
Table 3.4 H aematology, biochemistry and venous blood gas results from a hospital ised 99 foal affected with cryptosporidiosis
Table 3.5 Prevalence of C. parvum and Campylobacter spp among newborn calves from 1 08 24 dai ry farms i n the Manawatu region of N ew Zealand
Table 4.1 Demographic characteristics of the o utbreak of cryptosporidiosis among a class 1 40 of veterinary students reported in Section 4. 1
Table 4.2 Risk factor analysis of the outbreak of cryptosporidiosis reported i n Section 4 . 1 1 43
x i i
LIST OF FIGURES
Figure 1 . 1 The intestina l and extraintestinal life cycle of C.parvum 1 1
Figure 1 .2 Least square means of the log10 of ( 1 +number of C. parvum oocyst per gram 1 7
of faeces) i n 20 newborn calves affected with cryptosporidosis in a dairy farm i n Israel
Figure 1 .3 Nucleotide polymorphisms (in yel low) between the 1 8S rRNA gene 20 sequences of the so cal led "horse genotype", C. parvum, and C. wrairi
Figure 1 .4 Upper g raph: The n um ber of cases of cryptosporidiosis notified in New Zealand between 1 997 and 2007 ; lower graph : the seasonal shifts between the number 28 of C. parvum and C. hominis isolates identified in New Zealand between 2000 and 2003
Figure 1 .5 Dendrogram showing "human only sub-groups" of C. parvum multilocus genotypes in Scotland, as reported by Mal lon et al. (20 03) (above) and sing le and double 30 locus variant networks (SDLVN) of the same multilocus genotytpes (be low)
Figure 2.1 Rarefaction curves, by comparison 57
Figure 2.2 Single locus variant eBU RST networks for C. parvum and C. hominis 66
Figure 2.3 C. parvum and C. hominis M LG rank abundance plots 67
Figure 2.4 C. parvum and C. hominis analytical rarefaction curves 68
Figure 3.1 Fused and atrophic duodenal vi l li (arrow) and mildly increased numbers of 84 mononuclear inflammatory cel ls within the lamina propria
Figure 3.2 PCR-restriction fragment length polymorphism analysis of Cryptosporidium !3- 8 5 tubu lin , poly T , R N R and COWP genes
Figure 3.3 Foals with cryptosporidiosis. 1 00
Figure 4.1 Duration of i l l ness (upper g raph) and distribution of symptoms ( lower graph) in the outbreak of cryptosporidiosis, as elicited from the responses to questionnaire 01 141
Figure 4.2 Epidemic curve of the outbreak of cryptosporidiosis as elicited by the 1 42 responses to 01
xiii
AIDS
BLST
bp
Cl
CIN
COWP
GP60
HAART
HIV
HSP70
lgA
lgG
I gM
IVABS
LATU
MLG
MU
OPG
PAS
PCR
poly T
RFLP
RNR
SIA
SNP
UPGMA
uv XLD
ZN
18S rRNA
LIST OF ABBREVIATIONS
acqu i red immu nodeficiency syndrome
Bi locus seq uence type
base-pairs
confidence interval/confidence l im it
cefsu lodin , i rg asan and novobiocin agar
Cryptosporidium oocyst wall protein
Cryptosporidium surface G P45/15 g lycoprotei n (or 60-kDA g lycoprote in)
High ly Active Antiretroviral Therapy
human i m munodeficiency v i rus
70 kDa Heat Shock Protei n gene
Immunoglobu l i n A
Immunoglobu l i n G
Im munoglobu l in M
Institute of Veterinary, An i m al and Biomedical Sciences
Large An imal Teaching Un i t
mu lti locus genotype
Massey U n iversity
oocysts per g ram of faeces
periodic acid-Schiff stain
polymerase chain react ion
polythreon i ne repeat
restriction frag ment length polymorph ism
ribonuclease reductase
standardized i ndex of association
s ingle nucleotide polymorphism
Unweighted Pair Group Method with Arithmetic mean
u ltra violet
Xylose Lys ine-dehoxycolate
Ziehl Neelsen
smal l subu nit 18S ribosomal RNA
xiv
CHAPTER 1
INTESTINAL CRYPTOSPORIDIOSIS IN HUMANS AND DOMESTIC
MAMMALS: AN INTERPRETIVE OVERVIEW
1.1 CRYPTOSPORIDIOSIS IN THE HISTORICAL PERSPECTIVE
Cryptosporidium is a genus of protozoan parasites of amphibians, f ish, repti les, birds,
m ammals, and humans, f i rst described by Ernest Edward Tyzzer (1875-1 965) i n 1907 (Tyzzer
1907). Using l ight microscopy, this eminent infectious disease researcher at Harvard Un iversity,
Massachussetts, observed coccidian- l ike parasites in the gastric and intestinal cells of m ice,
which he then named Cryptosporidium muris and Cryptosporidium parvum, respectively (Tyzzer
1910, 19 1 2) . He proposed the name Cryptosporidium (from Greek Kpum6c;, kryptos : h idden)
because sporocysts were not seen in the oocysts (Tyzzer 1 9 1 0).
Despite the early recognition of these new parasites by Tyzzer, the f i rst descript ion of the
disease cryptosporid iosis in any host was recorded about 60 years later in a calf (Panciera
1 971 ) , and later in a 3 year-old g i r l from a farm who had symptoms of abdominal pain and
d iarrhoea (N ime et al. 1976). Unti l the 1980s Cryptosporidium parasites were not considered to
be important pathogens in immunocompetent humans (B i rd and Sm ith 1980) , as
cryptosporidiosis was mostly seen in immunodeficient patients. This was due to the fact that
the diag nosis depended upon h istopathological examination of i ntestinal t issues, a procedure
that was performed only in the most severe cases ( Meisel et al. 1976). With the emergence of
the H IV-AIDS epidemic in the 1 980s, h istopatholog ical tests were required more f requently to
diagnose the disease in patients affected with A IDS (Casemore et al. 1984ab, 1985ab).
Eventually, s imple methods for the m icroscopic detection of the oocysts in faeces, for example
those based on the cold Ziehl Neelsen stai n i ng of faecal smears, were adopted by human
diag nostic laborator ies (Garcia et al. 1 983 ; asemore e a . ""9-s-4ab . nrere"Stingly; these-
methods were f i rst devised for the diagnosis of cryptosporidiosis in calves ( Poh lenz et al . 1978 ;
Henriksen and Pohlenz 1 981 ). The i ntroduct ion of such simple, non- i nvasive and cost effective
diagnostic procedu res allowed cryptosporidiosis to also be included in the differential d iagnosis
of infectious d iarrhoea in immunocompetent humans and in calves. Consequently, the rate of
identification of Cryptosporidium i ncreased, to eventually become one of the m ost common
agents identified from cases of diarrhoea in humans and calves in more than 1 00 countries
( reviewed by Fayer 2008).
The interest in Cryptosporidium research increased significantly after the realisation that these
parasites can cause explosive water-borne diarrhoea! d isease epidem ics. The Mi lwaukee,
Wisconsin, epidemic in 1993, in which more than 400,000 people are believed to have acqu i red
the agent from a s ingle dri nking water plant source ( MacKenzie et al. 1 994) , was a particular
event that focused the attention on Cryptosporidium. This, and other outbreaks, prompted the
Director of the US Centers for Disease Control and Prevention to include Cryptosporidium in the
l ist of agents defined by him as "major etiologic agents identif ied since 1973" (Satcher 1995) .
1 .2 1MPACT OF CRYPTOSPORIDIOSIS ON HUMAN AND ANIMAL HEALTH
The most common clin ical presentation of cryptosporidiosis in imm unocompetent patients in
developed cou ntries is of self- l imit ing d iarrhoea. Some exceptional cases of gastrointesti nal
i l lness lasting up to four months have been described (Hunter and N ichols 2002; Warren and
Guerrant 2008). Subcl in ical carriage of Cryptosporidium has been reported in humans (Siwi la
et al. 2007), and i m m u nocompetent ind ividuals can excrete oocysts i n the faeces for up to
seven weeks after infection (Steher-G reen et al. 1 987) . However, in H IV-AIDS or otherwise
immunocompromised patients cryptosporidiosis may be a chronic debi l itat ing , or even a
fulm inant d isease, and these patients might also suffer from extrai ntesti nal infections (Chappel l
and Okhuysen 2002 ; Hunter and Nichols 2002; Tzipori and Ward 2002; Huang et al. 2004).
Specific anti- Cryptosporidium treatments are not avai lable. Thus, cryptosporidosis was, u nt i l
recently, a major debi l itating disease and cause of mortality in H IV-positive patients.
Encourag ing ly, the recent i ntroduction of High ly Active Anti retroviral Therapy (HAART) protocols
decreased the incidence, severity and mortality of cryptosporidiosis as well as other
opportun istic infections in these patients ( Maggi et al. 2000; M iao et al . 2000; Pozio and
Morales 2005). However, the burden of cryptosporidiosis remains serious in immunosuppressed
patients in countries that cannot afford HAART (Tzipori and Widmer 2008) .
In many developing reg i ons of the world cryptosporid iosis is associated with persistent
childhood d iarrhoea, m alnourishment, stunted g rowth and high mortality (these aspects of
human cryptosporidiosis have been reviewed by Di l l ing ham et al. 2002, and Snel l ing et al.
2007). The reasons for the difference in the spectrum of severity of cryptosporidiosis between
developed and deve loping regions are not understood because mu ltifactorial epidemiological
comparisons between reg ions are lacking. The h igher prevalence of H IV-positive people in
some deve loping reg ions could i ncrease the overall r isk of chronic cryptosporidiosis as
compared with reg ions with lower H IV prevalence. For exam ple, 67/76 (88%) of
Cryptosporidium-posit ive children adm itted with chronic d iarrhoea to Mu lago hospital, Kampala,
Uganda, were H IV-positive (Tumwine et al. 2005). The cycle of m alnourishment leading to
immunosuppression cou ld also explain the difference in the spectrum of severity of
cryptosporidiosis between developing and developed regions. However , the effect of
malnou rishment is d ifficu lt to assess as recent observations in an imal models indicate that
malnou rishment might be an effect, rather than a cause of chronic cryptosporidiosis (Coutinho
et al. 2008). In one epidemiological study in Bangladesh , there was a significant d ifference in
the lgA and lgM levels in patients with persistent diarrhea caused by C. parvum, as compared
with those with acute diarrhea, which had g reater lgA and lgM levels. The authors hypothesised
2
that a d imin ished m ucosal lgA response may contribute to the persistence of the infections
( Khan et al. 2004).
A h igh incidence of Cryptosporidium superinfections, as expected in heavi ly contaminated
environments, can also provide a plausible explanation for the h igh rate of chronic i nfections
observed in some reg ions where hygiene is poor. I ndeed, as will be seen later in this overview,
Cryptosporidium may diversify by recombinatio n in the gastrointestinal tract of the host. I n
theory, superinfections with genetical ly heterogeneous parasites m ay faci l itate t h e emergence
of recombi nant parasites, which may differ antigen ically from their parental cel ls, a feature that
could enable the evasion of the imm une response of the host and enhance chronic infect ions.
The study presented in Section 2.2 explores the rate of recombinat ion in natural C. parvum and
C. hominis populations.
Stud ies addressing the deg ree of protection conferred by previous exposure against re-i nfection
with Cryptosporidium parasites in humans provided conflicting results. In one study with human
volunteers, Okhuysen and col leagues (1999) found a partial resistance to re-infection in
previously exposed persons. Conversely, in a different study, volunteers with pre-existing anti
Cryptosporidium antibodies shed less oocysts in the faeces than the seronegative, but on the
other hand manifested a more severe d isease (Chappel l et al. 1999). lt is plausible that the
immune response developed in the course of cryptosporidiosis is stronger against homologous
than hetero logous species , or genotypes. This idea has been recently corroborated by Sheoran
and colleagues (2008). These researchers showed that the immunity developed against C.
hominis provided on ly partia l protection agai nst subsequent C. parvum i nfection in the
gnotobiotic pig model. The effect of previous exposu re on the susceptibi l ity to C. parvum
infection wil l be further explored in the study reported in Chapter 4.
A wide range of Cryptosporidium taxa have been identified i n many host spec1es y
O'Donoghue 1 995 and Fayer 2008). However , so far a causative role in disease has been
establ ished on ly for C. parvum in calves and to a lesser extent lambs and kids, and perhaps for
Cryptosporidium andersoni i n juven ile and adu lt cattle.
Cryptosporidium parvum is an important causative agent of neonatal calf diarrhoea worldwide.
Causality in calves has been confi rmed by numerous observational studies, experimental
infections, and therapeutic trials ( Pohlenz et al. 1978; Tzipori et al. 1980b, 1983 ; Fayer and E l l is
1993 ; Naciri et a l . 1993, 1999 ; O'Handley et a l . 1 999; Castro-Hermida et al. 2002b; Gr inberg et
al. 2002; Sevinc et al. 2003). Sig n ificantly, resu lts of recent molecular epidemiolog ical studies
ind icated that Cryptosporidium bovis, which was described in 2005 (Fayer et al. 2005) , is also
widespread in young cattle (Fayer et al. 2007; Feng et al. 2007). The finding that C. bovis is
h ig hly prevalent i n cattle is of considerable public health relevance, as th is parasite, which is
phenotypical ly-s im i lar and thus, easi ly confused with C. parvum, has never been identif ierd from
3
cl in ically overt i nfections in cattle o r humans, and is therefore not considered either pathogenic
o r zoonotic.
Cryptosporidium andersoni i nfects the gastric glands of juven i le and adult cattle caus ing m i ld
lesions of an u ncertain pathogenic significance (see Section 1.6). lt produces oocysts different
from C. parvum in shape and s ize (Lindsay et al. 2000) , and has been reported o nce in
humans, in an H IV-positive person (Guyot et al. 2001 ).
1.3 THE TAXONOMIC CLASSIFICATION OF GENUS CRYPTOSPORID/UM
There is lack of consensus on what constitutes a Cryptosporidium taxon. Thus, in th is overview
the specific terms of 'species' or 'genotype' will be used for those taxa which in the author' s
opinion are widely accepted as such by the scientific com munity. Other Cryptosporidium genetic
variants wi l l be referred to by us ing the term 'taxon'. The term 'isolate' wil l be used to describe
any Cryptosporidium-positive faecal specimen f rom an individual human or an imal host, o r
genomic DNA extracted from such specimens.
Cryptosporidium a re intracel lu lar protozoan parasites that can be classified biological ly as either
intest inal (that is , parasites with a biological cycle that is completed in the cel ls of the i ntestinal
tract of the host) , or gastric (where the cycle is completed in the gastric cel ls) taxa. Some
authors have indicated that there is h igh phylogenetic relatedness between taxa with in each
g roup, regard less of the host-range (Xiao and Ryan 2008) . This h igh l ights the shortcom ings of
the nomenclature based on the host species i nst igated by Tyzzer when proposing the name C.
muris to the parasites he fou nd in m ice (Tyzzer 1910, 191 2) and widely used in the 1970s
(Barker and Carbonell 1974; Tzipori 1988). The sequencing of the genomes of C. parvum and
C. hominis, the major intest inal Cryptosporidium of man and animals, has been completed
(Abrahamsen et a l. 2004; Xu et al. 2004) , and that of the gastric C. muris is sti l l in progress.
major advance, as it will enable the genomic comparison
i ntestinal species (Tzipori and Widmer 2008).
Many opinion leaders endorse the taxonomy indicating Cryptosporidium as a genus with in the
Phylum Apicomplexa, Class Coccidea, Order Eucoccidiorida, Family Cryptosporidi idae (Tzipori
and Ward 2002 ; Fayer 2008). However, based on the nucleotide sequence of the small subunit
ribosomal RNA gene, Cryptosporidium and the G regarina appear to form a s ing le clade, which
is separated from the coccidia and the other members of the Phylum Apicomplexa (Carreno et
al. 1999). In agreement with the apparent phylogenetic separation of Cryptosporidium from the
coccidia, there are conspicuous phenotypic differences between these taxa, which had been
reviewed by Barta (2007). T hese are the epicel lu lar localization of Cryptosporidium with in the
cells, the apparent lack of a plastid, the endogenous sporulation , resistance to folate pathway
antimicrobials, and lack of susceptibi l ity to anticoccidial chemotherapeutic agents.
4
As said , in the 1970s the taxonomic nomenclature with in the genus Cryptosporidium was largely
based on the host-species from which the oocysts were recovered. However, as the oocysts of
many intestinal Cryptosporidium are m orphological ly sim i lar, and i n m any instances no host
specificity was observed, a l l i ntestinal cryptosporidium were subsequently considered to be long
to a s ing le species named C. parvum (Tzipori et a l . 1 980a). This view started to change in the
1 990s, when the fi rst papers report ing on the existence of genetic heterogeneity in C. parvum
were publ ished. Currently, the taxonomic classification within the genus Cryptosporidium is
main ly based on the genotype, rather than on phenotype.
The f i rst report of genetic heterogeneity in C. parvum isolates found in the literature was
published in 1 99 1 . The paper described a study performed using southern blot hybridization of
chromosomal restriction endonuclease digests (Ortega et al. 1991 ). The f i rst applicat ion of the
PCR techn ique to amplify Cryptosporidium gene sequences was publ ished in the same year
( Laxer et al. 1 991 ). This work demonstrated the feas ib i l ity of using the PCR technique for
Cryptosporidium research , which eventually resu lted i n the discovery of numerous g enetic
variants. The smal l subu n it ribosomal RNA (188 rR NA) gene sequence is currently the most
popular locus used for the taxonomic typ ing of Cryptosporidium isolates. I n 1996, Zamani et al.
(1996) ind icated that the 1 88 rRNA gene of C. parvum is present in one heterogeneous and
fou r identical copies in the genome. Heterogeneous copies of the 188 rRNA gene seem to
occur also in other Cryptosporidium taxa, such as Cryptosporidium felis (Xiao et al. 1 999). This
locus is particularly usefu l for taxonomic typ ing , as it comprises a species-specific reg ion. In
add ition , it is present in four identical copies in the genome of C. parvum and C. hominis, which
should - at least in theory - enhance PCR sensitiv ity (Pevsner 2003; R i ley 2004). Therefore, the
188 r R NA gene is usual ly among the f irst to be characterised when new Cryptosporidium
parasites are found, and Caccio and col leagues (2005) recommended the inclusion of th is gene
in an molecular identif ication scheme for Crvptosporidium. Other coding or non-coding genes,
such as the �-tubul in gene, the Cryptosporidium o ocyst wal l protein (COWP) gene, a
polythreonin repeat (poly T) , a thrombospondin-re lated protein , the ribonuclease reductase
( R N R ) gene and the so-called LI B13 marker, have also been used for taxonomic identif ication
purposes (Carraway et a l. 1 996, 1997; Peng et al. 1 997; Spano et al. 1998 ; Caccio et a l . 1999,
2000 , 2005 ; Tanriverdi et al . 2003) . I ntuit ively, sequences of taxonomically informative loci
should be conserved with in a taxon, but differ between taxa. The d ifferences between the taxa
can be revealed by means of restriction fragment length polymorphism analysis (RFLP) or
sequence analysis of the PCR ampl icons.
So far, evidence for recombi natio n between Cryptosporidium taxa in nature is lacking.
Therefore, the same combination of al leles at al l loci with taxonomic information content should
be present i n iso lates belonging to the same taxon. H owever, for m any Cryptosporidium taxa
the nucleotide sequences of many loci are sti l l u n known, and so identification schemes
performed using several taxonomic loci can lead to am biguous conclusions. For example , Elwin
5
and Chalmers recently reported on the f inding of Cryptosporidium isolates in sheep showing the
R FLP pattern of the 188 rRNA gene of C. bovis, and the COW P pattern of the Cryptosporidium
'cervi ne genotype' ( E iwin and Chalmers 2008}. The authors concluded that the isolates were
mixtures of both taxa , and that preferential PCR amplif ication of the C. bovis 188 r RNA gene
had occurred. In this author's view, such a conclusion is not supported as the COW P gene
sequence of C. bovis is not known.
D ifferent l ists of Cryptosporidium taxa have been published in recent years (X iao and R yan
2004 ; Fayer 2004; Fayer 2008; X iao and Fayer 2008}. However , it is apparent that the
taxonomy within genus Cryptosporidium is far from being resolved, and there is st i l l a long l ist of
genetic variants of uncertain taxonomic standing and bio logical s ign ificance. At the 61h Meet ing
on M olecu lar Epidemiology and Evolutionary Genetics of Infectious Diseases held in 2002, it
was concluded that the followi ng aspects should be described when suggest ing a new
Cryptosporidium species : ( 1 } , morphometric data on oocysts; (2} , a genetic characterisation of
the proposed species; (3}, demonstrate natural, and when feasible experimenta l , host
specificity; and (4) , com ply with I nternational Code for Zoological Nomenclature (Fayer 2008} .
Notwithstanding th is proposal there is sti l l uncertainty and confusion as to what constitutes a
valid Cryptosporidium taxon. Conf l ict ing l ists of "accepted", " recogn ised", or "val id
Cryptosporidum species" have been recently published by different authors (Snel l ing et a l .
2007 ; X iao and Feng 2008; Fayer 2008 ; Xiao and Fayer 2008} , and there are discrepancies
between the l ists suggested by the same authors in different papers. For example, in one
recent paper, the number of species was set at 16 "recorded species" (Snel l ing et al . 2007), and
in the same year other authors proposed 16 "val id" species and "over 30 genotypes" (Santi n
and Fayer 2007) . A year later, X iao and Feng (2008) i ndicated there are 1 6 "accepted"
Cryptosporidium species and "about 50 genotypes", but in another paper Xiao i nd icated the
number of "val id' species to be 1 8 , and that there are "over 40 genotypes" (Xiao and Fayer
2008}. Whi le in 2008, Fayer suggested the existence of 16 species and more
genotypes (Fayer 2008} , in another paper this author indicated 16 species and o n ly 11
genotypes (Xiao and Fayer 2008). Furthermore, the number of genetic variants and taxa
recogn ised cont inues to increase. For i nstance, most recently, Ryan et al. (2008} proposed the
new species name of C. fayeri (in honour of Fayer) for Cryptosporidium genetic variants isolated
from the red kangaroo (Macropus rufus), and in the same year, Fayer et al. proposed the
species name of C. ryanae ( in honour of Ryan) , as a new species name for the so-cal led
Cryptosporidium deer- l ike genotype (Fayer et al. 2008) .
Accord ing to Fayer , a genotype " is not a taxon", but rather a part ia l and temporary descriptor
(Fayer 2008}. In fact, the term 'genotype' has been used to acknowledge the uniqueness but
also the incomplete knowledge on the new variant. Occasional ly, new genotype names have
been designated based on l imited evidence. Such is the case of the Cryptosporidium 'horse
genotype'. This descriptor was proposed by Xiao and Feng (2008) and Fayer and Xiao (2008)
6
based on a previous report of a new, partial ( -4 70 base-pairs long) 1 8S rRNA gene sequence
identified in o ne i solate from a Przewalski 's wi ld horse ( Equus przewa/sk1) i n a zoo ( Ryan et al.
2003) . The gene sequence of the 'horse genotype' has never been identified again in any other
host, but nonetheless, it has been repeated ly clai med that horses are "wel l known to be i nfected
with the horse genotype" (X iao and Feng 2008; Fayer and Xiao 2008). The idea of the
occurrence of a 'horse genotype' is further d iscussed in Section 1 .5.4 and in the studies
reported in Sections 3.2 and 3 .3.
There are a number of objective reasons for the lack of a clear consensus of what constitutes a
Cryptosporidium taxon. First, i n many cases there is sti l l uncertaintly on how to d iscern between
the intra-taxo n and inter-taxon genetic variatio n (Fayer 2008) . Second, the requisite of a
biological species, which implies a natural population reproductively isolated from other
populat ions, is difficult to assess in Cryptosporidium. I ndeed, although in vitro Cryptosporidium
g rowth has been achieved (Current and H aynes 1984 ; H ijjawi et al . 2002, 2004) , systems
capable of yield ing high numbers of Cryptosporidium oocysts in vitro have not been been
developed. In addition, experimental animal m odels which support the g rowth of d ifferent
species are often lacking . Consequently, the only experimental unit for cross-breedi ng
experiments are the Cryptosporidum ' iso lates', which are composed of a f in ite number of
oocysts orig i nat ing from one, natural ly i nfected an imal. However, as wi l l be seen in the section
describ ing the Cryptosporidium l i fe cycle, the oocysts derived from an individual an imal cannot
be considered a single clone or strain , because they may represent m ixtures deriving from
assemblages of taxa infect ing the same host, recombinants, or perhaps even reproductively
separated l i neages of the same taxon (Xiao et al . 2004) . Unfortunately, the genetic identificat ion
using PCR-based gene ampl ification can not resolve such a complex genet ic m ake-up of the
isolates, due to the problem of PCR ampl ificatio n bias (Suzuki and Giovannoni 1996, Rochel le
et al . 2000). This is somewhat different to the s ituation with bacteria, in which a single cell can
be isolated and g rown and its progenies considered as a si ngle clonal l ineage. Thus, the i ntra
iso late genetic d iversity of Cryptosporidium is st i l l unknown , and th is l im its the possibi l ities to
meaningful ly interpret the results of genetic cross-breed ing studies using the isolates as the
operational taxonomic un it . Lastly, as in vivo passages are needed for the propagation of
Cryptosporidium, there is a g reat potential for cross contamination of the iso lates, which is
d iff icult to pred ict and monitor. Th is problem was wel l i l lustrated by the displacement of the
or ig i nal parasites of the widely used ' IOWA' C. parvum isolate with exogenous variants found i n
calves (Cam a e t al. 2006) .
Of the several Cryptosporidium taxa identified i n humans, C. parvum and C. hominis accou nt for
the majority of cases of cryptosporidiosis worldwide (reviewed by X iao 2007, and N ichols 2008) .
Notwithstanding the problems concerning the taxonomy of genus Cryptosporidium, the
differentiat ion of C. parvum and C. hominis i nto two different species seems to have reached a
consensus. The species name C. hominis was initially proposed by Morgan-R yan et al. (2002),
7
to differentiate the C. parvum ' human genotype' (synonym: 'type 1 ' o r 'genotype H') , which
cycles i n humans, from the C. parvum 'cattle genotype' (synonym : 'genotype C' , ' type 2' , or
'cattle'/'bovine' genotype), i nfecting both humans and animals. The new proposed nomenclature
preserved the species name of C. parvum to the 'cattle' genotype, whi le the new name of C.
hominis was g ive n to the 'human genotype'. The separation of these genotypes i nto two species
is consistent with the conspicuous genetic and epidemiological d ifferences exist ing between
these taxa, and the apparent absence of recombinant genotypes, which is consistent with two
reproductively isolated popu lat ions ( Spano et al. 1 998; Mclaughl in et a l . 2000) . The species
names of C. parvum and C. hominis wi l l therefore be used throughout th is thesis, except in the
study presented in Section 3.2, which reports the resu lts of a study performed in 2002, when the
old name of C. parvum 'catt le' genotype was sti l l widely use.
1 .4 THE LIFE CYCLE OF THE INTESTINAL CRYPTOSPOR/D/UM PARASITES
The present dissertation of the life cycle focuses on issues of genetic exchange and population
genetic structure of intestinal Cryptosporidium, as these are further explored i n the
epidem iolog ical study presented in Section 2 .2 .
The biological cycle of intest inal Cryptosporidium parasites was described before the d ifferent
species could be d ifferentiated based on the genotype. Except for some comparative notes
(Tzipori 1988; Fayer 2008) , authoritative descriptions of the cycle i n the different host species,
or of the different taxa, were not found i n the scientific l iteratu re. I n early descript ions of the life
cycle, the name C. parvum was used to describe the cycle of both C. parvum and C. hominis
(Tzipori and Gr iffiths 1 998; Tzipori and Ward 2002). I n a recent d issertation of the l ife cycle,
Fayer (2008) used the general descriptor of Cryptosporidium spp.
The entire biological cycle of i ntesti nal Cryptosporidium parasites is completed i n the intestinal
tract of the host, and cu lm inates with the excretion of sporu lated and fu l ly i nfectious oocysts in
the faeces (Figure 1 . 1 ). The oocysts are coated with a hard protective wal l and are h igh ly
resistant in the envi ronment ( Ranucci et al. 1 993; Spano et al. 1 997 ; reviewed by Fayer 2008).
The complex physical and chemical factors governing the decay in the i nfectivity of the excreted
oocysts have been widely studied in the laboratory, and their description is beyond the scope of
the present dissertat ion ( reviewed by Fayer 2008 and Peng et al. 2008). However, it is assu med
that some Cryptosporidium oocysts can remai n i nfectious for long periods of t ime, even in what
has been defined by Fayer as "harsh envi ronments" (Fayer 2008).
I nfections with Cryptosporidium are typically acqu i red through the i n gestion of oocysts in water,
food, or other i ngesta. Accord ing to some authors, the cycle m ay also commence by an
i nhalation of the oocysts (Tzipori 1 988; Fayer 2008). Each oocyst conta ins four haploid
sporozoites, which are the basic replicat ing Cryptosporidium cel ls. E ight chromosomes have
been described in C. parvum and C. hominis ( Blunt et al. 1997; Xu et a l . 2004). In the small
8
i ntestine, the sporozoites excyst a long a suture at one of the poles of the oocyst, and the free
sporozoites in fect the enterocytes. l t is thought that the i nvasion of the enterocytes is in itiated by
an adhesion of sporozoite surf ace lect ins to the intestinal m ucus fol lowed by an interact ion of
l igand surface proteins with receptors present on the surface of the enterocytes, and f inal ly, an
internalisat ion of the sporozoite ( Riggs et al . 1 997; Cevallos et al . 2000 ; Smith et al. 2005a;
Feng et al . 2006). As in other Apicomplexa, i t is bel ieved that the select ion of the host cel l , and
contact and penetration of the sporozoite to the cel l , i s mediated by structures and
m acromolecules p resent in an apical complex (reviewed by Borowski et al. 2008) .
Feng and eo-workers (2006) reported that b i le salts, which are normal ly present in the gut,
s ign ificantly enhanced the i n i t ia l i nvasion of cel ls by both C. parvum and C. hominis in vitro.
Once in the cel l , the sporozoite develops with in a parasitophorous vacuole located with in the
m icrovi l l i of the brush border. The cell membranes of the sporozoite and the enterocyte fuse at
the basal zone of the parasitophorous vacuole, forming the feeder organel le (Theodos et al .
1 998) , and the sporozoite g radual ly transforms into a trophozoite. Then, in a process referred to
as merogony (or schizogony) the trophozoite's nucleus undergoes mu ltiple asexual divis ions, to
form a mult inucleate meront (o r schizont) , which subsequently segregates into 6-8 uninucleate
merozoites. The mature merozoites bu rst f rom the meront and abandon the cel l , to infect new
epithelial cel ls , i n which they u ndergo a second round of merogony. Two types of meronts have
been described for C. parvum: Type 1 meront, which is composed of of 6-8 merozoites, and
Type 1 1 meront, with only fou r merozo ites. l t i s bel ieved that Type 11 meronts either differentiate
i nto an intracel lu lar microgamont, which releases several extracel lu lar haploid microgametes, or
into a macrogamont, which remains in the cel l. By a poorly understood process, the
m icrogamete penetrates f i rst the host's cel l and then the m acrogamont membranes, to ferti l ise
the macrogamont, with the formation of a d iploid zygote. Subsequently, the zygote undergoes a
reductional divis ion into two haploid progenies, which then divide again , conservatively, to
generate four haploid sporozoites, whi le at the same time the oocyst cell wall i s being formed. In
this process, cons idered by m any as a meiosis, chromosomal remodel ing by recombination m ay
occur if the gamonts are genetically-different, generat ing two pairs of progenies which differ
genetically from each parental gamete.
Whi le diversificat ion by recom bination has been documented in C. parvum in exper imental
infections (Tanriverdi et al. 2007) , the contribution of this process to the genetic diversification of
C. parvum and C. hominis in n ature is not well understood. According to the above cycle, each
oocyst may contain two pairs of genetical ly-heterogeneous sporozoites, which differ from the
parental cells due to recombination. Moreover, the Cryptosporidium iso lates, which are
composed of a f in ite number of oocysts recovered from a single host, m ay themselves be
composed of an assemblage of genetical ly-heterogeneous oocysts. With in-oocyst and between
oocyst heterogeneity are therefore the two possible sources of genetic variation with in
Cryptosporidium isolates. I nterestingly, these sources of variation are not usual ly taken i nto
9
accou nt, o r discussed in molecular epidemiological studies of cryptosporidiosis, in which
t raditional ly the operational taxonomic units of the analysis have been the 'isolates'. As said in
Section 1.3, the intra-isolate genetic variation is difficul t to assess using the PCR due to the
potential for preferential amplification of the templates ( Suzuki and Giovan noni 1996; Rochel le
et al. 2000). The genotyping of sing le oocysts, as recently reported (Hashimoto et al. 2006) ,
might in part address this problem, but cannot resolve the intra-oocyst genetic variation, which
requires the use of PCR-free sequencing technologies that are just now becoming accessible.
At the end of the cycle, a fu l ly infectious oocyst contai ning four naked sporozoites is released
from the cel l (Smith et al. 2005a). Some observations have suggested that Cryptosporidium
oocysts exist in two forms, a thin walled and a thick wal led variant (Current and Reese 1986;
Tzipori 1 988) , leadin g to the belief that the thin walled oocysts may excyst in the intestina l tract
of the same host causing autoinfections ( Ridley and O lsen 1991; Templeton et al. 2004). As
discussed in Section 1 .4, these autointections may provide a plausible explanation for the
occurrence of chronic i nfections in i m m unosuppressed i ndividuals (Current 1988 ; Di l lingham et
al. 2002).
10
small s<>orozoileslcysll
f
.. � Merozoite �
causing: Villous blunting,
mild Inflammation, prolonged diarrhea
and malnutrition
llmeron� nuclear divisions
4 merozmtes)
J M�metocyte (� � ·c::J v +
Macrogametocyte ® \
Figure 1 . 1 : The intestinal and extraintestinal life cycle of Cryptosporidium parvum. (source: Dillingham et
al. 2002). This figure will be incorporated in the thesis published online upon receipt of the copyright
permission from the publisher.
1 1
1.5 PATHOGENESIS OF INTESTINAL CRYPTOSPORIDIOSIS
I ntesti nal Cryptosporidium are obl igate i ntrace l lu lar parasites of the enterocytes. The i nvasion of
the cell is bel ieved to be i n it iated by an i nteraction between l igand macromolecu les on the
sporozoite's su rface and its apical complex and the surface of the enterocyte, fol lowed by the
i n ternalisat ion of the sporozoite . A number of putative l igands have been described in C.
parvum sporozoites ( reviewed by Tom ley and Soldati 2001, and Borowski et al. 2008) .
Antibodies d i rected agai nst some epitopes of these l igands were able to neutral ise C. parvum
i nfectivity both i n m ice and in vitro (R iggs et a l . 1 997, Tzipori and Ward 2002). One of the most
w idely studied C. parvum and C. hominis putative l igand prote in is the 60 kDA surface
g l ycoprotei n (Cevallos et al. 2000; Strong et al. 2000) , also known as the 'G P60' prote in . As
expected for a molecule under immunolog ical pressure , the gene encoding the GP60 is h igh ly
polymorph ic and comprises numerous non-synonymous polymorphisms (Strong et al . 2000) .
S uch a polymorphism reduces the appeal of the GP60 as a potential immun is ing agent, but on
the other hand enhances i ts usefu lness as an epidemiological marker. Chapters 2 and 3 of th is
thesis report epidemiological studies using subtyping of the G P60 gene.
Within the enterocyte, the sporozoite carves a niche in a un ique i ntracel lular but
extracytoplasmic location. Un l ike other apicomplexan organ isms, such as Toxoplasma,
Plasmodium, Eimeria and Cyclospora, which develop in the cytoplasm surrounded by a
parasitophorous vacuole, the Cryptosporidium sporozoite remains anchored to the host's cell
m embrane with in the remnant of the m icrovi l lus (Griffiths et al. 1 998) . it has been hypothesised
that in th is location it can develop whi lst protected from the host's cell cytoplasm , the immune
s ystem, and m any chemotherapeutics (Griff iths et al. 1998 ; Theodos et al. 1 998).
T he patholog ical changes induced by C. parvum and C. hominis vary in severity, but are fair ly
s im i lar in the various hosts. H istolog ically, using G iemsa stain the i nfect ing organisms can be
v isualised as small basoph i l ic bodies embedded in the m icrovi l l i . Other changes i nc lude the
p resence of blunt, fused i ntestinal vi l l i combi ned with m ucosal hyperplasia accompanied by a
variable i nflam matory response consist ing of lymphoid cel ls , macrophages, and neutroph i ls
inf i ltrat ing the lamina propria. The lesions are often found throughout the smal l i ntesti ne, but
can also appear in the large intestine. They tend to be more severe in the d istal jejunum and
i leum (Laurent et al. 1999; Tzipori and Ward 2002; Stewart and Penzhorn 2004). Hyperaemia
o f the affected segments and stunting and fus ion and/or cross bridg ing of the adjacent v i l l i are
often observed in calves, and have also been described in the horse (K im 1990).
I n H IV-positive patients, the morphologic changes seem to be correlated with the number of
o rganisms present in the t issues (Genta et al . 1 993). In immunocompetent hosts, i ntestinal
cryptosporidiosis is typical ly a self- l im it ing disease last ing a few days. The short duration is
g enerally presumed to be due to the mount ing of an im mune response, but perhaps also to the
biolog ical 'program ming' of a l im ited number of merogony cycles, as on ly two types of meronts
1 2
are known to exist (Tzipori 1 988) . However, as previously stated, it has been hypothesised
that the th in-walled oocysts excyst in the intest inal tract of the same host causing autoinfections.
Autoinfect ions have been impl icated as a leading cause of chronic debi litating cryptosporidiosis
i n malnourished chi ldren (D i l l i ngham et al. 2002) . While i n an imals, chronic C. parvum
i n fections have been experimentally produced in mice (Ungar et a l . 1 990 ; Perrym an and
Bjorneby 1 991 ) , in nature they have only been described in immunodefic ient Arabian horses
(Snyder et al. 1 978; Gibson et al. 1 983) .
The variabil ity in infectivity between different Cryptosporidium iso lates has been assessed in
h uman volu nteers (Okhuysen et al. 1 999) . However, the interpretation of the results of such
studies is difficult , because Cryptosporidium oocysts do not survive freez ing, and need to be
passed in vivo in order for thei r viabi l ity to be maintained. Such passages may modify the
genetic m akeup of the isolate due to cross-contam i nation with wild oocysts or even i nternal
recombinat ion , which are d ifficult to assess or mon itor.
1.6 INFECTIONS WITH CRYPTOSPORIDIUM IN DOMESTIC MAMMALS
1.6.1 Infections with Cryptosporidium in cattle ( 8os taurus)
The most prevalent Cryptosporidium taxa found in cattle are C. parvum, C. andersoni and C.
bovis. Other taxa, such as C. hominis (Smith et al. 2005b), the Cryptosporidium 'cervine'
genotype and the 'deer-l ike genotype' (Fayer et al. 2005, 2006; Trotz-Wi l l iams et a l . 2006 ; Feng
et al. 2007; Feltus et al. 2008) , C. suis and 'su is-l ike genotype' (Geurden et al. 2006), and C.
felis (Bornay L l inares et al. 1 999) , have on ly been reported sporadical ly in cattle, but their
i mpact on bovi ne health is unknown.
Cryptosporidium andersoni is a gastric species that infects the gastric epithel ial cells of juveni le
and mature cattle and causes m i ld di lat ion of the pyloric g lands, hypertrophy of the gastric
m ucosa, and th i n ni ng of the epithelial l i n ing , with little or no inf lammation (Oison et al. 1 997;
Kvac et al. 2008) . Animals infected with C. andersoni excrete oval oocysts 4x7 11m in d iameter
( Lindsay et al. 2000; Kvac et al. 2008) . Some authors postulated that infections with C.
andersoni m ay impair prote in d igestion and decrease productivity ( Esteban and Anderson
1 995) . C. andersoni is not considered zoonotic, although it has been isolated from one H IV
positive patient (Guyot et al. 2001 ) . No reports of C. andersoni i nfections in cattle in New
Zealand were retrieved in the scientific literature consulted.
Conversely, C. parvum and C. bovis are considered intestinal parasites producing
phenotypical ly s im ilar, round oocysts 4-6 11m i n d iameter (Fayer et al. 2005; Fayer 2008) . Whi le
C. parvum is a well-known pathogen of cattle, no reports of cl inical ly overt i nfections with C.
bovis were found in the scientific literature consu lted. However, it should be remembered that C.
bovis was on ly described for the f i rst t ime in 2005 and consequently, much of the information
about infections with this parasite is sti l l unknown.
1 3
The f i rst descript ion of an i nfection with Cryptosporidium in cattle dates from 1971 (Panciera et
a l . 1971 ) . A number of years later, the lesions in calves were described in more detai l (Morin et
al. 1976 ; Pohlenz et al. 1978) . At the begin ning of the 1980s, the aetiologic role of
Cryptosporidium as a frank pathogen of cattle was debated due to the frequent eo- infect ions
with other enteropathogen s and the m i ld h istopathological lesions found i n the course of
infections (deGraaf et al . 1999). I ndeed, Angus, f rom the Morendun Research I nstitute,
Scotland, argued that " lt seems probable that cryptosporid ial infections represent a ser ious
compl icat ion of virus-induced e nterit is, particu larly in you ng calves." (Angus 1983).
The first outbreak of calf d iarrhoea in which Cryptosporidium was identified as the sole agent
was published in 1980 (Tzipori et al. 1 980b). Although 85% of the calves were affected, no
mortality was recorded. Koch 's postulates were fulfi l led by Tzipori and eo-workers in 1983
(Tzipori et al. 1 983) . Final ly , in 1985, Upton and Current suggested the species name of C.
parvum as a descriptor for the parasites producing 'small oocysts ' , distinguish ing it from the
' large oocyst' type invading the gastric m ucosa of cattle and at that time known as C. muris, but
later re-classified as C. andersoni (Upton and Current 1985 ; L indsay et a l . 2000).
I n the years that fol lowed, the aetiologic role of Cryptosporidium was repeated ly corroborated by
the results of experimental infections, observational studies, and therapeutic tr ials (Moore and
Zeman 1991 ; Brenner et al . 1993 ; Fayer and El l is 1 993; Naciri et al . 1 993, 1999; Moore et al .
2003; Grinberg et al . 2002 ; Joachim et al. 2003 ; Sevinic et al. 2003). Currently, C. parvum i s
considered among the com monest aetio log ical agents of neonatal calf diarrhoea worldwide
(Oison et al. 2004; Fayer 2008). Conversely, the prevalence of C. parvum i n post-weaned,
juven i le , and adult cattle is low (Atwill et al . 1 999; Atwi ll and DasPerei ra 2003 ; Fayer et al. 2006 ;
Santin and Trout 2008; Santin et a l . 2004, 2008) . Moreover , because the oocysts of C. parvum
and C. bovis are morpholog ical ly s im i lar, it is l ikely that many parasites observed in the past i n
t h e faeces o f juven i le and adu lt cattle were C. bovis, rather than C. parvum. In recent years ,
studies us ing some form of genotyping indicated that C. parvum is the com monest
Cryptosporidium species of unweaned calves, while C. bovis is found at a greater prevalence i n
post weaned calves (Santin e t a l . 2004, 2008 ; Fayer et al. 2006; Geurden et a l . 2006).
I nfections with C. parvum in calves are typically acqui red perinatally. The prepatent period
ranges between 3 and 11 days (Anderson 1 981, 1982 ; Fayer et al. 1998 ; Uga et al. 2000 ;
G rinberg et a l . 2002). In u ncompl icated cases of cryptosporidiosis, the cl in ical presentat ion is
fair ly predictable and characterised by a profuse self- l im it ing diarrhoea! disease lasti ng a
number of days (O' Handley et al. 1999; Uga et al . 2000 ; Gr inberg et al. 2002) . I n additio n to C.
parvum, other v i ral, bacterial and parasitic pathogens, such as rotavi rus, enterotox igenic
Escherichia coli, and coronavirus, are prevalent in calves during the f i rst weeks of life . Some
authors believe that eo-infect ions with these agents increase the severity of cryptosporidiosis
14
(deGraaf et al . 1999; Olson et al. 2004) , but no epidemiological stud ies support ing th is v iew
were found i n the scientif ic l iterature consulted.
The faecal oocyst excret ion cu rve in calves is predictable and bell-shaped. I n general, i nfect ions
are perinatal and the oocysts reach detectable numbers i n the faeces 3-5 days post infection ,
concomitantly with the onset of d iarrhoea. Their numbers peak a few days later, then rapidly
decrease to undetectable levels (Anderson and Bulg in 1981; Fayer et al. 1998; Atwi l l et a l .
1999 ; Uga et al . 2000; Cast ro-Hermida et a l . 2002b; Gri nberg et al. 2002; Figure 1.2). Oocysts
numbers as h igh as 10 7 oocysts per g/m l (OPG) of faeces have been reported at the peak of
excretion ; d iarrhoea, if it occurs, is general ly concom itant with the shedding of oocysts (Fayer et
al. 1998; Uga et al. 2000; G rinberg et al. 2002; F igure 1.2).
In neonatal calf cryptosporidiosis rem ission general ly occu rs, and death rates seem to be very
low in wel l -m anaged farms (O'Handley et al. 1999 ; Uga et al. 2000; G ri nberg et al. 2002).
Consu latat ion of the scientific l iterature revealed only one report of h igh mortality in calves with
cryptosporidiosis in o ne farm (Sanford et al. 1982) . Evidence of differences in breed
susceptibi l ity to cryptosporidiosis is l im ited. Some opin ion leaders have suggested that "when
infection occurs in beef calves, it is usual ly more severe in these calves than in dai ry" (Oison et
al. 2004) , although neither supporting data or references are provided. The study in New
Zealand reported i n Sect ion 2.1, which was published i n 2005, suggests a possible effect of the
breed on the susceptib i l ity of calves to Cryptosporidium i nfections. In terestingly , a s im i lar effect
has been suggested by the results of a subsequent molecu lar epidemio log ical study i n the USA,
in which none of the Jersey cattle surveyed were found to be carrying C. parvum (Starkey et al .
2006).
Unl ike coccidian parasites , Cryptosporidium oocysts do not requ i re part icular environmental
conditions to become infectious, as they are excreted ful ly i nfectious in the faeces. Each
infected calf excretes hu ndreds of m i l l ions of oocysts during the patent period, readi ly
contaminati ng the farm environment with oocysts that are fai r ly resistant to phys ical and
chem ical inactivants (Gri nberg et al. 2002; reviewed by Fayer 2008) . As a resu lt,
cryptosporidiosis can become a permanent problem on farms with anecdotal evidence
suggest ing that clean i ng and chemical dis infection of the facilities provide little rel ief. I ndeed,
disease incidence r isks of up to 100% have been recorded in herds with year round calving
(Uga et al. 2000; G rinberg et al. 2002). The economic losses associated with calf
cryptosporidiosis are main ly due to the i ncreased labour needed to treat calves and the costs of
diagnostic test ing. Convalescent calves are believed to develop a protective immunity (Fayer
1998). I nteresting ly, chronic infections and stunt ing have not been recorded in calves, and there
appear to be no sign ificant studies providi ng evidence that cryptosporidiosis has a long-term
effect on performance as measured , for instance, by body weight at wean ing.
15
Since there is overwhelm ing evidence indicating a patent period of on ly a few days between the
f i rst and third week of l ife, purposive sampling of an imals of this age is needed in o rder to
assess the occurrence of C. parvum in catt le. In addit ion, the epidemiological term of
'prevalence' seems inappropriate to describe the rate of occu rrence of C. parvum i n cattle, as
the i nfections are short l ived. A more useful indicator m ig ht be farm-level prevalence, that is, the
number of infected farms in a reg ion , which can be measured by testing many calves between
the f i rst and th i rd week of life on farms, as in the study presented in Sectio n 3.4 .
Cross sectional studies of calf cryptosporidiosis i n different reg ions have shown a variable
prevalence of infected farms, and of calves with in farms (Genchi et al. 1 984; Harp and
Woodmansee 1 989 ; Garber et al . 1 994 ; Santin et al. 2004, Winkworth et al. 2008; Pau l et al.
2008, Coklin et al. 2007). A few long itudinal studies from overseas applying repeated sampl ing
on the same farms reported 1 00% farm- level prevalence (Castro-Hermida et al. 2002b ; Trotz
Wi l l iams et al. 2005). At the an imal- level , an infectio n i ncidence of 1 00% has been occasional ly
documented in longitud inal studies of calves on individual farms (Uga et a l . 2000 ; Gri nberg et al.
2002, Santin et al. 2008) , and there is a general bel ief that most calves acqu i re C. parvum
i nfections during the f i rst month of l ife. Th is idea m ig ht be tested by the applicat ion of repeated
sam pl ing of cohorts of calves on a s ign ificant number of farms, but such studies are labour
intensive and were not found in the scientific literature, so the cumu lative incidence of C.
parvum i nfections in calves is not known .
Some farm management characteristics have been evaluated as potential risk factors for
Cryptosporidium i nfections, with conflict ing results. For example, some studies reported g reater
farm-prevalence in dairy herds than in open range cow-calf beef un its (Oison et al. 1 997; Kvac
et al. 2006). Converse ly, in Tennessee (USA) , a g reater prevalence of cryptosporid iosis was
found in farms where calves were al lowed to nurse with dams (Qu igley et al. 1 994) , wh ich was
typical for open range cow-calf farms. In another study in the State of New York, a decreased
risk of infection was found in farms with artificial feed ing of calves (Moham med et al. 1 999). In a
study in Spain , calf m anagement practices had n o effect on the prevalence of C. parvum
i nfection (Castro-Hermida et al. 2002a) , but in anothe r study, a positive association between the
herd size and the farm- level prevalence of Cryptosporidium was found (Garber et al. 1 994).
Col lectively, these contrast ing resu lts indicate a complex m u ltifactorial epidem iology
compounded by regional factors.
Despite the wide variety of genetic variants of C. parvum found in nature, no studies com paring
the effects or the i nfectious dose of different var iants in cattle were found in the scientific
l iterature. In one study using exper imental infection , the duration of oocyst shedding was
associated with the chal lenge dose, with larger doses leading to longer du ration of the sheddi ng
of oocysts (Moore et al. 2003). lt should be emphasised that the view that C. parvum is the on ly
intestinal Cryptosporidium parasitising young cattle can no longer be un iversal ly appl ied, due to
1 6
the recent recognit ion of a wisdespread distribution of C. bovis in th is host species. P revious
est imates of the C. parvum prevalence should therefore be reassessed using genetic
identification tools. Such a reassessment is important, as C. bovis is phenotypically
indistingu ishable from C. parvum but has never been found in humans, which challenges the
idea that al l Cryptosporidum i nfecti ng young cattle are potential ly zoonotic.
Up u nt i l 2005, bovine cryptosporidiosis had on ly been occasionally reported in New Zealand. I n
a letter to the editor of the New Zealand Veterinary Journal , Townsend and Lance ( 1 987)
reported that 206 out of 550 (37%) calf diagnostic faecal specimens subm itted to the R uakura
Ani m al Health Laboratory from Ju ly t i l l December 1984 - 1 986 were positive for
Cryptosporidium, with the h ighest rate of infection seen in specimens f rom 4- 1 4 days o ld calves.
I n 2003, Learmonth et al. reported the occurrence of Cryptosporidium in 7% of faecal
specimens from cows (n=354) and calves (n=304) on 36 herds in the Waikato ( Learmonth et al.
2003) . However, the ages of the calves and the farm-level prevalence were not reported.
Sect ions 3.4 and 3.5 of this thesis reports two epidemiolog ical stud ies of Cryptosporidium i n
young cattle in New Zealand .
1 4-00 � � + &: 12 -00
Q .2 1 0-00
0 m 8-00 c <ll
� 6-00 m � <ll
4-00 :::J CT m 1ii 2-00 <ll Q)
....J
0
• Treated • Untreated
5 7 9 1 1 1 3 1 5
+ Observation day 1 8 21
Figure 1 .2. Least square means of the log1 0 (1 + number of C. parvum oocyst per gram of faeces) in 20
newborn calves affected with cryptosporidosis in a dairy farm in Israel. Red bars: 1 0 untreated calves;
green bars: 1 0 calves treated with paromomycin sulphate between Days 1 and 9 of life. OPG+ 1 = oocyst
per gram of faeces + 1 ; The calves' age in days are indicated on the X axis (from Grinberg et a l . 2002}.
This f igure will be i ncorporated in the thesis pubished on line upon receipt of the copyright permission from
the publishers.
1 .6.2 Infections with Cryptosporidium in small rumi nants
Knowledge about the pathogenesis of Cryptosporidium i nfections in lambs and kids is scarce,
and the impact of cryptosporidiosis on the health of smal l rum inants is not we l l def ined. In a
literature review, de Graaf suggested that C. parvum is an important pathogen of lambs and
17
kids (1999) , but no support ing data were provided. S imi larly, the public health s ign i f icance of the
i solates isolated from sheep and goats is not understood , as wide variat ion is reported in the
prevalence of potential ly zoonot ic taxa in these host species.
Cl in ically-overt Cryptosporidium i nfections in small ruminants were f i rst described in 1- 3 week
o ld lambs ( Barker and Carbonel l 1974) , and subsequently in a 2-week old kid with d iarrhoea
(Mason et al . 1981 ) . I nteresting ly, Koch's postu lates were fulfi l led in specific-pathogen-free
lambs using a calf isolate (Angus et al. 1982) . Although the natural h istory of cryptosporidiosis
in lambs and kids is not wel l u nderstood, i t appears to be sim i lar to the d isease observed in
calves. Documented c l in ical s igns i nclude d iarrhoea, depression and anorexia , accompanied by
the excret ion of faecal oocysts (Anderson 1982 ; Angus et al . 1982 ; Tzipori et al. 1982 ;
Thamsborg 1990 ; Ortega-Mora and Wright 1994) .
A variable prevalence of Cryptosporidium oocysts i n faecal specimens f rom sheep has been
reported in different studies, and were recently summarised by Santin and Trout (2008) .
However, there are confl ict ing reports about the genetic m akeup and zoonotic potential of the
Cryptosporidium parasites i nfect ing lambs and kids. In 1998, Morgan et al . reported on the
identification of C. parvum (the "calf g roup" in that paper) in a small number of goats and one
lamb (Morgan et al. 1998) . In a recent extensive molecular epidemiological study, C. parvum
was the only species identif ied i n 137 diarrhoeic lambs and 17 goat kids. Al l were under 21 days
of age, and located on 71 s heep and 7 goat farms in the north-eastern reg ion of Arag6n , Spain
(Quilez et al. 2008) . In support of this f inding , Muel ler- Doblies and colleagues (2008) reported
that C. parvum was the dom inant species isolated from d iarrhoeic lambs i n the United Ki ngdom ,
but C. bovis and the 'cerv ine genotype' were also identif ied i n some specim ens. By contrast, the
"cervine genotype" was the predominant genetic variant in a random sample of faecal
specimens from subcl i n ical ly i nfected lambs on ten farms in Belg ium, whi le on ly C. parvum was
identified in kids in the same region (Geurden et al. 2008). Conversely, Chalmers et al. reported
a novel 'sheep genotype' in subcl in ical ly i nfected lambs (Chalmers et al. 2002). In a recent
report, Pritchard and eo-workers reported on the identif ication of C. parvum in 43 out of 48
oocyst-positive faecal specimens from lambs subm itted to diagnostic laboratories in E ng land
and Wales for post morten examination ( Pritchard et al. 2008) . Other species sporadical ly
isolated from lambs were C. bovis (Pritchard et al. 2008) and C. hominis ( Ebeid et al. 2003;
Gi les et al. 2009). I nterest ing ly, preweaned lambs in Western Austral ia were recently found to
be infected with C. bovis (n = 52) , the 'cervine genotype' (n = 1 0) , and C. parvum (n = 2) when
a genetic identification scheme using the 18S rRNA gene was used for the identif icat ion.
However, when the same sam ple of faecal specimens was typed target ing a second locus (a C
type lectin-encoding gene which, accord ing to the authors, is C. parvum-specif ic) , 63 C. parvum
were identif ied (Yang et a l . 2008). lt is unclear how the authors could d ifferentiate between C.
bovis and C. parvum us ing the above C-type lectin-encoding gene, as the sequence of this
18
gene in C. bovis is sti l l unknown. Recently, Paoletti et al. (2009) identified C. parvum i n 26/26
PCR-positive faecal specimens from lambs on six farms in central Italy.
1.6.3 Infections with Cryptosporidium in horses
Equ ine cryptosporidiosis was f i rst reported in immunodeficient Arabian foals us ing m icroscopic
parasito logical methods, fol lowed by a few descriptions of overt infections also in
immunocompetent foals (Snyder et a l . 1978 ; G ibson et a l . 1983 ; Gajadhan et al. 1985 ; Coleman
et al. 1989). A num ber of surveys indicate subcl in ical Cryptosporidium i nfect ions are re latively
com mon in horses (Tzipori and Campbell 1 981; Netherwood et al. 1994 ; Xiao and Herd 1994 ;
Cole et al. 1998 ; Chalm ers et al. 2005). However, reports conf i rming the causative role of these
parasites in diarrhoea of horses are scant.
Early unsuccessfu l attempts to produce exper imental disease in foals using calf
Cryptosporidium isolates in the 1980s (Tzipori 1983) induced some authors to believe that
horses are infected with unique Cryptosporidium variants (Saul Tzipori , personal com mu nication
to the author from 2002) . This idea has been recently reiterated by other authors , who have
suggested the existence of a Cryptosporidium 'horse genotype' (see Section 1.3). However, the
Cryptosporidium ' horse genotype' has only been reported in one isolate from a Przewalski 's wild
horse ( Equus przewalskit) i n a zoo in the Czech Republic (Ryan et a l . 2003) .The orig ina l paper
reporti ng this novel genetic variant i ncluded a number of discrepancies. For instance, whi le it
was concluded that the isolate from the E. przewalskii was "most related" to Cryptosporidium
wrairi based on its 18S rRNA gene sequence, the dendrogram presented in the same paper
showed that the isolate clustered also with C. parvum ( Ryan et al. 2003). S imi larly, whi le it was
acknowledged that the 70 kDa heat shock protein gene of the isolate f rom the Przewalski's wild
horse was not determined (see Table 1 in Ryan et al. 2 003) , the authors concluded that a "h igh
degree of sequence identity" with C. wrairi was also at th is locus. In order to further investigate
these d iscrepancies , th is author retrieved the 18S rRNA gene sequence of the isolate f rom the
Przewalski's wild horse from Genbank, dubbed the 'horse genotype' by Xiao and Feng (2008) ,
and al igned it with the 18S rRNA gene sequence of C. parvum and C. wrairi publ ished in the
same database by R yan et al. The a l igned nucleotide sequence of C. parvum, C. wrairi, and the
isolate f rom the Przewalski's wild horse, are shown in Figure 1 .3. lt is notable that there is a
very smal l , s im i lar number of polymorphisms between the sequence of the 'horse genotype' and
C. parvum and C. wrairi, which is inconsistent with the idea that the former was mostly related to
C. wrairi.
The f i rst known outbreak of cryptosporid iosis in domestic foals i ncorporating cl in ical ,
epidemio log ical and pathological data, as wel l as the identification of the outbreak iso lates as C.
parvum 'cattle' genotype, is reported in Section 2.1 of this thesis. Fol low up studies are
reported in Sections 2.2 and 2.3.
19
C . p a r vum - - - - - - - - - - - - -T CGAT T C C G G AGAGGGAGCC TGAGAAAC G G CTACCACATC
C . w r a i r i - - - - - - - - - - - - TCGATT C C G G AGAGGGAGCC TGAGAAAC G G CTACCACATC
H o r s e G e n o t ype - - - - - - - - CGATT C C G G AGAGGGAGCC TGAGAAAC G G CTAC CACATC
C . p a r vum TAAGGAAGGC AGCAGGCGCG CAAATTACCC AATCCTAATA CAGGGAGGTA
C . w r a i r i TAAGGAAGGC AGCAGGCGCG CAAATTACCC AATCCTAATA CAGGGAGGTA
H o r s e G e n o t ype TAAGGAAGGC AGCAGGCGCG CAAATTACCC AATCCTAATA CAGGGAGGTA
C . p a r vum G T GACAAGAA ATAACAATAC AGGACTTTTT GGTTTT GTAA TTGGAATGAG
C . wr a i r i G T GACAAGAA ATAACAATAC AGGAC TTTTT GGTTTTGTAA TTGGAATGAG
H o r s e G e n o t ype G T GACAAGAA ATAACAATAC AGGAC TTTTT GGTTTTGTAA TTGGAATGAG
C . p a r vum TTAAGTATAA ACCCC TT TAC AAGTATCAAT TGGAGG GCAA GTCTGGTGCC
C . w r a i r i TTAAGTATAA AC C C C T T TAC AAGTATCAAT T G GAGGGCAA GTCTGGTGCC
H o r s e G e n o t ype TTAAGTATAA A C C C C T T TAC AAGTATCAAT TGGAGGGCAA GTCTGGTGCC
C . pa rvum GCAGCCGCG GTAATTC CAG CTC CAATAGC GTATATTAAA GTTGTTGCAG
C . wr a i r i AGCAGCCGCG GTAATT C CAG CTC CAATAGC GTATATTAAA GTTGTTGCAG
H o r s e G e n o t ype AGCAGCCGCG GTAATTC CAG CTC CAATAGC GTATATTAAA GTTGTTGCAG
C . p a r vum TTAAAAAGCT CGTAGTT GGA TTTCTG TTAA TAATTTATAT AAAATAT T T T
C . w r a i r i TTAAAAAGCT CGTAGTT GGA TTTCTGTTAA TAATTTATAT TAATATTTT
H o r s e G e n o t ype TTAAAAAGCT CGTAGTTGGA TTTCTGTTAA TAATTTATAT AAAATAT T TT
C . p a r vum G AJGAATATT TATATAATAT TAACATAATT CATATTACTA TATA TTT . A
C . w r a i r i GA . AAATATT TATATAATAT TAACATAATT CATATTAC TA ��TAT T TT T
H o r s e G e n o t ype GAAAAATATT TATATAATAT TAACATAATT CATAT TACT G A TA�TTT
C . p a r vum GTATATGAAA TTTTACTTTG AGAAAATTAG AGTGCT TAAA GCAGGCATAT
C . wr a i r i GTATATGAAA TTTTACTTTG AGAAAATTAG AGTGCT TAAA GCAGGCATAT
H o r s e G e n o t ype GTATATGAAA TTTTACTTTG AGAAAATTAG AGTGCT TAAA GCAGGCATAT
C . p a r vum G C C T T GAATA CTCCAGCATG GAATAATATT AAAGAT T T T T ATCTTTCTTA
C . w r a i r i G C C T T GAATA CT C CAGCATG GAATAATATT AAAGATTTTT ATCTTTCTTA
H o r s e G e n o t ype G C C T TGAATA CTCCAGCATG GAATAATATT AAAGATTTTT ATCTTTCTTA
C . p a r vum TTGGTT CTAA GATAAGAATA ATGAT TAATA GG GACAGTTG GGGGCA
C . w r a i r i T T G G TTCTAA GATAAGAATA ATGATTAATA G GGACAG TT G GGGGCA
H o r s e G e n o t ype T T G G TTCTAA GATAAGAATA ATGATTAATA G G . ACAG T T G GGGGCA
Figure 1 .3 N ucleotide polymorphisms (in yellow) between the 1 88 rRNA gene sequence of the so-called
'horse genotype' (Genbank accession number AY273770) , C. parvum (Genbank accession number
AF093490), and C. wrairi (Genbank accession number AF1 1 5378). The Cryptosporidium 'horse genotype'
gene sequence is reported in ful l , as originally reported in GenBank. For C. parvum and C. wrairi, only the
segments overlapping the 'horse genotype' sequence are reported.
1 .6.4 Infections with Cryptosporidium in cervids
Little is known about the epidem iology of Cryptosporidium infections in deer. Tzipori et al.
reported an outbreak of diarrhoea in young red deer associated with the presence of
Cryptosporidium oocysts in their faeces, and h istopathological lesions consistent with
cryptosporidiosis (Tzipori et al. 1 98 1 a} . I n 2002, a n 1 8S rRNA gene sequence o f a
Cryptosporidium 'deer genotype' (synonym 'cervi ne genotype') was reported i n deer (Genbank
accession number AY1 209 1 0) , without specifyi ng the species of deer (Xiao et al . 2002} . The
same genetic variant was later identified i n a number of host species (summarised by Santi n
and Fayer 2007) i ncluding humans (N ichols 2008) , and specifically, one person in New Zealand
(Learmonth et al. 2004} . I nterest ing ly, a Cryptosporidum "deer- l ike genotype" was also
20
described, but th is variant has on ly been reported in calves. The descriptor "deer- l ike" was
proposed to account for the s im ilarity between the 1 8S rRNA gene sequence of th is variant and
the above 'deer genotype'. Recently, the species name "Cryptosporidium ryanae" was
proposed for the Cryptosporidium "deer- l ike genotype" (Fayer et al. 2008}. The authors based
the assig nment of a species status to the Cryptosporidium "deer-like genotype" on the size of
the oocysts (which m easure 2.9-4 x 2.9-3.6 1-Jm and are thus smaller than C. parvum), and the
genetic d ifferences from other known Cryptosporidium taxa at multiple loci.
In an epidemiolog ical study of four farms in China, two out of 1 24 faecal specimens from farmed
sika deer (Cervus nippon Temminck) contained Cryptosporidium oocysts (Wang et al. 2008}.
The isolates were assigned to the 'cerv ine genotype' , although thei r 18S rRNA gene sequence
differed sl ightly from the publ ished sequence of th is genotype. Subcl in ical Cryptosporidium
i nfect ions in captive wh ite-tailed deer ( Odocoileus virginianus) have been reported ; the ocysts
recovered from the infected deer were infectious to neonatal mice and calves (Fayer et al .
1996). Asymptomatic sheddi ng of Cryptosporidium oocysts has been reported in I reland
(Skerrett and Holland 2001 ), but the oocysts have not been identified. Cryptosporidiosis i n
farmed deer calves has been reported in New Zealand (Orr et al. 1985). Although there is
anecdotal evidence of cryptosporidiosis being a sig nif icant clinical problem in young farmed
deer in New Zealand, no reports were found in the veterinary literature. Only one report of an
i nfection with a conf irmed C. parvum in a deer was found in the scientific literature, but the
species of deer was not specified (Sulai man et al . 1998).
1 .6.5 Infections with Cryptosporidium in dogs and cats
I n 1 979, lseki proposed the name Cryptosporidium felis as a descriptor for the parasites found
in cats in Japan (from Fayer 2008}. Later, Sargent et al. (1998) described a Cryptosporidium
"smal l oocyst type" i n subcl in ically infected cats, and complemented the phenotypic f indings
with genotyping, resu lt ing in the def in ition of a novel genotype in th is host species. The fi rst
paper suggesting C. felis as a genetical ly-distinct species was published in 1998 (Morgan et al.
1998). As noted i n Section 1 . 6. 1 , C. felis was also identified in one cow (Bornay Ll inares et al.
1 999}. Santin and colleagues recently found C. felis and C. muris in cats in Bogota, Colombia
(Sant in et al. 2006}. No other Cryptosporidium taxa are known to cycle i n fel ine popu lations. In a
literature review of 58 cases of human C. felis i nfect ion reported in different parts of the world ,
more than 80 % of cases occurred i n H IV-positive patients (Raccurt 2007).
The f i rst evidence of the cycl ing of Cryptosporidium parasites in dogs was provided by Tzipori
and Campbell (1981 } , who reported the presence of anti- Cryptosporidium antibodies i n 1 6/20
dogs. In 2000, Morgan and col leagues ( 2000) identified a novel Cryptosporidium variant in e ight
dogs from Austral ia and the US, which they dubbed the "dog genotype". This genotype was
elevated to the species status by Fayer et al. one year later ( Fayer et al. 2001 ).
21
Surveys aimed at assessing the prevalence of Cryptosporidium in canine and fel ine popu lat ions
have been performed in different countries, with contrasting resu lts (recently reviewed by Sant in
and Trout 2008) . In a recent study, C. canis and C. fe/is were the main variants found in
Australian dogs and cats, respectively ( Palmer et al. 2008). I n another survey in the USA
Cryptosporidium oocysts were found in 30/250 domestic cats and al l the successfu l ly
genotyped iso lates were ident if ied as C. felis based on the sequence of the 1 8S rRNA gene
( Bal lweber et al . 2009). As C. canis, C. felis and C. muris have on ly occasional ly been found in
humans, avai lable epidemiological evidence would preclude dogs and cats as s ign ificant
sources of zoonotic cryptosporidiosis in immunocompetent humans. However, the zoonotic
species C. parvum has been sporadically identified in dogs Italy (Giangaspero et al. 2006), the
USA ( Fayer et al. 2001 ) , and Czeck Republic (Hajdusek et a l . 2004). Furthemore, the zoonotic
potential of Cryptosporidium f rom cats has been suggested after one successful attem pt to
infect 6-weeks-old kittens by o ral inoculation of an isolate recovered from an immunodeficient
person (Current et al. 1 983) , and from one cat-to-human transmission event inferred in one
case of cryptosporidiosis i n a ch i ld fol lowing exposure to an i nfected cat ( Egger et a l . 1990). In
addition , X iao and colleagues reported an infection with C. canis i n one g i r l , her brother and dog
l iv ing i n L ima, Peru. Both chi ldren had diarrhea, but the dog was asymptomatic (Xiao et al.
2007). No data on the pathogenicity of Cryptosporidium parasites in dogs and cats were found
in the scientific l iterature.
1 .6.6 Infections w ith Cryptosporidium in pigs
Although both C. parvum and C. hominis have been propagated in pigs (Widmer et al . 2000;
Pereira 2002; Akiyoshi et al . 2003; Ebeid et al . 2003), knowledge about the prevalence and
genetic makeup of these parasites in farmed pigs is scarce. Cl in ical s igns of depression ,
diarrhoea and vom iting have been observed i n pig lets experimentally infected with oocysts
origi nat ing from calves (Tzipori et al. 1981 b). However, no clear association between i nfection
and disease is known to exist, as surveys have reported subcl in ical i nfections in pigs (Gusel le et
al. 2003, Qui lez et al. 1996).
In 2004, the species name of C. suis was suggested for a genetic variant found in pigs ( R yan , et
a l. 2004). Recently, a 22% infection rate with C. suis and the 'pig genotype 1 1 ' was reported in
289 p igs located i n four Western Austral ian faci l it ies (Johnson et al. 2008). Xiao and colleagues
(2008) found DNA sequences of C. suis, the 'pig genotype 1 1 ' , and C. muris, i n 25 out of 56 pig
slurry samples f rom 33 I rish farms. The Cryptosporidium 'pig genotype 1 1 ' was found in 33/33
pigs from one faci l ity in Canada (Guselle et al. 2003). Because the most common
Cryptosporidium taxa found in pigs were on ly occas ional ly found in humans, some authors
hypothesised that "domestic pigs do not pose a sign ificant public health risk" (Johnson et al.
2008). However , the zoonotic C. parvum has also been identified in the Czech Republic (Kvac
et al. 2008) . Furthermore, p ig lets cou ld be experimental ly i nfected using isolates from calves
(presumably C. parvum) (Tzipori et al. 1981 b), suggesting there is no biological restriction for
22
the cycl ing of zoonotic C. parvum i n pigs. No data about the pathogen icity of Cryptosporidium
taxa occurring in pigs was found in the consu lted l iteratu re.
1.7 GENETIC TYPING OF CRYPTOSPORID/UM
Despite the recent i mprovements of in vitro cult ivation (H ijjawi et al. 2002, 2004) ,
Cryptosporidium are st i l l hard to g row in vitro and thei r propagation depends on animal
inocu lation. Therefo re, disease diagnosis depends on the di rect detection of the oocysts or
antigens in the faeces by microscopic techniques, or commercial kits, rather than the isolation of
the agent. Because the oocysts of many i ntesti nal Cryptosporidium are s im i lar , and the
phenotypic identif icatio n of the taxon of an isolate is not feasible, the generic term of
cryptosporidiosis is commonly used in diagnostic practice. Fortunately, the genetic typabi lity of
isolates does not seem to be severely compromised if faeces are refrigerated , either with or
without preservatives, which has enabled retrospective molecu lar epidemiological studies to be
performed using extracted DNA from such faeces.
Although Cryptosporidium taxa are genetical ly s im i lar , m any polymorphic genetic loci , which can
be used for the typi ng of cl in ical or environmental parasites, exist. As stated above, the f i rst
genetic polymorph isms between Cryptosporidium isolates were detected in the early 1 990s
(Ortega et al. 1991 ). Later, techn iques involv ing the PCR am plification of genes fol lowed by
either an analysis for the presence of restriction f rag ment length polymorphisms ( RFLP) , or
sequencing of the amplicons, were developed (Bonnin et al. 1 996 ; Leng et a l . 1996; Carraway
et al. 1997). The h igh reproducibi l ity and cost effectiveness of the PCR enabled the extensive
use of molecu lar tools i n epidem iolog ical surveys, which resu lted i n the identification of a long
l ist of Cryptosporidium taxa.
The f i rst step of any genetic characterisation of a Cryptosporidium iso late is its ass ignment to a
taxon. Genetic loci that are h igh ly conserved with in taxa, but on the other hand sufficiently
polymorphic to allow differentiation between taxa, are used for this purpose. As stated above,
Caccio and colleagues (2005) recommended the use of the 188 rRNA gene for all genetic
identification schem es for Cryptosporidium. The advantages of us ing this gene for taxonomic
purposes have been described in Section 1 .3 .
Once an isolate has been assigned to a taxon, genotyping beyond this level is not necessary
un less further specific detai ls are requ i red. Conversely, if a differentiat ion between genetic
variants with in the same taxon is needed (for instance, to infer transmission routes or sources of
infect ions) , further subgenotyping (synonym : subtyping) at loci that are polymorphic within the
taxa, such as m icro and minisatel l ite repeats, is requi red. Micro and m in isatell ite repeats are
sequence repeats of variable length found throughout the genomes of eukaryotes. They are
usual ly composed of a variable num ber of repeats of 1 -6 basepairs (microsatel l ites) or 10-500
basepai rs (minisatel l i tes) (Pevsner 2003). M icro and m inisatell ite sequences may exhibit length
23
polymorph isms due to either loss or gain of repeat un its, presumably due to sl ippage during
DNA repl ication (Jeffreys et a l. 1985). As a resu lt, alleles of different s izes can often be
observed i n eukaryotic organisms at m in i and m icrosatel l ite loci, enabl ing the identification of
unique genetic f ingerprints. These loci are advantageous for epidemiological i nference, thanks
to their h igh degree of polymorphism.
M icrosatel l ite and m in isate l l ite length polymorphism analysis was fi rst used for subtyping of
Cryptosporidium i n the early 2000s (Feng et al. 2000 ; Caccio et al. 200 1 ). Because the
genomes of C. parvum and C. hominis iso lates have now been sequenced (Abrahamsen et al.
2004; Xu et al. 2004} , it is poss ible to exam i ne the genomic databases of these species for the
presence of repeat sequences that are l ikely to show polymorph isms. The 70 kDa heat-shock
protein (HSP70) gene of C. parvum and C. hominis contains such a polymorphic repeat
(Khramtsov et al. 1995; Mallon et al. 2003}. Another usefu l polymorph ic protei n-coding repeat is
the polyser ine repeat reg ion of the Cryptosporidium 60 kDA surface g lycoprotein gene. This
gene codes a 60 kDa precursor protein that is cleaved i nto two sub-u nits, G P15 and G P40, and
so it is also known as the 'G P60', 'G P40/15' , o r 'G P45/15' gene (Ceval los et al. 2000 ; Strong
et al. 2000).
Both s ing le- locus and mu lt i - locus subtypi ng schemes have been used for the subtyp ing of
Cryptosporidium. The s ing le l ocus subtyping approach i nvolves the characterisation of each
isolate at a sing le polymorphic locus, whereas multi locus subtyping schemes use two or more
loci. The s ing le locus approach is useful for source tracking studies, and is advantageous, as
compared with mu lti locus subtyping schemes, due to its s implicity. Indeed, a big disadvantage
of the multi locus approach is that fai lure to characterise an isolate at all the loci could preclude it
from the analysis. On the other hand, the mu lt i locus approach is, i ntu itively, more discrim inatory
than any of the corresponding single locus schemes. In add ition , as C. parvum and C. hominis
undergo sexual recombinat ion within the species as part of their l ife cycle (Tanriverdi et al.
2007} , s ing le-locus subtyping schemes are l im ited in their abi l ity to capture phylogenetic
relations between isolates.
1 .8 CRYPTOSPOR/DIUM PA R VUM AND C. HOMINIS POPULATION G ENETIC STRUCTURE
The genetic structures of local C. parvum and C. hominis populations have been studied i n
several locations using s ing le o r multiple genetic markers. Observations based on s ing le loci
(Peng et al. 1997; Widmer et al. 1998 ; Caccio et al. 200 1 ) contributed to the proposal of
elevat ing the genetically-distinct, anthroponotically transmitted C. parvum "human genotype" to
a new species, which was named C. hominis ( Morgan-Ryan et al. 2002}.
Due to its extensive sequence polymorphism , the G P60 gene has been widely used for studying
C. parvum and C. hominis populations ( Leav et al . 2002; Alves et al. 2003, 2006; Sulaiman et
al. 2005 ; Akiyosh i et al. 2006; Misic and Abe 2006; Xiao et al . 2006, Waldro n et al. 2009} . Th is
24
appoach has led to the identification of what has been designated as Cryptosporidium G P60
"subtypes", or "fam i l ies" (Sulaiman et al. 2005). Mu lt i locus subtyping schemes us ing un l inked
loci (that is, loci that do not eo-segregate duri ng the meiotic process) are amenable to the study
of the population genetic structure using al lel le l i nkage disequi l ibriu m analysis , which is not
possible using the s ing le locus approach. Such schemes have been applied to the study of C.
parvum and C. hominis populat ions in Scotland ( Mal lon et al. 2003) , India (Gatei et a l . 2007a,b) ,
and the Middle East (Tanriverdi et a l . 2006). However, l ittle is known about the population
structure of C. parvum and C. hominis on a g lobal scale.
Five molecular epidem iological studies of Cryptosporidium using s ing le or mu lt i locus subtyping
approaches are reported in Chapters 2 -4 of th is thesis.
1 .9 ZOONOTIC CRYPTOSPORIDIOSIS
As stated above, in the 1 980s, intest inal Cryptosporidium parasites were sti l l considered to be a
s ingle species known as C. parvum (Tzipori et al. 1980a) , and cryptosporidiosis was mainly
considered a zoonotic disease (Schultz 1 983). However, at about the same time, the
observation of human -to-human transmission events i nd icated a more complex epidem iology
for human cyptosporidiosis (Casemore and Jackson 1984) . Final ly, i n 1998, Awad-ei-Kariem
used isoenzyme e lectrophoresis to demonstrate the existence of genetical ly d istinct "human
and an imal populations of C. parvum", a pattern later repeatedly confi rmed genotypical ly us ing
PC R , and eventual ly substantiated by the dist inction into the species of C. parvum and C.
hominis.
Since then , seven Cryptosporidium species and a n umber of other taxa have been identified in
hum ans. Of these, C. hominis and C. parvum account for the vast majority of infections in
im munocompetent and immunocompromised people, and other taxa have on ly been found
sporadically, mainly in immunocompromised individuals. The taxa sporad ically i nfecting humans
have been repeatedly reviewed and are C. meleagridis, which infects mainly avian species, C.
canis, found i n dogs, C. fe/is, found in cats, C. muris, found in rodents , the Cryptosporidium
'cervi ne genotype' , or iginal ly found in deer but also from sheep and cattle, the Cryptosporidium
suis- l ike genotype, Cryptosporidium andersoni and the andersoni-l ike genotype, the 'ch ipmunk
genotype' , the 'skunk genotype' and Cryptosporidium 'monkey genotype' (Xiao and Fayer 2008 ;
Nichols 2008 ; Xiao and Ryan 2008) , and most recently the Cryptosporidium 'rabbit genotype'
(Chalmers et al. 2009). Xiao and Fayer (2008) argued that, as the rare genetic variants found in
humans were identified from m icroscopically-positive faecal specimens from clin ical ly-affected
individuals, they reflect active i nfections rather than a passive transit of oocysts i n the
gastrointestinal tract.
Although C. hominis is believed to cycle primari ly among hum ans, it has also been reported in a
dugong (Dugong dugon) ( Morgan-Ryan et al. 2002) , in non-human primates (Akiyoshi et al.
25
2003) , cattle (Smith et al. 2005b) , lambs (G i les et al . 2009), and one goat (Gi les et al. 2009). I n
addition , C. hominis was propagated in g notobiotic and conventionally reared piglets (Widmer et
al. 2000; Ebeid et al. 2003) , one lamb (G i les et al. 200 1 ) and Mongol ian gerbi ls (Meriones
unguiculatus) (Baishanbo et al . 2005) .
Conversely, C. parvum cycles in hum ans and other anim als, in part icular young cattle, and it is
considered potential ly zoonotic. There are reports of C. parvum infections in a wide spectrum of
mammalian hosts, including horses. However, most studies have been based on m icroscopy,
with no genetic characterisation of the isolates, and basically, the host-range of C. parvum is
sti l l unresolved.
Thus far, natural infections with C. parvum in animals have been conf i rmed by means of
molecu lar too ls in rum inants (cattle, sheep, goats, s ika deer) , pigs, dogs (see Section 1 .5 ) , two
pet leopard geckos ( Eublepharis macularius) (Pedraza-D iaz et a l . 2009), and tortoises (one
Testudo graeca and two Testudo hermannt) (Traversa et al . 2009). However, it should be noted
that the genetic identificat ion in the tortoises was performed by sequence analysis of the COWP
gene, and the makeup of this gene in many Cryptosporidium taxa is unknown. The studies
presented in Sections 2.1 and 2.3 of this thesis are the fi rst known reports reports of c l in ical ly
overt infectio ns with C. parvum in horses.
The majority of reports of C. parvum i nfections in an imals concern cattle. Whi le there is a large
amount of evidence indicati ng C. parvum is the most prevalent species in pre-weaned calves, it
has rare ly been found in post-weaned calves. Conversely, the prevalence of C. bovis and C.
andersoni, which seem to have little zoonotic significance, tends to increase in post-weaned
and juven i le cattle (Sant in et al. 2004 ; Fayer et al. 2006; Sant in et a l. 2008). lt is widely
accepted that young calves are mainly infected with C. parvum, and that these animals are a
major source of zoonotic C. parvum. The possibi l i ty of a di rect zoon otic transm ission of C.
parvum from cattle is supported by the resu lts of transm ission studies in human vol unteers
using bovine isolates, and from numerous case and case-control studies i n people in several
countries, i ncluding New Zealand ( Pohjola et al. 1 986; Reif et al. 1 989; M i l lard et al. 1 994;
DuPont et al. 1 995; Chappel and Okhuysen 200 1 ; Stefanog iannis et a l . 2001 ) . However, the
relative contribution of the oocysts or ig inating from cattle as a source of human
cryptosporid iosis is diff icu lt to assess, as human-to-human and bovine-to-human transm issions
can eo-occur. Perhaps the most convinci ng data support ing a wide zoonotic transm ission
through the contamination of the ecosystem with bovine C. parvum oocysts was the sharp
decrease in the number of notifications of h uman cryptosporidiosis in E ngland and Wales during
the 200 1 foot and mouth disease epidemic. This decrease has been attributed to the restrict ions
on human m ovement i n ru ral areas and the extensive cul l ing of animals imposed dur ing the
epidemic , which reduced human exposure to livestock (Smerdon 2003 ; Sopwith et al . 2005) .
Interest ingly , further epidemiological evidence support ing the widespread zoonotic transm ission
26
of C. parvum origi nated from New Zealand. Here, human i nfections with C. parvum fol low a
seasonal pattern, with the number of notifications peaking every year in sprin g and early
summer, soon after the calving season. Using faecal speci mens submitted to diag nostic
laboratories, Learmonth et al. (2003, 2004, 2005) elegantly showed that this peak is
accompanied by a virtual substitution of the anthroponotic C. hominis, which is seen year round,
wi th the potent ial ly zoonotic C. parvum (F igure 1.4) . Thus, it is possible that the synch ronous
presence of m i l l ions of h igh ly susceptible newborn calves determines a massive amplification of
C. parvum, contributing to the cattle-to human transm ission of cryptosporidiosis at that time.
Unt i l recently, a h igh prevalence of C. parvum i nfections i n humans i n a given reg ion , as
compared to C. hominis, was general ly viewed as evidence of a widespread zoonotic
transmission of cryptosporidiosis i n the reg ion (Mclaug h l in et al. 2000; Learmonth et al. 2003,
2004, 2005 ; Hunter and Thompson 2005). However, some researchers rejected th is view, and
suggested a more complex m odel, which contemplates the existence of anthroponotic C.
parvum parasites that do not cycle in cattle (Mal lon et al . 2003; Xiao et al. 2004). This concept
is of considerable public health i nterest, as it i m plies that any barrier across the livestock
human interface would be ineffective in reg ions where anthroponotic C. parvum cycl ing prevai ls.
The anthroponotic model of transmission of C. parvum is supported by two l i nes of evidence.
One l ine, proposed by Xiao et al. i n a review of the l iterature (2004) , is based on the observation
of C. parvum isolates from humans carrying the G P60 al lele fami ly " le " (now nominated " lie"
fol lowing the acceptance of C. parvum and C. hominis as different species) , which were never
found in cattle. According to this argument, C. parvum carryi ng lie G P60 alleles are
anthroponotic and do not cycle in cattle. However , the literature support ing this model reveals a
more complex picture.
27
300
250
200
150
lOO
50 \. \ � 0 t.�l I ! I I 1 1 I I I ! I I ! I I I! I 1 1 1 1 1 1 1 I l l \ I I l l I I l l I I l l ! 1 1 1 1 1 1 I l l I f I! I l l ! I I 1 1 I I ! I I l l 1 1 I ! ��� 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 I I I l l I I l l I ! I I I I! I l l I 1 1 1 1 1 1 1
L-t 997__L_ 1 99&--L- ! 99�200�200 1__L_200�200�200�200s--L-200&--L-2007_J Month I Year
i 0 .!!! '0 ... .! e ::J
z
40
35
30
25
20
1
1 0
5
0
Oat.e
o C. patvum l>ot�lne • C. homtnls
Figure 1 .4 Upper graph : The number of cases of cryptosporid iosis notified in New Zealand between 1 997
and 2007 (from: New Zealand Public Health Surveillance Report, Institute of Environmental Science and
Research Ltd. http://www.nzpho.org.nz/NotifiableDisease.aspx, accessed October 2008); lower graph: the
seasonal sh ifts between the number of C. parvum and C. hominis isolates identified in New Zealand
between 2000 and 2003 (from : Learmonth et al . 2004). These figures will be incorporated in the thesis
publ ished on l ine upon receipt of the copyright permission from the publishers.
While it is indeed accurate that /le al leles have been identified on a number of occasions in
human C. parvum i n some geograph ical reg ions (Leav et al. 2002; Alves et al. 2003, 2006; Xiao
et al. 2004b; Gatei et al. 2007b; Waldron et al . 2009) , thei r absence in the respective cattle
populations could not be ru led out, as on ly a few or no bovine isolates from these regions were
subtyped in the same studies. Moreover, most human C. parvum isolates carrying G P60 /le
alleles or ig inated from H IV-positive pat ients, and so the general isatio n to the population as a
whole, is difficu lt. lt shou ld be also remembered that C. parvum is a genetically superdiverse
species consist ing of a large number of rare genetic variants (Mal lon et al. 2003) and so a
significant sampl ing effort would be needed in order to declare the bovine population as being
f ree of the rare C. parvum GP60 /le allele family.
28
A different l ine of evidence support ing the existence of anthroponotic C. parvum was provided
by Mallon and eo-workers (2003) . These authors subtyped C. parvum iso lates from humans and
cattle in Scotland at seven polymorphic loci, and by doing so were able to def ine the mu lt i locus
genotype of each isolate. Then, the authors generated a pairwise genetic d istance m atrix of
seven possible values ( 1 -to-6 loci difference) between the multi locus genotypes, which was
used to construct a dendrogram based on the Unweighted Pair Group Method with Arithmetic
mean (UPGMA) . Based on a simple visual i nspection of the UPGMA dendrogram ( reproduced
in Figure 1 .5 ) , the authors concluded the presence of "human-on ly" mu lti locus genotype "sub
g roups" in the sample. However, a re-analysis of the raw data provided by Mal lon et al. by th is
author revealed numerous ties in proximity between the mu lti locus genotypes (that is , mu lt i locus
genotypes that are equidistant f rom multiple m u lti locus genotypes) . These ties determi ned the
presence of severe distort ions in the dendrog ram , which were probably not seen by the or ig inal
authors (the concept of t ies in proximity in cluster analysis and how they may distort
dendrogram s is wel l explained in MacCu ish et al. 2001 , and Arnau et al. 2005) . For i nstance,
mu lti locus genotype 21 (from the "human-only sub-group C") is a double locus variant of the
other members of the same sub-group, but mu lti locus genotypes 1 9 , 20, and 1 8 from the same
"sub-group C" have double locus variants also in "sub-group B", some of which or ig inated f rom
bovine iso lates (Figure 1 .5) . In addition, although the dendrogram would suggest the "human
on ly sub-group A" is a wel l -defined cluster, its components (m ulti locus genotypes 2, 3 and 57)
are only weakly clustered. I ndeed, the s ing le and double locus variant networks of mu lti locus
genotypes show that mu lt i locus genotype 57 does not cluster with 2 and 3 . Further exploration
of the raw data provided by M allon et al. i nd icated that mu lti locus genotype 57 is on ly a four
loci variant of 2 and 3.
Together, these resu lts suggest that the concept of the existence of anthroponotic C. parvum
requi res corroborat ion. A study further addressing the questio n of the existence of anthroponotic
C. parvum by a re-analys is of the data presented by Mallon et al . (2003) using a different
analytical approach is reported in Section 2 . 1 . Four studies addressing the zoonotic impact of
cattle and horses in New Zealand are presented i n Chapters 3 and 4.
29
J\-1.£. .Mnllon et al. /Jnfecnon. GPm>nrr and Emhmon 3 (.1003) :!07-11 8 r-r======:::;::=::=������� �7 � c � ·::::.:�A 3 btun.'Ul only 5 1 55 ..--c==� '---c== � r--e==� t--c==�
54 --t---48 47 40 10 1 1
'---1--- � 56 r-c==== l3 14 '-----c== �
r::::;::::::= 15 16 48
'---c== :; ..--c== �
_..t--t:==== �� --c==�� L� 26 4 1 43 28
29
,..------� 1 -"'i--- 18 19
Sub-group B Hwn .. m.
00..-incand
1...--------------c== �� I C.pa1,.mll monkey gc11otypc
, 57 , I
5 1
�----- � r------ � C. pnm1111 Type I 37 ------ 35 36
�' 38
, J•
, J
C. pm,·um Type2
, l
Fig. 1 .5 Dendrogram showing the "human only sub-groups" of C. parvum multilocus genotypes in
Scotland reported by Mallon et al. (2003) (above) , and single and double locus variant networks ( SDLVN)
of the mult i locus genotytpes (MLG), generated by the author using the data provided by Mallon et al .
(below) . I n the networks, the mu ltilocus genotypes are represented by dots l inked to their single locus
variants (purple l ines) and double locus variants (blue lines). The numbers represent the MLG identifiers
as defined by Mallon et al . Note the presence of numerous ties in proximity between MLGs of "sub-group
C" and "sub-group B" in the dendrogram. The SOL VN were constructed using eBURST software (see
Section 2.2). The upper f igure wi l l be incorporated in the thesis publ ished on l ine upon receipt of the
copyright permission from the publishers.
30
1.10 CONCLUDING REMARKS
Cryptosporid iosis is a disease of significant impact on both human and bovi ne health i n both
developed and d eveloping countries. Ernest Edward Tyzzer fi rst real ised that whi le some
Cryptosporidium p arasites i nvaded the gastric epithel ium, others were found i n the enterocytes.
He proposed the species name of C. muris tor the gastric parasites, and C. parvum tor the
intestinal parasites of mice (Tyzzer 1 9 10 , 1912) , form ing the basis for the phenotypic taxonomic
nomenclature wh ich was accepted unt i l recently. With the advent of cost effective PCR
equipment and reagents in the 1990s, many laboratories around the world started genotyping
isolates. As a consequence, a large amount of evidence ind icati ng an extensive genetic
diversity with in genus Cryptosporidium rapidly accumulated. Nonetheless, the taxonomy with in
genus Cryptosporidium is far f rom being resolved and there is sti l l no fu l l consensus o n what
constitutes a Cryptosporidium taxon. These developments forced researchers to re-assess
some of their establ ished views, and perform new epidemio logical research us ing molecular
tools. Such a rapid evolution of thought wi l l be apparent in some of the epidemiolog ical stud ies
that fol low.
1 . 1 1 REFERENCES
Abrahamsen MS, Templeton T J, Enomoto S, Abrahante JE, Zhu G, lancto CA, Deng M, Liu C,
Widmer G, Tzipori S, Buck GA, Xu P, Bankier AT, Dear PH, Konfortov BA, Spriggs HF, lyer L,
Anantharaman V, Aravind l , Kapur V. Complete genome sequence of the apicomplexan,
Cryptosporidium parvum. Science 304, 441 -5, 2004
Akiyoshi DE, Mor S, Tzipori S. Rapid displacement of Cryptosporidium parvum type 1 by type 2 in mixed
infections in piglets . Infection and Immunity 71 , 5765-71 , 2003 .
Akiyoshi DE, Tumwine JK, Bakeera-Kitaka S, Tzipori S. Subtype analysis of Cryptosporidium isolates
from children in Uganda. Journal of Parasitology 92: 1 097-1 00, 2006
Alves M, Xiao l, Antunes F, Matos 0. Distribution of Cryptosporidium subtypes in humans and domestic
and wild ruminants in Portugal . Parasitology Research 99: 287-92, 2006
Alves M, Xiao l, Sulaiman I, lal AA, Matos 0, Antunes F. Subgenotype analysis of Cryptosporidium
isolates from humans, catt le , and zoo ruminants in Portugal. Journal of Clinical Microbiology 4 1 , 2744-47,
2003
Anderson BC. Patterns of shedding of cryptosporidial oocysts in I daho calves. Journal of the American
Veterinary Medical Association 1 78, 982-84, 1 981
Anderson BC. C ryptosporidiosis in Idaho lambs: natural and experimental infections. Journal of the
American Veterinary Medical Association 8 1 , 1 5 1 -53, 1 982
Anderson BC, Bu lgin MS. Enteritis caused by Cryptosporidium in calves. Veterinary Medicine and Small
Animal Clinician 76, 865-68, 1 98 1
3 1
Angus KW. Cryptosporidiosis in man, domestic animals and b i rds: a review. Journal of the Royal Society
of Medicine 76, 62-70, 1 983
Angus KW, Tzipori S, Gray EW. Intestinal lesions in SPF lambs associated with Cryptosporidium from
calves with d iarrhoea. Veterinary Pathology 1 9, 67-8, 1 982
Arnau V, Mars S, Marin I . Iterative Cluster Analysis of Protei n Interaction Data. Bioinformatics 2 1 , 364-
78, 2005
Atwi l l ER, das Pereira M. Lack of detectable shedding of Cryptosporidium parvum in periparturient dairy
cattle. Journal of Parasitology 89, 1 234-6, 2003
Atwill ER, Johnson E, Kl ingborg DJ, Veserat GM, Markegard G, Jensen WA, Pratt DW, Delmas RE,
George HA, Forero LC, Phi l ips RL, Barry SJ, McDougald NK, Gildersleeve RR, Frost WE. Age,
geograph ic, and temporal d istribution of fecal shedding of Cryptosporidium parvum oocysts in cow-calf
herds. American Journal of Veterinary Research 60, 420-25, 1 999
Awad-EI-Kariem FM, Robinson HA, Petry F, McDona ld V, Evans D, Casemore D. Differentiation
between human and animal isolates of Cryptosporidium parvum using molecular and biological markers.
Parasitology research 84, 297-301 , 1 998
Baishanbo A, Gargala G, Delaunay A, Francrois A, Ballet JJ, Favennec L. I nfectivity of
Cryptosporidium hominis and Cryptosporidium parvum Genotype 2 Isolates in lmmunosuppressed
Mongolian Gerbi ls. Infection and Immunity 73, 5252-55, 2005
Ballweber LR, Panuska C , Huston CL, Vasilopulos R , Pharr GT, Mackin A. Prevalence of and risk
factors associated with shedding of Cryptosporidium felis in domestic cats of Mississippi and Alabama.
Veterinary Parasitology 1 60, 306-1 0, 2009
Barker I K, Carbonell PL. Cryptosporidium agni sp. n. from lambs and Cryptosporidium bovis sp. n. from a
calf with observations on the oocyst. Zeitschrift fur Parasitenkunde 44, 289-98, 1 974
Barta JR. Evolutionary Origins of Cryptosporidium species (Myzozoa, Apicomplexa) - Unique Coccidium
or Vertebrate G regarine? P roceedings of the 1 1 International Conference on Giardia and Cryptosporidium,
Morel ia, Michoacan, Mexico, May 1 3 - 1 8, 2007. Taxonomy, Nomenclature and Evolution S ession,
abstract 5, 2007
Bird RG, Smith MD. Cryptosporidiosis in man: parasite l i fe cycle and fine structural pathology. Journal of
Pathology 1 32, 2 1 7-33, 1 980
B lunt OS, Khramtsov NV, Upton SJ , Montelone BA. Molecular Karyotype Analysis of Cryptosporidium
parvum: Evidence for Eight Chromosomes and a Low-Molecular-Size Molecule. Clinical and Diagnostic
Laboratory Immunology 4, 1 1 -3, 1 997
32
Bonnin A, Fourmaux MN, Dubremetz J F, Nelson RG, Gobet P, Harly G , Buisson M, Puygauthier
Toubas D, Gabriei-Pospisil G, Naciri M, Camerlynck P. Genotyping human and bovine isolates of
Cryptosporidium parvum by polymerase chain reaction restriction fragment length polymorphism analysis
of a repetitive DNA sequence. FEMS Microbiology letters 1 37, 207-1 1 , 1 996
Bornay-llinares FJ , da Si lva AJ, Moura IN, Myjak P, Pietkiewicz H, Kruminis-Lozowska W, G raczyk
TK, Pieniazek NJ. I dentification of Cryptosporidium felis in a cow by morphologic and molecular methods.
Applied and Environmental Microbiology 65, 1 455-8, 1 999
Borowski H, Clode PL, Thompson RCA. Active invasion and/or encapsulat ion? A reappraisal of host-cell
parasitism by Cryptosporidium. Trends in Parasitology 24, 509- 1 6, 2008
Brenner J, Elad D, Markowics A, Grinberg, A, Trainin Z. Epidemiological study of neonatal calf
diarrhoea in I srael - a one-year survey of faecal samples. Israel Journal of Veterinary Medicine 48, 1 1 3-
1 6, 1 993
Caccio S, Homan W, van Dijk K, Pozio E . Genetic polymorphism at the 13-tubul in locus among human
and animal isolates of Cryptosporidium parvum. FEMS Microbiology Letters 1 70, 1 73-79, 1 999
Caccio S, Homan W, Camill i R, Traldi G , Kortbeek T, Pozio E. A microsatellite marker reveals
population heterogeneity within human and animal genotypes of Cryptosporidium parvum. Parasitology
1 20 , 237-44, 2000
Caccio S, Spano F, Pozio E. Large sequence variation at two microsatel l ite loci among zoonotic
(genotype C) isolates of Cryptosporidium parvum. International Journal of Parasitology 3 1 , 1 082-86, 2001
Caccio SM, Thompson RCA, McLauchl in J , Smith HV. Unravell ing Cryptosporidium and Giardia
epidemiology. Trends in Parasitology 2 1 , 430-37, 2005
Cama V, Arrowood M, Ortega V, Xiao, L . Molecular characterization of the Cryptosporidium parvum Iowa
isolate kept in different laboratories. Journal Eukaryotic Microbiology. 53: 840-2, 2006
Carraway M, Tzipori S, Widmer G. Identification of Genetic H eterogeneity in the Cryptosporidium parvum
ribosomal repeat. Applied and Environmental Microbiology 62, 7 1 2-1 6, 1 996
Carraway M, Tzipori S, Widmer G. A new restriction length polymorphism from Cryptosporidium parvum
identifies genetically heterogeneous parasite populations and genotypic changes following t ransmission
from bovine to human hosts. Infection and Immunity 65, 3958-960, 1 997
Carreno RA, Martin OS, Barta JR. Cryptosporidium is more closely related to the gregarines than to
coccidia as shown by phylogenetic analysis of apicomplexan parasites inferred using small-subunit
ribosomal RNA gene sequences. Parasitology Research 85, 899-904, 1 999
Casemore DP, Armstrong M, Jackson FB. Screening for Cryptosporidium i n stools. Lancet 1 984; 1 :734-
735, 1 984
33
Casemore DP, Armstrong M , Sands RL. Laboratory diagnosis of cryptosporidiosis. Journal of Clinical
Pathology 38, 1 337-4 1 , 1 985a
Casemore DP, Jackson FB. Hypothesis : cryptosporidiosis in human beings is not primarily a zoonosis.
Journal of Infection 9 , 1 53-6, 1 984
Casemore DP, Sands RL, Curry A. Cryptosporidium species a "new" human pathogen . Journal of
Clinical Pathology 38, 1 321 -36, 1 985b
Castro-Hermida JA, Gonza les-Lozada YA, Ares-Mazas E. Prevalence of and risk factors involved in the
spread of neonatal bovine cryptosporidiosis in Galicia (Spain) . Veterinary Parasitology 1 06, 1 - 1 0, 2002a
Castro-Hermida JA, Gonzales-Lozada Y A, Mezo-Menendez M, Ares-Mazas E. A study of
cryptosporidiosis in a cohort of neonatal calves. Veterinary Parasitology 1 06, 1 1 -7, 2002b
Ceval los AM, Zhang X, Waldor MK, Jaison S, Zhou X, Tzipori S, Neutra MR, Ward HO. Molecular
cloning and expression of a gene encoding Cryptosporidium parvum glycoproteins G P40 and gp1 5.
Infection and Immunity 68, 4 1 08-1 6 , 2000
Chalmers RM, Elwin K, Reilly WJ, lrvine H, Thomas AL, Hunter PR. Cryptosporidium in farmed
animals: the detection of a novel isolate in sheep. International Journal for Parasitology 32, 21 -6, 2002
Chalmers RM, Robinson G, E lwin K, Hadfield SJ, Xiao L, Ryan U, Modha D, Mal laghan C.
Cryptosporidium sp. rabbit genotype, a newly identified human pathogen. Emerging I nfectious Diseases
1 5, 829-30, 2009
Chalmers RM, Thomas AL, Butler BA, Morel MC. Identification of Cryptosporidium parvum genotype 2
in domestic horses. Veterinary Record 1 56, 49-50, 2005
Chappel CL, Okhuysen PC. C ryptosporidiosis in health adu lt volunteers. I n : Cryptosporidiosis, the
analytical challenge. M. Smit h and KC Thompson (eds). The Royal Society of Chemistry, Cambridge, UK ,
Pp 62-72, 2001
Chappell CL, Okhuysen PC. Cryptosporidiosis. Current Opinion in Infectious Diseases 1 5, 523-7, 2002
Chappell CL, Okhuysen PC, Sterl ing CR, Wang C, Jakubowski W, Dupont HL. I nfectivity of
Cryptosporidium parvum i n healthy adults with pre-existing anti-C. parvum serum immunoglobul in
American Journal of tropical Medicine and Hygiene 60, 1 57-64, 1 999
Coklin T, Farber J , Parrington L, Dixon B. Prevalence and molecular characterization of Giardia
duodena/is and Cryptosporidium spp. in dairy cattle in Ontario, Canada. Veterinary Parasitology 1 50 , 297-
305, 2007
34
Cole DJ, Cohen NO, Snowden K, Smith R. Prevalence of and risk factors for fecal shedding of
Cryptosporidium parvum oocysts in horses. Journal of the American Veterinary Medical Association 21 3,
1 296-302, 1 998
Colema n SU, Klei TR, French DD, C hapman MR, Costvet RE. Prevalence of Cryptosporidium sp in
equ ids in Louisiana. American Journal of Veterinary Research 50, 575-77, 1 989
Coutinho BP, Oria RB, Vieira CM, Sevilleja JE, Warren CA, Maciel JG, Thompson MR, Pinkerton RC,
Lima AA, Guerrant RL. Cryptosporidium infection causes under-nutrit ion , and conversely, weanling
under-nutrition intensifies infect ion. Journal of Parasitology 94 , 1 225-32, 2008
Current WL. The biology of Cryptosporidium. American Society for Microbiology News 54, 605- 1 1 , 1 988
Current WL, Haynes TB. Complete development of Cryptosporidium in cel l cul ture. Science 224, 603-05,
1 984
Current WL, Reese NC. A comparison of endogenous development of three isolates of Cryptosporidium
i n suckling mice. Journal of Protozoology 33, 98- 1 08, 1 986
Current WL, Reese NC, Ernst JV, Bai ley WS, Heyman MB, Weinstein WM. Human cryptosporidiosis in
immunocompetent and immunodeficient persons. New England Journal of Medicine 308, 1 252-57, 1 983
De Graaf DC, Vanopdenbosch E, Ortega-Mora LM, Abbassi H, Peeters JE . A review of the importance
of cryptosporidiosis in farm animals. International Journal for Parasitology 29, 1 269-87, 1 999
Dil l ingham RA, L ima AA, Guerrant RL. Cryptosporidiosis : epidemiology and impact. Microbes and
Infection 4, 59-66, 2002
DuPont HL, Chappel C L, Sterl ing CR, Okhuysen PC, Rose JB, Jakubowsky W. The infectivity of
Cryptosporidium parvum in healthy vol unteers. New England Journal of Medicine 332, 855-59, 1 995
Ebeid M, Mathis A, Pospischi l A, Deplazes P. Infectivity of Cryptosporidium parvum genotype in
conventionally reared piglets and lambs. Parasitology Research 90, 232-35, 2003
Egger M, Nguyen XM, Schaad UB, Krech T. I ntestinal cryptosporidiosis acqu ired from a cat. Infection 1 8,
1 77-8, 1 990
Elwin K, Chalmers RM. Contemporary identification of previously reported novel Cryptosporidium isolates
reveals Cryptosporidium bovis and the cervine genotype in sheep ( Ovis aries). Parasitology Research 1 02,
1 1 03- 1 1 05, 2008
Esteban E, Anderson BC. Cryptosporidium muris: prevalence, persistency and detrimental effects on mi lk
product ion in a dry lot dairy. Journal of Dairy Science 78, 1 068-72, 1 995
Fayer R. Cryptosporidium: a water-borne zoonotic parasite. Veterinary Parasitology 1 26, 37-56, 2004
35
Fayer R. Biology. I n : Fayer, R . , Xiao, L. (Eds. ) , Cryptosporidium and cryptosporidiosis, second ed. CRC
Press and lW A Publ ishing, Boca Raton, FL , pp . 1 -42, 2008
Fayer R, Ellis W. Paromomycin is effective as prophylaxis for cryptosporidiosis in dairy calves. Journal of
Parasitology 79, 771 -4, 1 993
Fayer R, Fischer JR, Sewel l CT, Kavanaugh OM, Osborn DA. Spontaneous cryptosporidiosis in captive
white-tailed deer (Odocoi leus virginianus) . Journal of Wildlife Diseases 32, 61 9-22, 1 996
Fayer R, Gasbarre L, Pasquali P, Canals A, Almeria S, Zarlenga D. Cryptosporidium parvum infection
in bovine neonates: dynamic cl inical , parasitic and immunologic patterns. International Journal for
Parasitology 28 :49-56, 1 998
Fayer R, Santin M, Trout JM. Prevalence of Cryptosporidium species and genotypes in mature dairy
cattle on farms in eastern Un ited States compared with younger cattle from the same locations. Veterinary
Parasitology 1 45, 260-66, 2007
Fayer R, Santin M, Trout JM. Cryptosporidium ryanae n. sp. (Apicomplexa: Cryptosporidiidae) in cattle
(8os taurus). Veterinary Parasitology 1 56, 1 9 1 -8 . 2008
Fayer R, Santin M, Trout JM, G reiner E. Prevalence of species and genotypes of Cryptosporidium found
in 1 -2-year-old dairy cattle in the eastern United States. Veterinary Parasitology 1 35, 1 05- 1 2, 2006
Fayer AM, Santin M, Xiao L. Cryptosporidium bovis n. sp. (Apicomplexa: Cryptosporidiidae) in catt le (8os
taurus) . Journal of Parasitology 9 1 , 624-29, 2005
Fayer R, Trout JM, Xiao L , Morgan UM, Lal AA*, Dubey JP. Cryptosporidium canis N.Sp. from domestic
dogs. Journal of Parasitology 87, 1 41 5-22, 200 1
Feltus DC, Giddings CW, Khaitsa ML, McEvoy JM. High prevalence of Cryptosporidium bovis and the
deer- l ike genotype in calves compared to mature cows in beef cow-calf operations. Veterinary
Parasitology 1 5 1 , 1 9 1 -95, 2008
Feng H, Nie W, Sheoran A, Z hang Q, Tzipori S. Bile acids enhance invasiveness of Cryptosporidium
spp. into cultured cel ls. Infection and Immunity 74, 3342-46, 2006
Feng Y, Ortega Y, He G, Das P, Xu M, Zhang X, Fayer R, Gatei W, Cama V, Xiao L. Wide geographic
distribution of Cryptosporidium bovis and the deer- l ike genotype in bovines. Veterinary Parasitology 1 44,
1 -9 , 2007
Feng X, Rich SM, Akiyoshi D, Tumwine JK, Kekitiinwa A, Nabukeera N, Tzipori S, Widmer G.
Extensive polymorphism in Cryptosporidium parvum identified by mult i locus m icrosatel l i te analysis.
Applied and Environmental Microbiology 66, 3344-49, 2000
36
Gajadhan A, Caron JP, Alien JR. Cryptosporidium in two foals. Canadian Veterinary Journal 26, 1 32-34,
1 985
Garber LP, Salman MD, Hurd HS, Keefe T, Schlater J. Potential risk factors for Cryptosporidium
infection in dairy calves. Journal of the American Veterinary Medical Association 205, 86-9 1 , 1 994
Garcia LS, Bruckner DA, Brewer TC, S himizu RV. Techniques for the recovery and identification of
Cryptosporidium oocysts from stool specimens. Journal of Clinical Microbiology 1 8, 1 85-90, 1 983
Gatei W, Barrett 0, Lindo JF, Cama V, Xiao L. Extensive homozygosity in Cryptosporidium parasites
identified by multilocus sequence typing in Jamaica. Proceedings of the 1 1 International Conference on
Giardia and Cryptosporidium, Morelia, Michoacan, Mexico, May 1 3 - 1 8, Molecular Epidemiology and
Typing, Session 2, Abstract 1 1 , 2007a
Gatei W, Das P, Dutta P, Sen A, Cama V, Lal AA, Xiao L. Multi locus sequence typing and genetic
structure of Cryptosporidium hominis from children in Kolkata, India. Infection Genetics and Evolution 7,
1 97-205, 2007b
Genchi C, Hermon J, Sangali G, Traldi G. La criptosporidiosi nel vitel lo, fattore determinante nella
diarrea neonatale. (Calf cryptosporid iosis, a determinant factor of neonatal diarrhoea). Praxis Veterinaria
3, 4, 1 984
Genta RM, Chappel l C L, White AC, Kimball KT, Goodgame RW. Duodenal morphology and intensity of
infection in AI DS-related intestinal cryptosporidiosis. Gastroenterology 1 05, 1 769-75, 1 993
Geurden T, Goma FY, Siwila J , Ph iri IGK, Mwanza AM, Gabriel S, Claerebout E, Vercruysse J.
Prevalence and genotyping of Cryptosporidium in three cattle husbandry systems in Zambia. Veterinary
Parasitology 1 38, 2 1 7-22, 2006
Geurden T, Thomas P, Casaert S, Vercruysse J, Claerebout E. Prevalence and molecular
characterisation of Cryptosporidium and Giardia in lambs and goat kids in Belgium. Veterinary
Parasitology 1 55, 1 42-5, 2008
G iangaspero A, lorio R, Paoletti 8, Traversa 0, Cappel l i G. Molecular evidence for Cryptosporidium
infection in dogs in Central Italy. Parasitology Research 99, 297-99, 2006
Gibson JA, Hi l l MWM, Huber MJ. Cryptosporidium in Arabian foals with severe combined
immunodeficiency. Australian Veterinary Journal 60, 378-9, 1 983
G iles M, Chalmers R, Pritchard G , Elwin K, Mueller-Doblies 0, Clifton-Hadley F. Cryptosporidium
hominis in a goat and a sheep in the UK. Veterinary Record 1 64 , 24-5, 2009
G iles M, Webster KA, Marshal! JA, Catchpole J, Goddard TM. Experimental infection of a lamb with
Cryptosporidium parvum genotype 1 . Veterinary Record 1 49, 523-25, 2001
37
Griffiths JK, Balakrishnan R, Widmer G, Tzipori S. Paromomycin and geneticin inhibit intracellular
Cryptopsporidium parvum without trafficking through the host-cell cytoplasm : impl ications for d rug del ivery.
Infection and Immunity 66, 387 4-83, 1 998
Grinberg A, Markovics A, Gal indez J, Lopez-Vil lalobos N, Kosak A, Tranquil lo. VM. Contro l l ing the
onset of natural cryptosporidiosis in calves with paromomycin sulphate. Veterinary Record 1 5 1 , 606-8,
2002
Guselle NJ, Appelbee AJ , Olson ME. Biology of Cryptosporidium parvum in p igs : from weaning to
market. Veterinary Parasitology 1 1 3 , 7- 1 8, 2003
Guyot K, Fol let-Dumoulin A, Lel ievre E, Sarfati C, Rabodonirina M, Nevez G, Cai l l iez JC, Camus D,
Dei-Cas E. Molecular characterization of Cryptosporidium isolates obtained from humans in France.
Journal of Clinical Microbiology 39, 3472-80, 200 1
Hajdusek 0, Ditrich 0, Slapeta J. Molecular identification of Cryptosporidium spp. i n animal and human
hosts from the Czech Republic. Veterinary Parasitology 1 22, 1 83- 1 92, 2004
Harp JA, Woodmansee DB, Moon HW. Effect of colostral antibody on susceptibility of calves to
Cryptosporidium parvum in fection. American Journal of Veterinary Research 50, 2 1 1 7- 9, 1 989
Hashimoto A, Sugimoto H , Sh igemitsu M, Tsuyoshi H . Genotyping of single Cryptosporidium oocysts
in sewage by semi-nested PCR and di rect sequencing. Water Research 40, 2527-32, 2006
Henriksen SA, Pohlenz J. Staining of cryptosporidia by a modified Ziehi- Neelsen technique. Acta
Veterina Scandinavica 22:594-5, 1 98 1
Hijjawi N S , Meloni BP, Ng'anzo M, Ryan UM, O lson M E , Cox PT, Monis PT, Thompson R C . Complete
development of Cryptosporidium parvum in host cell-free culture. International Journal for Parasitology 34,
769-77, 2004
Hijjawi NS, Meloni BP, Ryan UM, Olson ME, Thompson RC. Successful in vitro cultivation of
Cryptosporidium andersoni: evidence for the existence of novel extracellular stages in the l i fe cycle and
implications for the classificat ion of Cryptosporidium. International Journal for Parasitology, 32 : 1 7 1 9-25,
2002
Huang DB, Chappell C, Okhuysen PC. Cryptosporidiosis in chi ldren . Seminars in pediatric infectious
diseases 1 5, 253-59, 2004
Hunter PR, Nichols G. Epidemiology and cl in ical features of Cryptosporidium i nfection in
immunocompromised patients. Clinical Microbiology Reviews 1 5, 1 45-54, 2002
Hunter PR, Thompson RCA. The zoonotic transmission of Giardia and Cryptosporidium. International
Journal for Parasitology 35, 1 1 8 1 -90, 2005
38
Jeffreys AJ , Wi lson V, Thein SL. Hypervariable 'minisatellite' regions in human DNA. Nature 3 1 4, 67-73,
1 985
Joachim A, Krull T, Schwarzkopf J , Daugschies A. Prevalence and control of cryptosporidiosis in
German dairy herds. Veterinary Parasitology 1 1 2, 277-88, 2003
Johnson J, Buddle R, Reid S, Armson A, Ryan UM. Prevalence of Cryptosporidium genotypes in pre
and post-weaned pigs in Australia. Experimantal Parasitology 1 1 9 , 4 1 8-21 , 2008
Khan WA, Rogers KA, Karim MM, Ahmed S, Hibberd PL, Calderwood SB, Ryan ET, Ward HO.
Cryptosporidiosis among Nangaladeshi chi ldren with diarrhoea: a prospective, matched case-control study
of c linical features, epidemiology and systemic antibody responses. American Journal of Tropical Medicine
and Hygiene 7 1 , 4 1 2-1 9, 2004
Khramtsov NV, Ti l ley MDS, B lunt BA, Montelone BA, Upton, SJ . Cloning and analysis of a
Cryptosporidium parvum gene encoding a protein with homology to cytoplasmic form HSP70. Journal of
Eukaryotic Microbiology 42, 41 6-22, 1 995
Kim CW. Cryptosporidiosis in pigs and horses. In : Cryptosporidiosis of man and animals 1 05-1 1 . J P
Dubey C A Speer and R Fayer (eds). C R C Press inc . , Boca Raton, Florida, USA, 1 990
Kvac M, Kouba M, V1tovec J. Age-related and housing-dependence of Cryptosporidium infection of
calves from dairy and beef herds in South Bohemia, Czech Republ ic. Veterinary Parasitology 1 37 , 202-
09, 2006
Kvac M, Sak 8, Hanzlikova D, Kotilova J, KviHonova D. Molecular characterization of Cryptosporidium
isolates from pigs at slaughterhouses in South Bohemia, Czech Republic. Parasitology Research
1 04:425-28, 2009
Kvac M, Sak B, Kvetonova D, Ditricha 0, Hofmannovad L, Modrya D, Vitovec J, Xiao L. Infectivity,
pathogenicity, and genetic characteristics of mammalian gastric Cryptosporidium spp. in domestic
ruminants. Veterinary Parasitology 1 53, 363-67, 2008
Laurent F, McCole D, Eckmann L , Kagnoff MF. Pathogenesis of Cryptosporidium parvum infection.
Microbes and Infection 1 , 1 4 1 -8, 1 999
Laxer MA, Timbl i n BK, Patel RJ. DNA sequences for the specific detect ion of Cryptosporidium parvum
by the polymerase chain reaction. American Journal of Tropical Medicine and Hygiene 45, 688-94, 1 99 1
Learmonth JJ, lonas G, Ebbet KA, Kwan ES. Genetic characterisation and transmission cycles of
Cryptosporidium species isolated from humans in New Zealand. Applied and Environmental Microbiology
70, 3973-8, 2004
39
Learmonth J, lonas G , Pita A, Cowie R. Identification and genetic characterisation of Giardia and
Cryptosporidium strains i n humans and dairy cattle in the Waikato Region of New Zealand. Water Science
and Technology 4 7, 2 1 -6, 2003
Learmonth J, lonas G, Pita A, Cowie R. Seasonal shift in Cryptosporidium parvum transmission cycles in
New Zealand. Journal of Eurkaryotic Microbiology 48, 34s-35s, 2005
Leav BA, Mackay MR, Anyanwu A, RM OC, Cevallos AM, Kindra G, Rol l ins NC, Bennish Ml, N elson
RG, Ward HO. Analysis of sequence d iversity at the h ighly polymorphic Cpgp40/1 5 locus among
Cryptosporidium isolates from human immunodeficiency virus-infected chi ldren in South Africa. Infection
and Immunity 70,3881 -90, 2002
Leng X, Mosier DA, Oberst RD. Differentiation of Cryptosporidium parvum, C. muris, and C. baileyi by
PCR-R FLP analysis of the 1 88 rRNA gene. Veterinary Parasitology 62, 1-7, 1 996
Lindsay OS, Upton SJ, Owens DS, Morgan UM, Mead JR, Blagburn BL. Cryptosporidium andersoni n.
sp. (Apicomplexa: Cryptosporiidae) from cattle , Bos taurus. Journal of Eukaryotic Microbiology 47, 91 -5,
2000
MacCuish J, Nicolaou C, MacCuish NE. Ties in proximity and clustering compounds. Journal of
Chemical Information and Modeling 4 1 , 1 34 -46, 2001
Mac Kenzie WR, Hoxie NJ, Proctor ME, Gradus MS, Blair KA, Peterson D E, . Kazmierczak JJ,
Addiss DG, Fox KR, Rose JB, Davis JP. A massive outbreak in Milwaukee of Cryptosporidium i n fection
transmitted through the public water supply. New England Journal of Medicine 331 , 1 6 1 -7 ; 1 994
Maggi P, Larocca AMV, Quarto M, Sergio G, Brandonisio 0, Angarano G, Pastore G. Effect of
antiretroviral therapy on cryptosporidiosis and microsporidiosis in patients infected with human
immunodeficiency virus type 1 . European Journal of Clinical Microbiology and Infectious Diseases 1 9 :21 3-
1 7, 2000
Mclaughlin J , Amar C, Pedraza-Diaz S, Nichols GL . Molecular epidemiological analysis of
Cryptosporidium spp. in the United K ingdom: Results of genotyping Cryptosporidium spp. in 1 705 fecal
samples from humans and 1 05 fecal samples from livestock animals. Journal of Clinical Microbiology 38,
3984-90, 2000
Mallon M, Macleod A, Wastling J, Smith H, Tait A. Multi locus genotyping of Cryptosporidium parvum
Type 2 : population genetics and sub-structuring. Infection, Genetics and Evolution 3, 207- 1 8, 2003
Mason, RW, Hartley WJ, Tilt L. I ntestinal cryptosporidiosis in a kid goat. Australian Veterinary Journal 57,
386-88, 1 981
Meisel JL, Perera OR, Meligro C, Rubin CE. Overwhelming watery diarrhea associated with a
Cryptosporidium in an immunosuppressed patient. Gastroenterology 70: 1 1 56-60, 1 976
40
Miao YM, Awad-ei-Kariem FM, Franzen C, El l is OS, Muller A, Counihan HM, Hayes PJ, Gazzard BG.
Eradication of cryptosporidia and microsporidia fol lowing successful antiretroviral therapy. Journal of
Acquired Immunodeficiency Virus 25 : 1 24-29, 2000
Mil lard PS, Gensheimer KF, Addiss DG, Sosin OM, Beckett GA, Houck-Jankoski A, Hudson A. An
outbreak of cryptosporidiosis from fresh-pressed apple cider. Journal of the American Medical Association
272, 1 592-96, 1 994
Misic Z, Abe A. Subtype analysis of Cryptosporidium parvum isolates from calves on farms around
Belgrade, Serbia and Montenegro, using the 60 k Da glycoprotein gene sequences. Parasitology 1 -8 , 2006
Mohammed HO, Wade SE, Schaaf S. Risk factors associated with Cryptosporidium parvum infection in
dairy cattle in southeastern New York State. Veterinary Parasitology 83, 1 -1 3, 1 999
Moore DA, Atwi l l ER, Kirk JH, Brahmbhatt D, Alonso LH, Hou LL, Singer MD, Mi l ler TO. Prophylactic
use of decoquinate for infections with Cryptosporidium parvum in experimentally challenged neonatal
calves. Journal of the American Veterinary Medical Association 223, 839-45 2003
Moore DA, Zeman OH. Cryptosporidiosis in neonatal calves: 277 cases ( 1 986- 1 987). Journal of the
American Veterinary Medical Association 1 98, 1 969-71 , 1 991
Morgan UM, Sargent KO, Deplazes P, Forbes DA, Spano F, Hertzberg H, El l iot A, Thompson RCA.
Molecular characterisation of Cryptosporidium from various hosts. Parasitology 1 1 7 :3 1 -7 , 1 998
Morgan UM, Xiao L, Monis P, Fal l A, lrwin PJ, Fayer R, Denholm KM, Limor J, Lal AA, Thompson
RCA. Cryptosporidium spp. in domestic dogs: the "Dog" genotype. Applied and environmental
microbiology 66, 2220-23, 2000
Morgan-Ryan UM, Fall A, Ward LA, Hijjawi N, Sulaiman I, Fayer R, Thompson RCA, Olson M, Lal A,
Xiao, L. Cryptosporidium hominis n. sp. (Apicomplexa: Cryptosporid i idae) from Homo sapiens. Journal of
Eukariotic Microbiology 49, 433-40, 2002
Morin M, Lariviere S, Lalier R. Pathological and m icrobiological observations on spontaneous cases of
acute neonatal calf diarrhoea. Canadian Journal of Comparative Medicine 40, 228, 1 976
Mueller-Doblies D, Gi les M, Elwin K, Smith RP, Cl ifton-Hadley FA, Chalmers RM. Distribution of
Cryptosporidium species in sheep in the UK. Veterinary Parasitology 54, 2 1 4-9, 2008
Naciri M, Mancassola R, Yvore P, Peeters JE. The effect of halofuginone lactate on experimental
Cryptosporidium parvum infections in calves. Veterinary Parasitology 45, 1 99-207, 1 993
Naciri M, Lefay MP, Mancassola R, Poirier P , Chermette R. Role of Cryptosporidium parvum as a
pathogen in n eonatal diarrhoea complex in suckl ing and dairy calves in France. Veterinary Parasitology
85, 245-57, 1 999
41
Netherwood T, Wood JLN, Townsend HGG, Mumford JA. Foal diarrhoea between 1 99 1 and 1 994 in
the Un ited Kingdom associated with Clostridium perfringens, rotavirus, Strongyloides westeri and
Cryptosporidium spp. Epidemiology and Infection 1 1 7, 375-83, 1 994
N ichols G. I n : Fayer, R . , Xiao, L. (Eds . ) , Cryptosporidium and cryptosporidiosis, second ed. CRC Press
and lW A Publishing, Boca Raton , FL, pp. 79- 1 1 8, 2008
N ime FA, Burek JD, Page DL. Acute enterocolitis in a human being infected with the protozoan
Cryptosporidium. Gastroenterology 70, 592-8, 1 976
Okhuysen PC, Chappell CL, Crabb JH, Sterling CR, DuPont HL. Virulence of three d istinct
Cryptosporidium parvum isolates for healthy adults. Journal of Infectious Diseases 1 80, 1 275-8 1 , 1 999
Olson ME, O'Handley RM, Ralston BJ, McAIIister TA, Thompson RCA. Update on Cryptosporidium
and Giardia i nfections in cattle. Trends in Parasitology 20, 1 85- 1 9 1 , 2004
Olson ME, Thorlakson CL, Deselliers L, Morck DW, McAI I ister TA. Giardia and Cryptosporidium i n
Canadian farm animals. Veterinary Parasitology 68, 375-8 1 , 1 997
Orr M B, MacKintosh CC, Sutie JM. Cryptosporidiosis in deer calves. New Zealand Veterinary Journal 33:
1 5 1 - 1 53, 1 985
Ortega YR, Sheehy RR, Cama VA. Restriction-fragment length polymorphism analysis of
Cryptosporidium parvum isolates of bovine and human origin. Journal of Protozoology 38, S40-S41 , 1 991
Ortega-Mora LM, Wright SE . Age-related resistance in ovine cryptosporidiosis: patterns o f infection and
humoral immune response. Infection and Immunity 62, 5003-09, 1 994
O'Donoghue PJ. Cryptosporidium and cryptosporidiosis in man and animals. International Journal of
Parasitology 25, 1 39-95, 1 995
O'Handley RM, Cockwil l C, McAIIister TA, Jelinski M, Morck DW, Olson ME. Durat ion of naturally
acquired giardiasis and cryptosporidiosis in dairy calves and their association with diarrhea. Journal of the
American Veterinary Medical Asscociation 21 4, 39 1 -6, 1 999
Palmer CS, Traub RJ, Robertson ID, Devlin G, Rees R, Thompson RC. Determining the zoonotic
signif icance of Giardia and Cryptosporidium i n Australian dogs and cats. Veterinary Parasitology 1 54 , 1 42-
7, 2008
Panciera RJ, Thomassen RW, Garner FM. Cryptosporidial infection in a calf. Veterinary Pathology 8,
479-84, 1 971
Paoletti B, Giangaspero A, Gatti A, lorio R, Cembalo D , Mi l i l lo P , Traversa D. lmmunoenzymatic
analysis and genetic detection of Cryptosporidium parvum in lambs from Italy. Experimantal Parasitology
in p ress, doi : 1 0. 1 0 1 6/j .exppara.2009.05.006, 2009
42
Paul S, Chandra D, Ray DD, Tewari AK, Rao JR, Banerjee PS, Baidya S, Raina OK. Prevalence and
molecular characterization of bovine Cryptosporidium isolates in I ndia. Veterinary Parasitology 1 53 , 1 43-6,
2008
Pedraza-Diaz S, Ortega-Mora LM, Carrion BA, Navarro V, G6mez-Bautista M. Molecu lar
characterisation of Cryptosporidium isolates from pet repti les. Veterinary Parasitology 1 60, 204- 1 0, 2009
Peng X, Murphy T, Holden NM. Evaluation of temperature on d ie-off 1 rate of Cryptosporidium parvum
oocysts in water, soi ls and faeces. Applied and Environmental Microbiology, Published on l ine,
doi: 1 0. 1 1 28/AEM.01 442-08, 2008
Peng MM, Xiao L, Freeman AR, Arrowood MJ, Escalante AA, Weltman AC, Ong CSL, Mac Kenzie
WR, Lal AA, Beard CB. Genetic polymorph ism among Cryptosporidium parvum isolates: evidence of two
distinct h uman transmission cycles. Emerging Infectious Diseases 3, 567-3, 1 997
Pereira SJ . Pathogenesis of h uman and bovine Cryptosporidium parvum in gnotobiotic pigs.
Journal of Infectious Diseases 1 86 , 71 5-8, 2002
Perryman LE, Bjorneby JM. I mmunotherapy of cryptosporidiosis in immunodeficient animal models.
Journal of Protozoology 38, 98S-1 OOS, 1 99 1
Pevsner J . Bioinformatics and functional genomics Pp. 543-50. John Wi ley and Sons Inc. publ ications,
Hobokem New Jersey, USA, 2003
Pohlenz J, Moon HW, Chevi l le NF, Bermick WJ. Cryptosporidiosis as a probable factor in neonatal
diarrhoea of calves. Journal of the American Veterinary Medical Association 1 72, 452, 1 978
Pohjola S, Jokipii AM, Jokipii L. Sporadic cryptosporidiosis in a rural population is asymptomatic and
associated with contact to catt le. Acta Veterinaria Scandinavica 27, 9 1 -1 02, 1 986
Pozio E, Morales MAG. The impact of H IV-protease inhibitors on opportunistic parasites. Trends in
Parasitology 21 , 58-63, 2005
Pritchard GC, Marshal! JA, Gi les M, Mueller-Doblies D, Sayers AR, Marshal! R N , Elwin K, Chalmers
RM. Cryptosporidium species in lambs submitted for diagnostic postmortem examination in England and
Wales. Veterinary Record 1 63, 688-9, 2008
Quigley JD, Martin KR, Semis DA, Potgieter LND, Reinemeyer CR, Rorhbach BW, Dowlen HH,
Lamar KC. Effects of housing and colostrum feeding on the prevalence of selected infectious organisms in
feces of Jersey calves. Journal of Dairy Science 77, 31 24-31 , 1 994
Quilez J, Torres E, Chalmers RM, Hadfield SJ, Del Cacho E, Sanchez-Acedo C. Genotype and
subtype characterisation of Cryptosporidium in lambs and goat kids in Spain. Applied and Environmental
Microbiology, published ahead of print , doi : 1 0. 1 1 28/AEM.00606-08, 2008
43
Quilez J, Sanches-Acedo C, Clavel A, dei-Cacho E, Lopez-Bernal F. Prevalence of Cryptosporidium
infection in pigs i n Aragon (northestern Spain) . Veterinary Parasitology 67, 83-88, 1 996
Raccurt CP. Worldwide human zoonotic cryptosporidiosis caused by Cryptosporidium felis. (in French,
abstract avai lable in English at http ://www.ncbi .n lm.n ih .gov/pubmed/1 7432054). Parasite 1 4, 1 5-20, 2007
Ranucci L, Mu ller HM, La Rosa G, Reckmann I , Morales MA, Spano F, Pozio E, Crisanti A.
Characterization and immunolocalization of a Cryptosporidium protein containing repeated amino acid
motifs. Infection and Immunity 6 1 , 234 7-56, 1 993
Rid ley RK, Olsen RM. Rapid diagnosis of bovine cryptosporidiosis with a modified commercial
acid-fast staining procedure. Journal of Veterinary Diagnostic Investigation 3, 1 82-3, 1 991
Reif JS , Wimmer L , Smith JA, Dargatz DA, Cheney JM. Human cryptosporidiosis associated with an
epizootic in calves. American Journal of Public Health 79, 1 528-30, 1 989
Riggs MW, Stone AI, Vaunt PA, Langer RC, Arrowood MJ, Bentley DL. Protective monoclonal
antibody defines a ci rcumsporozoite-like glycoprotein exoantigen of Cryptosporidium parvum sporozoites
and merozoites. Journal of immunology 1 58, 1 787-95, 1 997
Riley LW. I n : Molecu lar Epidemiology of I nfectious Diseases, pp. 49. ASM Press, Wash ington DC, USA,
2004
Rochelle PA, De Lean R, Atwi l l ER. Intra-isolate heterogeneity and reproducibility of PC R-based
genotyping of Cryptosporidium parvum using the -tubul in gene. Quantitative Microbiology 2, 87- 1 0 1 , 2000
Ryan UM, Monis P , Enemark H L, Sulaiman I , Samarasinghe 8, Read C, Buddle R, Robertson I ,
Zhou L, Thompson RCA, Xiao L . Cryptosporidium suis N . Sp. (Apicomplexa:Cryptosporidi idae) in pigs
(Sus Scrota) . Journal of Parasitology 90, 769-73, 2004
Ryan UM, Power M, Xiao L. Cryptosporidium fayeri n. sp. (Apicomplexa: Cryptosporidiidae) from the red
kangaroo (Macropus rufus) . Journal of Eukaryotic Microbiology 55, 22-6, 2008
Ryan U, Xiao L, Read C, Zhou L, Lal AA, Pavleski I. Identification of novel Cryptosporidium genotypes
from the Czech Republic. Applied and Environmental Microbiology 69, 4302-07, 2003
Sanford SA, Josephson GKA. Bovine cryptosporidiosis: c l inical and pathological findings in forty-two
scouring neonatal calves. Canadian Veterinary Journal 23, 340-3, 1 982
Santm M, Fayer R. l ntragenotypic variations in the Cryptosporidium sp. cervine genotype from sheep with
impl ications for public health. Journal of Parasitology 93, 668-72, 2007
Santin M, Trout JM. Livestock. In: I n : Fayer, R . , Xiao, L. (Eds. } , Cryptosporidium and cryptosporidiosis,
second ed. CRC Press and lW A Publ ishing, Boca Ratan , FL, pp. 451 -83, 2008
44
Santin M, Trout JM. Companion Animals. In : In : Fayer, R . , Xiao, L. ( Eds.} , Cryptosporidium and
cryptosporidiosis, second ed. C RC Press and lW A Publ ishing, Boca Raton, FL, pp. 437·49, 2008
Santin M, Trout JM, Fayer R. A longitudinal study of cryptosporidiosis in dairy cattle from birth to 2 years
of age. Veterinary Parasitology 1 55 , 1 5-23, 2008
Santin M, Trout JM, Vecino JAC, Dubey J P, Fayer R. Cryptosporidium, Giardia and Enterocytozoon
bieneusi in cats from Bogota (Colombia) and genotyping of isolates. Veterinary Parasitology 1 4 1 , 334-9,
2006
Santin M, Trout JM, Xiao L, Zhoub OL, G reiner E, Fayer R. Prevalence and age-related variation of
Cryptosporidium species and genotypes in dai ry calves. Veterinary Parasitology 1 22 , 1 03-1 7 , 2004
Sargent KD, Morgan UM, El l iot A, Thompson RCA. Morphological and genetic characterisation of
Cryptosporidium oocysts f rom domestic cats. Veterinary Parasitology 77, 221 -7, 1 998
Satcher D. Getting ahead of the curve. Emerging Infectious Diseases 1 , 1 -6, 1 995
Schultz, MG. Emerging zoonoses. New England Journal of Medicine 308, 1 285-86, 1 983
Sevinc F, lrmak K, Sevinc M . The prevalence of Cryptosporidium parvum infection in diarrhoeic and non
diarrhoeic calves. Revue de Medecine Veterinaire 1 54, 357-6 1 , 2003
Sheoran AS, Jeong K, Wiffin A, Chapman-Bonofiglio, Tzipori S. Cryptosporidium hominis-specific
immunity provides incomplete protection against C. parvum in the gnotobiotic piglet model . International
Workshop on Opportunistic P rotists ( IWOP- 1 0}, May 28-3 1 , 2008, Boston MA, USA (Abstract P063}
Siwila J, Phiri IG, Vercruysse J, Goma F, Gabriel S, C laerebout E, Geurden T. Asymptomatic
cryptosporidiosis in Zambian dairy farm workers and their household members. Transactions of the Royal
Society of Tropical Medicine and Hygiene 1 01 , 733-4, 2007
Skerrett HE, Holland CV. Asymptomatic shedding of Cryptosporidium oocysts by red deer hinds and
calves. Veterinary Parasitology 94, 239-46, 2001
Smerdon WJ, Nichols T, C halmers RM, Heine H, Reacher MH. Foot and mouth d isease in l i vestock
and reduced cryptosporidiosis in humans, England and Wales. Emerging Infectious Diseases 9 , 22- 8,
2003
Smith HV, Nichols RAB, G rimason AM. Cryptosporidium exystation and invasion: getting to the guts of
the matter. Trends in Parasitology 2 1 , 1 33-42, 2005a
Smith HV, Nichols RAB, Mallon M, Macleod A, Tait A, Rei l ly WJ, Browning LM, Gray D, Reid SWJ,
Wastl ing JM. Natural Cryptosporidium hominis infections in Scottish cattle. Veterinary Record 1 56, 7 1 0-
1 1 , 2005b
45
Snell ing WJ, Xiao L, Ortega-Pierres G , Lowery CJ, Moore JE, Rao JR, Smyth S, Mi llar BC, Rooney
PJ, Matsuda M, Kenny F, Xu J, Dooley JSG. Cryptosporidiosis in developing countries. Journal of
Infection in Developing Countries 1 , 242-56, 2007
Snyder SP, England JJ, McChesney AE. Cryptosporidium in immunodeficient Arabian foals. Veterinary
Pathology 1 5, 1 2-7, 1 978
Sopwith W, Osborn K, Chalmers R, Regan M. The changing epidemiology of cryptosporidiosis in North
West England. Epidemiology and Infection 1 33, 785-93, 2005
Spano F, Puri C, Ranucci L, Putignani LA, Crisanti. Cloning of the entire COW P gene of
Cryptosporidium parvum and ultrastructural localization of the protein during sexual parasite development.
Parasitology 1 1 4 , 427-37, 1 997
Spano F, Putignani LA, Crisanti A, Sall icandro P, Morgan U , Le Blancq SM, Tchack L, Tzipori S.,
Widmer G. Multilocus genotypic analysis of Cryptosporidium parvum isolates from different hosts and
geographical origins. Journal of Clinical Microbiology 36, 3255-59, 1 998
Starkey SR, Zeigler PE, Wade SE. Factors associated with shedding of Cryptosporidium parvum versus
Cryptosporidium bovis among dairy cattle in New York State. Journal of the American Veterinary Medical
Association 229, 1 623-6. 2006
Stefanogiannis N , McLean M, Van Mi l H. Outbreak of cryptosporidiosis l inked with a farm event. New
Zealand Medical Journal 1 1 4, 51 9-21 , 2001
Steher-Green J, McCaig l, Remsen HM, Rains CS, Fox M, Juranek DD. Shedding of oocysts in
immunocompetent individuals infected with Cryptosporidium. American Journal of Tropical Medicine and
Hygiene 338-42, 1 987
Stewart CG, Penzhorrn Bl . Cryptosporidiosis. in : I nfectious Diseases of Livestock, 2nd edition. Pp. 334.
Authors: JAW Coetzer and RC Tustin. Oxford University press, Oxford UK. 2004
Strong WB, Gut J , Nelson RG. C loning and sequence analysis of a highly polymorphic Cryptosporidium
parvum gene encoding a 60-kilodalton glycoprotein and characterization of its 1 5- and 45-kilodalton zoite
surface antigen products. Infection and Immunity 68, 4 1 1 7-34, 2000
Sulaiman IM, Hira PR, Zhou L, AI-Aii FM, AI-Shelahi F A, Shweiki HM, lqbal J, Khal id N, Xiao L.
Unique endemicity of cryptosporid iosis in chi ldren in Kuwait. Journal of Clinical Microbiology 43, 2805-09,
2005
Sulaiman IM, Xiao L, Yang C, Escalante L, Moore A, Beard CB, Arrowood MJ, Lal AA. Differentiating
human from animal Isolates of Cryptosporidium parvum. Emerging Infectious Diseases 4, 681 -5, 1 998
Suzuki MT, G iovannoni SJ . Bias caused by template annealing in the amplification of m ixtures of 1 6S
rRNA Genes by PCR. Applied and Environmental Microbiology 62, 625-30, 1 996
46
Tanriverdi S, Arslan MO, Akiyoshi DE, Tzipori S, Widmer G . Identification of genotypical ly mixed
Cryptosporidium parvum populations in humans and calves. Molecular and Biochemical Parasitology 1 30,
1 3-22, 2003.
Tanriverdi S, Blain JC, Deng B, Ferdig MT, Widmer G. Genetic crosses in the apicomplexan parasite
Cryptosporidium parvum define recombination parameters. Molecular Microbiology 63, 1 432-9, 2007
Tanriverdi S, Markovics A, Arslan MO, ltik A, Shkap V, Widmer G. Emergence of distinct genotypes
of Cryptosporidium parvum in structured host populations. Applied and Environmental Microbiology 72:
2507- 1 3, 2006
Templeton TJ, Lancto CA, Vigdorovich V, Liu C, London NR, Hadsal l KZ, Abrahamsen MS. The
Cryptosporidium oocyst wall protein is a member of a multigene family and has a homolog in Toxoplasma.
Infection and Immunity 72, 980-7, 2004
Thamsborg SM, Jorgensen RJ, Henriksen SA. Cryptosporidiosis in kids of dairy goats. Veterinary
Record 1 27, 627-28 , 1 990
Theodos CM, Griffiths JK, D'onofrio J, Fairfield A, Tzipori S. Efficacy of nitazoxan ide against
Cryptosporidium parvum in cell culture and in animal models. Antimicrobial Agents and Chemotherapy 42,
1 959-65, 1 998
Tomley FM, Soldati DS. Mix and match modules: structure and function of microneme proteins in
apicomplexan parasites. Trends in Parasitology 1 7, 8 1 -8, 200 1
Townsend KG, Lance DM. Cryptosporidiosis in calves. New Zealand Veterinary Journal 35, 2 1 6-7, 1 987
Traversa D, lorio R, Otranto D, Modryc D, Slapeta J. Cryptosporidium from tortoises: Genetic
characterisation, phylogeny and zoonotic implications. Molecular and Cellular Probes 22, 1 22-8, 2008
Trotz-Wil liams LA, Jarvie BD, Martin SW, Leslie KE, Peregrine AS. Prevalence of Cryptosporidium
parvum infection in southwestern Ontario and its association with diarrhoea in neonatal dairy calves.
Canadian Journal of Veterinary Medicine 46, 349-51 , 2005
Trotz-Wi l liams LA, Martin DS, Gatei W, Cama V, Peregrine AS, Martin SW, Nydam DV, Jamieson F,
Xiao L. Genotype and subtype analyses of Cryptosporidium isolates from dai ry calves and humans in
Ontario. Parasitology Research 99, 346-52, 2006
Tumwine JK, Kekitiinwa A, Bakeera-Kitaka S, Ndeezi G, Downing R, Feng X, Akiyoshi DE, Tzipori
S. C ryptosporidiosis and microsporid iosis in Ugandan children with persistent diarrhea with and without
concurrent infection with the human immunodeficiency vi rus. American Journal of Tropical Medicine and
Hygiene 73, 921 -5, 2005
Tyzzer EE. A sporozoan found in the pepetic gland of the common mouse. Proceedings of the Society for
Experimental Biology 5, 1 2-3, 1 907
47
Tyzzer EE. An extracellular coccid ium, Cryptosporidium muris (ge n . et sp. nov. ) , of the gastric glands of
the common mouse. Journal of Medical Research 23, 487-509 , 1 9 1 0
Tyzzer EE. Cryptosporidium parvum (sp. nov . ) , a coccidium found i n the small intestine of the common
mouse. Arch. Protistenkd. 26, 394-4 1 2 , 1 9 1 2
Tzipori S. C ryptosporidiosis in animals and humans. Microbiological Reviews 47, 84-96, 1 983
Tzipori S. C ryptosporidiosis in perspective. Advances in Parasitology 27, 63- 1 29, 1 988
Tzipori S, Angus KW, Campbell I , Gray EW . Cryptosporidium: evidence of a single species genus.
Infection and Immunity 30, 884-86, 1 980a
Tzipori S, Angus KW, Campbell I , Sherwood D. Diarrhea in young red deer associated with infection
with Cryptosporidium. Journal of Infectious Diseases 1 44, 1 70-5, 1 98 1 a
Tzipori S, Campbell I. Prevale nce of Cryptosporidium antibodies i n 1 0 animal species. Journal of Clinical
Microbiology 1 4, 455-6, 1 98 1
Tzipori S , Campbell I , Sherwood D, Snodgrass OR, Whitelaw A . A n outbreak of calf d iarrhoea
attributed to cryptosporidial infection . Veterinary Record 1 07, 579-80, 1 980b
Tzipori S, G riffiths JK. Natural h istory and biology of Cryptosporidium parvum. Advances in Parasitology
40, 5-36, 1 998
Tzipori S, Larsen J , Smith M, Lue R. Diarrhea in goat kids attributed to Cryptosporidium i n fection.
Veterinary Record 1 1 1 , 35-6, 1 982
Tzipori S, McCartney E, Lawson GH, Rowland AC, Campbell I . Experimental infection of piglets with
Cryptosporidium. Research in Veterinary Sciences 3 1 , 358-361 , 1 98 1 b
Tzipori S, Smith M, Halpin C, Angus KW, Sherwood D, Campbell I. Experimental cryptosporidiosis i n
calves: cl i n ical manifestations a n d pathological findings. Veterinary Record 1 1 2 : 1 1 6-20, 1 983
Tzipori S, Ward H. Cryptosporid iosis : Biology, pathogenesis and disease. Microbes and Infection 4 ,
1 047-58, 2002
Tzipori S, Widmer G. A hundred-year retrospective on cryptosporidiosis. Trends in Parasitology 24, 1 84-
9 2008
Uga S, Matsuo J, Kono E, Kimura K, lnoue M, Rai SK, Ono K. Prevalence of Cryptosporidium parvum
infection and pattern of oocyst shedding in calves in Japan. Veterinary Parasitology 94, 27-32, 2000
Ungar BL, Burris JA, Quinn CA, Finkelman FD. New mouse models for chronic Cryptosporidium
infection in immunodeficient hosts. Infection and Immunity 58, 961 -9, 1 990
48
Upton SJ, Current W. The species of Cryptosporidium (Apicomplexa: Cryptosporidiidae) infecting
mammals. Journal of Parasitology 7, 625-29 , 1 985
Waldron LS, Ferrari BC, Power ML. Glycoprotein 60 d iversity in C. hominis and C. parvum causing
human cryptosporidiosis in NSW, Australia. Experimental Parasitology 1 22 1 24-1 27, 2009
Wang R, WangJ, Sun M, DangH, Feng Y, Ning C, Jian F, Zhang L, Xiao L. Molecular
characterization of the Cryptosporidium cervine genotype from a sika deer ( Cervus nippon Temminck) in
Zhengzhou, China and l iterature review. Parasitology Research 1 03 , 865-9, 2008
Warren CA, Guerrant RL. In: Fayer, R. , Xiao, L. (Eds. ) , Cryptosporidium and Cryptosporidiosis, second
ed. CRC Press and IWA Publishing, Boca Raton, FL, p. 235, 2008
Widmer G, Akiyoshi D, Buckholt MA, Feng X, Rich SM, Deary KM, Bowman CA, Xu P, Wang Y ,
Wang X , Buck GA, Tzipori S. Animal propagation and genomic survey of a genotype 1 isolate of
Cryptosporidium parvum. Molecular and Biochemical Parasitology 1 08 : 1 87-1 97, 2000
Widmer G, Tchack L, C happell C L, Tzipori S. Sequence polymorphism in the beta-tubul in gene reveals
heterogeneous and variable population structures in Cryptosporidium parvum. Applied and Environmental
Microbiology 64 : 44 77-81 , 1 998
Winkworth CL, Matthaei CD, Townsend CR. Prevalence of Giardia and Cryptosporidium spp in calves
from a region in New Zealand experiencing intensification of dairying. New Zealand Veterinary Journal 56,
1 5-20, 2008
Xiao L. Molecular epidemiology of endemic cryptosporidiosis in humans. Proceedings of the 11
International Conference on Giardia and Cryptosporidium, Morelia, Michoacan, Mexico, May 1 3 - 1 8, '
2007. Molecular Ep idemiology and Typing session 2, Abstract 7, 2007
Xiao L, Bern C, Sulaiman IM, Lal AA. Molecular epidemiology of human cryptosporidiosis. In R. C. A.
Thompson (ed.) , Cryptosporidium: from molecules to disease 227-62. Elsevier, Amsterdam, The
Netherlands, 2004a
Xiao L, Cama VA, Cabrera L, Ortega Y, Pearson J, Gi lman RH. Possible transmission of
Cryptosporidium canis among chi ldren and a dog in a household. Journal of Clinical Microbiology 45,
201 4-1 6, 2007
Xiao, L., Fayer, R. Molecular characterisation of species and genotypes of Cryptosporidium and Giardia
and assessment of zoonotic transmission. International Journal for Parasitololgy 38, 1 239-55, 2008
Xiao L, Fayer R, Ryan U, Upton SJ. Cryptosporidium taxonomy: recent advances and implications for
publ ic health. Clinical Microbiology Reviews 1 7, 72-97, 2004b
Xiao L, Feng Y. Zoonotic cryptosporidiosis (Minireview) . FEMS Immunology and Medical Microbiology 52,
309-23, 2008
49
Xiao L, Herd RP. Epidemiology of equine Cryptosporidium and Giardia infections. Equine Veterinary
Journal 26, 1 4-7, 1 994
Xiao L, Moore JE, Ukoh U, Gatei W, Lowery CJ, Murphy TM, Dooley JSG, M il lar BC, Rooney PJ, Rao
JR. Prevalence and Identity of Cryptosporidium spp. in pig slurry. Applied and Environmental Microbiology
72, 446 1 -63, 2008
Xiao L, Ryan UM. Cryptosporidiosis: an update in molecular epidemiology. Current Opinion in Infectious
Diseases 1 7, 483-90, 2004
Xiao L, Ryan UM. Molecular epidemiology. I n : Fayer, R . , Xiao, L. (Eds . ) , Cryptosporidium and
Cryptosporidiosis, second ed. C RC Press and lW A Publishing, Boca Ratan, FL, Pp. 1 1 9- 1 63, 2008
Xiao L, Limor JR, Li L, Morgan U, Thompson RC, Lal AA. Presence of heterogeneous copies of the
small subunit rRNA gene in Cryptosporidium parvum human and marsupial genotypes and
Cryptosporidium felis, Journal of Eukaryiotic Microbiology 46, 44S-45S, 1 999
Xiao L, Zhou L, Santin M, Yang W, Fayer R. Distribution of Cryptosporidium parvum subtypes in calves
in eastern United States. Parasitology Research 1 00, 701 -06, 2006
Xiao L, Sulaiman IM, Ryan UM, Zhou L, Atwil l ER, Tischler ML, Zhang X, Fayer R, Lal AA. Host
adaptation and host-parasite eo-evolution in Cryptosporidium: implications for taxonomy and public health,
International Journal of Prasitology 32. 1 773-85, 2002
Xu P, Widmer G, Wang V, Ozaki LS, Alves JM, Serrano MG, Puiu 0, Manque P , Akiyoshi 0, Mackey
AJ, Pearson WR, Dear PH, Bankier AT, Peterson DL, Abrahamsen MS, Kapur V, Tzipori S, Buck GA.
The genome of Cryptosporidium hominis. Nature 431 , 1 1 07-1 2, 2004
Yang R, Jacobson C, Gordon C, Ryan U. Prevalence and molecular characterisation of Cryptosporidium
and Giardia species in pre-weaned sheep in Australia. Veterinary Parasitology, On line,
doi : 1 0. 1 01 6/j.vetpar.2008. 1 2.021 , 2008
Zamani F, Upton SJ, LeBianc SM. Ribosomal RNA gen e o rganisation in Cryptosporidium parvum,
(abstract 455). In: Program and abstracts of the 45th annual meeting of the American Society of Tropical
Medicine and Hygiene 1 996, Baltimore MD p 250
50
CHAPTER 2
STUDIES OF THE POPULATION G ENETIC STRUCTURE OF
CRYPTOSPORIDIUM PARVUM AND CRYPTOSPORIDIUM HOM/N/5
This chapter contains two studies of the populat ion genetic structure of C. parvum and C.
hominis. The fi rst study (Sectio n 2 . 1 ) is a re-analysis of the raw data previously publ ished by
Mal lon et al . {2003a} (see also Section 1 .9} us ing a different analytical approach based on
diversity statistical tests. The study was possible due to the avai labi l ity of unpubl ished post-code
data generously supplied by Prof. Andy Tait, Wel lcome Centre for Molecular Parasitology,
G lasgow, Un ited Kingdom . These data remain confidential . The second study ( Section 2 .2) is
an or ig inal analysis of mu lti locus genotype data for C. parvum and C. hominis from seven
countries provided by Drs. S. Tarn iverdi and G . Widmer, Department of Infectious Diseases,
Cummings School of Veter inary Medicine, Tufts Un iversity, MA, U SA. All the laboratory work
described in Sect ion 2.2 was performed at Tufts. The author provided C. parvum DNA from New
Zealand, performed the analys is of the data and wrote the manuscript, together with G. Widmer.
The above studies were publ ished as:
Section 2 . 1 : Grinberg A, Lopez-Vi l la lobos N , Pom roy W , Widmer G, Smith H , Tait A. Host
shaped segregation of the Cryptosporidium parvum mult i locus-genotype repertoire.
Epidemiology and Infection 1 36 , 273-78, 2008
Section 2 .2 : Tannverdi S, G ri nberg A, Chalmers RM , Hunter P R , Petrovic Z, Akiyosh i DE,
London E , Zhang L , Tzipori S , Tumwine J K Widmer G . I nferences about the g lobal population
structure of Cryptosporidium parvum and Cryptosporidium homin is . Applied and Environmental
Microbiology, 27, 7227-34, 2008
Both Sections are presented as published, except that their format has been modified as
indicated i n the Preface.
5 1
2.1 HOST-SHAPED SEGREGATION OF THE CRYPTOSPORID/UM PAR VUM M U LTILOCUS
GENOTYPE REPERTOIRE
2.1 . 1 Summary
Cattle are among the m ajor reservoirs of C. parvum in nature. However, the relative contribution
of C. parvum oocysts or ig i nating from cattle to human d isease burden is d ifficult to assess, as
various transmission pathways - i nclud ing the human to human route, can eo-occur. In this
study, m u lti locus genotype richness of representative samples of human and bovine C. parvum
are compared statistically using analyt ical rarefaction and nonparametric taxonomic richness
est imators. Results indicate that in the t ime and space frames underlyi ng the analysed data
humans were infected with sign ificantly wider spectra of C. parvum genotypes than catt le, and
consequently, a signif icant fraction of human infect ions m ay have not orig inated from the local
bovine reservoirs .
Th is study provides statistical support to the emerging idea of the existence of disti nct
anthroponotic C. parvum cycles that do not involve catt le.
2.1 .2 I ntroduction
The m u lt ihost protozoan parasite Cryptosporidium parvum (formerly C. parvum 'Type 2') is a
major cause of diarrhoea i n humans and newborn calves, worldwide. Due to the h igh incidence
of early calfhood infect ions and the large numbers of oocysts shed with faeces dur ing natural
infections (Ongerth and Stibbs 1 989; Uga et al. 2000), newborn calves are considered among
the m ost efficient am pl if iers of C. parvum i n nature. Direct calf-to-human C. parvum
transm ission has been repeatedly i nferred from numerous case and case-control stud ies
(Pohjo la et al . 1 986ab; Reif et al . 1 989 ; S h ield et al . 1 990 ; Mi l lard et a l 1 994; Stefanogiann is et
al . 200 1 ; Hunter et al. 2004; Hunter and Thompson 2005; Xiao et al . 2004) . Yet, the relative
contribut ion of the environmental dispersal of C. parvum oocysts orig inat ing from cattle to
overall human morbidity is difficult to assess, as various transmission pathways , i nclud ing the
human-to-human route , can eo-occur.
Based on molecular epidem iological data, some authors have argued for the existence of
anthroponotic C. parvum that do not cyc le in cattle (Xiao et al . 2004) . I n support of th is idea,
Alves et a l . recently observed that HIV-positive humans in Portugal were infected with a wider
spectrum of C. parvum genetic l ineages than cattle (Aives et al. 2003, 2006) . Such i nference is
of considerable biologic and publ ic health interest, and chal lenges the generally held view that
disease control measures should target l ivestock, in particu lar cattle, as the- main reservoir for
human infections. Yet, thus far this m odel is supported by nonstatistical inferences, and from
the genetic characterisation of C. parvum isolates recovered from H IV-positive patients over
long periods of t ime (Aives et al. 2003, 2006) , and thus, its general val idity needs to be
corroborated.
52
In a study published in 2003, M allon et a l . applied a h ighly discrim inatory mu lti locus genotyping
scheme on a large battery of C. parvum cl inical iso lates from humans and cattle i n the Scottish
regions of Aberdeenshire and Dumfriesshire (Mallon et al . 2003a,b) . Forty eig ht C. parvum
mu lti locus genotypes (MLGs) were described, i ndicating an extensive genetic d iversity of this
parasite. Whereas a number of ubiqu itous and h ighly abundant M LGs caused the majority of
infections in both humans and cattle, there were many low abundance M LGs which were seen
in one or both hosts or reg ions, featuring a superdiverse M LG distribution . Based on a
dendrogram generated using the unweighted pair group method with arithmetic mean
(U PGMA), the authors hypothesised that some C. parvum i nfecting humans m ig ht not cycle in
cattle. Here, the resu lts of an analysis of the MLG abundance data generated by Mallon et al .
are presented. The analysis applies taxonomic diversity stat istical methods to test the
hypothesis that humans are i nfected with a wider spectrum of C. parvum M LGs than catt le. The
results are discussed in an epidem iolog ic and publ ic health context.
2. 1 .3 Materials and Methods
In this study, the C. parvum M LG abundance ( i .e . , the number of isolates in each M LG) of
Aberdeenshire and Dumfriesshi re or iginal ly reported by Mallon et al . (2003a,b) were used. The
or ig inal data f rom Orkney and Thurso were not i ncluded, as no human isolates were original ly
typed i n these regions. The a im of the analysis was to test the hypothesis that humans were
i nfected with a wider spectrum of C. parvum M LGs than catt le. Hence, the M LG richness ( i .e . ,
the total nu mber of MLGs) of the human and bovine C. parvum M LG assemblages were
compared us ing established taxonomic diversity statistics, based on the work ing assumption
that the isolates are independent (Krebs 1 989). To conform to this assumption, it was necessary
to remove the bovine duplicates with the same M LG, or ig inating from the same farm , as within
farm enzootic C. parvum has been repeatedly documented us ing molecular too ls (Peng et a l .
2003 ; Tanriverdi et al . 2006 ; Trotz-Wil l iams et a l . 2006) and such dupl icates could have biased
the results. Therefore, the isolates' post-codes (most l i kely corresponding to the farm of or ig in)
were retrieved, and a new dataset that inc luded only one isolate per M LG-post-code
combination was generated. Hence, data were subjected to the following comparisons:
1 - Com parison between human and bovine C. parvum MLG richness with no reference to the
region of orig in .
2 - Comparison between human and bovine C. parvum M LG richness i n Aberdeenshire.
3 - Comparison between human and bov ine C. parvum M LG richness in Dumfriesshire.
4 - Comparison between M LG richness of bovine C. parvum from Aberdeenshire and
Dumfriesshi re .
5 - Comparison between M LG rich ness of human C. parvum from Aberdeensh i re and
Dumfriesshi re .
6 - Comparison between M LG richness of Aberdeenshi re and Dumfriessh i re , with no reference
to the host species.
53
M LG richness was compared by means of analytical rarefaction and the total r ichness
estim ators Chao 1 and ACE 1 . Rarefact ion is a stat istical method fi rst described by Sanders ( in
Hughes et a l . 200 1 ) for estimating the number of taxa expected to be present in a random
sample of any size taken from a given collect ion. The approach is useful to compare observed
taxonomic r ichness among env i ronments that have been unequally sam pled. I ndeed, observed
taxonomic r ichness can fluctuate stochastical ly due to sampl ing variat ion and is sam ple-size
dependant (Hughes and Bohannan 2005) . In essence, the difference between taxonomic
r ichness of samples taken from homogeneous (non-partitioned) populations should on ly reflect
the combined effect of sampl ing variat ion and sample s ize difference . In our case, rarefaction
answered the question : What i s the expected number of MLGs - and variance - in a random
sample of the size of the smal l subsample taken from the large sub-sample of each
comparison?
Richness estimations by analytical rarefaction were calcu lated us ing PAST software (Hammer
et a l . 2005) , which applies variance est imates g iven by Heck et al . ( 1 975) . Rarefaction cu rves of
the sub-sam ples in each comparison were constructed increasing the sam ple size by one, each
time , using the 'step by 1 ' procedure of the rarefaction menu of PAST. In addition , MLG
richness of the human and bovine samples - and the 95% confidence intervals (Cl ) - were
compared using the nonparametric total r ichness estimator Chao 1 (Chao 1 984) and the
abundance coverage estimator ACE 1 (Chao 1 992) , which return theoretical esti mates of the
total popu lation richness, includ ing u nseen M LGs.
2.1 .4 Results
Overal l , 1 1 bovine dupl icates were e l im inated from the dataset. There were no m issing post
codes of bovine C. parvum from Dumfriesshire, and 1 4 missing post-codes from Aberdeenshire ,
which proportional ly correspond to the possible presence of on ly 2-3 bovine C. parvum
dupl icates for that reg ion . No dupl icates were seen in the human sample; there were 23 m issing
post-codes of human isolates. Yet, as wi l l be discussed later, the possible presence of human
C. parvum dupl icates does not alter the inferences of this study.
The f inal dataset, which consists of 1 67 isolates, is shown in Table 2 . 1 . Twenty f ive M LGs are
represented in humans only, six in cattle on ly, and 1 7 MLGs were shared. Overal l , and in each
reg ion separately, the human C. parvum sub-samples are larger than the bovine C. parvum
sub-samples.
Nominal results of the analytical rarefact ion, Chao1 and AC E 1 total r ichness est imates and their
95% C l , are reported in Table 2.2 and Figure 2 . 1 . Notice that, by rarefaction , the human sub
samples have greater MLG richness than the bovine subsamples, overa l l , and in each individual
region (comparisons H B, HBA, and HBD as defined in Table 2.2). These features are not l ikely
to be the result of stochastic sampl ing variat ion because the 95% lower confidence l im its of the
54
M LG richness of the rarefied human sub-samples do not encompass the observed rich ness of
the corresponding bovine sub-samples. Conversely, the lower 95% boundary of the calcu lated
richness of the rarefied large subsamples in comparisons BB and HH largely overlap the
observed richness of the small subsamples, i ndicati ng that there is no substantial d ifference in
MLG r ichness between the reg ions i n the human or bovine sub-samples (Table 2.2) . The
rarefaction curves are shown in Figure 2 . 1 . N otice that at a sample s ize of 64 in comparison HB,
the rarefaction curve for the bovine sample a lmost reaches the asymptote, whereas the curve
for the human samples is st i l l steep. This suggests that there i s a s ignificant number of unseen
human C. parvum M LGs, but at the same t ime, bovi ne C. parvum MLGs were re latively well
sampled, i . e . a further increase in the size of the bovine sample would not be expected to
greatly increase the number of new MLGs. I nterest ing ly, the rarefaction curves in contrast BB,
HH, and AD largely overlap, which indicates that with in each host, MLG richness does not d i ffer
between regions, nor does it differ among reg ions.
Chao 1 and ACE1 total r ichness est imators of the human sub-sample are greater than the
estimators for the bovine sub-sample. I nterest ingly, the 95% C ls of the Chao 1 estimate of the
human and bovine C. parvum samples do not overlap, and the Cls of ACE 1 esti mator overlap
sl ightly.
55
Human sample
Bovine sample
Total Isolates
Aberdeenshire M LGs
2( l ), 3 ( I ) , 4 ( l ), 5( I ), 6(8), 7(3) ,
8( 1 4), 9( 1 ) , 1 0(3), 1 1 ( 1 ) , 1 3(2) ,
1 5( 1 ), 1 7( 1 ) , 1 8( 1 ), 1 9( 1 ) , 20( 1 ) ,
2 1 ( I ), 22(3) , 23( 1 ), 24(6), 25 (5 ) ,
26( 1 ) , 27( I ) , 28( I ), 29( 1 ) , 30(3 ) . TOTAL ISOLATES: 64
6(9), 7( 4 ) , 8(7) , 9(2), I 0(2), 1 1 ( I ) , 1 2(2) , 1 3( 1 ) , 1 4( 1 ), 1 6( 1 ) , 2 2(4),
23( 1 ), 24( 1 ) 30( 1 ), 3 1 ( 1 ) . TOTAL ISOLATES: 38
102
Dumfriesshire M LG s
6(8 ) , 7( 1 ) , 8(6), 9(2), 1 0( 1 ),
1 1 (3) , 2 2(4), 24( 1 ) , 2 5( 1 ), 46( 1 ) ,
47( 1 ), 50( 1 ), 5 1 ( 1 ) , 52( 1 ) , 5 3(3) , 54( 1 ) , 56( 1 ), 57( I ), 58( I ) .
TOTAL I SOLATES: 39
6(4), 7( 1 ) , 8(7), 9(3), 1 1 ( 1 ) ,
22( 4 ), 23( I ), 24(2), 27( I ), 48( I ), 55( I ).
TOTAL I SOLATES: 26
65
Total isolates
103
64
167
Table 2.1 Distribution of C. parvum multilocus genotypes (MLGs) in Scotland, stratif ied by region
(Aberdeenshi re or Dumfriessh i re) , and host species ( human or bovine C. parvum) . MLGs are represented
with numbers, as in the original papers by Mallon et al. {2003a,b) . MLG abundances are in parentheses.
Comparison
HB
HBA HBD
BB HH AD
MLG richness in the small sub-sample
1 8
1 5
1 1
1 1
1 9
23
Richness (95% Cl) of large samples rarefied
at the respective smallsample size
26.8 (2 1 . 8-30. 1 )*
1 8.67 ( 1 5 , 2-22 .08)*
1 4.4 ( 1 1 . 7- 1 7 . 2 )*
1 2 . 1 (9.8- 1 4 .5 )
1 9 .9 ( 1 5 .5-2 2 . 3 )
23 .5 ( 1 9 .6-26.9)
Chao1 and ACE1 estimators
(95% Cl)
Chao l H: 324 (87- 1 65 3 )
Chao l B : 2 6 (20 - 5 6 )
A CEJ H: I SO (72 - 396)
A CE J B : 36 (22 - 96)
NC NC NC NC NC
Table 2.2 Rarefaction, Chao1 and ACE 1 richness estimators, by comparison. HH, h uman versus bovine
C. parvum; HBA, bovine versus human C. parvum i n Aberdeenshire; HBD, human versus bovine C.
parvum in Dumfriesshi re ; BB, bovine Aberdeenshire C. parvum versus bovine Dumfriesshire C. parvum;
HH, human Aberdeenshire C. parvum versus h uman Dumfriesshi re C. parvum; AD, C. parvum from
Aberdeenshire versus C. parvum from Dumfriesshire. The 95% confidence intervals not encompassing
the observed r ichness of the respective small samples are indicated by asterisks. H : human C. parvum
sample; B: bovine C. parvum sample. C l : confidence i nterval; NC: not calculated.
56
40 30 35 30 25 25 20 20 1 5 1 5 1 0 1 0 5 5 0 0
6-l 3
20 1 6 I -I
1 5 1 2 1 0
1 0
5
0 26 26
30 25 20 1 5 H H 1 0 5 0
65 I 39
Figure 2.1 Rarefaction curves, by comparison. Sample sizes (starting from 1 ) are on horizontal axes and
estimated multi locus genotype (MLG) richness on vertical axes. HB , human versus bovine C. parvum;
H BA, human versus bovine C. parvum in Aberdeensh ire; HBD, human versus bovine C. parvum in
Dumfriesshire; BB, bovine Aberdeenshire C. parvum versus bovine Dumfriesshire C. parvum; AD, C.
parvum from Aberdeenshire versus C. parvum from Dumfriessh ire ; HH , human Aberdeenshire C. parvum
versus human Dumfriesshi re C. parvum. Sub-sample sizes within each comparison are defined in Table 1 .
The long curves in each contrast represent either human or Aberdeensh ire sub-samples. The calculated
rarefied MLG richness are reported nearby the lower 95% confidence interval bars. Rarefaction curves in
contrast HH overlap, so no error bar is provided.
2.1 .5 Discussion
The study reported by Mal lon et al . i n two papers (2003a,b) is one of the most s ign ificant
genetic comparisons between human and bovine C. parvum iso lated from cl in ical ly overt
infections so far publ ished. The orig inal authors explored patterns of population genetic
structure us ing a l lele l inkage statistics and phenetic clustering methods. Here, the M LG
abundances were modelled using the diversity statistical approach , which al lowed an estimation
of total number of MLGs (seen and unseen M LG) as a function of the number of isolates i n the
sample. To comply with the working assumption of the approach, it was necessary to remove
non-i ndependent dupl icates that m ight have inf lated the M LG abundances. The m ost obvious of
such dupl icates were the bov ine isolates of identical M LG , possibly or iginating from the same
57
···· ·· ···· ···
farms . I ndeed, without removing such clusters the d ifference between the M LG richness of the
h u m an and bovine samples wou ld have been g reater. Other levels of spatial clustering of
M LGs, for example clustering due to an imal trade between farms, cou ld not be ruled out. Yet,
such dupl icates are also possible in the human sam ple, as the same M LG may have been
transmitted to different households in the course of point-source outbreaks. Converse ly,
although the presence of post-code dupl icates in the h uman sample were possible (as not all
the human post codes were retrieved) , this does not a lter the resu lts of this study but on the
contrary, if present, such dupl icates on ly increase the sample size of hu man C. parvum without
add ing new M LGs, leading to a m ore stringent statistical test for the comparisons between
h osts .
One of the most important find i ngs of the orig i nal study by Mal lon et al . was that most i nfections
were caused by a relatively smal l number of highly abundant and ubiquitous M LGs that were
s hared by both host species. Our resu lts indicate that the MLG excess seen in the human
sam ple can not be discounted on the basis of sample sizes alone as that it is beyond the
expected stochastic variation determ ined by sample s ize difference. Furthermore, a s imi lar
M LG excess was seen in the human sample in two different regions, but not between the sub
samples or iginati ng from the same host species but fro m different reg ions. This repetition in the
two sub-samples provides a cross validat ion against random type- 1 error (Hughes and
Bohannan 2005) . We therefore infer that in the t ime and space frames underlying the or ig inal
study, hu mans were infected by a s ign if icantly wider spectrum of M LGs than cattle. These
f indings are in accordance with the inference by Alves et al. based on the genotyping of
Cryptosporid ium surface proteins in iso lates recovered f rom H IV positive patients (Aives et al .
2003, 2006), and support i ts extension to the general populat ion.
The occurrence of an excess of low abundance C. parvum MLGs that did not transcend the
human boundary m ig ht i ndicate that certain M LGs i nfecting humans are not self-sustai n ing in
catt le. Such an idea is in l ine with previous observations (Xiao et a l . 2004) , and with the
hypothesis of the occurrence of 'human-only' M LGs form u lated in the orig inal study based on a
s imple i nspection of a UPGMA dendrogram. Alternatively, it m ight merely reflect a wide
reshuff l ing of the parasite's genetic repertoire across the human ecosystems via complex social
networks, such as trave l . Because this study analysed isolates col lected from cl in ical ly overt
cases, it could be claim ed that some M LGs seen on ly in humans caused on ly subcl inical
infections or mi ld d isease in cattle and thus, were not seen. Yet, such possibi l i ty is d iff icult to
reconci le biologically. Indeed, un less the occurrence of host specificity is assumed, newborn
calves - obviously lacking an acqui red active anti- Cryptosporidium i m m unity - should be
considered more susceptible to Cryptosporidium disease than adult humans, which were widely
represented in this study (data not shown) . Furthermore, this study analysed M LG r ichness
differences, hence, the possibi l i ty that M LG richness of bovine C. parvum was underesti m ated
is equal ly val id for the human sample.
58
In conclusion, in the t ime-space frame underlying th is or ig inal study humans were i nfected with
a wider spectrum of C. parvum genotypes than catt le , i nd icat ing that a s ign ificant fraction of
human i nfections was l ikely to have been caused by parasites that did not or ig inate from the
regional bovine reservoi rs. These results do not provide evidence of the occurrence of host
specificity in C. parvum, which in the author' s view can on ly be obtai ned by cross transm ission
studies in cattle us ing putative human-only parasites. Yet, they do not conform to a s i mpl istic
model that considers all C. parvum as m ult ihost anthropozoonotic agents, and support
statist ical ly the emerging concept of the occurrence of d ist inct cycles that do not involve cattle.
Such a phenomenon should be taken i nto account when assessin g the potential benefits of
var ious barriers across the l ivestock-human interface on public health, as it is l i kely that such
barriers would be i neffective in reg ions where anthroponotic C. parvum cycl ing is common.
Further epidemiological studies i n different geographical regions i n which humans and newborn
cattle s hare the same environment, and in vivo in catt le, a re warranted.
59
2.2 INFERENCES ABOUT THE G LOBAL POPULATION STRUCTURES OF
CRYPTOSPORID/UM PAR VUM AND CRYPTOSPORID/UM HOMINIS
2.2.1 Summary
In the previous study, publ ished multi locus genotype data of Scottish C. parvum from cattle and
humans were analysed to explore for the presence of partitions in the genetic reprtoire of the
parasite among the host species. In th is study, a battery of C. parvum and C. hominis i solates
from seven countries was genotyped using a n ine-locus DNA subtyping scheme. To assess the
existence of geographical partitions, the mu lt i locus genotype data were m ined using a cluster
analysis based on the nearest-neighbor principle. With in each country, the population genetic
structures were exp lored by combining d iversity stat istical tests, l i nkage disequ i l ibr iu m , and
eBU R ST analysis . For both parasite species, a quasi-complete phylogenetic segregat ion was
observed among the cou ntries. Cluster analysis accurately identified recently introduced
isolates. Rather than conforming to a strict paradigm of either a clonal or a panm ictic populat ion
structure, data are consistent with a flexible reproductive strategy characterized by the eo
occurrence of both propagation patterns. The relative contribution of each pattern appears to
vary between the regions, perhaps dependent on the prevai l ing eco logical determinants of
transmiss ion.
2.2.2 Introduction
Cryptosporidium parvum and C. hominis are two species of ubiqu itous protozoan parasites
responsible for the vast majority of cases of intesti nal cryptosporidiosis in humans.
Cryptosporidium parvum i nfects humans and an imals and is considered zoonotic. I n contrast,
C. hominis is thought to lack significant an imal reservoirs and appears to be transm itted
primari ly among humans. Transmission is typically through the ingestion of water contaminated
with oocysts, or direct contact with faeces. During most of their life cycle C. parvum and C.
hominis are haploid and reside in the intestinal cells of the host, where they undergo two rounds
of asexual mu ltipl icat ion. Thereafter, the differentiation and fusion of gametes leads to a
transient diploid stage, fol lowed by meiotic division . Meiot ic recombinat ion between genetical ly
heterogeneous C. parvum genotypes has been documented i n experimental infect ion
(Tanriverdi et a l . 2007} , but the relative contribution of this process to the diversificatio n of C.
parvum and C. hominis i n nature is not understood.
Ascertain ing the popu lation genetic structure of C. parvum and C. hominis is relevant to
understanding the pathobio logy of cryptosporidiosis and tracking sources of infectio n .
Cryptosporidium parasite popu lations have been studied using PC R-based ampl ification of
single or mu ltiple genetic markers in Italy (Caccio et a l . , 2000, 2001 ), Denmark ( Enemark et a l .
2002) , Scotland (Section 2 . 1 ; Mallon et al . 2003a,b), Ind ia (Gatei et al . 2007} , Israel and Turkey
(Tanriverdi et al . 2006}, England and Wales (Hunter et al. 2007} , France and H aiti
(Ngouanesavanh et al. 2006) , and I ndia, Kenya, USA, and Peru (Gatei et al . 2006) . Some
60
studies have used a gene encod ing the sporozoite surface glycoprotein G P60 (Ceval los et al .
2000 ; Strong et a l . 2000} . This m arker is appeal ing because of its extensive sequence
polymorphism and functional relevance. However, PCR-based studies based on a sing le-locus
are l im ited in their abi l ity to capture the structure of a popu lation , which is better explored using
m u lti locus typing schemes. The mu lti locus approach was used to explore the popu lation genetic
structures of C. parvum and C. hominis in Scotland (Mal lon et al. 2003a,b) , Haiti
( Ngouanesavanh et al. 2006}, and in I ndia, Kenya, U SA, and Peru (Gatei et al. 2006} .
The a im of the present study was to expand our understanding of the popu lation structure of C.
parvum and C. hominis to a g lobal scale. Therefore , a large battery of archived C. parvum and
C. hominis DNA sam ples from seven cou ntries was genotyped at n ine polymorphic loci , and the
m u lt i locus genotype ( M LG) data were m ined us ing cluster analysis , and com bi n i ng d iversity
statistical tests with measures of l inkage disequ i l ibrium .
2.2.3 Materials and Methods
Parasite samples. DNA from 289 hu man C. hominis isolates from Uganda, the US, and the
U K , and from 2 1 7 human and bovine C. parvum iso lates from Uganda, New Zealand, Turkey,
I s rael, Serbia, and the US were i nit ial ly included . DNA purification m ethods varied from country
to country as described below. Archived DNA was stored at -20QC.
I s rael ( I L) : A total of 62 DNA samples from Cryptosporidium parvum-positive faecal specimens
co l lected between March 2004 and April 2005 from 7-1 3 days-old calves on 1 4 farms ( n=60} , a
horse (n= 1 ) and a goat kid (n=1 } , were used . The col lection sites, oocysts purification and DNA
extraction method were previously described (Tanriverdi et al . 2006} .
New Zealand (NZ) : Twenty six isolates from humans (n= 1 9) and calves (n=7) were used. The
iso lates or ig inated from spontaneously reported cases diagnosed between August and
N ovem ber 2006 at med ical or veterinary diagnostic laboratories in the Waikato reg ion , North
I s land ( n= 1 3) , and in the South Is land (n= 1 3) . To purify the oocysts, approxi m ately 5 g of
faeces were suspended in water to a volume of 7 ml and strained with gauze. A vo lume of 3 m l
of diethyl ether was added to extract the fat (Current 1 990) . Oocysts were captured with 50 111
of i m m unomagnetic beads (Dynabeads®, Dynal , Norway). Purified oocysts were suspended in
1 00 111 TE buffer and subjected to three cycles of freeze-thawing. DNA was extracted from the
oocyst lysate usi n g a commercial column DNA pu rification kit (H i Pure™ template preparation
kit, Roche Diagnostics, l nd ianapol is , lnd . ) as previously described (Tanriverdi et al. 2006) , and
the DNA eluted in 50 111 disti l led water.
Serbia (SRB) : C. parvum-positive faecal specimens ( n=50} were col lected between April 2003
and September 2006 f rom calves 8-30 days of age raised on 1 0 farms located 1 8-45 km from
the city of Belgrade . Oocysts were purified by sedimentation on sucrose g radients as previously
described (Abe et al . 2 002} . Oocysts were lysed with three cycles of freeze-thawing , and DNA
purified with DNA purification kits (QIAamp™ DNA M in i Kit, as previously reported ( M isic and
Abe 2006} .
6 1
T urkey (TR) : Cryptosporidium parvum oocysts were isolated between September 2001 and May
2005 from 1 5 faecal specimens from calves on 1 4 farms in the Kars region in northeastern
Turkey. Oocyst purif ication and DNA extraction methods were previously described (Tanriverdi
et a l . 2006} .
Uganda (UG) : Cryptosporidium-positive faecal specimens (n==237; 62 C. parvum, 1 75 C.
hominis) were collected from chi ldren under five years of age diagnosed with persistent
d iarrhoea at the D iarrhoea Treatment Ward of Mulago Hospital, in Kampala, Uganda, as part of
a large cross-sectional survey that was previously described (Tumwine et al. 2003, 2005} . The
specimens were col lected from November 1 999 through January 2001 , and from November
2002 through May 2003. Most speci mens orig inated from patients resid ing in Kampala and its
surroundings. DNA was extracted us ing the FastDNA® SPIN Kit for Soil (Qbiogene I nc . ,
Carlsbad, California) .
Un ited K ingdom (UK) : A total of 1 43 C. hominis DNA s amples were selected from an archive
com posed of over 1 4 ,000 samples extracted from human isolates submitted between 2000 and
2005 to the UK Cryptosporidium Reference Un it by diag nostic laboratories throughout Eng land
and W ales. Of these, 1 1 3 samples were from sporadic cases in i m m unocompetent patients in
the North West of E ngland and Wales. These cases were previously inc luded in a case control
study which ran from November 2000 to February 2002 (Hunter et a l . 2004} . A further 21 C.
hominis samples from sporadic cases were chosen from the national col lection to include H IV
positive cases, and increase the geographical and age d istribution, and n ine samples were from
cases involved in two outbreaks l inked to water supplies . An outbreak was defined as two or
m ore l inked cases of cryptosporidiosis. Twenty-six sporadic cases had a history of being
outside the UK in the two weeks before the onset of i l lness, of which e ight had been in Pakistan.
Other p laces were defi ned as Mediterranean countries (n== 1 4}, other European desti nations
( n== 1 }, Africa (1 } , New Zealand (n== 1 ) and one unknown. Oocysts were separated from faecal
m aterial by flotation on a saturated salt solut ion, then i ncubated at 1 OOQC for 60 m in , d igested
with proteinase K, and the DNA extracted using DNA extraction kits as above (E iwin et a l .
200 1 } . Of a l l the samples from the UK, 1 05 were re-identified as C. hominis using the L IB1 3
m arker (see below)
United States (US) : Iso lates from the U S included C. parvum (n==1 0) and C. hominis (n==1 1 ) . The
C. parvum isolates were the reference isolate ' IOWA', three laboratory isolates used in human
vo lunteer studies (Okhuysen et al . , 1 999, 2002} , a bovine isolate from the state of Con necticut,
as wel l as isolates f rom spontaneous infections and from HIV positive individuals enrolled in a
cl in ical trial (Widmer et al. 1 998) . The C. hominis isolates were obtained from individuals
enrol led in the same cl in ical trial , f ro m two unrelated H IV-posit ive and two H IV-negative
individuals.
Genotyping. The Lib 1 3 species-specific marker (Tanriverdi et al . 2003} was used to
discri m i nate C. parvum f rom C. hominis and ru le out C. meleagridis, C. muris, and C. andersoni,
except for the isolates from Uganda, which were typed using the COW P restriction fragment
62
length polymorphism ( Spano et al. 1 997) . The UK isolates had all been previously identified at
the COW P locus by PCR-RFLP and were additional ly tested using the Lib 1 3 m arker. Nine m in i
and m icrosatellite markers (MS) were used to subtype C. parvum and C. hominis as previously
described (Tanriverd i et al . 2006; Tanriverdi and Widmer 2006) . Al l genotyp ing work was
performed at Tufts University. Markers are located on chromosome I (MSA, M SB),
chromosome 11 (MSC) , chromosome I l l ( MSK) , chromosome IV (MSE) , chromosome V ( MS9) ,
chromosome VI (MSG) , chromosome V I I ( 1 887) , and chromosome V I I I (TP 1 4) . M inisatell ite
MS9 and microsatel l i te TP1 4 were developed by Mal lon et al. (2003a) and adapted as
previously described (Tanriverdi and Widmer 2006) . PCR amplifications were carried out in a
real-time PCR mach ine (L ightCycler® Roche Applied Science) using SYBR® G reen I m aster
m ix (Roche Diagnostics) as described (Tanriverdi and Widmer 2006) . Amplicons were
fract ionated on 1 5% n ative polyacrylam ide gels and the bands visually scored in comparison to
a set of representative al le les and to a 1 00-base-pairs ladder. The al lele scoring method was
validated by sizing selected markers on a capi l lary electrophoresis instru ment (CEO™ 8000,
Beckman Coulter, Ful lerto n , CA) . Al leles were numbered with a 3-dig it code i ndicating their s ize
i n base-pairs.
Analysi s of the data. Only isolates that amplif ied the Lib 1 3 or COW P marker and al l the n ine
loci were included in the analysis . The M LGs of isolates which i ncluded double banded loci
were defined by om itti ng the large bands. This conversion was arbitrary, and was necessary
because the species a re h aploid. No genotypes with three or more bands were observed. The
possibi l ity that some M LG s generated by the arbitrary om ission of the large bands cou ld have
biased the inferences was ruled out by repeating the analyses after om itting double banded
isolates from the dataset (see below) . To e l im i nate possible bias introduced by resam pl ing sub
structured popu lat ions, on ly one representative isolate per MLG-farm combination was left in
the dataset as described in Section 2 . 1 . Th is resu lted i n the removal of 65 C. parvum i so lates.
This procedure was not applied to human C. parvum and C. hominis as residence i nformation
was not available. However, most isolates from the UK originated from sporadic cases of
cryptosporidiosis in patients residing at d ifferent addresses. For the analysis, M LG data were
compi led in categorical m atrixes com posed of 1 1 colum ns , with C. parvum or C. hominis
isolates characterised by a unique code, n ine al leles, and a MLG identifier. Al l the d ifferences
between proport ions were statistical ly assessed using the two-tailed Fisher's exact test.
The n ine-locus subtyp ing scheme used in this study defines a genetic d istance matrix of only
nine possible values. Therefore, dendrograms were not used to assess g lobal substructur ing
due to the occurrence of t ies and potential for severe distortions. Instead , the extent of
substructuring was assessed using a cluster analysis based on the Nearest Neighbor principle
(Cover and Hart 1 967) . The pairwise Ham ming distances (Hamming 1 950) , expressed as the
number of loci by which the MLGs differ, were used as the genetic d istances . For each C.
parvum or C. hominis M LG, its nearest neighbors, def ined as the M LGs at the shortest
63
Hamming distance, were retrieved manual ly. Within each country, the measure of clustering
was the proportio n of M LGs having al l the nearest neighbors i n the same country. The results
of this cluster analysis were explored by inspect ing the s ing le locus variant networks generated
using eBU RST software as described below. As wi l l be seen, the data did not require any
statistical test ing to be performed.
A combination of methods was used to explore the C. parvum and C. hominis popu lation
structure with in each country. The genetic diversity of both species was assessed using M LG
rank-abundance plots (Whittaker 1 965} , with M LG abundances scaled as a precent. In addit ion,
mu lt i locus genotype rich ness of C. parvum and C. hominis were statistically compared among
countries by means of analytical rarefaction (Section 2 . 1 ; Hughes et al . 200 1 ) . Rarefaction is a
statistical method for estimating the number of taxa expected to be present in a random sample
of any size taken from a given col lection. The approach is useful to compare taxonom ic
richness among environments, as the samples' taxonomic richness is dependent on sample
size, and fluctuates stochastical ly due to sampl i ng variation (Section 2.1 ) . Rarefaction was
performed using the individual-based rarefaction option in PAST software (Ham mer et al. 2005) .
To assess whether the arbitrary om ission of the large bands could have biased the shapes of
the rarefaction curves, the analysis was repeated after omitti ng double-banded isolates.
L inkage disequ i l ibr ium across all loci was assessed using the standard ized i ndex of association
( S/A) proposed by Habould and Hudson (Haubo ld and Hudson 2000). This i ndex, a derivation
of the Maynard S m ith's index of association , f luctuates stochastically around zero in complete
pan mixia, but departs further from zero (u nbound and in both d i rections) as l i nkage
disequi l ibr ium i ncreases. The i ndex, and its probabi l ity under a nu l l model of panmixia, were
calcu lated using L IAN software ( http ://aden ine .biz .fh-weihenstephan .de/cg i-b in/l ian/l ian .cg i .p l ,
accessed Ju ly 2007) , with 1 000 allele random isat ions. Linkage disequi l ibrium statistics were not
calcu lated for C. parvum from the USA, Turkey, and Israel , due to the smal l sample sizes.
These tests were repeated after om ission of double-banded isolates from Uganda.
Finally, the population structures were explored by visual assessment of networks of single
locus variants constructed using the eBU RST software (Fei l et al. 2004) . S ing le locus variant
eBURST networks are diagrams composed of M LGs depicted as dots, which are l i nked to their
s ingle locus variants by l i nes. A dot's diameter is proportional to the relative MLG frequency, so
that the largest dots correspond to the most abundant M LGs and the smal lest dots represent
s ingletons.
2.2.4 Results Genotyping. A total of 5 1 6 iso lates were identified as C. parvum (n=227) or C. hominis
(n=289) and genotyped. Out of 4,644 (5 1 6 isolates for each of the n ine loci) PCRs, 230 (5%)
fai led to generate vis ible ampl icons . The proport ion of fai l ing reactions was sign ificantly g reater
64
i n C. hominis (7 .0%) than i n C. parvum (2 .2%) (two-tai led Fisher's exact test; P=0.001 ) . The
same difference was observed between C. parvum and C. hominis iso lates from Uganda, a
country that provided human samples from both species wh ich were processed i n the same
m anner. Therefore, primer site po lymorphisms or a lower C. hominis oocyst output, rather than
different DNA extraction techn iques or host species, may have contributed to this difference.
Among all PCRs, 30 C. parvum ( 1 .4%) and 42 C. hominis ( 1 .6%) isolates showed double
bands. The s izes of the majority of the C. parvum ( 2 1 /27 [78%)) and C. hominis (33/38 [87%))
bands which were found i n double-banded reactions were also found i nd ividual ly i n other
isolates, suggest ing that most double-banded reactions reflected mixed infections rather than
PCR artifacts. The proportion of double-banded isolates was significantly greater in Ugandan C.
hominis isolates, of which 1 8 .2% had at least one double-banded locus, than in C. hominis
isolates from the Un ited Kingdom, of which on ly two (2%) were double-banded (two-tailed
Fisher's exact test; P=O.OO) (Table 2 .3) . The differences between the proportions of double
banded C. parvum isolates from various countries were also sign ificant. However, there was no
difference between the proportion of double-banded C. parvum and C. hominis iso lates
from Uganda (two-tai led Fisher's exact test; P= 0 .24) . After removing C. parvum replicates and
incomplete C. parvum and C. hominis MLGs, the final data set was composed of 1 23 C. parvum
and 1 90 C. hominis i so lates (Appendix 2 .2) .
Cryptosporidium hominis and Cryptosporidium parvum geographic clustering . Sixty n ine
un ique C. parvum and 73 un ique C. hominis M LGs were included in the cluster analysis
(Appendix 2 .2 ) . No M LGs are shared between the two parasite species or between countries, in
either C. parvum or C. hominis. Remarkably, with the exception of one C. parvum M LG from
Uganda (UG27) , which differs from its nearest neighbor at four loci , and one from Serbia
(SRB46), which has equid istant nearest neighbors in Serbia and Israe l , al l the M LGs have their
nearest neig hbors with i n their own countries, i nd icating that more al leles are shared with i n each
country than between the countries. A marked phylogenetic segregation is also evident in the
single locus variant networks, al l of which are composed of MLGs from only one country (F ig .
2 .2) . Sign ificantly, the C. hominis isolates U K79, U K78, UK8 1 , UK28, and U K29 are not l inked
to the large C. hominis cluster from the Un ited Kingdom . Retrospective analysis of the patients'
data ind icated that al l these M LGs originated from patients that had trave l led to the United
Kingdom from Pakistan less than two weeks pr ior to the iso lation of the parasites. Together, the
clustering of these isolates and the simi lar travel h istories strongly suggested that these isolates
were introduced. I n contrast to other countries , C. hominis and C. parvum M LG s from the United
States did not c luster, which is consistent with the disparate geographic and temporal orig ins of
these samples, and are therefore not shown in Fig . 2 .2.
65
A
IL49
SRB61
SRB62
B
UK31 . UKJO
UK33 • •
• L51
l.4�
ll28
• UG23 o SRBSa
o UGS , SRB59
· SRB46 o UG12
• UG1 1
SRI!eo SRB71
SRB73
. uK2 • UK7B , UK37
, UK79 • UKJ
• UK8 1
e UG2
• UG1 4
• UG20
TR:)l
TR30
TR26 o TR29
• 0024
• 0027
. u= ______. UG 19
0018 NZ� -� _-- NZ35
• UG22 · Nl52 NZ43
• UK29
• UK28 • UK77 • UK82 · UK32
• UG16
• UK4 • UK36
· UK80
. uK20 . uK25
UK22 . • UK26 .!:JK21 -· UG44 ..-
K1 � UK23
• UK2f • UK24
UG71
• UG70
• UG65
, UG74
U013 I ,UG16 ,· -
UG1:; ... . �·�. --U05
·-; UG17 0014 UG12
UG4 1
UG43 UG66 T --- · UG67
�G46 . __ JJG49 u� ,!-JO_OO lK.45: l ,.__ - I tlG40 - . UG39 UG47 .,.
UG7 . .
LJC42 .-
'· ,uG62
GB "- , UGS1
0G56 -r o UGe3 ,uo10
G76
e UG1 1 • UG57
• UG:;.! •--UG6
· 0056
-.. u-;�
- • UG72
, UG64
• UGSO
. UG!>6
UG51
Figure 2.2 Single locus variant eBU RST networks for C. parvum (A) and C. hominis (B) . Each MLG is
represented as a dot and designated by a unique identif ier. Dot diameters are proportional to the number
of isolates. For example, C. hominis UK22 was the most abundant MLG, found in 59 isolates, and the
smallest dots represent singletons. Single- locus variants are connected by l ines. IL , Israel ; NZ, New
Zealand ; SRB, Serbia; TR, Turkey; UG, Uganda; UK, United K ingdom.
66
Population genetic structure. Figure 2 .3 ( left) shows the g lobal MLG rank abu ndance curves
for C. hominis and C. parvum. The plot reveals the presence of a smal l number of highly
abundant M LGs and a large number of s ing letons i n both species, consistent with previous data
from Scotland ( Mallon et al. 2003a,b ; Sect ion 2 . 1 ). I n C. hominis, 59 out of 1 90 (31 %) isolates
belong to the m ost abundant MLG ( U K22) (Appendix 2 .2) , whereas the m ost abundant C.
parvum M LG (NZ41 ) accounts for 1 4/1 23 ( 1 1 %) isolates. A comparison between C. hominis
rank abundance plots from the United Kingdom and Uganda (Fig . 2 .3 , r ig ht) revealed a m ore
even d istribution in Uganda, where the m ost abundant MLG (UG 1 1 ) accounts for only 1 0/85
( 1 2%) of the isolates, compared with 5 1 /74 (69%) in the Un i ted Kingdom ( isolates from patients
reporting trave l excluded) .
� 0
"' u
100
� 10 "0 c: ::> .0 "' "' ·"' iii �
100
-...- UG --o- UK
---+-- C. hominis - -o - C. parvum
10 20 30 40 50 60 70 80 90 10 15 20 25 30 35 40 45 50 rank rank
Figure 2.3 C. parvum and C. hominis MLG rank abundance plots. The relative abundance of each MLG
is shown on the vertical axis as percent of a l l isolates. For each curve, the least abundant MLGs are
singletons. Left: global analysis shows similar rank abundance for both species; R ight: comparison of
Uganda and UK C. hominis showing a more even MLG distribution in Uganda.
Rarefactio n curves were used to compare C. parvum and C. hominis MLG richness levels
among cou ntries (Fig . 2 .4) . The MLG r ichness levels in the C. hominis and C. parvum samples
from Uganda and C. parvum from Turkey and Serbia, countries with a large proportion of
isolates with double-banded loci, are very s im i lar, as indicated by s im i lar rarefaction curves . I n
contrast, M LG richness in the samples from the Un ited K ingdom , Israel , and New Zealand,
countries where only a few double-banded genotypes were observed, is smal ler, as indicated
by lower curves approaching the asymptote. R arefaction curves drawn without double-banded
C. parvum and C. hominis isolates from Uganda and C. parvum isolates from Serbia and Turkey
displayed very s im i lar and overlapping curves ( not shown) , i nd icating that the arbitrary o m ission
of large bands did not bias th is result . As a substantial number of C. parvum and C. hominis
isolates was co l lected from humans in Uganda as part of the same surveys , it was possible to
compare M LG richness levels between C. parvum and C. hominis by using samples orig inat ing
67
c ::J 0 u
80
60
<.9 40 _j :2
20
from the same environment. Rarefied from a sam ple size of 85 to the C. parvum sam ple size of
36, C. hominis M LG richness in Uganda has a value of 24.2, which is the same as the M LG
richness of 24 observed for C. parvum from the same country.
- C. hominis - - - C. parvum
20 40 60 80 100 120 140 1 60 1 80 200 0 10 20 30 40 50 60 70 80 90
isolate count isolate count
Figure 2.4 C. parvum and C. hominis analytical rarefact ion curves. Left, global cu rves; right, country
specif ic curves. Ch, C. hominis; Cp, C. parvum. Error bars indicate the 95% confidence intervals for global
C. parvum and C. hominis and C. hominis from Uganda and the U K. Isolates from the US were excluded.
Note that the MLG richness in New Zealand is the lowest among the analysed countries, a result that wi l l
be re-addressed in the study presented in Section 3.5 and in Chapter 5.
I n addition to showi ng a clear MLG segregation by country, as discussed above in the context of
the cluster analys is , the eBURST d iag rams (Fig. 2 .2) also reveal differences between countries
with respect to the parasites' population structure. The d iagram of C. hominis from the United
Kingdom has a star-l ike topo logy, with the m ost abundant MLG (UK22) connected to the
g reatest number of single-locus variants. This topology is remin iscent of eBU RST networks of
computer-simu lated popu lations d iversifying at a h igh mutation-to-recombination ratio (Turner et
a l . 2007). In samples drawn from such popu lations, most l inks between the s ing le- locus variants
m i rror true clonal descent relat ions. Converse ly, the eBU R ST diag ram for C. hominis from
Uganda is stragg ly and shows long chai n ing of sing le-locus variants, a feature typical of
computer-simu lated popu lations d iversify ing at a low mutation-to-recombination ratio , i n which a
s ignificant proportion of l inks arise from recombination rather than true clonal descent (Turner et
a l . 2007) . The eBURST diagram for C. parvum from Uganda is also stragg ly and shows M LG
chain ing . The exclusion of double-banded isolates from Uganda did not s ign ificantly affect the
topologies of the eBU RST diagrams ( not shown) , indicating that the om ission of the large bands
for the def in it ion of the MLGs did n ot bias these resu lts .
68
I nterest i ng ly, the M LGs with the greatest number of s ingle-locus var iants ( U K22, UG1 1 , U G 1 5,
I L -44 , N Z4 1 ) were also the most abundant in al l the countries where abundant M LGs were
observed ( Fig . 2 .2 and Appendix 2.2) . This pattern argues against a recent epidemic expansion
of the abu ndant M LGs, as in such cases, al l the M LGs were equal ly l ikely to expand
epidem ical ly and prevail in the sample. Instead, the pattern is consistent with a popu lation
orig i nating from founders , as proposed for bacterial species by Fei l and Spratt (2001 ) .
Accord ing to th is structure, abundant genotypes show a g reater degree of diversif ication than
do rare genotypes, s imply because they undergo more m ultiplications than rare genotypes.
In support of the d ifferences between the eBU RST network topologies and M LG rich ness levels
between Uganda and the Un ited Kingdom , there is strong statistical evidence of al lele l i nkage
disequ i l ibrium in C. hominis iso lates from the United Kingdom . Conversely, although
"statistical ly signif icant," the SIA for C. hominis iso lates f rom Uganda is close to zero (Table
2 .3) . I nteresti ng ly, the proport ion of double-banded isolates of C. hominis is also sign ificantly
greater in Uganda than in the Un ited K ingdom, indicati ng a higher rate of m ixed infect ions in
Uganda, but the SJA did not change m uch after e l im inating the double-banded isolates (not
shown) . To further rule out an epidem ic structure or a b ias due to the presence of imported,
thus reproductively iso lated, M LGs in C. hominis isolates from the Un ited Ki ngdom, l i nkage
disequi l ibr ium ana lysis was repeated by us ing one iso late per MLG, without the iso lates from
patients report ing travel . As expected for a basic clonal popu lation structure (Sm ith et al. 1 993) ,
l i nkage disequi l ibr ium persisted (SIA=0 . 1 786; P= 0 .0 1 ) .
The popu lation structure of C. parvum i s less clear a s t h e sample sizes from Israel , Serb ia and
Turkey are relatively smal l , and no C. parvum samples from the UK were avai lable. Although
there is statistical evidence for al lele l i nkage disequi l ibri um in C. parvum from Uganda, the s la is
only 0 . 1 6 and the eBURST diagram is straggly and shows chain ing of MLGs. On the other
hand , there is no statistical evidence for l inkage disequi l ibr ium in C. parvum from New Zealand
and Serbia (Table 2 .3) . However, the lack of l inkage diseq u i l ibrium in these countries should not
be viewed as evidence for complete panm ixia, as it could be due to an u nderpowered statistical
test due to the small sample s ize, or the presence of only four polymorphic loci in New Zealand
C. parvum (Appendix 2 .2 ) . I ndeed, the eBU RST network for New Zealand C. parvum is star-l ike,
with the m ost abundant M LG ( NZ41 ) in the center, rem in iscent of a clonal population structure .
In contrast, the diagrams from Serbia and Turkey are straggly, consistent with the g reater
proport ion of double-banded C. parvum isolates observed in these countries.
69
Number of SIA Number (percentage) of
isolates with (p-value) double-banded isolatel
complete MLGsa
Uganda (UG)
C. hominis 85 0.06 (p<O.OO I ) 3 2 ( 1 8%)
C. parvum 36 0. 1 6 (p<O.OO I ) 7 ( 1 1 %)
UK
C. hominis 95 0.3 8 (p<O.OO I ) 2 (2%)
New Zealand (NZ)
C.parvum 24 0.03 (p<O. I ) 0
Israel (IL)
C. parvum 20 ND l (2%)
Serbia (SRB)
C. parvum 23 0.0 1 6 (p<0. 1 ) 7 ( 1 3%)
Turkey (TR)
C. parvum l l ND 5 (33%)
Table 2.3 C. parvum and C. hominis l inkage disequi l ibr ium and double-banded genotype statistics
according to country of origin. C. parvum and C. hominis i solates from the United States were excluded .
NO, not determined; SIA, standardised index of association.
a Isolates from USA excluded ; b All typed isolates, including incomplete MLGs, were used to calculate the
p roportion of double-banded isolates.
2.2.5 Discussion
I n this study, a battery of C. parvum and C. hominis isolates col lected from seven countries was
genotyped, enabl ing i nferences on the parasites' g lobal population structures to be made. The
m ain aims were to assess whether C. parvum and C. hominis popu lations are geographical ly
partitioned, and if so, compare the structure of different popu lations.
The results of the cluster analysis and the eBURST diagrams show a quasi-complete
phylogenetic segregation among countries i n both parasite species. Gene flow was therefore
70
not sufficient to erase genetic divergence among these geograph ical ly separated populations,
wh ich basical ly rem ained al lopatric . This result is noteworthy consider ing that both species are
cosmopolitan pathogens and m ay eas i ly travel between countries as asymptom atic infect ions.
Potential ly, the ecology of cryptosporidiosis in different countries may have selected for
phenotypes which are best adapted to each environment. This hypothesis would predict that
im ported parasites would be un l ikely to spread if environmental factors or transmission patterns
are unfavourable. This view is supported by the findi ng of a number of clustered C. hominis
isolates from the U nited Kingdom, which were apparently introduced from Pakistan and did not
c luster with the large network of M LG s from the Un ited Kingdom. Analogous observations were
reported in a recent M LG analysis of Scottish and Peruvian human isolates ( Morrison et a l .
2008) and are in accordance with the results of a study using sequence analysis of the G P60
locus (Chalmers et al . 2008) . The diversity between local and imported M LGs m ay also explain
the putative anthroponotic C. parvum reported by other authors (Mallon et a l . 2003b; Hunter et
al. 2007), as it is possible that "anthropogenic" isolates were in fact recently imported.
Geog raphic segregat ion, however, was not reflected in the C. parvum sample from New
Zealand, as no partit ion between North and South Is land was observed and the isolates
clustered in a s ingle eBU RST network (Figure 2 .2 ) . This interesting result suggests that i ntense
gene flow, as m ight occur through animal and human movements , may mix the genetic
repertoire of C. parvum even in the presence of sig nificant geograph ical barriers, i n this case
the Cook Strait. To further evaluate this model, the same cluster ana lysis was performed with
previously published C. parvum M LG data from Scotland (Mallon et al . 2003b) and no
phylogenetic part i t ion between the noncontiguous regions of Aberdeensh i re and Dumfriessh i re
could be seen (Fig u re 1 . 5) . The lack of partitioning i n the Scottish data may be explai ned by the
fact that the cattle popu lation in Aberdeenshire experiences h igh movement due to the im port of
cattle from elsewhere in the United Kingdom, therefore preventing the establishment of settled
and epidemiological ly isolated herds (Gi lbert et a l . 2005) . In contrast to these f indi ngs , C.
parvum samples col lected from ind ividual farms in Israel and Turkey showed a m arked
segregation of the M LGs by farm and a m icroepidemic structure with i n the farms (Tanriverdi et
al. 2006) , i ndicating both micro- and m acroecological factors impact C. parvum populations.
Because C. hominis is thought to propagate pr imari ly i n hum ans but C. parvum has a wider host
range, it was interesting to compare the population structures of t hese species, to assess
whether the differences in host range affect the population structures. Cryptosporidium
parasites have been defined as be ing clonal or panmict ic based o n the resu lts of l inkage
statistical tests emulating null m odels of random allele association (Mallon et al. 2003a,b;
Ngouanesavanh et a l . 2006) . However, these tests are l im ited i n their abi l ity to describe
popu lations propagating both clonal ly and by recom bination, as i n such cases the test stat istic
wil l be below or above the nu l l -model rejection threshold in function of the contribution of each
propagation pattern to the populat ion structure (Sm ith et al . 1 993) . Therefore, in this study we
used a combinat ion of complementary analytical approaches. In contrast to reports of local
7 1
genetic homogeneity i n C. hominis ( Mal lon et al . 2003a; Ngouanesavanh et al . 2006; Hu nter et
al . 2007) , no evidence of difference in the genetic d iversity of C. parvum and C. hominis was
found in Uganda, a cou ntry that provided samples of both species. Furthermore, the eBU RST
topology and l inkage disequi l ibr ium statistics in Ugandan C. parvum and C. hominis are
consistent with a s im i lar population structure in both species. Conversely, the coherent
differences between C. hominis from Uganda and the UK with respect to M LG richness,
eBU RST topology, and SIA, suggest a g reater rate of recombination in C. hominis i n Uganda
than in C. hominis from the U K . The sample from Uganda showed greater M LG richness, as
ind icated by a sign ificantly steeper rarefaction curve , as would be expected in a popu lation that,
in additio n to accum ulat ing variation by mutation , d iversifies by recombinat ion. Consistent with
this resu lt, there is a greater proportion of doub le-banded isolates in Uganda, suggesting that
many infections were caused by genetical ly heterogeneous paras ites, which enhances the
opportun ity for a d iversif ication by recombi nat ion. On the other hand, the resu lts of M LG
diversity analysis, eBURST network topology, and l inkage disequi l ibrium i n the United Ki ngdom ,
converge to i ndicate a g reater contribution of clonal propagation of C. hominis in th is country,
and perhaps also of C. parvum i n New Zealand.
Therefore, rather than being species-specific, C. parvum and C. hominis popu lations appear to
be shaped by local and host-related factors. The author postu lates that frequent transm ission i n
h igh ly contam inated environments increases the probabi l ity of infections with genetical ly
heterogeneous parasites, favour ing recombination . In countries where the san itary condit ions
are better and HIV is less prevalent ( l ike in the U K) , coi nfections with heterogeneous parasites
orig inat ing from environmental sources may be less f requent, and clonal propagatio n may
prevai l .
I n summary, the resu lts presented here ind icate that although C. parvum and C. hominis are
present worldwide, gene flow does not seem suff icient to erase genetic divergence among
geog raph ical ly separated populat ions, support ing a m odel of al lopatr ic diversification . As a
consequence, mu lt i locus genotyping would enable in m any cases the tracking of parasites to
their country of orig i n . R ather than conforming to a strict paradigm of either clonal or panmictic
species, the data are consistent with the eo-occurrence of both propagation pathways. The
relative contribut ion of each pathway appears to vary according to the prevai l ing ecological
determinants of transm ission, indicative of a h igh adaptive plasticity in C. parvum and C.
hominis.
2.3 CONCLUDING REMARKS
The resu lts of the studies presented in this Chapter indicate the existence of a conspicuous
sub-structuring in space and host-range, of the genetic repertoire of C. parvum and C. hominis.
These features support the idea of the existence of anthroponotic C. parvum parasites that do
not cycle in cattle, and i ndicate the feasibi lity of tracki ng of Cryptosporidium parasites to their
72
country of orig in using molecu lar tools. A com bination of different analytical approaches , rather
than l inkage disequ i l ibrium alone where results are open to mu lt iple explanat ions , was used i n
the study presented in Section 2 . 2 to i nfer the population genetic structures of C. parvum and C.
hominis at a g lobal scale. The results converged in indicat ing that C. hominis, and perhaps C.
parvum, are capable of d iversifying both by m utation and recombination. The rel iabi l ity of
genetic markers as faithful i ndicators of ancestry (and their usefulness as epidemio logical
m arkers) m ay thus vary among regions in function of the relative contribution of recombination
to the genetic d iversification . The cl in ico-epidemiological i m pl ications of the b io-geographical
sub-structuring of C. parvum and C. hominis sti l l need to be establ ished .
2 .4 REFERENCES
Alves M, Xiao L, Antunes F, Matos 0. Distribution of Cryptosporidium subtypes in h umans
and domestic and wild ruminants in Portugal . Parasitology Research 99, 287-92, 2006
Alves, M, Xiao L, Sulaiman I, Lal AA, Matos 0, Antunes F. Subgenotype Analysis of
Cryptosporidium Isolates from Humans, Catt le, and Zoo Rum inants i n Portugal . Journal of
Clinical Microbiology 2744-7, 2003
Caccio S, Homan W, Camil l i R , Traldi G , Kortbeek T, Pozio E. A m icrosatellite m arker
reveals popu lation heterogeneity with in human and animal genotypes of Cryptosporidium
parvum. Parasitology 1 20 , 237-44, 2000
Caccio S, Spano F, Pozio E . Large sequence variation at two m icrosatel l i te loci among
zoonotic (genotype C) isolates of Cryptosporidium parvum. International Journal of Parasitology
3 1 , 1 082-6 , 200 1
Chao A. Non parametric esti m ation of the number of classes in a population . Scandinavian
Journal of Statistics 1 1 , 265-70 , 1 984
Chao A, Lee SM. Estimating the number of classes via sampl ing coverage. Journal of the
American Statistical Association 87, 2 1 0- 1 7, 1 992
Cevallos AM, Bhat N, Verdon R, Hamer DH, Stein B, Tzi pori S, Pereira ME, Keusch GT,
Ward HD. Mediation of Cryptosporidium parvum infection in vitro by m ucin-like glycoproteins
defined by a neutralizing monoclonal antibody. Infection and Immunity 68, 5 1 67-75, 2000
Chalmers RM, Hadfield SJ, Jackson CJ, Elwin K, Xiao L, H unter P. Geograph ic Linkage and
Variation in Cryptosporidium hom inis . Emerging Infectious Disease 1 4, 496-8, 2008
73
Cover TM, Hart PE. Nearest Neighbor Pattern Classification . Ieee Transactions on Information
Theory l t 1 3 , 2 1 -+, 1 967
Elwin K, Chalmers RM, Roberts R, Guy EC, Casemore DP. Modificat ion of a rapid method for
the identification of genespecific polymorph isms in Cryptosporidium parvum and its application
to c l in ical and epidemiological invest igations. Applied and Environmental Microbiology
67:5581 -84, 2001
Enemark HL, Ah rens P, Juel CD, Petersen E, Petersen RF, Andersen JS, Lind P,
Thamsborg SM. Molecular characterizat ion of Danish Cryptosporidium parvum i solates.
Parasitology 1 25, 331 -4 1 , 2002
Feil EJ, Spratt BG. Recombination and the population structures of bacterial pathogens.
Annual Review of Microbiology 55, 561 -90, 200 1
Feil EJ, Li BC, Aanensen OM, Hanage WP, Spratt BG. eBU R ST: Inferring patterns of
evolutionary descent among clusters of related bacter ia l genotypes from mu lti locus sequence
typ ing data. Journal of Bacteriology 1 86, 1 5 1 8-30, 2004
Gatei W, Hart CA, G i lman RH, Das P, Cama V, Xiao L. Development of a m u lti locus sequence
typ ing tool for Cryptosporidium hominis. Journal of Eukaryotic Microbiology 53 Suppl 1 , S43-8,
2006
Gatei W, Das P, Dutta P, Sen A, Cama V, Lal AA, Xiao L. Multi locus sequence typ ing and
genetic structure of Cryptosporidium hominis from chi ldren in Kolkata, I nd ia. Infection Genetics
and Evolution 7, 1 97-205, 2007
Gilbert M, Mitchell A, Bourn D, Mawdsley J, Cl ifton-Hadley R, Wint W. Catt le movements
and bovine tuberculosis in Great Britain . Nature 435, 49 1 -6, 2005
Hammer 0, Harper OAT, Ryan PD. PAST: P alaeontolog ical Statistics, ver . 1 .37.
(http ://folk.uio. no/ohammer/past) . Downloaded on 1 5 January 2005
Hamming RW. Error Detecting and E rror Correct ing Codes. Bell System Technical Journal 29,
1 47-60, 1 950
Heck KL, van Belle G, Simberloff D. Explicit calcu lation of the rarefaction d iversity measurement and the determination of sufficient sample size. Ecology 56, 1 459-6 1 , 1 975
Haubold B, Hudson RR. LIAN 3.0: detect ing l inkage disequi l ibr ium in mu lti locus data.
Bioinformatics 1 6 , 84 7-8, 2000
74
Hughes JB, Bohannan BJM. Application of ecological diversity statistics i n m icrobial ecology.
I n : Kowalchuk GA, de Bruj in FJ, Head IM , Akkermans ADL, van E lsas JD (eds . ) . Molecular
Microbial Ecology Manual, 2nd Ed. Pp. 1 33 1 -44. Kluwer Academic Publ ishers, Dordrecht, The
Netherlands 2005
Hughes JB , Hellmann JJ, Ricketts TH. Counting the uncountable: stat istical approaches to
estimating m icrobial diversity. Applied and Environmental Microbiology 67, 4399-06, 2001
Hunter PR, Hadfield SJ, Wilkinson D, Lake IR, Harrison FC, Chalmers RM. Subtypes of
Cryptosporidium parvum in humans and disease risk. Emerging Infectious Diseases 1 3 , 82-8,
2007
Hunter PR, Hughes S, Wood house S, Syed Q, Verlander NO, Chalmers RM, Morgan K,
Nichols G , Beeching N, Osborn K. Sporadic cryptosporidiosis case-control study with
genotyping . Emerging Infectious Diseases 1 0 , 1 24 1 -9, 2004
Hunter P, Thompson RCA. The zoonotic transmission of Giardia and Cryptosporidium.
International Journal for Parasitology 35, 1 1 8 1 -90, 2005
Krebs CJ. Ecological Methodo logy, 2nd ed . , p. 4 1 5. Add ison Wesley Longman I nc . , Menlo
Park, Ca. USA, 1 989
Mallon ME, Macleod A, Wastl ing JM, Smith H , Tait A. Mult i locus genotyping of
Cryptosporidium parvum Type 2: popu lation genetics and sub-structuri ng . Infection, Genetics
and Evolution 3 , 207-1 8 , 2003a
Mallon MA, Macleod J , Wastling H, Smith H, Reil ly 8, Tait A. Population structures and the
role of genetic exchange in the zoonotic pathogen Cryptosporidium parvum . Molecular Genetics
and Evolution 56: 407-1 7, 2003b
Millard PS, Gensheimer KF, Addiss DG, Sosin OM, Beckett GA, Houck-Jankoski A,
Hudson A. An outbreak of cryptosporidiosis from fresh-pressed apple cider
Journal of the American Medical Association 272 : 1 592-96, 1 994
Misic Z, Abe N. Subtype analysis of Cryptosporidium parvum isolates from calves on farms
around Belgrade, Serbia and Montenegro, using the 60 kDa glycoprotei n gene sequences .
Parasitology, 1 -8 , 2006
Morrison LJ, Mallon ME, Smith HV, Macleod A, Xiao L, Tait A. The popu lation structure of
the Cryptosporidium parvum population in Scotland : A complex picture. Infection, Genetics and
Evolution 8, 1 2 1 -9 2008
75
Ngouanesavanh T, Guyot K, Certad G, Fichoux YL, Chartier C, Verdier RI, Cail l iez JC,
Camus D, Dei-Cas E, Banuls AL. Cryptosporidium Popu lation Genetics: Evidence of Clonality
in I solates from France and Haiti . Journal of Eukaryotic Microbiology 53, S33-S6, 2006
Okhuysen PC, Chappell CL, Crabb JH, Sterling CR, DuPont HL. Viru lence of th ree distinct
Cryptosporidium parvum isolates for healthy adults. Journal of Infectious Diseases 1 80 , 1 275-
8 1 , 1 999
Ongerth JE, Stibbs HH . Prevalence of Cryptosporidium i nfection in dai ry calves in Western
W ash ington . American Journal of Veterinary Research 50, 1 069-71 , 1 989
Peng MM, Mark AE, Wilson L, Holland RE, Steven AE, Meshnick R, Lal AA, Xiao L. Genetic
d iversity of Cryptosporidium spp. in cattle in Mich igan: impl ications for understanding the
transm ission dynam ics. Parasitology Research 90, 1 75-80, 2003
Pohjola S, Oksanen H, Jokipii L, Jokipii AM . Outbreak of cryptosporidiosis among veteri nary
students. Scandinavian Journal of Infectious Diseases 1 8, 73-8, 1 986a
Pohjola S, Jokipi i AM, Jokipii L . Sporad ic cryptosporidiosis in a rural populat ion is
asymptomatic and associated with contact to cattle. Acta Veterinaria Scandinavica. 27, 9 1 - 1 02 ,
1 986b
Reif JS, Wimmer L, Smith JA, Dargatz DA, Cheney JM . Human cryptosporidiosis associated
with an epizootic in calves. American Journal of Public Health 79, 1 528-30, 1 989
Shield J, Baumer JH, Dawson J A, Wilkinson PJ. Cryptosporidiosis - an educational
experience. The Journal of I nfection 2 1 , 297-301 , 1 990
Smith JM, Smith NH, O'Rourke M, Spratt BG. How clonal are bacteria? Procceedings of the
National Academy of Science. USA. 90 :4384-88, 1 993
Spano F, Putignani L, Mclauchl in J, Casemore DP, Crisanti A. PCR-RFLP analysis of the
Cryptosporidium oocyst wal l prote in (COW P) gene d iscrim inates between C. wrairi and C.
parvum, and between C. parvum isolates of human and animal or ig in . FEMS Microbiology
Letters 1 50 , 209- 1 7, 1 997
Stefanogiannis N, Mclean M, Van Mil H. Outbreak of cryptosporid iosis l inked with a farm
event. The New Zealand Medical Journal 1 1 4 :51 9-2 1 , 2001
76
Strong WB, Gut J , Nelson RG. Cloning and sequence analysis of a h igh ly polymorphic
Cryptosporidium parvum gene encoding a 60-ki lodalton g lycoprotei n and characterization of its
1 5- and 45-kilodalton zoite surface antigen products . I nfection and Immunity 68, 4 1 1 7-34,
2000
Tanriverdi S, Arslan MO, Akiyoshi DE, Tzipori S, Widmer G. Identification of genotypical ly
m ixed Cryptosporidium parvum populations in humans and calves. Molecular and Biochemical
Parasitology 1 30 , 1 3-22, 2003
Tanriverdi S, Markovics A, Arslan MO, ltik A, Shka p V, Widmer G. Emergence of d istinct
genotypes of Cryptosporidium parvum in structured host popu lations. Applied and
Environmental Microbiology 72, 2507- 1 3 , 2006
Tanriverdi S, Widmer G. Differential evolution of repetitive sequences in Cryptosporidium
parvum and Cryptosporidium hominis. Infection Genetics and Evolution 6, 1 1 3-22 , 2006
Tanriverdi S, Blain JC, Deng B, Ferdig MT, Widmer G . Genetic crosses in the apicom plexan
parasite Cryptosporidium parvum defi ne recombination parameters. Molecular Microbiology 63,
1 432-9, 2007
Trotz-Wil l iams LA, Martin OS, Gatei W, Cama V, Peregrine AS, Martin SW, Nydam DV,
Jamieson F, Xiao L. Genotype and subtype analyses of Cryptosporidium isolates from dairy
calves and humans i n Ontario. Parasitology Research 99, 346-52, 2006
Tumwine JK, Kekiti inwa A, Nabukeera N, Akiyoshi DE, Rich SM, Widmer G, Feng X,
Tzipori S. Cryptosporidium parvum in chi ldren with d iarrhea in Mu lago Hospital, Kampala,
Uganda. American Journal of Tropical Medicine and Hygiene 68, 71 0-5, 2003
Tumwine JK, Kekiti inwa A, Bakeera-Kitaka S, Ndeezi G , Downing R, Feng X, Akiyoshi DE,
Tzipori S . Cryptosporidiosis and m icrosporidiosis in ugandan chi ldren with persistent d iarrhea
with and without concurrent infection with the human immunodeficiency virus. American Journal
of Tropical Medicine and Hygiene 73, 92 1 -5, 2005
Turner KM, Hanage WP, Fraser C, Connor TR, Spratt BG. Assessing the reliabi lity of
eBU R ST using s imu lated popu lations with known ancestry. BMC Microbiology 7, 30, 2007
Uga S, Matsuo J, Kono E, Kimura K, lnoue M, Rai SK, Ono K. Prevalence of
Cryptosporidium parvum infection and patterns of oocyst shedding in calves in Japan.
Veterinary Parasitology 94, 27-32, 2000
77
Whittaker RH. Dominance and diversity in land p lant com munit ies: N umerical relat ions of
species express the i mportance of competition i n commun ity function and evolution . Science
1 47, 250-60, 1 965
Widmer G, Tzipori S, Fichtenbaum CJ, Griffiths JK. Genotypic and phenotypic
characterization of Cryptosporidium parvum isolates from people with A IDS. Journal of
Infectious Diseases 1 78 , 834-40, 1 998
Xiao L, Fayer R, Ryan U, U pton SJ. Cryptosporidium taxonomy: Recent Advances and
Impl ications for Publ ic Health . Clinical Microbiology Reviews 1 7, 72-97, 2004
78
CHAPTER 3
EPIDEMIOLOGICAL STUDIES OF CRYPTOSPORIDIOSIS IN DOMESTIC
ANIMALS IN NEW ZEALAND
This chapter contai ns three epidemiological studies of cryptosporidiosis in New Zealand on
horses (Sections 3 . 1 - 3 .3) and cattle ( Sections 3 .4 and 3 .5) . The studies on horses were
in i tiated in 2002 with a letter submitted by the author to New Zealand equ ine practit ioners. I n
that letter, the practit ioners were asked t o co-operate i n identifyi ng cases o f cryptosporid iosis in
foals in order to genetically characterise the Cryptosporidium isolates , g iven the lack of data
avai lable. Followin g th is in itiative, a phone cal l from a concerned cl in ic ian in the Waikato (Dr.
Laurinda Oliver) was received, which prompted the outbreak investigat ion reported in Section
3 . 1 . The molecular test ing described in th is section was kindly performed and described by the
late J i m Learmonth . The subsequent studies reported in Section 3.2 and 3.3 were performed i n
2006 a n d 2007. T h e stud ies o n catt le were performed i n 2002 (Section 3.4) and 2006 ( Section
3 .5) . Except for some diagnostic test ing performed in the study in Section 3. 1 , all the work for
these studies was performed at Massey University.
Four of the above studies have been publ ished as :
Sect ion 3 . 1 : Grinberg A, Oliver L, Learmonth JJ, Leyland M, Roe W, Pom roy W E . Identif ication
of Cryptosporidium parvum 'cattle' genotype from a severe outbreak of neonatal foal diarrhoea.
Veterinary Record 1 53, 628-30 , 2003
Sect ion 3 .2 : Grinberg A, Learmonth J , Kwan E, Pom roy W, Lopez Vi l la lobos N , Gibson I ,
Widmer G. Genetic diversity and zoonotic potential o f Cryptosporidium parvum causing foal
diarrhoea. Journal of Clinical Microbiology 46:2396-98, 2008
Section 3 .3 : G rinberg A , Pom roy WE, Carslake H , Sh i Y, Gibson I , Drayton B. A study of
neonatal cryptosporidosis of foals i n New Zealand . New Zealand Veterinary Journal 57, 284-
289, 2009
Sect ion 3.4: G rinberg A, Pom roy W, Weston JF, Ayanegui-Aicerreca A, Kn ight D . The
occurrence of Cryptosporidium parvum, Campylobacter and Salmonella i n newborn dairy calves
in the Manawatu reg ion of New Zealand. New Zealand Veterinary Journal 53, 3 1 5-20, 2005
The studies are presented as published, except that thei r format has been modified as indicated
in the Preface.
79
3.1 IDENTIFICATION OF CRYPTOSPOR/D/UM PARVUM 'CATTLE' GENOTYPE FROM A
SEVERE OUTBREAK O F NEONAT AL FOAL DIAR RHOEA
3.1 . 1 Summary
A severe outbreak of diarrhoea in Thoroughbred foals accompanied by shedding of
Cryptosporidium-l ike structures in the faeces of the affected an imals was i nvestigated. The
outbreak occurred in 2002, i n a com mercial Thoroughbred broodmare farm in the Waikato
region of New Zealand . N ine foals suffered from acute, m i ld, and severe disease accom panied
by dehyd ration and weakness. Despite intensive treatments, two foals died from the d isease
and a th i rd was euthanased d ue to severe condition . Six faecal samples from affected foals
were sent to a veterinary d iag nostic laboratory where they were tested for bacterial and vi ral
enteropathogens and for Cryptosporidium. Five faecal samples were positive for
Cryptosporidium. Postmortem examinations were performed on the euthanased foal and on the
dead animals. Gross f indings i ncluded extreme emaciation and di lated , thin-wal led, f lu id-fil led
intestines with no evidence of i nflam mation in the abdom inal cavity. Tissues and a faecal
specimen from the euthanised foal and three faecal specimens from other foals on the farm
were submitted to Massey Un iversity. Al l four faecal specimens were negative for Salmonella
species, Yersinia species, and group A rotavi rus VP6 protein . Microscopically, rou nd, acid-fast
structures resembl ing Cryptosporidium oocysts were seen in the four specimens.
Histopathological ly, numerous round, PAS-negative, Giemsa-positive, Cryptosporidium- l ike
organ isms, 2-5 11m in diameter, were present at the apical border of vi l lous epithel ia l cel ls
throughout the i ntesti ne.
Cryptosporidium isolates recovered from the faeces of three foals were subjected to a
mu lti locus genetic characterization . Sequence analysis of a 850 base-pair ampl icon from the
1 8S rRNA gene revealed sequences identical to each other and to the C. parvum 'cattle'
genotype sequences publ ished at the GenBank accession number AF093490. The mu lt i locus
genotyping showed restriction fragment length features consistent with C. parvum 'cattle'
genotype at the (3-tubu l in gene, the poly threonine repeat, COW P, and the R N R genes. This is
the f i rst report of an outbreak of cryptosporidiosis in foals which incorporated epidem iological,
cl inical and patho log ical data, as wel l as genetic characterization of the outbreak isolates .
3.1 .2 Introduction
The i ntesti nal protozoan parasite Cryptosporidium parvum has been intensively studied over the
past decade, due to its m ajor impact on human and an imal health. So far, two genotypes of C.
parvum have been extensively characterised : the 'human' genotype, primarily associated with
infections in man, and the 'cattle' genotype, found in human beings and also in domestic
livestock such as catt le, sheep and goats (Morgan et al. 200 1 ; Akiyoshi et al. 2002) . The genetic
divergence between the two genotypes manifests at a number of genomic loci , includ ing the
1 8S rRNA gene (Xiao et al. 2000), the Cryptosporidium oocyst wall protein (COWP) gene
(Spano et al . 1 997) , the ribonuclease reductase ( R N R ) gene (Widmer et al . 1 998) , the
80
polythreonine repeat (poly T) (Carraway et al . 1 997) and the r3-tubul in gene (Caccio et a l . 1 999) .
Extensive with in-genotype genetic heterogeneity also exists (Widmer et al . 2002; Mal lon et a l .
2003ab) . Equ ine cryptosporidiosis was in i t ia l ly described i n immunodeficient Arabian foals us ing
morphometric and morphologic parasitolog ical methods, fol lowed by descript ions of the disease
also in immunocompetent foals (Snyder et a l . 1 978 ; G ibson et al . 1 983; Gajadhan et a l . 1 985;
Coleman et al . 1 989) .
Whereas some surveys i ndicate that infections with Cryptosporidium species in horses are
relatively com mon, reports confirm i ng its role in foal d iarrhoea are scarce and attem pts to
produce experimental disease have been unsuccessfu l (Tzipori and Campbell 1 981 ; Tzipori
1 983; Coleman et a l . 1 989 ; Xiao and Herd 1 994; Netherwood et a l . 1 996; Cole et al. 1 998) .
Moreover, the published data on the genetic m akeup and biology of the equ ine isolates i s scant
and, strictly speaking, even their taxonomy with in the genus of Cryptosporidium is sti l l
unresolved.
This study describes the resu lts of an i nvestigation of a severe outbreak of diarrhoea i n
thoroughbred foals, accom pan ied by the shedding of Cryptosporidium- l ike structu res in the
faeces of the affected ani mals. To the author's knowledge, this is the fi rst report of an outbreak
of cryptosporid iosis in foals, wh ich incorporates epidemiological, cli nical and pathological data,
as well as the genetic characterisation of the outbreak isolates.
3.1 .3 Materials and Methods
Outbreak characteristics. Du ring the peak of the foal ing season in 2002, there was a severe
outbreak of foal diarrhoea in a commercial thoroughbred broodmare farm located in the Waikato
region of New Zealand. According to the practit ioner in charge, the outbreak lasted for
approximately one month and, dur ing that period, nine foals suffered from acute, mi ld to severe
d isease accompanied by dehydration and weakness. Approximately 30 foals were born on the
farm dur ing the same period. The i ndex case and six other foals were aged between four and
n ine days at the onset of d iarrhoea. The other two manifested the disease when they were three
weeks of age, which was seven to 1 0 days after returning to the farm from a regional neonatal
i ntensive care u nit where they were sent soon after birth due to unrelated condit ions. During the
outbreak, two foals died f rom the d isease and a third was euthanised due to its severe c l in ical
condition despite intensive treatments, which included intravenous fluids, broad-spectrum
antibiotics ( including metronidazole) , gastric protectants and anti-ulcer medication. Fresh cow
colostrum was also g iven via a nasogastric tube to some of the foals as an external source of
immunoglobu l ins . None of the affected foals was an orphan or on a foster m are . All mares had
colostrum tested at the t ime of foal ing and had adequate readings on a refractometer, with
colostrum immunoglobul in G ( lgG) levels corresponding to approx imately 60 g/litre. The serum
lgG levels of three affected foals were more than 800 m g/d l , indicat ing normoglobulinaemia . A
fourth foal had an lgG level of 640 mg/d l , attributable to fa i lure of passive transfer or to the
8 1
consumption of antibody over the course of the disease. Beef cattle co-existed with the foals
and adu lt horses on adjacent paddocks of the same farm . Yearl ing cattle arrived every year
from a constant external source and no cows calved on the farm . Some paddocks used by
horses during the outbreak had been previously grazed by cattle. Foals aged up to one week
were normal ly housed in a barn with a h igh an imal turnover but, during the outbreak, all new
foals were subsequently stabled in an alternative bui ld ing and a strict isolation of the sick
an imals was promptly implemented. Six faecal samples from affected foals were sent to a
commercial veterinary diagnostic laboratory where they were tested for bacterial and v i ral
enteropathogens and Cryptosporidium. One of the samples had Gram-posit ive rods resembl ing
Clostridium species, but it was negative for Clostridium perfringens on culture. Test ing for
Clostridium difficile toxin was not performed. Five faecal samples were positive for
Cryptosporidium oocysts. Other bacterial or viral pathogens were not detected. Postmortem
examinations were undertaken on the euthanased foal and on the two that died. Gross f i ndings
i ncluded extreme emaciation and di lated th in-walled , f lu id-f i l led intesti nes with no evidence of
inflam mation in the abdom inal cavity.
Laboratory methods. Pieces of small and large intestines, kidney, lung and liver from the
euthanased foal were col lected in 1 0 per cent formal in and subm itted to Massey University,
along with faecal samples from the euthanased foal and from three other affected foals wh ich
were sti l l al ive. The tissues were processed routinely for h istopathology and al l sections were
stained with haem atoxyl in and eosin . Sections of intestine were also stai ned with periodic acid
Sch iff (PAS) and Giemsa. The faecal samples were tested for the presence of several
pathogens. For Salmonella species, the faeces were directly inocu lated onto Xylose Lysine
dehoxycolate (XLD) plates and i ncubated at 37"C for 24 hours, or placed i n selen ite enr ichment
broth for 24 hou rs at 37"C with subsequent subcu ltur ing onto XLD and incubation as before. For
Yersinia species, faeces were directly i nocu lated onto selective-differential media inc luding
cefsu lod in , i rgasan and novobiocin (GIN) and incubated at 37"C for 48 hours. These were
placed in tubes containing phosphate-buffered sal ine (pH 7,3) , and incubated up to 1 4 days at 2
to 4 "C, with subsequent subcultures onto G I N plates , and then incubated as above. Virological
procedures i ncluded test ing for the faecal VP6 protein of g roup A rotavirus with com mercial
immunochromatographic kits, accord ing to the manufacturer's instructions (Rota-Srip ; Goris
BioGoncept, Gembloux, Belg ium) . For Cryptosporidium species, a method based on faecal
oocyst sed imentation by centrifugation, fol lowed by acid-fast stain of smears and screening with
a l ight m icroscope at x400 was applied (the method is described in Section 3.4) .
After completion of the diagnostic tests, the faecal specimens were m ixed with equal volu mes of
2 per cent potassium dichromate and conserved at 2 to 4 "C for further genetic analyses. Two
months later, Cryptosporidium isolates recovered from three faecal specimens were subjected
to a multilocus genetic characterisat ion. Oocysts were concentrated from the faeces and most
of the faecal debris was removed by the formal saline/ether method (Al ien and Rid ley 1 970) .
82
Methanol-fixed smears of the oocyst concentrates were stained with an immunofluorescent
m onoclonal antibody, according to the manufacturer's instructions (Merifluor C/G, Medir idian
Bioscience , C incin nat i , Ohio, USA), and exam i ned with an epifluorescent microscope at x200.
The smears were positive for Cryptosporidium species and negative for Giardia species. To
isolate the oocysts from the rem ain ing faecal debris, an immunomagnetic separation kit was
used according to the manufacturer's instruct ions ( Dynal®, lnvitrogen, Carlsbad, CA, USA) .
DNA was extracted by suspend ing the oocysts in 1 00 !J I of TE buffer ( 1 0mM Tris hydroch loride ,
1 m M disodium ethylenediamine tetra-acetic acid , pH 8·5) containing 1 per cent Non idet P40.
To this, 20 !J I of a 20 per cent suspension of Che lex 1 00 resin (Biorad Laboratories, Hercu les,
CA, USA) was added before f ive freeze/thaw cycles of two m inutes in l iquid n itrogen and two
m inutes in 95 "C water. Ce l l debris was removed by centrifugation at 1 0,000 g for three m inutes
and the supernatant was col lected and stored at 4 "C.
Each isolate was characterised at five genomic loci . A nested PCR-restriction fragm ent length
polymorph ism (PCR- RFLP) analysis was applied at the 1 8S rRNA gene as described by X iao et
al . (2000) , followed by the sequencing in both di rections of the 850 bp f ragment of the
secondary amplicon using an ABI Prism 377 autosequencer (Perkin Elmer, Waltham , MA,
USA) . The 1 8S rRNA gene sequences were al ig ned with other Cryptosporidium 1 8S rRNA
gene sequences in Genbank us ing C lustal W software (Thompson et a l . 1 997).
PCR- RFLP methods were also applied at the �-tubul in gene (Caccio et al . 1 999 ) , COW P gene
(Spano et al . 1 997) , RN R gene (Widmer et a l . 1 998) and a Cryptosporidium poly threonine
repeat (Poly T) (Carraway et a l . 1 997) us ing the restriction enzymes Vspl (Promega, Madison ,
W l , USA), Ode! ( R oche, Auckland, NZ) , Rsal ( l nvitrogen, Carlsbad, CA, USA) , Tsp509 I ( New
England Biolabs, Ipswich, MA, USA) and Rsal ( l nvitrogen, Carlsbad, CA, USA) , respectively,
according to the m anufacturers' instructions. Restriction fragments were resolved on 3 .5 per
cent agarose and the gel was visual ised by ethid ium brom ide stain ing . The DNA from a
previously characterised C. parvum 'human' genotype isolate was i ncluded i n the analysis as a
contro l .
3.1 .4 Results
The four faecal samples were negative for Salmonella spp. Yersinia spp. and g roup A rotavirus
VP6. Microscopical ly, round, acid-fast structures resembl ing C. parvum oocysts were seen .
Histopatho logical ly, v i l l i with i n the duodenum and i leum were moderately atrophic and
occasional groups of vi l l i were fused . There were m i ldly increased numbers of lymphocytes and
plasma cel ls, with occasional neutroph i ls , i n the lamina propria. Numerous round, PAS
negative, Giemsa-positive, Cryptosporidium-l ike organisms, 2 to 5 !Jm in diameter, were present
at the apical border of vil lous epithelial cells throughout the intest ine (F igure 3 . 1 ). These
organ isms were m ost numerous in the duodenum, where they extended to the base of crypts,
but a few organisms were present in the colon . With in the jejunum there were occasional focal
areas of vacuolation of epithel ia l cells at the t ips of the vi l l i . No other relevant h istolog ical
83
abnormalit ies were noted i n the other t issues examined. The lesions were consistent with
intestinal cryptosporid iosis (K im 1 990) .
Sequence analysis of the 850 bp secondary ampl icon f rom the nested PCR-RFLP of the 1 8S
rRNA gene revealed that the three isolates from the foals were identical to each other and to the
published sequences for the 'catt le' genotype (GenBank accession number AF 093490) . The
mu ltilocus PCR-RFLP analysis showed restriction fragments consistent with C. parvum 'cattle'
genotype at the {3-tubu/in gene, po ly T, COW P , and R N R genes (Table 3 . 1 ; Figure 3 .2) .
Figure 3.1 (a) Fused and atrophic duodenal vi l l i (arrow) and mildly increased numbers of mononuclear
inflammatory cells within the lamina propria. Haematoxyl i n and eosin, x 1 00. (b) Protozoal organisms
among microvil li on the luminal border of a duodenal v i l lus (arrow). Giemsa, x 600
Locus PCR length (in base- Restriction 'Human genotype' 'Bovine genotype' pairs) endonuclease fragments size ( in fragments size ( in
base-pairs) base-pairs)
Poly T 3 1 8 Rsal 3 1 8 45, 273
�-tubul in 592 Ode/ 592 1 78, 4 1 4
R N R 441 Tsp509 / 1 80, 21 0 1 0, 47, 7 1 ' 96, 1 07, 1 1 0
COWP 550 Rsa/ 34, 1 06, 1 25, 285 34, 1 06, 4 1 0 1 8S rRNA 832 Vspl 82, 86, 1 04, 560 82, 1 04, 645
Table 3.1 Restriction f ragment length polymorphisms between C. parvum "cattle' and 'human' genotypes.
The bibl iographic references for each locus are provided in the text.
84
(a) 1 2 3 4 5 6 7 8 9 10 (b) 1 2 3 4 5 6 7 8 9 10
... .. :o.1. � � � � ,_. a p.r ..
� � - ...... �.1 ...
� - - -
- ....
-_-"' :'...._ -
...
• = = � ,.,., - -
- .. ..,.., �i�J -· .... • M:' ...... �<....· . .,:.. ··�(.l•. -
Figure 3.2 PeR-restriction fragment length polymorphism analysis of P-tubul in, poly T, R N R and COWP
genes. (a) Lanes 1 and 6 50 bp ladder, Lanes 2 to 4 P-tubu lin , horse isolates, Lane 5 P-tubulin, human
genotype, Lanes 7 to 9 Poly T, horse isolates, Lane 1 0 Poly T, human genotype. (b) Lanes 1 and 6 50 bp
ladder, Lanes 2 to 4 RNR, horse isolates, Lane 5 R N R , human genotype, Lanes 7 to 9 COWP, horse
isolates, Lane 1 0 COW P, human genotype
3.1 .5 Discussion
The results of this study indicate the possibi l ity of the emergence and circu lation of C. parvum
'cattle' genotype in foals, which m ight cause, or be a co-factor of , severe , l i fe-threateni ng
outbreaks of diarrhoea in apparently immunocom petent, normog lobu l inaemic an imals . This
investigation did not i nclude the whole range of possible causes of diarrhoea i n newborn foals,
and it is impossible to rule out completely eo-morbidity with other causes. Nonetheless, the
epizootological features and the histopathological f indings were most consistent with
cryptosporidiosis.
In this case, as in an outbreak previously reported by Konkle et al . ( 1 997) , there was a
tem poral-spatial l ink between the horses and calves. Human and calf cryptosporidiosis due to
C. parvum 'cattle' genotype is commonly diagnosed i n the Waikato d istrict in New Zealand
( Learmonth et al . 200 1 ) , a d istrict also known for its i ntensive cattle-rearing i ndustry and
relatively h igh density of thoroughbred breed ing premises. The same characteristics probably
exist in other horse-rearing countries, yet, to the authors' knowledge, th is is the first report
confirming cryptosporidiosis in foals with identification of C. parvum 'cattle' genotype. This wou ld
suggest that the disease is being underd iag nosed in the f ield, or that the tests used by most
veterinary diagnostic laboratories, whi le being well establ ished for calves, are inadequate for
diagnosing cryptosporid iosis in foals. Alternatively, it is plaus ible that, at present, the
85
susceptib i l ity of horses to C. parvum 'catt le' genotype is l im ited to a relatively narrow spectrum
of pathogenic horse-adapted subtypes , and that disease would only m anifest fol lowing specif ic
sporadic host-parasite encounters. This m ay also account for previous unsuccessful attempts to
produce experimental d isease in foals with bovine isolates (Tzipori 1 983).
I n order to test this hypothesis, a battery of horse iso lates of C. parvum 'cattle' genotype from
different outbreaks needs to be characterised by mu lti locus genetic typ ing of high discrim inatory
power, which may be fol lowed by analys is of the populat ion genetic structure (Aiel lo et a l . 1 999,
Caccio et al . 2000, Mal lon et al . 2003a,b) . Such a study in horses wou ld a lso further the general
understand ing of the m olecular mechanisms of host adaptation in C. parvum.
86
3.2 GENETIC DIVERSITY AND ZOONOTIC POTENTIAL OF CRYPTOSPORID/UM PAR VUM
CAUSING FOAL DIARRHOEA
3.2.1 Summary
Section 3 . 1 reported the fi rst known report of an outbreak of cryptosporid iosis in foals which
included the identification of the isolates as C. parvum. The author postu lated that the
susceptibi l ity of horses to C. parvum may be l im ited to a relatively narrow spectrum of horse
adapted subtypes , and disease would on ly m an ifest fol lowing specific sporadic host-parasite
encounters. Therefore , in the study presented in this section Cryptosporidium isolates from
diarrhoeic foals in New Zealand (n=9) collected during the above outbreak and in 2006-2007 ,
were in itial ly aga in identified as C. parvum. Then, the isolates were subtyped at two
polymorphic loci and compared with human (n=45) and bovine (n=8) isolates. Foal C. parvum
were genetical ly-d iverse, m arkedly s im i lar to human and bovi ne isolates , and carried G P60 /la
A1 8G3R1 al leles, i nd icati ng a zoonotic potentia l .
3.2.2 Introduction
Intestinal Cryptosporidium parasites, in part icular Cryptosporidium parvum, are common causes
of diarrhoea in humans and an imals worldwide. C. parvum is also a zoonotic species.
Diarrhoea! d isease is a common cl inical condition in newborn foals (Cohen 1 994, Knottenbelt et
al. 2005 ; Magdes ian 2005 ; Crabbe 2007) . W hi le results of a number of stud ies suggest that
intestinal carriage of Cryptosporidium is relatively com mon in horses (Xiao and Herd 1 994; Cole
et al. 1 998; Hajduseka et al. 2004 ; Majewska et al. 2004 ; Chalmers et al . 2005) , reports
confirming the role of Cryptosporidium in diarrhoea in foals are rare, and their pathogenic
potential in these hosts is sti l l debated (Wilk ins 2004; Crabbe 2007) . The idea of
Cryptosporidium i n foals being of low pathogen icity is difficult to reconci le with our previous
report of an outbreak of foal diarrhoea in which C. parvum was identified as the sole agent
(Section 3 . 1 ). Therefore, the author hypothesised that d isease in foals m ay be underdiagnosed,
or alternatively, may only man ifest following specific encounters with a narrow spectrum of
horse-adapted parasites (Section 3 . 1 ) . However, at that juncture the hypothesis of the
existence of horse-adapted C. parvum could not be corroborated, as h igh ly-discrim inatory
molecular tools for the subtypin g of the isolates were not widely available.
The aim of th is study was to test this hypothesi s using novel molecular tools. Therefore,
Cryptosporidium isolates collected in New Zealand from diarrhoeic foals in 2002, 2006 and
2007 were genetically identified and subtyped by sequencing of the polymorphic reg ions of the
sporozoite 60-kDa g lycoprote in (GP60) and the 70 kDa heat shock prote in (HSP70) genes. To
infer about the possible routes of transmission and the zoonotic potentia l , the i solates from foals
were compared with isolates from humans and cattle also isolated in New Zealand .
87
3.2.3 Materials and Methods
Parasites. Cryptosporidium-positive diagnostic faecal specimens collected in New Zealand
f rom foals (n=9) , humans (n=45) , and cattle ( n=8) , were used in this study. The specimens from
foals were collected dur ing the foal ing seasons of 2002 (n=3) , 2006 ( n=5) , and 2007 (n= 1 ) . The
specimens from 2002 orig inated f rom an outbreak of foal cryptosporid iosis in the W aikato
region, which has been described i n Section 3 . 1 . Four specimens from 2006 or ig i nated f rom an
outbreak of foal d iarrhoea i n a farm located i n the North Island (see Section 3 .3 ) . One of these
specimens orig inated from a foal that was hospital ised due to severe d iarrhoea, and the other
three were col lected a week later by the fi rst author, from 1 -2 weeks-old diarrhoeic foals
presented for examination dur ing a visit to the farm. The fifth specimen from 2006 and the
specimen from 2007 were diag nostic specimens from two and three weeks old d iarrhoeic foals,
and were donated by a com m ercial laboratory operating in the North I s land. No addit ional
i nformation was provided on these sporadic specimens. The human specimens were col lected
between 2001 and 2003 as p art of a different study ( Learmonth et al. 2004) . As only C.
parvum was identif ied in foals (see below) , C. parvum-positive human specimens were used.
The bovine specimens orig inated from diarrhoeic calves on eight farms, and were col lected
between August -October 2006 by a veteri nary laboratory operating in the North Island . Al l
faecal specimens were stored between 2-4 "C, with no preservatives. Faecal speci mens
collected in 2002 were preserved in 2 per cent potassium dichromate (Section 3.1 ) .
Cryptosporidium identificatio n and subtyping . The identification of human C. parvum and
foal C. parvum col lected in 2002 has been previously done and described by the late J im
Learmonth and eo-workers of the Protozoan Research Un it, Massey University (Learmonth et
a l . 2004; Section 3 . 1 ) . The identification of Cryptosporidium from 2006 and 2007 was performed
us ing a nested PCR followed by sequence analysis of a -850 base-pair segment of the 1 8S
rRNA gene (Xiao et al. 2000 ) . Genomic DNA of the specimens from foals from 2006 was
extracted from the oocysts as described in Section 3 . 1 , with a modification consist ing of the use
of three freeze/thaw cycles of one m inute in l iquid nitrogen and water at 95 "C. Genomic DNA of
bovine specimens and the foal specimen from 2007 was extracted using a DNA extraction kit
(DNA Stool Min i Kit , Oiagen, H i lden , GmbH) . The nested PCR was performed in a thermo
cycler (GeneAmp 9700 Applied Biosystems, Foster City, CA), using the pr imers 5' -GTT AAA
CTG CGA ATG GCT CA -3' (forward) and 5' -CCA TTT CCT TCG AAA GAG GA-3' (reverse)
for the primary amplification of a - 1 325 base-pairs reg ion . The 20 111 reaction m ixtu re consisted
of 2 111 of 1 OX PCR buffer ( ln vitrogen, Carlsbad, CA, USA), 6 m M MgCI2 , 250 mM (each)
deoxyribonucleoside triphosphate, 0.2 mM (each) pr imer, 2.5 un its of P lati num® Taq
( l nvitrogen , Carlsbad, CA, USA) , and 1 �I of DNA template. Thermo-cycl ing consisted of a hot
start at 96"C for two minutes fol lowed by 35 cycles of 94 "C for 30 sec. , 55 ° C for 30 sec., 72° C
for 45 sec. and a f inal extension of 72° C for 5 m in . The prim ary PCR product was di luted 1 : 1 0
with water prior to a secondary amplif ication with the primers 5'-CTC GAG TTT ATG GAA GGG
TTG-3' and 5'- CCT CCA ATC TCT AGT TGG CAT A -3'. Wi th the exception of 3 m M MgCI2
88
the PCR and cycl ing condit ions were the same as the prim ary round. This secondary PCR
product was 850bp in length ( Xiao et al . 2000) . Molecular-grade water and a C. parvum-positive
specimen from a calf were used as negative and positive controls . Amplicons were
electrophoresed in 1 .5% agarose, then stained with eth id ium brom ide and visual ised under UV
lig ht. Products o f the expected size were purified on a column (H igh Pure PCR Product
Purificat ion Kit, Roche D iag nostics, Man n heim , GmbH) and the DNA concentration was
measured us ing a spectrophotometer (NanoDrop 2000, Thermo Fisher Scientif ic, Wi lm ington ,
DE, USA) . Amplicons were then sequenced in both directions using a n ABI 3730 DNA analyser
(Applied Biosystems, Foster City, CA) .
Complementary sequences were alig ned and edited ; m argi nal segments that could not be
accurately determined were tri mmed and the f inal sequences aligned with Cryptosporidium 1 8S
rRNA gene sequences in our database us ing ClustaiX software (Thomson et al . 1 997) . For the
subtyping, genomic DNA was extracted using extraction kits as above. Subtypi ng was ach ieved
by means of sequencing two polymorphic loc i . The f i rst was a - 830 base-pairs region of the
Cryptosporidium sporozoite G P60 gene . Th is locus was ampl ified by Jim Learmonth using the
nested PCR described by G laberman et al. {2000), except that the anneal ing temperature of the
primary PCR of the present assay was 60 "C. The second locus was a - 470 base-pairs reg ion
of the HSP70 gene that comprises a polymorphic repeat (Khramtsov et a l . 1 995; Mal lon et a l .
2003ab) . Ampl ification of th is locus was performed using a reaction developed by Mr . E rrol
Kwan , Protozoa Research U nit, Massey Un iversity.
The PCR mixture included 200�M of the primers 5'- CACCATCCAAGAACCAAAGG (forward) ,
and 5 ' - GCCTAAAGGTAGAGTGTGCTTITC ( reverse) , 1 xPCR buffer ( l nvitrogen, Carlsbad ,
CA) , 1 .5mM MgCI2, 1 m M d NTPs (Fermentas Lifesciences, GmbH) , and 1 un it of taq
polymerase ( Platinum® Taq, l nvitrogen , Carlsbad, CA) , in a final vo lume of 20�1 . Thermo
cycl ing consisted of 1 cycle of 96"C for 2 m i ns , 572C for 2 mins, and 72 "C for 2 mins, then 40
cycles of 94 "C for 30 sec, 57 "C for 30 sec, and 72 "C for 30 sec, and a f inal elongation step of
72"C for 2 mins . Water was used as a negative control in each batch test ing . G P60 and HSP70
amplicons were electrophoresed, purified, and sequenced as above.
Final sequences were alig ned with publ ished G P60 and H SP70 gene sequences (Khramtsov et
al. 1 995; Strong et al. 2000) . Due to the conserved nature of the HSP70 protein among
eukaryotic organisms, the possibi lity that H SP70 genes f rom other organisms were ampl ified
was checked by clusteri ng the sequences on line with s imi lar sequences deposited in GenBank
using the neig hbor-join ing cluster ing algorithm of B LAST
(http ://www. ncbi . n lm .nih .gov/blast/Biast.cg i , accessed on January 2008) (provided by The
National Center for Biotech nology Information of the National I nstitutes of Health , USA) .
89
I n it ial ly, human and bovine Cryptosporidium were not sequenced at the HSP70 locus. However,
isolates having G P60 sequences identical to the sequences in foal isolates were chosen at
random and subtyped at the HSP70 locus, allowin g a comparison between bi locus sequence
types (BLST) from different hosts.
3.2.4 Results
All the 1 8S rRNA gene sequences of foal and bovine Cryptosporidium were i ndisti ngu ishable
from the C. parvum sequence deposited in GenBank u nder accession number AF093490 (X iao
et a l . 2000) . One foal sequence from 2006 in it ial ly d iffered by 1 base-pair, but re-extracted DNA
yie lded a sequence i ndistingu ishable from AF093490 . S ix foal specimens amplif ied at both the
G P60 and HSP70 loci , one at the G P60 locus on ly, one at the HSP70 locus only, and one cou ld
not be amplified at either locus. The edited G P60 and HSP70 sequences were longer than 71 0
and 420 base-pairs, respectively, and comprised the repeat reg ions of both loci . Al l foal , human
and bovine C. parvum had G P60 /la A 1 8G3R1 al leles accord ing to the nomenclature suggested
by Peng et al. (200 1 ) and Sulaiman et al. (2005) . Th is nomenclature consists of the letter 'A'
fol lowed by the number of TCA codons, the letter 'G' fol lowed by the number of TCG codons,
and the letter 'R ' fol lowed by the number of ACATCA sequences at the end of the polyser ine
repeat.
There were five d ifferent GP60 sequences in foal C. parvum, differing by s ing le nucleotide
polymorphisms (SNP) but exhibiti ng more than 99% simi larity with each other (Tables 3.2 and
3 .3 ) . The foal C. parvum G P60 sequences observed in this study have been deposited in
GenBank under accession numbers E U483074 to E U483080.
There were five different HSP70 sequences C. parvum from foals, which differed with each
other by SNPs and from the sequence reported by Kh ramtsov et al . ( 1 995) by the number of
m inisatell ite repeats and/or SNPs external to the repeat. Using Blast software, these sequences
clustered only with C. parvum sequences. In each outbreak, at least one isolate differed from
others at both loc i . E ight subtyped foal C. parvum defi ned seven genetic variants (Table 3 .3 ) .
Identical GP60 sequences were found in three C. parvum from foals, 4 1 /45 from humans, and
the e ight from calves . Ten human C. parvum and the eight bovine C. parvum with th is G P60
al le le were also sequenced at the HSP70 gene, reveal ing the same BLST in two foal , 1 0 human
and seven bovine C. parvum.
90
Bases Cod on
position* change
4 1 9 - 42 1 TCA t o TCG
425 - 427 TCA to CCA
563-565 TCT to TCC
629-631 CAA to CGA
647-649 ACC to ccc
671 -673 AAA to AGA
698-700 ATG to GTG
9 7 1 -973 ACC to GCC
1 070- 1 072 AGA to AGG
Deduced amino acid
change
serine to serine
serine to prol ine
serine to serine
g lycine to argin ine
t h reonine to prol ine
lysine to argin ine
metion ine to val ine
threon ine to alanine
arg i n i n e to argin ine
C. parvum positive specimen in which the polymorphism was
seen
1 -6 ; 9
5
4
6
6
5
5
4
3
Table 3.2 Single nucleotide polymorph isms and deduced am ino acid changes in the 60-kDa g lycoprotei n
o f C. parvum isolates from foals , a s compared with the seq uence reported b y Strong et a l i n GenBank
accession num ber AF022929. D ifferences i n the number of se rine repeats are not reported.
* Accord i ng to Strong et a l . (2000) .
91
Isolate number*
1 I A (foai!W aikato/02)
2/1 (foai/Waikato/02)
3/2 (foai/Waikato/02)
4/7 4 (foai/Manawatu/06)
5/73 (foai/Manawatu/06)
6/48 (foai/Manawatu/06)
7/72 (foai/Manawatu/06)
8/47 (foai/Waikato/06)
9/569 (foai/W aikato/07)
1 0- 1 9 (human)
20-26 (bovine)
27 (bovi ne)
G P60 allele designation
2
3
4
5
ON
ON
HSP70 allele B LST
designation designation
2 2
3 3
3 4
ON NO
4 5
ON N O
5 N O
2 2
2 2
2 2
N O N O
Table 3.3 Bilocus sequence types (BLST) of foal , human, and bovine Cryptosporidium parvum i n New
Zealand. Arbitrary numbers designate alleles and BLSTs. Isolates 9/569 and 8/47 are from the sporadic
cases. BLST, b i locus sequence type; DN, did not ampl ify; GP60, C. parvum 60-kDa su rface glycoprotei n ;
H SP70, C. parvum heat-shock protein 70 gene ; N O : not determined. * : these isolate numbers were used
a lso in GenBank
3 .2.5 Discussion
This is the fi rst report describing the genetic d iversity of Cryptosporidium parasites caus ing foal
d iarrhoea. The key f indings of this study were the high genetic diversity of foal C. parvum and
their s imi larity with human and bovine isolates.
Based on the identificat ion of a novel partial 1 88 rRNA gene sequence in a Przewalski's wild
horse ( Equus przewalskit) i n a zoo (Ryan et al. 2003), X iao and Feng suggested that horses are
i nfected with a Cryptosporidium 'horse genotype' (Xiao and Feng 2008) , which has never been
identified in other hosts. In addit ion, results of recent molecular studies support the possib i lity of
the existence of host-restriction in C. parvum ( Mal lon et al. 2003a,b; Xiao and Feng 2008) .
92
Thus, the mere identificat ion of C. parvum in the 2002 outbreak did not allow conclusions to be
drawn about the or ig in or zoonotic potential of foal Cryptosporidium. In this study, the isolates
were identified , subtyped, and then compared with human and bovine iso lates.
Conform ing with the superdiverse genetic structure described for C. parvum populations i n
Sect ion 2. 1 , eight foal isolates cou ld b e subdivided into seven genetic variants . Nonetheless,
the dominant /la G P60 allele and BLST were shared by the three host species. G P60 /la al leles
are also highly prevalent in human and bovine C. parvum in other countries (Sula iman et al.
2005; Leoni et al . 2007) . Therefore, the genetic repertoire of foal, bovine and human C. parvum
largely overlap, and so foal C. parvum should be considered potential ly zoonotic.
Lastly, in accordance with the resu lts of waterborne outbreak investigat ions in hu mans (Mathieu
et al . 2004; G laberman et a l . 2000; Leoni et a l . 2007) , we identified different C. parvum al leles
among foals in two outbreaks, suggest ing that genetical ly-heterogeneous parasite assemblages
m ay be involved in outbreaks of cryptosporidiosis. This feature may hamper our abi l ity to track
infectio n sources using molecular tools.
93
3.3 A STU DY OF NEONATAL CRYPTOSPORIDIOSIS OF FOALS IN NEW ZEALAND
3.3.1 Summary
Sections 3 . 1 and 3.2 dealt with the molecu lar characterisation of Cryptosporidium parasites
causing neonatal diarrhoea in foals. The study presented in the present Section deals with the
cl in ico-epidemiological aspects of neonatal cryptosporidiosis in farmed foals in New Zealand.
The Cryptosporidium isolates collected dur ing th is study were included in the study reported in
Section 3 .2 .
To assess the occurrence of Cryptosporidium oocysts i n d iagnostic faecal specimens f rom
foals, selected specimens received by a di agnostic veterinary laboratory i n New Zealand
between 2006 and 2007 were subm itted to Massey Un iversity (MU) and tested microscopical ly
for the presence of Cryptosporidium oocysts. Then , the Cryptosporidium parasites were
genetical ly identified to taxon level . I n addit ion, specimen subm ission data from the
participat ing laboratory for 2005-2007 were examined.
Twelve faecal speci mens from diarrhoeic foals were transferred to MU between 2006 and 2007,
from which three tested posi t ive for C. parvum. One Cryptosporidium-positive specimen
identified i n the course of the study orig inated from a foal that was hospital ised due to severe
diarrhoea. This case tr iggered an on-site investigation of the broodm are farm that i t came from,
which revealed a high incidence of neonatal diarrhoea in foals. Four affected foals were
examined during two visits to the farm . In all four cases, the d isease was self- l imit ing and
man ifested during the second week of l ife, rasembl ing foal heat d iarrhoea. A s imi lar c l in ical
manifestat ion had been observed by the owner and the veteri narian in charge in most of the
foals born on the farm during the foal ing season . Cryptosporidium parvum was the on ly
enteropathogen found i n the faeces of the 4/4 affected foals examined. The oocyst shedding
was of short du ration and intense in al l cases, reminiscent of cryptosporid iosis i n calves.
Specimen submission records for 2005-2007 indicated 67 faecal specimens were tested for
Cryptosporidium by the part ic ipat ing laboratory, and 1 2 ( 1 8%) tested positive.
3.3.2 Introduction
Numerous microorganisms, parasites, and non-infectious factors have been associated with
neonatal d iarrhoea in foals ( Magdesian 2005) . However, the causal role of many of these
agents is u ncertain, and it has been est imated that the aet iological diagnosis of diarrhoea i n
foals remains elusive in about 50% o f cases (Knottenbelt e t a l . 2005) .
Cryptosporidium protozoan parasites, i n particu lar C. parvum, are common causes of diarrhoea
in humans and young calves worldwide. Cryptosporidium parvum is also a zoonotic species
(Fayer 2008). Carriage of Cryptosporidium parasites appears to be relatively common in horses
94
(Tzipori and Campbell 1 98 1 ; Coleman et a l . 1 989; Xiao and Herd 1 994; Cole et al . 1 998;
Hajduseka et a l . 2004; Majewska et a l . 2004; Chalmers et al. 2005) . However, reports
confirm ing the role of Cryptosporidium in d iarrhoea in foals are scarce, and their pathogenic
potential in immu nocompetent an im als has been debated (Wilkins 2004; Crabbe 2007) . The
concept of low pathogenicity for Cryptosporidium i s also supported by early, unsuccessful
attempts to produce disease in foals using isolates from calves (Tzipori 1 983} , and by at least
one study which found no association between the presence of Cryptosporidium oocysts and
d iarrhoea in horses (Xiao and Herd 1 994} . S im i larly, in a case control study performed in the
Un i ted Kingdom, Netherwood and eo-workers ( 1 996) found Cryptosporidium oocysts in 1 7% of
d iarrhoeic foals and 20% of controls , but a statistically sig n ificant association between the
presence of the oocysts and d iarrhoea in only one of the mu ltivariate statistical models
exami ned. Further, data from the United States and the United Kingdom i ndicate that testing for
Cryptosporidium is not widely performed by d iag nostic laboratories, and the agent is not
consistently i ncluded in the differential d iag nosis of diarrhoea in foals in epidemiolog ical studies
(Anonymous 2007a,b,c, 2008a,b; Hol l is et al. 2008 ; Roberts et al. 2008; Woh lfender et al.
2009) .
The concept o f a low pathogenicity o f Cryptosporidium i n foals is difficult to reconcile with the
previous report of an outbreak of d iarrhoea in foals in New Zealand in which C. parvum was
identified as the sole agent (Sect ion 3 . 1 ) . In the present section, the results of a survey of the
occu rrence of Cryptosporidium parasites in d iag nostic faecal specimens from diarrhoeic foals
subm itted to a diagnostic veterinary laboratory in New Zealand are presented. The results of the
survey, and of an investigation of an outbreak of cryptosporidiosis in foals triggered during the
same survey, are discussed in view of the author's previous f indings.
3.3.3 Materials and methods
Study outline. Between 2005 and 2007, a col laborative study between Massey University (MU)
and a diagnostic laboratory operat ing i n the North Island of New Zealand was conducted. The
study a im was to assess the occurrence of Cryptosporidium oocysts in diagnostic faecal
speci mens from foals, and genetical ly characterise Cryptosporidium iso lates. Therefore, a
subset of faecal specimens from foals received in 2006 and 2007 by the participating laboratory
for a m icrobiolog ical analysis for causes of diarrhoea was transferred to MU . The specimens
were transferred at the discretion of the pathologist in charge, provided faecal m aterial was
ava i lable after the completion of the requested tests, and regardless of whether or not the
test ing for Cryptosporidium had been i n it ial ly requested . In addition, the participat ing laboratory
provided specimen submission data for 2005, 2006, and 2007. The results of the genetic
characterisation of the i solates has been reported in Section 3 .2 .
On-site outbreak investigation. I n November 2006, large numbers of Cryptosporidium
oocysts were seen on d i rect faecal smears from one of the specimens transferred to MU . The
95
specimen originated from an 8-day-old Thoroughbred foal ( index case) that had been
hospitalised at MU due to severe diarrhoea. The foal was born on a broodmare farm in the
lower North Is land. The referring veterinarian reported that there had been a high i ncidence of
neonatal d iarrhoea on the farm, which prompted an outbreak investigation .
The farm was visited twice, on 5 and 12 December 2006 . Three diarrhoeic foals (aged 6, 8 , and
1 1 days at the first visit) and their dams, were presented for examination dur ing these visits.
Faecal and environmental specimens were col lected at each visit, and rectal faecal specimens
collected from the foals during the fi rst ( n=3) , and second (n=3} visit to the farm, and from thei r
mares (n=3) dur ing the fi rst visit . Faecal specimens from the hospital ised foal were taken 1 , 4 ,
5 , 6 , 8 , and 1 1 days fol lowing admission (n=6} . In add ition , a sample of bedd ing material from
the foal ing shed, and muddy soil from a paddock used to house mares and foals, were
col lected . All the samples were analysed for Cryptosporidium and other com mon
enteropathogens of foals.
Laboratory methods. In order to increase the sensitivity of the test for the detection of
Cryptosporidium oocysts, the faecal spec imens submitted to MU were tested by means of two
methods, with parallel i nterpretation . The fi rst method included the s imple stain ing of d i rect
faecal smears using both the modified Ziehi-Neelsen (ZN) stain and a bivalent com mercial
immunofluorescence test kit for Cryptosporidium and Giardia (Mer iF iuor Crypto & G iardia;
Merid ian Bioscience, Cincinnati OH, U SA) . The stained smears were examined microscopically
at 400x m agn ification , and were considered positive for Cryptosporidium i f there were one or
more round acid-fast oocysts of 4-6 �m diameter contai n ing internal sporozoites (Ortega and
Arrowood 2003}, or apple-green f luorescent oocysts. The specimens that tested negat ive by
this method were then subjected to an additional test, which d iffered in that it included
separation of the oocysts from faecal debris by sed imentat ion prior to the preparat ion of the
slides as previously described (Grinberg et a l . 2002; see also Section 3 .4} .
The specimens col lected from the hospita l ised foal one day after adm ission and from the foals
during the f i rst visit to the farm , were tested for the presence of Cryptosporidium and Giardia as
described above, and for ova of he lm inths, Salmonella spp. , and Group-A rotavirus. Testing for
Salmonella spp. was performed using an i nocu lation of a loopful of faeces onto xylose-lysine
deoxycholate agar and into selenite enr ichment broth fol lowed by subcu lture onto xylose-lysine
deoxycholate (Fort Richards Laboratories, Auckland, NZ) . Media were incubated for 24 h at
37"C in aerobic cond itions . Testing for Group-A rotavi rus was performed using a com m ercial
latex agg lut ination test kit (SerobactRotavirus ; Medvet, Adelaide, Austral ia) . The presence of
ova of helminths in the faeces was assessed m icroscopically after salt flotation by the
technician of the laboratory of parasitology of the Institute of Veterinary, Animal and Biomedical
Sciences, M U . Specimens from mares, subsequent specimens collected from the hospital ised
96
foal on Days 4, 5 , 6 , 8 and 1 1 fol lowing admission, and from the foals during the second visit to
the farm, were on ly tested for Cryptosporidium, as the other agents had already been excluded.
The samples of bedding materia l and soi l were on ly tested for the presence of Cryptosporidium
using the followi ng method : A 5 g sample from each source was suspended i n 50 m l tap water,
sieved through a coarse sieve , and centrifuged at 900g for 1 0 m inutes. The deposit was re
suspended in 3 m l water, and tr ipl icates of 1 0 1-11 were deposited as drops on sl ides, stained for
imm unofluorescence, and screened microscopical ly as described above .
The taxonomic identificat ion of the Cryptosporidium parasites was performed by means of
sequence analys is of a species-specific reg ion of the Cryptosporidium 1 8S small subunit
ribosomal RNA ( 1 8S rRNA) gene, us ing the oocyst separat ion method, and nested PCR and
sequencing procedures described in Section 3.2 .3 . I n addition , DNA was extracted from the two
environmental samples using a DNA extraction kit ( DNA Stool Min i Kit ; Qiagen, H i lden ,
Germany) , and tested for the p resence of the Cryptosporidium 1 8S rRNA gene us ing the same
nested PCR and sequencing m ethods,
The number of Cryptosporidium o ocysts per ml of faeces was estimated in the first faecal
specimen col lected from the hospitalised foal , and in one specimen col lected from a diarrhoeic
foal during the fi rst visit to the farm. These specimens were thorough ly mixed , and tripl icates of
1 0 IJ I were seria l ly di luted in normal saline to a d i lution of 1 o-2. A 1 0 1-1 1 a l iquot of this d i lution
was deposited as a drop on a s l ide and stained usi ng the immunofluorescence kit. The oocysts
on the entire surface of the drops were counted using the 400x m agn if ication of an
epifluorescent m icroscope, and the number of oocysts per ml of faeces extrapolated by
mu ltiplying the mean count of the tripl icates by 1 o4. An oocyst count cou ld not be performed on
the other specimens from foals on the farm due to the need to preserve the smal l amount of
faecal material obtained for DNA extraction .
3.3.4 Results
Laboratory submission data for 2005-2007. A total of 1 3 1 specimens from foals with a
history of diarrhoea and/or enteritis were received by the participati ng laboratory between 2005-
2007. I n many cases the specimens arrived with a request for testing but with no cl i nical
history ind icated. Routine testin g for Cryptosporidium was only performed if specifically
requested by the submitt ing veterinarian or patholog ist in charge, by means of a ZN sta in of
faecal smears. Only 67 speci mens were tested for Cryptosporidium and 1 2 ( 1 8%) tested
positive. Twelve l iquid faecal specimens, not all i n itia l ly tested for Cryptosporidium by the
participating laboratory, were transferred to MU in 2006 and 2007, and were used in this study
in addition to the specimens col lected during the on-farm investigat ion . Three of these
specimens tested positive for Cryptosporidium at M U . Two of the Cryptosporidium-positive
specimens were col lected from foals in the Waikato aged 2 and 3 weeks, in 2006 and 2007; no
97
addit ional information o n these specimens was avai lable. The th i rd Cryptosporidium-positive
specimen or ig inated from the h ospitalised foal . Sequence analysis revealed that these i so lates,
and the additional isolates col lected during the o n-farm investigat ion (see below) , were C.
parvum (the molecular ident ification of these parasites is reported in Section 3 .2) .
Findings from the on-site investigation. The index case had a normal parturition and nursing
h istory; 700 ml of the m are's colostrum was admin istered by stomach tube to the foal 1 hour
after birth and the foal stood and nursed normally. Twelve hours pr ior to admission, the foal
developed watery, m alodorous, non-haemorrhagic d iarrhoea. No abnormalit ies had been seen
in either the mare or foal prio r to this, and the mare had not shown any recent oestrous
behaviour. The foal developed mi ld colic s igns about 4 hours later, m anifested by rol l i ng and
flank watching. At th is time, lactated R i ngers solution ( 1 L , I V) , f lunixin meglum ine ( 1 OOm g IV) ,
and trimethoprim and su lphad iazine ( 1 440mg combined dose, IM) , were adm in istered by the
referring veterinarian . The foal rem ained bright but did not nurse, and no i mprovement in the
signs of colic was seen . Two hours before admission , hyoscine-n-butylbrom ide (40mg I V) and
dipyrone (5000mg IV) were admin istered to no effect. On admission, the foal was depressed,
and showed frequent f lan k-watching behaviour. Heart and respiratory rates and rectal
temperature were with in normal ranges. Intestinal sounds were norm al, but there were frequent
episodes of watery diarrhoea and faecal sta in ing of the perineum. Ultrasonographic exam ination
of the foal 's abdomen showed m i ld gassy d istension of the large intest ine and hypermoti l ity of
the sm all i ntestine. Umbi l ical rem nants appeared normal . I n itial treatment i ncluded hydration
treatment with IV boluses of lactated R inger's solution supplemented with 2 .5% g lucose, and
oral b ismuth subsalicylate. A faecal specimen submitted for bacteriolog ical culture to the
participating diagnostic laboratory at admission revealed a l ight growth of a mixture of G ram
positive cocci and Gram-negative rods, but n o pathogenic bacteria were isolated .
One day after adm ission , a faecal specimen was subm itted to M U for an analysis for
Cryptosporidium oocysts . At MU , numerous Cryptosporidium- l ike oocysts were seen on d i rect
smears from this specimen and stained by both the modified ZN and the immunofluorescent
stains. The same specimen was negative for Salmonella spp . , Giardia, G roup-A rotavirus, and
ova of he lminths. Two days after adm ission, isotonic f lu ids were administered via stomach tube,
and omeprazole and l ive yoghurt treatments were started. Over the followi ng 3 days the foal
stabi l ised and faecal consistency gradual ly i mproved . Blood samples taken at adm ission and in
the following days showed anaemia throughout the observation period, the exact cause of
which cou ld not be determined . A mi ld leucopenia, hyperfibri nogenaemia, and hyponatraemic
metabolic acidosis, and e levated levels of aspartate aminotransferase and glutamate
dehydrogenase were observed (Table 3.4) . Addit ional faecal specimens taken on Days 4 , 5, 6,
after admission were positive for Cryptosporidium. The foal was discharged 1 2 days fo l lowing
adm ission, after two consecutive faecal specimens (for Days 8 and 1 1 ) were negative for
98
Cryptosporidium. Skin excoriations as a resu lt of the diarrhoea were present on the perineal
reg ion and haunches on the day of discharge ( Figure 3.3) .
Units
RBC x 1 012
HCT % Hb g/L PLT x 1 09
WBC x1 09
Neutrophils x1 09
Lymphocytes x1 09
Monocytes x1 09
Fibrinogen
lgG
Glucose
CK
AST
GGT
GLDH
Bile acids
Total protein
Albumin
Globulin
Urea
Creatinine
Phosphate
Total Ca
Na
K
Chloride
Venous pH
PVC02
VHC03
Anion gap
g/L
g/dl
mmoi/L
I U/L
I U/L
IU/L
IU/L
JlmOI/L
g/L
g/L
g/L
mmoi/L
JlmOI/L
mmoi/L
mmoi/L
mmoi/L
mmoi/L
mmoi/L
mm Hg
mmoi/L
mmoi/L
At admission
5.45*
2 1 .6*
69* 206
7 . 9
6 .6
0 .8*
0.6*
0.84
6.6*
45
5.7
1 28
3.4
1 02
7.26*
38.3*
1 7.2*
· 1 0*
1 2 h post
admission
4.79*
1 9.4*
2 1 0
4.4*
3.2*
0.9*
0.3
6.2*
42
4.3
1 3 1
3.6
1 06
7.2 1 *
4 1 .9*
1 6.9*
· 1 1 *
36 h postadmission
4.78*
1 8.9*
232
6.2
5.0
0 .7*
0.5
50
6 days post
admission
5.6*
22*
274
7. 1
4 . 1
2.4
0.6*
5.0*
1 93
446*
63
308*
1 5
53
28
25
1 .7*
52*
1 .86
2.94
1 3 1
4.2
1 2 days post
admission
4.5*
1 8*
201
6.6
5.2
1 . 1
0 .3
0.98
Normal rang ea
6.9-1 1 .8
32 - 47
1 02-1 54 1 00 - 350
6 .2-1 2.4
4 . 1 - 9. 1
1 ·3 . 1
0 . 1 - 0.5
1 .5 - 4.2
0 .69- 1 .86
3 . 3 - 5.6
1 41 -4242
69-3 1 6
1 5- 63
1 -8
0 - 20
42 - 66
2 5 - 35
1 3 - 36
4 . 1 - 1 2.5
1 06 - 31 2
1 .2 - 2.2
2 .4 - 3.3
1 3 1 - 1 41
3 .0 - 4.6
93 - 1 05
7 . 36- 7.43
45 - 49
22.3 - 25
+4 - -4
Table 3.4. Haematology, biochemistry and venous blood gas results from a hospitalised foal affected with
cryptosporidiosis. Tests indicated by a dash were not performed.
a Normal ranges are those used by New Zealand Veterinary Pathology Ltd, New Zealand, for
Thoroughbred foals aged 0-3 weeks. Asterisk denote values outside normal range. RBC= red blood
cel ls; HTC= haematocrit; Hb=haemoglobin; PL T = platelets; WBC= white blood cel ls ; C K= Creatine kinase
AST = Aspartate aminotransferase; GGT = Gamma Glutamyl transferase; GLDH= Glutamate
dehydrogenase; PVC02: carbon dioxide partial pressure; VHC03: venous bicarbonate concentration
The broodm are farm was visited twice, on 05 and 1 2 December 2006. The farm was located on
agricu ltural land crossed by a stream . lt was a new business in its f i rst operational foal ing
season, established on land previously used to raise cattle and sheep. A smal l number of sheep
and weaned beef cattle were g razing on the same facility dur ing the visits.
99
Potable water was supplied to the animals, and they also had ful l access to a stream . Pregnant
m ares from different locations were transferred to the facility for foal ing and breeding one month
before the est imated date of foal ing , and returned to thei r farms 2 months after foal ing. Mares
were al lowed to g raze up unt i l 3-4 days before the expected foal ing date , when they were
moved to a foal i ng barn. Mares and neonates were moved back to a paddock as soon as
possible after foal ing . Forty-five foals, the m ajority of which were Thoroughbred , were born on
the faci l ity between August and November 2006. Diarrhoea had affected the majority of them
throughout the season. Most cases were self- l im i ti ng , with an onset at about 6-8 days of age
and a duration of 2-3 days. Some protracted cases were seen, and one foal died in October
after suffering from diarrhoea. Management of diarrhoeic foals included their transfer, with their
dams, to a sectio n of the foal ing shed also used for foal ing , as no other faci l ity for the sick
animals was avai lable (Figure 3 .3) . Treatment of d iarrhoeic foals i ncluded the admin istration of
oral electrolytes and a 3-day course of an oral co-trimoxazole.
Figure 3.3 Foals with cryptosporidiosis . Left: a foal and the mare on the farm ; Right: the hospitalised foal
at the day of discharge . Notice the presence of excoriat ions in the hau nches caused by the faecal soi l ing
d u ring the disease. These pictures were taken by BVSc student Abigai l Deuel
The three diarrhoeic foals presented for exam ination during the vis its to the farm were the last
neonates of the season. They appeared bright but their tails were soi led with faeces. On the
f i rst visit, one foal passed l iquid faeces, one a small amount of semi -l iquid faeces, and the th ird
d id not pass faeces , although a smal l amount of faecal material cou ld be extracted from the
rectum . Their dams passed ful ly formed faeces. The rectal temperature of the 1 1 -day-old foal
was sl ightly elevated (39.4 "C). As the other two foals were restless, their rectal temperatures
were not measured. The same three foals were bright and passed f i rm faeces on the second
vis i t .
Laboratory f indings. The fi rst faecal specimens collected from the foals on the farm were
negative for Salmonella spp . , Giardia spp, G roup-A rotavirus , and ova of helm inths, but had
large numbers of Cryptosporidium oocysts, which were seen on d i rect smears by both the
1 00
modif ied ZN and imm unofluorescent stai ns . There were > 1 o6 oocysts per m l of faeces in the
first faecal specimen collected from the hospital ised foal and in one specimen col lected from a
diarrhoeic foal dur ing the fi rst visit to the farm . Al l the Cryptosporidium isolates were identified
as C. parvum by sequence analysis , as described previously in Sect ion 3 .2 . No oocysts were
seen in the speci mens from mares and foals taken during the second visit to the farm . S imilarly,
no oocysts were seen in the environmental samples. However, a C. parvum 1 8S rRNA gene
sequence was ampl ified from DNA extracted from the soil sample, but not from the bedding
materia l .
3.3.5 Discussion
Cryptosporidiosis in foals is a poorly characterised d isease. In an earl ier outbreak in 2002, the
diagnosis of cryptosporidiosis was based on the iso lat ion of C. parvum as the sole agent, in
conjunction with conclusive histopatholog ical f indings (Section 3 . 1 ). In the outbreak described
here, post-mortem f indings were not avai lable. Nonetheless, the same diagnosis was supported
by the f inding of a h igh incidence of self- l imit ing diarrhoea manifest ing dur ing the f i rst and
second weeks of l ife, and in particular the f inding of the concom itant c l in ical and parasito logical
rem ission in the four foals, remin iscent of bovine cryptosporidiosis (Anderson 1 98 1 ; Uga 2000;
Grinberg et al. 2002) .
Accord ing to the data reported in Sections 3 . 1 and 3 .2 , C. parvum has been identified i n New
Zealand from cases of diarrhoea in foals from two separate reg ions, dur ing three non
consecutive foal ing seasons. Furthermore, 1 8% of the specimens from foals tested for
Cryptosporidium by the participat ing laboratory in 2005-2007 were positive for this agent.
Col lectively, these resu lts suggest foal cryptosporidiosis caused by C. parvum is not uncommon
in New Zealand.
In New Zealand, m ost registered foals are born on agricultural land in reg ions with large
popu lations of cattle . M oreover, the foa l ing and calvi ng seasons generally overlap (Rogers et al .
2007) , and two independent studies converged i n ind icat ing Cryptosporidium parasites are
present in about 40% of the dai ry farms (Section 3 .4 ; Winkworth et al. 2008) . Th is cou ld
facilitate the transmission of C. parvum of bovine or ig in to foals as compared with other horse
rearing countries. In fact, C. parvum isolates or ig i nating from foals, calves and hum ans in New
Zealand are genetical ly-s imi lar (Sect ion 3 .2) . The f indi n g in the study presented here of a C.
parvum DNA signature in soil is evidence of a contaminated farm environ ment and supports this
view. However, cryptosporidiosis in foals may also be common in other cou ntries, as suggested
by the presence of oocyst- l ike structures in the faeces of foals affected by foal-heat d iarrhoea in
Italy (Sgorbini et al . 2003 ) .
i t i s i ntriguing that cryptosporid iosis is seldom reported in foals. There are remarkable
s imi larit ies , in terms of d isease onset, duration , and severity, between foal-heat d iarrhoea and
1 0 1
the cases of cryptosporidiosis described previously (Section 3 . 1 ) and herein . Foal-heat
d iarrhoea is a common self- l imiti ng condit ion of 1 -2 week-old foals that has a poorly
characterised aetiology (Magdesian 2005 ; Crabbe 2007), and it wou ld seem possible that
cryptosporidiosis in foals is underdiagnosed, or i n many cases managed empi rical ly as foal-heat
d iarrhoea. I ndeed, the smal l number of specimens from foals tested for Cryptosporidium by the
participating laboratory and overseas ind icates the parasite is not consistently considered in the
d ifferential d iag nosis by cl i n ic ians. The short patent period, as observed in th is study in 4/4
foals, could also contribute to the underdiag nosis by i ncreasing the l ikel ihood of the agent not
being present in specimens col lected after any de lay.
The presence of the hospitalised foal al lowed cl in ical and haematological parameters of
cryptosporidosis to be investigated, at least in th is case. In addition to the alterat ion in generic
markers of dehydration and i nflammation , the foal suffered from anaemia throughout the
observation period. However, as a simi lar c l in ical investigation cou ld not be performed in the
other foals, this f inding needs to be corroborated .
Some authors have suggested that horses are i nfected with a so-called ' Cryptosporidium horse
genotype' (Xiao and Fayer 2008 ; Xiao and Feng 2008; Xiao and Ryan 2008; see also Section
1 .6.3) . Based on a s ingle observation , which was not accompanied by any descript ion of the
i nfection with the same genotype i n the horse, the 'horse genotype' has been classified by
Fayer as a 'major' intest inal Cryptosporidium affecting the horse (Fayer 2008) . The putative
occurrence of the Cryptosporidium 'horse genotype' in equine popu lations is of significance, as
un like C. parvum, this genetic variant has not been identified in humans and therefore is not
considered zoon otic. However, whereas C. parvum has been repeatedly identified in the
domestic horse ( Equus cabal/us) in New Zealand and overseas ( Sections 3. 1 and 3 .2 ;
Chalmers et al . 2005; Tanriverdi et a l . 2006) , the 'horse genotype' has on ly been reported in
one Przewalski's wild horse ( Equus przewalskit) i n a zoo (Ryan et al . 2003) . Thus , the idea of
wide cycl ing of a Cryptosporidium ' horse genotype' in the domestic horse needs to be
substantiated, and people hand l ing d iarrhoeic foals should be mindfu l of the zoonotic potential
of cryptosporidiosis in foals caused by C. parvum.
I n conclusion , the results of this study complement previous observations and suggest the
incidence of c l in ically overt C. parvum i nfections in newborn foals in New Zealand m ay be
underest imated. The author postu lates that cryptosporidiosis may be underdiagnosed, perhaps
accounting for a proportion of cases empi rically d iagnosed as foal-heat d iarrhoea. it is advisable
to take hygienic precautions when handl ing diarrhoeic foals, unti l C. parvum, which is a
potential ly zoonotic agent, is ru led out i n the laboratory, preferably by mu ltiple test ing to
enhance the agent's detection .
1 02
3.4 THE OCCURRENCE OF CRYPTOSPORIDIUM PAR VUM, CAMPYL OBA CTER AND
SALMONELLA IN N EWBORN CALVES IN THE M ANAWATU REGION OF N EW ZEALAND
3.4.1 Summary
In 2002, a cross-sectional study was conducted dur ing the winter calv ing season, with the aim
of determin ing the rate of occurrence of Cryptosporidium oocysts in faecal specimens taken
from newborn dairy calves on 24 dairy farms in the M anawatu reg ion of New Zealand.
Faecal specimens were collected from the rectums of 1 85 newborn calves from 24 dairy farms
selected by convenience criteria . The specimens were tested microscopical ly for the presence
of Cryptosporidium parvum oocysts, and bacter iologically for the presence of Campylobacter
spp. and Salmonella spp. The identification of the Cryptosporidium oocysts to taxon level was
not performed, as at that junction C. parvum was considered the only intestinal species i nfect ing
newborn calves (th is m atter wi l l be further discussed in Section 3.5) .
I nfections with C. parvum were identified in 33/1 56 (21 . 1 %) calves from 1 0 farms. More than
1 o6 oocysts/gr of faeces were detected in calves from four farms. Campylobacter spp. were
isolated from 58/1 6 1 (36%) calves from 1 8 farms ; in particu lar, C. jejuni subsp jejuni was
isolated from 1 1 /1 6 1 (6 ,8%) calves from seven farms . Salmonellae were not detected .
These results indicate that despite the short, concentrated calving pattern and the long interval
between calving seasons characterising most dairy farms in New Zealand , C. parvum is
widespread among calves. Campylobacter spp, especial ly C. jejuni, colonise the i ntesti nal tract
of calves, early in l ife.
3.4.2 Introduction
The prevalence of human m icrobial enteropathogens in cattle has been the subject of intensive
research in many countries, due to the risk of an im al-to-human transm iss ion. I n New Zealand,
the protozoan parasite Cryptosporidium parvum and bacteria belonging to the genus
Campylobacter and Salmonella are among the m icrobial pathogens most com monly detected in
cases of human gastrointest inal i nfections (Anonymous 2004) .
A number of Cryptosporidium species have been reported to infect humans, but on ly the
anthroponotic species C. hominis (Morgan- Ryan et al . 2002) (formerly known as C. parvum,
'hu man ' genotype, o r Type I) and the zoonotic C. parvum (formerly known as C. parvum 'cattle'
genotype, or Type 11) are widespread. Other species have on ly been reported sporadical ly in
intestinal and non-intestinal infections in immunocompromised ind ividuals (X iao et al . 2004;
Xiao and Ryan 2008) . Cryptosporidium parvum is an obl igate intestinal parasite and has a wide
host range (Fayer 2004) . The parasite is widespread in l ivestock and it is believed that l ivestock,
especial ly cattle, fu nction as natural reservoi rs for human infect ions. Perhaps the most
convincing data support ing th is belief were the 35% reduction in laboratory notifications of
human cryptosporidiosis during the 2001 foot-and-mouth disease epidemic in Eng land and
1 03
Wales, attributed to a reduction in the catt le populat ion and decreased di rect and i ndirect
exposure of humans to l ivestock (Smerdon et al. 2003} .
I n catt le, infections are predom inantly perinatal, and a typical faecal oocyst shedding period
lasts a number of days fol lowed by the development of resistance to re-infection (Anderson
1 98 1 ; Harp and Woodm ansee 1 990; Peeters et al . 1 993 ; Fayer et al . 1 998} . In calves, C.
parvum causes d iarrhoea, as repeatedly indicated by results of observational stud ies,
experimental i nfections, and therapeutic tr ia ls (Tzipori et a l . 1 983; Heine et al. 1 984; Fayer and
El l is 1 993 ; N aciri et al . 1 993, 1 999 ; Fayer et a l . 1 998; O'Handley et a l . 1 999; Castro-Hermida et
al . 2002; Gr inberg et al . 2002 ; Sevinc et al . 2003}. Faecal counts as high as 1 06 - 1 0?
oocysts/g (OPG) were found in faeces of infected calves during the peak of excretion (Ongerth
and Stibbs 1 989; Fayer et al. 1 998; O'Handley et al . 1 999; Uga et al . 2000; N ydam et al . 2001 ) .
Most studies indicate peak shedding of oocysts during the second week after birth , and that
adu lt catt le on ly sporadical ly shed low nu mbers of oocysts. Hence, 1 - 2-weeks-old calves are
regarded among the most eff icient ampl ifiers of C. parvum in nature , whereas adult cattle are,
perhaps, maintenance hosts ( Harp and Woodmansee 1 990 ; Harp et al. 1 996; Fayer et al. 1 998 ;
Atwi l l e t a l . 1 999, 2003; de la Fuente et al . 1 999, Sischo et a l . 2000; Uga et a l . 2000 ; Hoar et a l .
200 1 ; Nydam et al . 200 1 ; G rinberg et al . 2002; Atwi l l et a l . 2003; Atwi l l and das Pereira 2003;
Sevinc et al . 2003; Fayer 2004}. Given these characteristics, gaug ing the prevalence of C.
parvum prevalence in newborn calves is i mportant i n assessment of the possible zoonot ic
impact of dairy farm ing .
Bacteria belonging to the genus Campylobacter, especial ly C. jejuni subsp. jejuni (C. jejum) , are
important human pathogens causing main ly gastro intestinal i l l ness (Nachamkin 2003) .
Although C. jejuni has caused mastitis exper imental ly and C . jejuni and C. fetus subsp fetus can
sporadical ly cause abort ion , only C. fetus subsp veneralis, the cause of bovine venereal
campylobacteriosis, is considered a true pathogen of catt le. The other Campylobacter species
are generally considered non-pathogenic commensals of the bovine gastrointest inal tract
(Joens 2004) and are of main ly zoonotic importance.
There are about 2,500 serotypes of Salmonella and most of those infect ing m ammals belong to
the species S. enterica subsp enterica (Libby et al. 2004) . In the developed world, human
salmonellosis tends to m an ifest cl in ical ly as a gastrointest inal i l lness accompanied by diarrhoea,
fever, and abdominal cramps. Cases are mostly l inked to the i ngest ion of contam inated food of
animal origin (Bopp et al . 2003) . Bovine salmonellosis m anifests mai nly as enteritis or a
septicaem ia (Libby et a l . 2004} . Salmonella enterica serotype Typhimur ium was, by far, the
serotype most frequently isolated from cases in humans and cattle in New Zealand in 2003 and
2004, and m any of the isolates from both hu mans and cattle belonged to the same phagetype
(Anonymous 2004} . The bovine host-adapted S. enterica serotype Dubl in (Libby et a l . 2004}
was not isolated from cattle in New Zealand in 2003 and 2004 (Anonymous 2004) .
1 04
Although the presence of C. parvum in faecal samples from calves submitted to diag nostic
laboratories in New Zealand has been repeated ly reported (Townsend and Lance 1 987;
Learmonth et a l . 2004; Varney 2004) , the prevalence of th is parasite in dairy cattle in New
Zealand is unknown . Extrapolating C. parvum preva lence data from overseas to cattle in New
Zealand is d ifficult. Most existi ng prevalence data originate from countries where the dairy
i ndustry has a year- round calvi ng pattern, whereas the vast majority of farms in New Zealand
have a concentrated calv ing pattern, mostly in late winter. A sharp increase in the numbers of
immunological ly-na"ive calves, and their virtual absence between calving seasons, m ight have a
d ifferent effect on the epidemio logy of this infectio n in New Zealand as compared to cattle
rearing countries in which there is un rem itting enzootic cycl ing due to a conti nuous p resence of
susceptible calves.
The aim of the study presented here was to assess the occurrence of C. parvum among
newborn calves i n the Manawatu reg ion of New Zealand, and to provide basel ine data for future
reference. Whi lst assessment of Campylobacter and Salmonella was not the m ain purpose of
the study, i t was envisaged that by including these two zoonotic organisms, th is study would
also provide data on their impact on cattle in New Zealand .
3.4.3 Materials and methods
Study design and sampling strategy. A cross-sectional survey was conducted in the
Manawatu reg ion of New Zealand during the calving season , in August 2002. Dai ry farms were
selected by convenience criter ia from the cl ient l ist of a veter inary practice. Farms were el ig ible
for inclusion in the study if at least 1 50 cows had been m i lked in the previous season, and
approximately 60 farms fulfi l led th is criterion . No information on the occurrence of enteric
pathogens and neonatal calf diarrhoea in previous calving seasons was considered. Farmers
agreeing to participate were asked to allow al l the calves between 9 and 1 5 days of age to be
sampled. This purposive sampl ing was performed i n consideration of the budget available, the
estimated number of calves of this age that would be avai lable for the sampl ing , and mainly
g iven that longitudina l excret ion stud ies in calves i ndicated a peak of prevalence of oocysts in
faeces mostly coincidental with th is age interval (Anderson 1 98 1 ; Harp et al . 1 996a; Fayer et a l .
1 998 ; Atwi l l e t a l . 1 999; Uga et a l . 2000; Grinberg et al . 2002} . Faecal specimens were collected
from the rectums of i ndividual calves and transferred to clean watert ight containers; g loves were
changed between calves. I nformation recorded included gender and breed of the calves, and
the type of flooring or bedding m aterial .
Faecal specimens were categorised as 'sol id ' (when deposited in its container, the specimen
conserved the orig inal shape) , 'semi-sol id' (sam ple spreading across the bottom of the
container but not l iquid) , and ' l iqu id ' (sample had a l iquid consistency) . Speci mens were
transported on ice to the microbiology laboratory and were processed the same day for
Campylobacter and Salmonella, and stored at 4QC for up to 72 h unti l tested for C. parvum.
1 05
All procedu res i nvolvi ng the sampling of the anim als were approved by the Animal Ethics
Com m i ttee of Massey U ni versity, Palme rston North , New Zealand.
Laboratory procedu res for detection of Cryptosporidium parvum. One g of faeces was
suspended in 1 0 ml of tap water and sieved through a 500 11m sieve. Then, oocysts were
concentrated by centrifugation at 900 g and the pel let (of approxi m ately one m l ) was re
suspended in 4 ml normal sal ine. Ten m i c rolitres of suspension was deposited as a drop on a
sl ide, a i r-dried, and stained using the cold acid-fast stai n i ng tech nique. The enti re area of the
smear was exami ned usi n g an optical m icroscope at 400x magnification , and acid-fast oocyst
l ike structures stained red were assessed morphological ly and morphometrical ly at 1 OOOx
magnification. Samples were considered positive if they h ad at �east one round acid-fast oocyst
with a d iameter of about 4 - 6 11m , and contai ning i nternal pu rple-stained sporozoites (Ortega
and Arrowood 2003) . Each oocyst detected represented an average of at least 500 oocysts i n
one gram o f faeces.
Laboratory procedu res for detection of Campylobacter. A 500 mg sample of faecal m ateria l
was i noculated i n cefoperazone-am photericin-teicoplanin (CAT) b roth prepared i n -house
(Atabay and Carry 1 998) , and incu bated with loose caps for 48 h at 37 "C in jars co ntain ing
com m ercial kits for microaerobic, capnoph i l ic atmosphere suitable for the growth of
Campylobacter spp. ( M itsubishi Gas Chem ical Co. , Tokyo , Japan). Then, 5 111 were plated onto
modified cefoperazone-ch arcoal-deoxycholate agar ( m C C DA) and on com m ercial CAT agar
plates ( Fort Richards Labo ratories, Auckland , New Zealand), and i ncu bated as before. P lates
were c hecked for g rowth every 48 h for a maximum of 8 days ( E n g berg et a l . 2000) . When
g rowth was seen, one colony was tested for a G ram -stai n reaction , and oxidase reaction using
oxidase-detection str ips (Oxidase strips, Oxoid Ltd . , Hants, UK). Colo n i es of oxidase-positive,
G ram -negative wavy baci l l i resem bl ing cam pylobacters were subcultu red onto a 5% sheep
blood agar plate prepared in-house and i ncubated at 37"C for 48 hours in jars, as before.
Bacteria recovered from blood agar plates were suspended in nutr ient broth conta in ing 1 5%
(Vo l u m eNolume) g lycero l , and frozen at -70 "C for future reference. After 1 2 m onths , one
frozen isolate from each positive sample was cultured for three cycles o n 5% sheep blood agar
plates, as before, and identified using the followi ng tests (Nacha m k i n 2003) : h ippu ricase
activity us ing a fast test, as per the m an ufacturer's instructions (Becton D ickinson Microbiology
System s , Cockeysvi l le M D , USA) ; susceptibi l ity to nal idixic acid and cephalot h i n using the disc
diffusion test; g rowth at 25"C and 42 "C ; catalase reactio n , and production of i ndoxyl acetate as
described by Popovic-Uroic et al . ( 1 990) .
Laboratory procedures for Salmonella. Swabs of faecal material were i nocu lated into tubes
contai n i ng selen ite en rich ment broth ( Fort Richards labo ratories) and i ncubated aerobically at
37"C for 20-24 h. Five 111 of broth were i nocu lated onto xylose-lysi ne-deoxycholate (XLD) plates
1 06
( Fort Richards Laboratories) and incubated as before. Further steps were not needed, as there
was no growth consistent with Salmonella in the samples.
Statistical analysis. Assuming a perfect test, the 95% confidence interval (C l ) of the proportion
of Cryptosporidium-positive farms was calculated using the f reeware Win Episcope 2 .0 (De Bias
and Ortega 2000} , option 'Sample Size to Estim ate Percentage ' , a popu latio n size of 60, level of
confidence set at 0 .05 , and f in i te populat ion correction . Odds ratios (OR) and exact 95% C l , and
two-tailed Fisher's exact tests, were used to assess associations between the presence of
Cryptosporidium infections and l iquid faeces on farms, and at the calf leve l . Calculat ions were
performed using Episheet© 2002 freeware ( Rothman 2002} . The modest sample size precluded
a mu ltivariate analysis.
3.4.4 Results
A total of 1 85 calves from 24 farms were sampled, during 26 farm visits carried out between
August 1 2 and September 3, 2002. Two farms, one test ing positive and the other test ing
negative to Cryptosporidium at fi rst instance, were re-sampled three weeks after the fi rst
sampling i n order to re-asses their Cryptosporidium i nfection status. All the sam ples were
tested for Salmonella, 1 62 for Campylobacter and 1 56 for Cryptosporidium, as some samples
were of an insuff icient quantity for test ing accord ing to the th ree different protoco ls. Most farms
reported sel l ing male calves at the age of about 1 week, hence, only 2 1 /1 85 ( 1 1 .4 %} calves
were male. Management systems on farms included leavin g calves with their mothers for 1 - 4
days, and then g rouping them i nto pens in barns or paddocks, where they were fed colostrum
and/or whole m i lk. Only o ne farm reported feeding calves with milk replacer. Calves of the
same age were mostly kept together. A variety of flooring or bedding materials were reported
(Table 3 .5) .
There were 33/1 56 (21 .2%) Cryptosporidium-positive calves from 1 0/24 (42%) farms (95% Cl=
26.3-56.8} . Most infected farms had more than one calf infected . The within-farm prevalence of
infected calves ranged from on ly one of seven to seven of seven calves test ing positive (Table
3.4) . There was i nterpretive uncertainty concern ing on ly one farm , which was eventual ly
considered posit ive by the presence of one positive sample contain ing only two oocysts on the
entire sl ide. One farm where a l l calves tested negative on the first visit became infected and
showed positive calves on a second visit about 3 weeks later, and was thus considered
Cryptosporidium-positive. The other farm visited twice had infected calves on both occasions
but it was counted as posit ive only once. S ix infected calves from four farms were shedding
more than 1 o6 OPG faeces. I nterest ingly, none of the four farms rearing Jersey cattle had
infected calves (Table 3 .5 ) . Of 1 0 farms where calves had l iquid faecal samples, n ine were
Cryptosporidium-positive. The occurrence of l iquid faeces on farms was positively associated
with the f ind ing of at least o ne Cryptosporidium-positive calf (0R=1 1 7, 95% C l = 4.8 - 5489; P<
1 07
0 .0 1 ) . Ten of 1 6 calves with l iquid faeces were Cryptosporidium-positive , but on ly 1 0/33
Cryptosporidium-positive calves had l iquid faeces. The association between the presence of
l iquid faeces and Cryptosporidium i nfections at the calf-level was significant (0R=8.47, 95% C l =
C l=2 .45-30.8 ; p<0 . 0 1 ) .
Breed Bedding No. C. parvum- No. Campylobacter- Number type positive positive samples/No. of l iquid
samples/No. examined faeces exa mined
F Wood chips 5/8 4/8 2 F Paddock 0/7 5/7 0 F Woodch ips 0/9 1 /9 0 J Sawdust 0/8 7/1 3 0 J Wooden slats 0/3 0/3 0 F Sawdust 017 3/8 1 F Sawdust 0/9 7/1 3 0 c Concrete 1 /7 2/7 1 c Woodch ips 3/8 1 0/1 1 1 nr Saw dust 0/7 2/8 0 nr Paddock 0/5 1 /6 0 J Paddock 0/3 0/3 0 c Wooden slats 0/6 2/6 0 J Woodchips 0/5 0/5 0 c Wooden slats 6/6 5/9 2 F Sawdust 4/1 0 2/1 0 4 c Paddock 0/7 1 /4 0 c Straw 0/7 0/5 0 c Sawdust 3/8 0/6 1 F Sawdust 0/4 3/4 0 F N R 3/6 1 /4 2 F Paddock 1 /4 1 /2 0 c Sawdust 4/6 1 /4 1 F Woodchi�s 3/6 0/6 1
Table 3 .5. Prevalence of Cryptosporidium parvum and Campylobacter spp among newborn calves from 24
dairy farms in the Manawatu region of N ew Zealand (each row represents one farm) . F= Friesian ; J=
Jersey; C= cross-breed; NR= not recorded
Fifty-eig ht (36%) samples from 1 8 farms tested positive for Campylobacter. A wide range of
Campylobacter phenotypes were detected; C. jejuni subsp. jejuni was isolated from 1 1 samples
from 7 farms (Table 3 .5) . The most common phenotype was that of C. sputorum-fecalis, isolated
from 30 samples from 1 1 farms. C. hyointestinalis subsp hyointestinalis phenotype was isolated
in 1 0 samples from seven farms, C. coli phenotypes were isolated fro m three samples, and C.
lari was isolated once. Colonies consistent with Salmonella were not observed on XLD agar
plates.
3.4.5 Discussion
The prevalence of C. parvum i n d airy calves in New Zealand has not been measured
previously. In th is study, a purposive sampling of newborn calves at the theoretical peak of the
1 08
patent period was applied to en hance herd-test sensitivity. More than 3 sam ples were tested in
the m ajority of the Cryptosporidium-negative farms , and 8/1 0 Cryptosporidium-positive farms
were declared positive by the presence of mu ltiple i nfected calves (Table 3.4) . Hence, test
accuracy at the herd level was h igh . The overall farm-prevalence was 42%. Com parable
percentages of Cryptosporidium-infected farms have been reported in countries with year-round
calving (Genchi et al . 1 984 ; Harp and Woodmansee 1 990 ; Garber et al . 1 994; Oui lez et a l .
1 996) . However, a prevalence >90% was reported i n the Canadian states of Quebec and
Ontario in cross-sectional studies, and in Galicia ( Spain ) in a long itudinal study (Ruest et a l .
1 998 ; Castro-Herm ida et a l . 2002 ; McAI I ister et a l . 2005 ; Trotz-Wi l l iams et a l . 2005) . Although
some inadvertent bias due to non-random recruitment of farms is possible, these resu lts
suggest that enzootic C. parvum cycles estab lish in a considerable proport ion of farms, despite
the short and concentrated period of calv ing and long t ime interval between calving seasons
characteristic of most dairy farms in New Zealand. The proportion of C. parvum positive calves
with in farms was variab le, in accordance with resu lts described elsewhere ( Santi n et al. 2004) .
More than 1 o6 OPG faeces were detected i n six samples from four farms. Such h igh numbers
are typical ly found dur ing a smal l fraction of the patent period (Fayer et a l . 1 998; Uga et a l .
2000 ; Gri nberg et a l . 2002) . Hence, it is conceivable that i n a longitudinal study, an excret ion of
th is m agn itude would have been observed, at some stage, in the majority of the positive calves.
G iven the h igh number of New Zealand dairy cattle, and in v iew of the fact that calves p roduce
the vast majority of C. parvum oocysts shed on farms (Atwi l l and das Pereira 2003; Fayer
2004) , these results indicate a massive natural am plif ication of C. parvum during the calving
season . What remains u nknown is whether infections on farms are in it ia l ly acquired from
environmental sources, or from infected reservoi r-cows. Another question is whether or n ot
calves on apparently negative farms become infected later i n life, as calves raised in iso lation
remained susceptible to experimental i nfectio n for at least 3 months (Harp and Woodm ansee
1 990) .
The possibil ity of cattle-to-human cycl ing of C. parvum is supported by the resu lts of
experimental infect ions i n humans with cattle iso lates (DuPont et al . 1 995, Chappel and
Okhuysen 2001 ) , and by studies of the popu lation genetic structure of C. parvum that have
shown extensive sharing of genotypes between humans and cattle ( Mallon et al . 2003ab) . A
number of f indings converge in suggest ing an epidemiolog ical associat ion between the
occurrence of human cryptosporidiosis and the dynamics of the dairy cattle population in New
Zealand: National notificat ions of cases of human cryptosporid iosis from the last 4 years
denoted monthly fluctuat ions , and the nu mber of notified cases peaked after the end of the
calv ing season in spring (Anonymous 2004) . Rivers impacted by dairy farms were found to be
at a h igher risk of being contam inated with faecal i ndicator bacteria ( Donnison and Ross 1 999) ,
and results of a systematic survey indicate a widespread d istribution of Cryptosporidium spp.
oocysts in surface waters in New Zealand (Brown et al . 1 998) . Final ly, mo lecular
characterisat ion of the Cryptosporidium cl in ical isolates recovered from humans in 200 1 and
1 09
2002 in New Zealand showed a disti nctive virtual substitution of the anthroponotic species C.
hominis with the zoonotic C. parvum after the end of the calving season in both years
(Learmonth et a l . 2004) . Our study provides another line of evidence to tentatively explain th is
interest ing sh ift: it is plausible that the sign ificant expansion of the niche represented by the
large increase in numbers of immunolog ical ly-na'lve calves m ight al low a select ive ampl ification
of h ighly-infective clones, followed by their environmental d ispersal v ia calf-related biomasses.
However, humans can acqu i re C. parvum infectio n through a variety of routes, including
ingestion of contami nated food and water, an imal-to-human, and person-to-person (Guerrant
1 997; Xiao et al . 2004) and at present, the idea of a massive cattle-to-human parasite cycl ing is
specu lative. To prove this concept, an analysis of the populat ion genetic structure us ing a large
number of isolates of C. parvum from human and catt le, and a h igh ly discri m inatory typing
method, wou ld be necessary. Such a study is presented in Section 3 .5 .
I n th is study, the probabi l ity o f detecting cryptosporidial i nfections was significantly higher on
farms in which at least one calf was suffering f rom l iquid diarrhoea, and the associat ion between
the presence of l iqu id faeces and an i nfection was significant at the calf-level . However, this
study was not desig ned to study the causes of d iarrhoea, hence, these stat istics are on ly
reported for futu re reference.
A relatively h igh percentage of farms infected with Campylobacter spp, and especial ly with C.
jejuni, the most important human pathogen of th is genus (Nachamkin 2003) , was observed i n
o u r study. Campylobacter jejuni is known to co lonise the intestinal tract o f asymptom atic catt le.
However, most popu lation-based studies were conducted using either samples from adult
cattle, older calves, or without precise age-specification (Garcia et al. 1 985; Meanger and
Marshal ! 1 989; G iacoboni et al. 1 993; Atabay et al. 1 998 ; Stanley et a l . 1 998; Busato et a l .
1 999 ; Hoar et a l . 2001 ; N ielssen 2002 ; Savi l l et a l . 2003 ; Sato et a l . 2004 ; Bae et al . 2005;
Wesley et a l . 2000) , and little is known about co lon isation of the intestines by Campylobacter in
the neonate calf . Campylobacter jejuni was found in a relatively h igh percentage of 4-week-old
calves in an abatto i r study (Grau 1 988). The present study indicates that a wide range of
Campylobacter species, in particular C. jejuni, co lon ise the intestinal tract of cattle early in l ife.
Salmonellae were n ot detected in this study. This is in agreement with reports from other
countries indicat ing a very low rate of detect ion of intest inal carriage of Salmonella among
healthy young calves (Lance et a l . 1 992; Busato et a l . 1 999; Naciri et a l . 1 999, McAI I ister et a l .
2005) and consisten t with the observation of a lower prevalence of carriage of Salmonella in
unweaned calves than in adult an imals observed by Huston et al . (2002) . These low rate of
subcl in ical carriage of Salmonella in newborn calves reinforces the diag nostic value of i solating
of Salmonella fro m the faeces of newborn calves dur ing disease outbreaks.
Calves infected with C. parvum and C. jejuni may be a source of human disease by direct
transmission . Sm ith et al. (2004) concluded that calves were the reservoir of mu ltiple enteric
1 1 0
pathogens, i nclud ing C. parvum and C. jejuni, for chi ldren i n the Un ited States . Stefanogiannis
et al . (200 1 ) l i nked an outbreak of cryptosporidiosis i n ch i ldren in New Zealand to direct contact
with calves during a farm visit . The i nfectivity of C. parvum and C. jejuni i n hum ans is h igh
(Okhuysen et al . 1 999; Chappel and Okhuysen 2001 ; N achamkin 2003) . Thus, care should be
taken to avoid unnecessary exposure of people to calves less than 4 weeks old on farm s. An
epidemiolog ical study in the USA reported that the i ncreased frequency of spreading manure on
fields was a risk factor for detecting Cryptosporidium oocysts in streams (Sischo et al. 2000) . At
present, it seems advisable to avoid spreading calf manure and bedding o n paddocks.
In conclus ion, this study provides a snapshot of the occurrence of C. parvum, Campylobacter
spp and Salmonella spp in the Manawatu region, which perhaps can be generalised to other
regions in New Zealand with comparable cattle-rearing practices. Despite the theoretical
sanit ising effect of t ime between calving seasons in New Zealand, results confi rm that newborn
calves are amplifiers of C. parvum. Although results suggest an important role for C. parvum in
the neonatal calf diarrhoea complex, its attributable impact in New Zealand needs to be
establ ished. Campylobacter spp, in part icular C. jejuni, but not Salmonella, were also found to
be widespread. Studies of alternative systems to reduce the envi ronmental d ispersal of viable
enteropathogens from preweaned calf wastes at the end of the calv ing season are warranted.
1 1 1
3.5 PERSISTENT DOMINANCE OF TWO G P60 //a ALLELES IN DIARRHOEAG ENIC HUMAN
AN D BOVINE CRYPTOSPORIDIUM PAR VUM IN N EW ZEALAND
3.5.1 Summary
The study presented i n Sectio n 3 .4 provided an estim ate of the dairy farm-prevalence of C.
parvum in New Zealand. At that junction , the molecular characterisation of the iso lates was not
deemed necessary as C. parvum was considered the only taxon extensively parasitis ing catt le.
The author has hypothesised that because New Zealand has a un ique dairy enviro nment,
where mi l l ions of susceptible newborn calves are reared withi n a short t ime period dur ing
winter, C.parvum genetic l ineages able to rapidly f i l l the niche represented by the transient
presence of susceptible newborn calves, have become establ ished.
In this study, 68 d iarrhoeagenic human (n=20} and bovine (n=48) Cryptosporidium isolates
collected duri ng the annual peak of morbidity i n wi nter and sprin g of 2006, were genetical ly
identified at the 1 8S rRNA gene and subtyped at the polymorphic region of the G P60 gene. Al l
the identified isolates were C. parvum. Two dominant G P60 al leles belong ing to the /la
A1 8G3 R 1 and //a A 1 9G4R 1 alel le famil ies, which persisted i n New Zealand as the dominant C.
parvum allele since 2002, were found in bovine and human C. parvum. The author postu lates
that the cyclic domi nance of these subtypes in New Zealand is due to a rapacious phenotype, of
an ability to rapid ly f i l l the niche during the calving season , and survive between seasons.
These results corroborate previous observations on the domi nant role of C. parvum i n humans
during the seasonal peaks of morbidity, and provide the molecular epidem iological evidence to
support the notion of widespread zoonotic transm ission of this parasite dur ing these peaks.
3.5.2 Introductio n
U nti l recently, C . parvum was considered the sole i ntestinal Cryptosporidium species i nfecting
young cattle and due to the h igh incidence of cryptosporidiosis and the large numbers of
oocysts e l im inated in the faeces, i nfected calves were considered among the m ajor amplifiers of
zoonotic C. parvum in nature ( Harp and Woodmansee 1 990; Harp et al . 1 996; G rinberg et al .
2002) . However, this v iew started to change as phenotypical ly-s imi lar Cryptosporidium taxa of
uncertain pathogen icity and zoonotic potential , such as C. bovis, the Cryptosporidium 'deer-l ike
genotype', C. suis, C. hominis, and C. suis-l ike genotype, have been identified in catt le using
molecu lar tools ( reviewed by Sant in and Trout 2008} . Furthermore, results of some molecular
epidemiological studies revealed the possib i l ity of the existence of host-substructuring, and the
occurrence of human C. parvum subtypes that do not cycle in cattle (Mallon et al . 2003a,b ; X iao
and Fayer 2008; Section 2 . 1 ) . Therefore, whi le in the past the mere identificat ion of C. parvum
l ike oocysts i n cattle was regarded as as compel l ing evidence for the zoonotic potential of these
parasites, current epidemiological practice requ i res the gebetic identification of the isolates and
their comparison with human parasites using molecular tools . This trend is clearly manifested by
1 1 2
the large number of molecular studies of Cryptosporidium in l ivestock using subtyping publ ished
in recent years ( l isted by Santin and Trout 2008).
Many studies have used the gene encoding the Cryptosporidium sporozoite surface
glycoprotein GP60 (Cevallos et a l . 2000 ; Strong et al . 2000) (see Sections 1 .5 and 1 . 7 ) . Th is
locus is appeal ing because of i ts extensive sequence polymorph ism , in part icular the length
polymorphism of a polyserine repeat. Many studies have revealed a variety of G P60 al le l les in
C. parvum from hum ans and cattle with i n different reg ions (Aives et al. 2003, 2006; Thom pson
et a l . 2007; Brog l ia et a l . 2008; Oui lez et al . 2008; Z intl et a l . 2009) . However, it is somehow
surpris ing that on ly a few studies have genetically-compared isolates col lected from h umans
and animals over the same t ime and space frames ( Mal lon et a l . 2003a,b ; Sect ion 2 . 1 ) .
Human cryptosporidiosis has been a notifiable disease i n New Zealand since 1 996 ( Learmonth
et al . 2004) . Since then, a s ignificant associat ion between the rate of notificat ions of
cryptosporidiosis in humans and the dynamics of the l ivestock population have been recorded.
For instance, every year the number of notified cases of cryptosporidiosis has peaked s harply
after the end of the calving season in spring , and then abruptly dropped in the su m mer,
coinciding with a sharp reduction in the number of immunological ly-naive calves p resent
(www.surv.esr.cr i .nz/PDF _survei l lance/Annuai Rpt, accessed on 1 0 February 2009; F igure 1 .4) .
Most interestingly, Learmonth et a l . {2001 , 2004) revealed a virtual substitution of the
anthroponotic species C. hominis with C. parvum dur ing the peaks of morbidity. However,
except in the study presented in Section 3.2, no genetic comparisons between human and
bovine C. parvum isolates were undertaken in New Zealand.
I n the present study, Cryptosporidium-positive faecal specimens from diarrhoeic humans and
calves col lected over the same time period were g enetical ly identif ied and subtyped by
sequence analysis of the 1 8S rRNA gene and the Cryptosporidium sporozoite surface 60 kDA
glycoprotein gene (GP60) , to assess the possible role of cattle as a source of zoonotic
cryptosporidiosis in the Waikato reg ion . The results are discussed in the context of previous
f ind ings and the pecu l iar eco logical conditions prevai l ing in the reg ion .
3.5.3 Materials and Methods
Study location. This study used human and bovine Cryptosporidium-positive faecal specimens
col lected from overt infections in the region of W aikato, North Is land, New Zealand . The
Waikato is a m ixed rural-urban region with ea. 4000 dairy farms and one m i l l ion cows
{2007/2008 New Zealand Dairy Statistics, Livestock Improvement Corporatio n L im ited ,
www. l ic .co.nz, down loaded on 1 0 February 2009) . In 2006, the rate of notif ication of
cryptosporidiosis in the Waikato was between 24.2 - 76.5 cases per 1 00,000 population , well
above the national rate of 1 7.8 per 1 00 ,000 popu lation (Notifiable and other Diseases in New
Zealand, Annual Report 2006, www.surv.esr.cri . nz/PDF _surveillance/Annuai Rpt, downloaded
1 1 3
on 1 0 February 2009) . Results of previous molecu lar epidemiological studies ind icated C.
parvum as the predominant Cryptosporidium species in humans in that reg ion ( Learmonth et a l .
2004) .
Cryptosporidium positive faecal samples. Forty eight bovine and 20 human faecal
specimens were used in th is study. The specim ens were arbitrari ly selected from a col lection of
bovine and human Cryptosporidium-positive speci mens donated by veteri nary and human
diagnostic laboratories i n the W aikato reg ion . The bovine speci mens or ig inated from unweaned
calves and were orig inal ly subm itted by farmers or veteri nary practitioners for analysis of causes
of diarrhoea during the calv ing season between July-October 2006. No i nformation about eo
infections with other enteropathogens was avai lable. Only one specimen per farm was i nc luded
in this study. The human faecal specimens were or ig inal ly submitted to two diag nostic
laboratories for analysis of causes of diarrhoea between Ju ly-October 2006. No patient- level
inform ation was avai lable. The bovine and human specimens were submitted on ice to M assey
Un iversity and stored between 2 - 4 "C with no p reservatives, unti l analysed.
Cryptosporidium identification and subtyping. Genomic DNA was extracted from the 68
specimens using a commercial DNA extraction kit (QIAamp® DNA Stool M in i Kit , Q iagen,
Hi lden , GmbH) . The identification of Cryptosporidium was performed us ing a nested PCR
fol lowed by sequence analysis of a -850 base-pair segment of the 1 8S rRNA gene descr ibed in
Sections 3 . 1 and 3.3. Mo lecu lar-grade water was used as negative control. Forward and
reverse sequences were a l igned and edited with the aid of chromatogram s. Proximal and d istal
sequence seg ments that could not be accurately determined were trimmed , and the edited
sequences al igned with Cryptosporidium 1 8S rRNA gene sequences in GenBank using
nucleotide a l ignment ClustaiX software (Thom pson et al . 1 997) . Cryptosporidium subtyp ing was
performed by analysis of the sequence of the po lymorphic region of the gene coding for the
sporozoite G P60 gene (Cevallos et a l . 2000 ; Strong et a l . 2000) as described i n Section 3 .2 .
3.5.4 Results
Thirty n i ne out of 48 (81 %) bovine specimens yielded 1 8s rRNA gene amplicons of the
expected s ize in gels. Fourteen of these (36%) yielded sequences that could be unambiguously
edited . The 1 8s rRNA gene sequences of the remain ing 25 ampl icons could not be edited due
to uneditable umbiguities in the chromatog rams, or the absence of sequence s ignals.
Conversely, 1 6 out of 20 (80%) human Cryptosporidium-positive faecal specimens yielded 1 8S
rRNA gene am plicons of the expected sizes o n gels, which could al l be accu rately edited . The
1 6 human sequences and 1 3/ 1 4 bovi ne sequences were identical to the sequence of the C.
parvum 1 8S rRNA gene (Gen Bank accession number AF093490) . One bovine sequence was
identical to the polymorph ic (or "Type B") copy of the same C. parvum gene (LeBiancq et a l .
1 997; see Section 1 .3) .
1 1 4
Unambiguous G P60 sequences could be generated for 32 (67%) bovine iso lates (the G P60
sequences of e ight bovine C. parvum isolates have been reported in Section 3 .2) . Th i rty one out
of 32 GP60 sequences of bovine isolates corresponded to known C. parvum alleles.
Su rpris ing ly, one isolate had a G P60 al lele previously identified several t imes in C. hominis from
humans. This C. hominis allele had been reported seven times in GenBank under the taxon
name C. parvum ' human genotype' (accession numbers AF403 1 69 . 1 ) , and C. hominis
(accession numbers AY382670, AY382673. 1 , AY382669. 1 , EF576980 . 1 , EF591 786. 1 , and
EF59 1 785 . 1 ) . However, DNA extracted from the same iso late a number of months later yielded
a G P60 sequence of C. parvum which was identical to the most abundant sequence found in
this study (see below). Thus, the fi rst C. hominis sequence m ay have been the result of an
isolate identification error. Th i rty e ight out of 48 (77%) bovine isolates could be unambiguously
identif ied as C. parvum at either the 1 8S rRNA gene, the GP60 locus, or both loci and ten
bovine isolates (2 1 %) could not be identified. Seven out of 20 (35%) human isolates yielded
unambiguous G P60 sequences. Al l these human isolates yielded C. parvum 1 8S rRNA gene
sequences.
There were three different GP60 sequences in the sample (Appendix 3 .5) . Twenty-n ine bovine
and six human sequences were identical to each other. Accord ing to the nomenclature
suggested by Sulai m an et al. (2005) , this allele belonged to the C. parvum G P60 al lele fami ly
/la A 1 8G3R 1 . The same sequence was the dominant C. parvum allele identified in New
Zealand from foals and humans between 2001 -2007 (Sect ion 3 .2) . A search in a database
maintained by the Protozoa Research Unit of the I nstitute of Veterinary, Animal and Biomedical
Sciences, Massey U n iversity, New Zealand (PRU) , revealed that the same /la A 1 8G3R1 al lele
has been identified in 1 65/263 (62%) of the iso lates collected between 2002-2008, and
genetical ly characterised by the Un i t ( Errol Kwan, personal comin ication) . A search in GenBank
(website maintained by The Nat ional Center for Biotechno logy I nformation (NCBI) of the
N ational I nstitutes of Health, USA) revealed that this allele had also been identified from calves
in Ontario, Canada (Trotz-Wi l l iams et al. 2006) . Three C. parvum isolates from calves had
G P60 sequences identical with each other and belonging to the C. parvum G P60 al lele fami ly
/la A 1 9G4R 1 . A search in the PRU database indicated th is al lele as the second most frequent
allele seen in human C. parvum in New Zealand , present in 64/263 (24%) isolates . The same
allele has been found in bovine C. parvum in eastern USA (GenBank accession number
006305 1 6) and Canada (accession numbers AF 1 64493. 1 and 001 92504. 1 ) , and also in
h um ans in Brasi l (accession number AF1 64493 . 1 ) . One human C. parvum isolate also had a
G P60 sequence belonging to the G P60 al lele fam i ly /la A 1 8G 3 R 1 which differed from the
sequence present in the other six human isolates at a single nucleotide external to the
polyserine repeat. The d ifference was not l i kely to be an isolated edit ing error as it persisted
after the author re-ed ited the sequence a year later. This allele has never been previously
identified in New Zealand, and an on l ine search in GenBank did not return any identical
sequence .
1 1 5
3.5.5 Discussion
I n the present study, d iagnostic faecal specimens were analysed in order to genetical ly
compare Cryptosporidium parasites from humans and calves col lected dur ing the peak of
morbidity period i n 2006 i n the Waikato. The avai labil ity of isolates from both humans and cattle
differentiates this study from other molecular epidem iological studies applyi ng s im i lar genetic
typing methods which only used isolates from one host species.
Accumulated epidemiological data f rom a number of countries i ndicated that most
Cryptosporidium i nfect ions i n newborn calves are caused by C. parvum, whereas other taxa are
rarely found in this age g roup (Santin et al. 2004, 2008 ; Trotz-Wil l iams et al. 2006; Fayer et al .
2006; Geurden et a l . 2006) . The results of the present study support these results.
In the study in newborn calves in New Zealand presented in Sect ion 3 .4, the dairy farm
prevalence of C. parvum was estimated to be -40%. However, that study was performed in
2002, and at that juncture the genetic identif ication of the isolates was not carried out, so the
presence of non-parvum taxa could not be established . U n like the above study, the present
study was not designed to estimate the farm-prevalence of C. parvum. Nevertheless, the
identification of this species in 38 different farms in the Waikato supported the conclusion that
there is a widespread presence of this parasite in the dairy econiche in New Zealand expressed
in Section 3 .4 .
The exclusive f ind ing of C. parvum i n hu m ans corroborated previous f ind ings that indicated the
dominant role of C. parvum i n humans during the annual peaks of cryptosporidiosis notifications
in spring (Learmonth et al . 2004) . I n the study presented in Section 2 . 1 , a partit ion of the
multi locus genotype repertoire of C. parvum between humans and cattle was identif ied using
rarefaction analysis , which supported the notion of the existence of anthroponotic C. parvum
cycles in Scotland. The studies presented i n th is sectio n , and in Sect ions 2 .2 and 3.2 , fai led to
identify any genetic host-partition of the genetic repertoire of C. parvum in New Zealand . I n fact,
in the present study C. parvum isolates from humans and calves shared the most abundant
GP60 al leles, and although in the study in Section 2.2 the sample-size of C. parvum was too
small for an analysis usi ng rarefaction, human and bovi ne isolates shared most of the mu lt i locus
genotypes, form ing a si ng le eBURST network (Figure 2.4) . In addit ion, no putative
anthroponotic C. parvum isolates carry ing G P60 /le al leles have been identif ied in this study, or
stored in the database of the PRU. Col lectively, these resu lts do not support the existence of
anthroponotic C. parvum cycles but rather suggest a significant role of the zoonotic
transm ission route in New Zealand .
The avai labi l ity of the resu lts of a study from previous years (Section 3 .2 ) , and the G P60 data
stored by the PRU al lowed an assessment of the temporal variation in the prevalence of the
different C. parvum G P60 subtypes. The fact that the two most abundant al le les in 2006 were
1 1 6
also the dominant al leles i n m u ltiple host species since 2002 was strik ing . Despite the wide
spectrum of C. parvum subgenotypes in c i rculation in humans in New Zealand, two
subgenotypes - belonging to the al lele famil ies //a A1 8G3R 1 and /la A1 9G4 R 1 - pers istently
dom inated the samples. As h ypothesised in the study presented in Section 3.4, the author
postulates that the cyclic dominance of these subgenotypes is due to a rapacious phenotype,
and an abi l ity to rapidly f i l l the n iche during the calving season and survive between seasons .
The fact that th is study analysed d iagnostic specimens was a l imitat ion. Further studies us ing
representative samples of bovi ne C. parvum are needed in order to better captu re the genetic
diversity of this parasite species in cattle in New Zealand.
F inal ly, the pathogenic potential of the non-parvum Cryptosporidium cycl ing in cattle is n ot we l l
understood. Apart from s ix studies analys ing d iag nostic specimens (Mal lon et al . 2003a,b;
Thompson et a l . 2007; Brogl ia et al . 2008; Qui lez et a l . 2008; Soba and Logar 2008) , al l the
molecular studies analysing Cryptosporidium isolates of bovine or ig in analysed specimens
col lected from an imals of a wide age range and/or on a l imi ted number of selected farm s, with
no cl in ical h istory i ndicated (Mclauchlin et al. 2000; Learmonth et al. 200 1 ; Alves et a l . 2003;
Peng et al . 2003; Santin et a l . 2004; Nei ra-Otero et al . 2005; Roy et a l . 2006; Geurden et a l .
2006, 2007; Trotz-Wi l l iams et a l . 2006; Langkjar et al . 2007; Xiao et a l . 2007; Duranti et a l .
2008 ; Feltus et a l . 2008; Santi n et al 2008 ; Soba and Logar 2008) . The results of the present
study are in accordance with the above six studies, i nd icating C. parvum as the sole
d iarrhoeagenic Cryptosporidium species in newborn calves.
3.6 CONCLUDING REMARKS
Chapter 3 reports five epidemio log ical studies of cryptosporidiosis in foals, cattle and humans in
New Zealand. The combined resu lts of stud ies 3 . 1 , 3 .2, and 3.3 ind icate that c l in ical ly overt
infections with C. parvum are relat ively common in foals in New Zealand, and that the condit ion
is l ikely to be underdiagnosed . The eight cases of cryptosporid iosis documented in foals i n
Sections 3 . 1 - 3 .3 had an onset between the fi rst and third week o f l ife. The disease was self
l im iting and characterised by a short and intense oocyst shedding period, resembl ing neonatal
cryptosporidiosis in calves. The i nfections were caused by C. parvum parasites genetical ly
s im ilar to bovi ne and human isolates, indicat ing the possibi lity of cross-transmission of C.
parvum between these host species. Due to the potential for zoonotic transm ission of C.
parvum, it is advisable to take precautions when handl ing d iarrhoeic foals and calves u nt i l th is
agent has been ruled out by the laboratory.
The results of the studies described in Section 3.4 - 3 .5 indicate newborn calves are sign ificant
amplifiers of potentially zoonotic C. parvum i n New Zealand, despite the short and concentrated
calving pattern characterising dairy farm ing . Biomasses from calf-rearing operations should be
adequately treated in order to avoid the contam i nation of the environment with i nfectious
1 1 7
oocysts. The f inding of two persistently dominant G P60 /la alleles in C. parvum warrants further
invest igat ion .
3.7 REFERENCES
Aiello A E, Xiao L, Limor JR, Liu C, Abrahamsen MS, Lal AA. Microsatell ite analysis of the
human and bovine genotypes of Cryptosporidium parvum. Journal of Eukaryote Microbiology
46, 46S-4 7S, 1 999
Akiyoshi DE, Feng X, Buckholt G, Widmer G, Tzipori S. Genetic analysis of a
Cryptosporidium parvum human genotype 1 isolate passaged throug h d ifferent host species.
Infection and Immunity 70, 5670-75, 2002
Alien AVH, Rid ley OS. Further observations on the formal ether concentration technique for
faecal parasites. Journal of Clinical Pathology 23, 545, 1 970
Alves, M, Xiao L, Sulaiman I , Lal AA, Matos 0, Antunes F. Subgenotype Analysis of
Cryptosporidium Isolates from H umans, Cattle, and Zoo Ruminants in Portugal . Journal of
Clinical Microbiology 2744-7, 2003
Alves M, Xiao L, Antunes F, Matos 0. Distribution of Cryptosporidium subtypes in humans
and domestic and wild rum inants in Portugal . Parasitology Research 99: 287-92, 2006
Anderson BC . Patterns of shedding of cryptosporid ia l oocysts in Idaho calves. Journal of the
American Veterinary Medical Association 1 78, 982-4, 1 98 1
Anonymous. New Zealand Publ ic Health Survei l lance Report, Vo lume 2 , Issue 4 , Institute of
Environmental Science and Research Ltd, Porirua, New Zealand, 2004
Anonymous. Equine disease surveil lance, July to September 2006. Veterinary Record 1 60, 5-
8 , 2007a
Anonymous. Equine disease survei l lance, January to M arch 2007. Veterinary Record 1 6 1 , 79-
82, 2007b
Anonymous. Equine disease survei l lance, April to June 2007. Veterinary Record 1 60, 507- 1 0 ,
2007c
Anonymous. Equi ne d isease survei l lance, Ju ly to September 2007. Veterinary Record 1 62, 70-
4, 2008a
1 1 8
Anonymous. Equine disease survei l lance, Apri l to June 2008. Veterinary Record 1 63, 367-80,
2008b
Atabay HI, Corry JE. The isolation and prevalence of campylobacters from dairy cattle us ing a
variety of methods. Journal of Applied Microbiology 84, 733-40, 1 998
Atwil l ER, das Pereira M. Lack of detectable shedding of Cryptosporidium parvum in
periparturient dairy cattle. Journal of Parasitology, 89, 1 234-6 , 2003
Atwil l ER, Johnson E, Kl ingborg DJ, Veserat GM, Markegard G, Jensen WA, Pratt DW,
Delmas RE, George HA, Forero LC, Phi l ips RL, Barry SJ, McDougald NK, Gildersleeve
RR, Frost WE. Age, geographic and temporal d istribution of fecal sheddi ng of
Cryptosporidium parvum oocysts in cow-calf herds. American Journal of Veterinary Research
60, 420-5, 1 999
Atwil l ER, Hoar B, das Gracas Cabral Pereira M, Tate KW, Rulofson F, Nader G. Improved
quantitative est imates of low environmental loading and sporadic peripartur ient shedd ing of
Cryptosporidium parvum in adu lt beef catt le. Applied and Environmental Microbiology 69, 4604-
1 0 , 2003
Bae W, Kaya KN, Hancock DD, Cal l DR, Park WY, Besser T. Prevalence and antim icrobial
resistance of thermoph i l ic Campylobacter spp. from cattle farms in Washi ngton State. Applied
and Environmental Microbiology 71 , 1 69-74, 2005
Bopp CA, Brenner FW, Fields PI, Wel ls JG, Strockbine NA. Escherichia, Shigella and
Salmonella. I n : PR Murray (ed) . Manual of Clinical Microbiology, 8th edtn . Pp 654-71 , ASM
Press, Washington DC, USA, 2003
Broglia A, Reckinger S, Caccio SM, Nockler K. Distr ibution of Cryptosporidium parvum
subtypes i n calves in Germany. Veterinary Parasitology 1 54 , 8-1 3, 2008
Brown T, lonas G, Learmonth J, Keys L, Mclenachan T. The distribution of Giardia and
Cryptosporidium i n New Zealand waters - a nationwide survey. Water and Wastes in New
Zealand 1 0 1 , 60-63, 1 998
Busato A, Hofer D, Lentze T, Gail lard C, Burnens A. P revalence and infection r isks of
zoonotic entheropatogenic bacterial i n Swiss cow-calf farms. Veterinary Microbiology 69, 25 1 -
63, 1 999
1 1 9
Caccio S, Homan W, Camilli R, Traldi G , Kortbeek T, Pozio E. A microsatellite marker
reveals populat ion heterogeneity with in human and an imal genotypes of Cryptosporidium
parvum. Parasitology 1 20, 237-44, 2000
Caccio S, Homan W, Vand Dijk K, Pozio E. Genetic polymorphism at the beta-tubul in locus
among human and animal isolates of Cryptosporidium parvum. FEMS Microbiology Letters 1 70 ,
1 73-9, 1 999
Carraway M, Tzipori S, Widmer G. A new restriction length po lymorphism from
Cryptosporidium parvum identifies genetical ly heterogeneous parasite popu lations and
genotypic changes fol lowing transmission from bovi ne to human hosts. Infection and Immunity
65, 3958-60, 1 997
Castro-Hermida J A, Gonzales-Lozada Y A, Ares-Mazas E. Prevalence of and risk factors
involved in the spread of neonatal bovine cryptosporidiosis in Gal icia (Spain ) . Veterinary
Parasitology 1 06 , 1 - 1 0 , 2002
Cevallos AM, Bhat N, Verdon R, Hamer OH, Stein B, Tzipori S, Pereira ME, Keusch GT,
Ward HO. Mediation of Cryptosporidium parvum i nfection in vitro by mucin- l ike g lycoproteins
defined by a neutral iz ing monoclonal antibody. Infection and Immunity 68, 5 1 67-75, 2000
Chalmers RM, Thomas AL, Butler BA, Morel MC. Identification of Cryptosporidium parvum
genotype 2 in domestic horses. Veterinary Record 1 56, 49-50, 2005
Chalmers RM, Thomas AL, Butler BA, Morel MZ. Identification of Cryptosporidium parvum
genotype 2 in domestic horses. Veterinary Record 1 56 : 49-50, 2005.
Chappel CL, Okhuysen PC. Cryptosporidiosis in health adult vo lunteers. I n : Sm ith M. and
Thompson KC (eds) , Cryptosporidiosis, the analytical challenge, Pp 62-72. The Royal Society
of Chem istry, Cambridge, UK, 200 1
Cohen, N.D. Causes of and farm m anagement factors associated with d isease and death i n
foals. Journal o f the A merican Veterinary Medical Association 204: 1 644- 1 651 , 1 994
Cole DJ, Cohen NO, Snowden K, Smith R. Prevalence of and risk factors for fecal shedding
of Cryptosporidium parvum oocysts in horses. Journal of the American Veterinary Medical
Association 2 1 3 : 1 296-02, 1 998
1 20
Coleman SU, Klei TR, French DD, Chapman MR, Costvet RE. Prevalence of
Cryptosporidium sp. in equids in Louisiana. American Journal of Veterinary Research 50, 575-
77, 1 989
Crabbe B. The foal. I n : The comprehensive guide to equine veterinary medicine, p . 295.
Ster l ing Publ ishing Ltd . , New York. 2007
De Bias I , Ortega C, WinEpiscore 2.0 Freeware, 2000
de la Fuente R, Luzon M, Ruiz-Santa-Quiteria JA, Garcia A, Cid D, Orden JA, Garcia S,
Sanz R , Gomez-Bautista M. Cryptosporidium and concurrent infections with other m ajor
enterophatogens in 1 to 30-day-old d iarrheic dairy calves in central Spain . Veterinary
Parasitology 80, 1 79-85, 1 999
Donnison AM, Ross CM. Animal and human faecal pol lution in New Zealand rivers. New
Zealand Journal of Marine and Freshwater Research 33, 1 1 9-28, 1 999
DuPont HL, Chappel CL, Sterling CR, Okhuysen PC, Rose JB, Jakubowsky W. The
infectivity of Cryptosporidium parvum in healthy volunteers . New England Journal of Medicine
332, 855-859, 1 995
Duranti A, Caccio SM, Pozio E, Di Egidio A, De Curtis M, Battisti A, Scaramozzino P. Risk
Factors Associated with Cryptosporidium parvum I nfection in Cattle A. Zoonoses and Public
Health, Publ ished on l ine ahead of print, doi : 1 0 . 1 1 1 1 /j . 1 863-2378.2008 . 0 1 1 73.x, 2008
Engberg J , On SLW, Harrington CS, Gerner-Smidt P. Prevalence of Campylobacter,
Arcobacter, Helicobacter and Sutterel/a spp. in human fecal samples as estimated by a
reevaluation of isolation methods for Campylobacter. J ournal of Clinical Microbiology, 38, 286-
91 , 2000
Fayer R. Cryptosporidium: a water-borne zoonotic parasite. Veterinary Parasitology 1 26 , 37-
56, 2004
Fayer R. Biology. I n : Fayer R, Xiao L. (eds) . Cryptosporidium and Cryptosporidiosis, 2nd edtn.
Pp 1 -42. C RC Press and I WA Publ ish ing, Boca Ratan FL, USA, 2008
Fayer R, Gasbarre L, Pasquali P, Canals A, Almeria S, Zarlenga D. Cryptosporidium
parvum infection in bovine neonates: dynamic cl in ical , parasitic and immunologic patterns.
International Journal for Parasitology 28, 49-56, 1 998
1 2 1
Fayer R, Ell is W. Paromomyci n is effective as prophylaxis for cryptosporidios is i n da i ry calves.
Journal of Parasitology 79, 771 - 4, 1 993
Fayer R, Santin M, Trout JM, Greiner E. Prevalence of species and genotypes of
Cryptosporidium found in 1 -2-year-old dairy cattle in the eastern Un ited States . Veterinary
Parasitology 1 35, 1 05-1 2 , 2006
Feltus DC, Giddings CW, Khaitsa ML, McEvoy JM. High prevalence of Cryptosporidium
bovis and the deer-l ike genotype in calves compared to mature cows i n beef cow-calf
operations. Veterinary Parasitology 1 5 1 , 1 9 1 -5, 2008
Gajadhan AA, Caron JP, Al ien JR. Cryptosporidium i n two foals. Canadian Veterinary Journal
26, 1 32-34 , 1 985
Garber LP, Salman MD, Hurd HS, Keefe T, Schlater J. Potential risk factors for
Cryptosporidium i nfection in dairy calves. Journal of the American Veterinary Medical
Association 205, 86-9 1 , 1 994
Garcia MM, Lior H, Stewart RB, Ruckerbauer GM, Trudel JAR, Skljarevsky A. I solation
characterisat ion and setrotyping of Campylobacter jejuni and Campylobacter col i from slaughter
cattle. Applied and Environmental Microbiology 49, 667-72, 1 985
Genchi C, Hermon J, Sangali G, Traldi G . La criptosporid iosi nel vitel lo, fattore determ inante
nel la diarrea neonatale. (Calf cryptosporidiosis, a determ inant factor of neonatal diarrhoea) .
Praxis Veterinaria 3 , 4, 1 984
Geurden T, Berkvens D, Martens C, Casaert S, Verycruysse J, Claerebout E. Molecular
epidemiology with subtype analysis of Cryptosporidium i n calves in Belgiu m . Parasitology 1 34,
1 98 1 -87, 2007
Geurden T, Goma FY, Siwila J, Phiri IGK, Mwanza AM, Gabriel S, Claerebout E,
Vercruysse J. Prevalence and genotyping of Cryptosporidium in three cattle husbandry
systems in Zambia. Veterinary Parasitology 1 38, 2 1 7-22, 2006
Giacoboni, Gl, ltoh K, Hirayama K, Takahash i E, M itsuoka T. Com parison of fecal
Campylobacter in calves and cattle of different ages and areas in Japan . Journal of Veterinary
Medical Science 55, 555-59, 1 993
Gibson JA, Hi l l MWM, Huber MJ. Cryptosporidium in Arabian foals with severe com bined
im munodeficiency. Australian Veterinary Journal 60, 378-79, 1 983
1 22
Glaberman S, Moore JA, Lowerly CJ, Chalmers R , Sulaiman I, Elwin K, Rooney PJ,
Mi llar BC, Dooley J S G, Lal AA, Xiao L. Three dr ink ing-water-associated cryptosporidiosis
outbreak, Northern I reland. Emerging Infectious Diseases 8, 631 -3, 2000
Grau, FH. Campylobacter jejuni and Campylobacter hyointestinalis in the intestinal tract and on
the carcasses of calves and catt le. Journal of Food Protection 5 1 , 857-6 1 , 1 988
Grinberg A, Markovics A, Gal indez J, Lopez-Vil lalobos N, Kosak A, Tranqui l lo VM.
Contro l l ing the onset of natural cryptosporid iosis in calves with paromomycin su lphate.
Veterinary Record 1 5 1 , 606-8, 2002
Guerrant RL. Cryptosporidios is : an emerging, h ighly i nfectious threat. Emerging Infectious
Diseases 3 , 5 1 -7, 1 997
Hajduseka, 0., 0. Ditricha, and J . Slapeta. Molecular ide ntification of Cryptosporidium spp. in
an imal and human hosts from the Czech R epublic. Veterinary Parasitology 1 22, 1 83-92, 2004
Harp J A, Jardon P, Atwi l l ER, Zylstra M, Checel S, Goff JP, De Simone C. Field testi ng of
prophylactic measures agai nst Cryptosporidium parvum i nfections in calves in a Californ ia dairy
herd. American Journal of Veterinary Research 57, 1 586-9 , 1 996
Heine J, Pohlenz JFL, Moon HW, Woode GN. E nteric lesions and diarrhoea in g notobiotic
calves monoinfected with Cryptosporidium species. Journal of Infectious Diseases 1 50 , 768-75,
1 984
Harp JA, Woodmansee DB . Resistance of calves to Cryptosporidium parvum: Effects of age
and previous exposure . Infection and Immunity 58, 2237-40, 1 990
Hoar BR, Atwil l ER, Elmi C, Farver TB. An examinatio n of risk factors associated with beef
cattle shedding pathogens of potential zoonotic concern. Epidemiology and Infection 1 27 , 1 47-
55, 2001
Hol l is AR, Wilkins PA, Palmer JE, Boston RC. Bacteremia in equ ine neonatal diarrhea: A
retrospective study ( 1 990-2007) . Journal of Veterinary Internal Medicine 22, 1 203-9, 2008
Huston CL, Wittum TE, Love BC. Persistent fecal Salmonella shedding in f ive dairy herds .
Journal of the American Veterinary Medical Association 220, 650-5, 2002
1 23
Joens LA. Campylobacter and Helicobacter. I n : G yles L, Prescott JF , Songer JG , Thoen CO
(eds) . Pathogenesis of Bacterial I nfections in An imals, 3rd Edtn , Pp. 353-6 1 . Blackwel l
Publ ish ing , Ames, USA, 2004
Kim CW. Cryptosporidiosis in pigs and horses. I n Cryptosporidiosis of Man and Animals, Pp.
1 05- 1 1 . Eds : J. P. Dubey, C. A. Speer, R . Fayer. Boca Ratan, CRC Press . 1 990
Khramtsov NV, Ti l ley MDS, Blunt BA, Montelone BA, Upton SJ. Cloning and analysis of a
Cryptosporidium parvum gene encoding a protein with homology to cytoplasmic form HSP70.
Journal of Eukaryotic Microbiology 42:4 1 6-422, 1 995
Knottenbelt OK, Holdstockand N , Madigan JE . Neonatal syndromes. I n : Equine
neonatology, Medicine and Surgery, 1 st ed. p . 2 1 9 . E lseiver, London, 2005
Konkle OM, Nelson KM, Lunn DP. Nosocomial transm ission of Cryptosporidium i n a veterinary
hospital. Journal of Veterinary Internal Medicine 1 1 , 340-43, 1 997
Lance SE, Mi l ler GY, Hancock DD, Bartlett PC, Heider LE. Salmonella i nfections in neonatal
dairy calves. Journal of the American Veterinary Medical Association 201 , 864-8, 1 992
Langkjaer RB1 , Vigre H, Enemark HL, Maddox-Hyttel C. Molecu lar and phylogenetic
characterization of Cryptosporidium and Giardia from pigs and catt le in Denmark. Parasitology
1 34, 339-50, 2007
Learmonth JJ, lonas G, Ebbet KA, Kwan ES. Genetic characterisation and transm ission
cycles of Cryptosporidium species isolated from humans in New Zealand. Applied and
Environmental Microbiology 70, 3973-8, 2004
Learmonth JJ, lonas G, Pita A, Cowie RS. Seasonal sh ift in Cryptosporidium parvum
transmission cycles in New Zealand. Journal of Eukaryotic Microbiology Suppl, 34S-35S, 2001
Le Blancq SM, Khramtsov NV, Zamani F, Upton SJ, Wu TW. Ribosomal RNA gene
organization in Cryptosporidium parvum. Molecular and Biochemical Parasitology 90 :463-78,
1 997
Leoni F, Mallon ME, Smith HV, Tait A, McLauchlin J. Mult i locus analysis of Cryptosporidium
hominis and Cryptosporidium parvum isolates from sporadic and outbreak-related human cases
and C. parvum isolates from sporadic l ivestock cases in the U nited Kingdom . Journal of Clinical
Microbiology 45: 3286-94, 2007
1 24
Libby SJ, Hasley TA, Altier C, Potter J, Gyles CL. Salmonella. I n : Gyles L, Prescott JF,
Songer JG, Thoen CO (eds) . Pathogenesis of Bacterial I nfections in An imals, 3rd edtn . Pp 1 43-
67 Blackwel l Publ ish ing , Ames, USA, 2004
Magdesian KG. Neonatal foal d iarrhoea. Veterinary Clinics of North A merica, Equine practice
2 1 : 295-3 1 2 , 2005
Majewska AC, Solarczyk P, Tamang L, Graczyk TK. Equine Cryptosporidium parvum
i nfections i n western Poland . Parasitology Research 93: 274-78, 2004
Mallon M, Macleod J, Wastl ing J, Smith H, Reil ly B, Tait A. Popu lation structures and the
role of genetic exchange in the zoonotic pathogen Cryptosporidium parvum. Molecular Genetics
and Evolution 56: 407-1 7 , 2003a
Mallon M, MacLeod A, Wastling J, Smith H, Tait A. Mult i locus genotyping of Cryptosporidium
parvum Type 2: populatio n genetics and sub-structuring . Infection, Genetics and Evolution 3 ,
207-1 8 , 2003b
Mathieu E, Levy DA, Veverkav F, Parrish M, Sarisky J , Shapiro N, Johnston S, Handzel T,
Hightower A, Xiao L, Lee V, York S, Arrowood M, Lee R, Jones JL. Epidem iolog ic and
environmental investigat ion of a recreational water outbreak caused by two genotypes of
Cryptosporidium parvum i n Ohio in 2000. American Journal of tropical Medicine and Hyg iene
71 , 582-9, 2004
McAI I ister T, Olson ME, Fletch A, Wetzstein M, Entz T. Prevalence of Giardia and
Cryptosporidium in beef calves in southern British Columbia. Canadian Veterinary Journal 46,
47-55, 2005
Mclauchl in J , Amar C, Pedraza-Diaz S, Nichols GL. Molecular Epidemiolog ical Analysis of
Cryptosporidium spp. in the Un ited Ki ngdom : Resu lts of Genotyp ing Cryptosporidium spp. in
1 ,705 Fecal Samples from Humans and 1 05 Fecal Samples from Livestock Ani mals. Journal of
Clinical Microbiology 38, 3984-90, 2000
Meanger JD, Marshal! R B . Seasonal prevalence of thermophi lic Campylobacter i nfections in
dairy cattle and a study of infection of sheep. New Zealand Veterinary Journal 37, 1 8-20, 1 989
Morgan U, Xiao L, Fayer R, Lal AA, Thompson ARC. Molecular epidem iology and
system atics of Cryptosporidium parvum. In Cryptosporidium: the Analytical Chal lenge. Eds M .
Smith, K . C . Thompson. Cambridge, R oyal Society o f Chemistry. p p 44-50, 200 1
1 25
Morgan-Ryan UM, Fall A, Ward LA, Hijjawi N, Sulaiman I, Fayer R, Thompson RCA, Olson
M, Lal A, Xiao L. Cryptosporidium hominis n. sp. (Apicomplexa: Cryptosporid i id ae) from Homo
sapiens. Journal of Eukariotic Microbiology 49, 433-40, 2002
Nachamkin I . Campylobacter and Archobacter. I n : Murray PR (ed) . Manual of C l in ical
M icrobiology, 8th ed. , Pp. 902- 1 4, ASM Press, Washington DC, USA, 2003
Naciri M, Mancassola R, Yvore P, Peeters JE. The effect of halofug inone lactate on
experimental Cryptosporidium parvum i nfections in calves. Veterinary Parasitology 45, 1 99-207,
1 993
Naciri M, Lefay MP, Mancassola R, Poirier P, Chermette R. Role of Cryptosporidium
parvum as a pathogen in neonatal diarrhoea complex in suckl ing and dairy calves in France.
Veterinary Parasitology 85, 245-57, 1 999
Neira-Otero P, Munoz-Sald1as N, Sanchez-Moreno M. Rosales-Lombardo MJ. Molecular
characterization of Cryptosporidium species and genotypes in Ch i le. Parasitology Research 97,
63-7, 2005
Netherwood T, Wood JLN, Townsend HGG, Mumford JA. Foal diarrhoea between 1 99 1 and
1 994 in the Un ited Kingdom associated with Clostridium perfringens, rotavi rus, Strongyloides
westeri and Cryptosporidium spp. Epidemiology and Infection 1 1 7, 375-83, 1 996
Nielssen EM. Occurrence and strain diversity of thermophi l ic Campylobacter i n cattle of
different age g roups in dairy herds. Letters in Applied Microbiology 35, 85-9, 2002
Nydam DV, Wade SE, Schaaf SL, Mohammed HO. Number of Cryptosporidium parvum
oocysts or Giardia spp. cysts shed by dairy calves after natural infection . American Journal of
Veterinary Research 62, 1 6 1 2-5 , 200 1
O'Handley RM, Cockwil l C, McAI I ister TA, Jelinski M , Morck DW, Olson ME. Duration of
naturally acqui red g iardiasis and cryptosporidiosis in dairy calves and their associat ion with
diarrhea. Journal of the A merican Veterinary Medical Association 2 1 43, 39 1 -6 , 1 999
Ongerth J E, Stibbs HH. Prevalence of Cryptosporidium i nfection in dairy calves in Western
Washingto n . American Journal of Veterinary Research 50, 1 069-71 , 1 989
Okhuysen PC, Chappell CL, Crabb JH, Sterling CR, DuPont HL. Viru lence of three distinct
Cryptosporidium parvum isolates for healthy adults. Journal of Infectious Diseases. 1 80 , 1 275-
81 , 1 999
1 26
Ortega YR, Arrowood M. Cryptosporidium, Cyclospora and Isospora. I n : Mu rray P R (ed) .
Manual o f Cl in ical M icrobiology, 8 th edtn. Pp 2008- 1 9 . ASM Press, Washington DC, USA, 2003
Peeters JE, Vi l lacorta I, Naciri M, Vanopdenbosch E. Specific serum and local antibody
responses against Cryptosporidium parvum during medication of calves with halofug inone
lactate. Infection and Immunity 6 1 , 4440-5, 1 993
Peng MM, Mark AE, Wilson L, Holland RE, Steven AE, Meshnick R, Lal AA, Xiao L. Genetic
divers ity of Cryptosporidium spp. in cattle in M ichigan: impl ications for understanding the
transmission dynamics. Parasitology Research 90, 1 75-80, 2003
Peng MM, Matos 0, Gatei W, Das, M. Stantic-Pavl inic P, Bern C, Sulaiman IM, G laberman
S, Lal AA, Xiao L. A comparison of Cryptosporidium subgenotypes from several geographic
reg ions. Journal of Eukaryotic Microbiology, Suppl, 288-3 1 S , 2001
Popovic-Uroic T, Patton CM, Nicholson MA, Kiehl bauch JA. Evalu at ion of the i ndoxyl
acetate hydro lys is test for rapid differentiat ion of Campylobacter, Helicobacter and Wolinella
species. Journal of Clinical Microbiology 28, 2335-39, 1 990
Quilez J, Sanchez-Acedo C, del Cacho E, Clavel A, Causape AC. Prevalence of
Cryptosporidium and Giardia i nfections in cattle in Aragon (northeastern Spai n ) . Veterinary
Parasitology 66, 1 39-46, 1 996
Quilez J, Torres E, Chalmers RM, Robinson G, Dei-Cacho E, Sanchez-Azedo E.
Cryptosporidium species and subtype analysis from dairy calves in Spai n . Parasitology 1 35,
1 6 1 3-20, 2008
Roberts VLH, Knottenbelt DC, Will iams A, McKane SA. Suspected prim ary lactose
intolerance in neonatal foals . Equine Veterinary Education 20, 249-5 1 , 2008
Rogers CW, Gee EK, Firth EC. A cross-Sectional survey of Thoroughbred stud farm
management in the North Island of New Zealand . New Zealand Veterinary Journal 55, 302-7,
2007
Rothman K. E pisheet© freeware . Spreadsheets for the analysis of epidem iolog ical data,
2002 .
Roy S , Sarkar S, Batabyal, Amiya A , Pramanik K. Observations on the epidemiology of
bovine cryptosporidiosis in Ind ia . Veterinary Parasitology 1 41 , 330-33, 2006
1 27
Ruest N, Faubert G, Couture V. Prevalence and geographic distribution of Giardia spp. and
Cryptosporidium spp. in dairy farms in Quebec. Canadian Veterinary Journal 39, 697-700, 1 998
Ryan U, Xiao L, Read C, Zhou L, Lal AA, Pavlasek I. Identification of Novel Cryptosporidium
Genotypes from the Czech Republic. Applied and Environmental Microbiology 69, 4302-07,
2003
Santin M, Trout JM. Livestock. I n : Fayer R, X iao L. (eds ) . Cryptosporidium and
Cryptosporidiosis, 2nd edtn. Pp 451 -83 . CRC Press and lW A Publ ish ing , Boca Ratan FL, USA,
2008
Santm M, Trout JM, Fayer R. A long itud ina l study of cryptosporidiosis in dairy cattle from birth
to 2 years of age. Veterinary Parasitology 1 55 1 5-23, 2008
Santin M, Trout JM, Xiao L, Zhoub OL, Greiner E, Fayer R. Prevalence and age-related
variat ion of Cryptosporidium species and genotypes i n da i ry calves, Veterinary Parasitology 1 22
1 03-1 7 , 2004
Sato K, Barlett PC, Kaneene JB, Downes FP. Com parison of prevalence and antim icrobial
susceptibi l ity of Campylobacter spp. isolates from organic and conventional dairy herds i n
Wiscons in . Applied and Environmental Microbiology 70 , 1 442-7, 2004
Savil l M, Hudson A, Devane M, Garrett N, Gi lp in B, Ball A. Elucidation of potential
transm ission routes of Campylobacter i n New Zealand. Water Science and Technology 47, 33-
8 , 2003
Sevinc F, lrmak K, Sevinc M. The prevalence of Cryptosporidium parvum i nfection in the
diarrhoiec and non-diarrhoeic calves. Revue de Medecine Veterinaire 1 54 (5}, 357-6 1 , 2003
Sgorbini M , Corazza M, D'Agostino C, Perrucci S, G iorgi L. Cryptosporidiosis and foal heat
diarrhoea. lppologia 4, 5- 1 0, 2003
Sischo WM, Atwill ER, Lanyon LE, George J. Cryptosporidia on dairy farms and the role
these farms may have in contam inating surface water supplies in the northeastern Un ited
States . Preventive Veterinary Medicine 43, 253-67, 2000
Smerdon WJ, Nichols T, Chalmers RM, Heine H, Reacher MH. Foot-and-mouth disease in
l ivestock and reduced cryptosporidiosis i n humans, Eng land and Wales . Emerging Infectious
Diseases 9, 22- 8, 2003
1 28
Smith KE, Stenzel SA, Bender J B , Wagstrom E, Soderl u n d D , Leano FT, Taylor CM, Belle
Isle PA, Dan i la R. Outbreaks of enteric i nfections caused by multiple pathogens associated
with calves at a farm day camp. Pediatric Infectious Diseases Journal. 23, 1 098-1 04, 2004
Snyder SP, England JJ, McCh esney AE. Cryptosporidium in immunodeficient Arabian foals.
Veterinary Pathology 1 5, 1 2-7, 1 978
Soba B, Logar J. Genetic classification of Cryptosporidium isolates from humans and calves in
Slovenia. Parasitology 1 35, 1 263-270, 2008
Spano F, Putignani L, McLauchl in J, Casemore DP, Crisanti A. PCR-RFLP analysis of the
Cryptosporidium oocyst wal l protein (COW P) gene determ ines between C wrairi and C parvum,
and between C parvum isolates of human and animal or ig i n . FEMS Microbiology Letters 1 50,
209-1 7, 1 997
Stanley KN, Wallace JS, Cu rrie JE, Diggle PJ, Jones K. The seasonal variation of
thermophi l ic campylobacters i n beef cattle, dai ry cattle and calves. Journal of Applied
Microbiology 85, 4 72-80 , 1 998
Stefanogiannis N, McLean M , Van Mil H. Outbreak of cryptosporidiosis l i nked with a farm
event. New Zealand Medical Journal 1 1 4, 5 1 9-2 1 , 2001
Strong WB, G ut J, Nelson RG. Clon ing and sequence analysis of a h igh ly polymorphic
Cryptosporidium parvum gene encoding a 60-Ki lodalton g lycoprotein and characterization of Its
1 5- and 45-Ki lodalton zoite surface antigen products. Infection and Immunity 68, 41 1 7-34, 2000
Sulaiman IM, H i ra PR, Zhou L, AI-Ai i FM, AI-Shelahi F A, Shweiki HM, lqbal J, Khal i d N,
Xiao L. Unique endem icity of cryptosporidiosis in ch i ldren in Kuwait. Journal of Clinical
Microbiology 43, 2805-09, 2005
Tanriverdi S, Markovics A, Arslan MO, ltik A, Shkap V, Widmer G . Emergence of dist inct
genotypes of Cryptosporidium parvum i n structured host popu lations. Applied and
Environmental Microbiology 72, 2507- 1 3 , 2006
Thompson H P, Dooley JSG, Ken ny J, M cCoy M, Lowery CJ, Moore J E, X iao L. Genotypes
and subtypes of Cryptosporidium spp. in neonatal calves in Northern I reland. Parasitology
Research 1 00 , 61 9-24, 2007
1 29
Thompson JD, G i bson T J, Plewniak F, Jea n mougin F, Higg ins DG. The ClustaiX windows
interface : flexible strateg ies for mu lt iple sequence a l ignment aided by qual ity analysis tools.
Nucleic Acids Research 24, 4876-82, 1 997
Townsend KG, Lance OM. Cryptosporidiosis in calves. New Zealand Veterinary Journal 35,
2 1 6 , 1 987
Trotz-Wi ll iams LA, Jarvie BD, Martin SW, Leslie KE, Pereg rine AS. Prevalence of
Cryptosporidium parvum i nfection in southwestern O ntario and its association with d iarrhoea i n
neonatal dairy calves . Canadian Journal of Veterinary Medicine 46, 349-5 1 , 2005
Trotz-Wil l iams LA, Martin OS, Gatei W, Cama V, Peregrine AS, Martin SW, Nydam DV,
Jamieson F, Xiao L. Genotype and subtype analyses of Cryptosporidium isolates from dairy
calves and hum ans i n Ontario. Parasitology Research 99, 346-52, 2006
Tzi pori S. Cryptosporidiosis in anim als and humans. Microbiological Reviews 4 7 , 84-96, 1 983
Tzi pori S, Campbe l l I . Prevalence of Cryptosporidium antibodies in 1 0 an imal species. Journal
of Clinical Microbiology 1 4 , 455-56, 1 98 1
Tzipori S , Smith M , Halpin C , Angus KW, S herwood D , Campbell I . Experimental
cryptosporidiosis in calves: cl i nical man ifestations and patho logical f indings. Veterinary Record
1 1 2 , 1 1 6-20, 1 983
Uga S, Matsu o J, Kono E, Kimura K, lnoue M , Rai SK, Ono K. Prevalence of
Cryptosporidium parvum i nfect ion and patterns of oocyst shedding i n calves in Japan.
Veterinary Parasitology 94, 27-32, 2000
Varney K . Quarterly review of d iagnostic cases - April to June 2004. Surveillance 31 (3) , 2 1 -5,
2004
Waldron LS, Ferrari BC, Power ML. Glycoprotei n 60 diversity in C. hominis and C. parvum
causing human cryptosporidiosis i n N SW, Austral ia. Experimental Parasitology 1 22 1 24-1 27,
2009
Wesley IV, Wells SJ, Harmon KM, Green A, Schroeder-Tucker L, G lover M , Siddique I .
Fecal shedding of Campylobacter and Arcobacter spp. in dairy catt le. Applied and
Environmental Microbiology 66, 1 994-2000 , 2000
1 30
Widmer G , Lin L, Kap u r V, Feng X, Abrahamsen MS. Genomics and genetics of
Cryptosporidium parvum: the key to u nderstand ing cryptosporidiosis. Microbes and Infection 4,
1 081 -90, 2002
Widmer G , Tzi pori S, Fitchenbaum CJ, G riffiths JK. Genotypic and phenotypic
characterisation of Cryptosporidium parvum
isolates from people with A I DS. Journal of Infectious Diseases 1 78, 834-840, 1 998
Wilkins PA. Disorders of foals. I n : SM Reed, WM Bayly, DC . Se l lon (eds) . Equine Internal
Medici ne . 2nd Edtn . P 1 4 1 9 . Elsevier, Ph i ladelphia, U SA, 2004
Wi nkworth CL, Matthaei CD, and Townsend C R . Prevalence of Giardia and Cryptosporidium
spp. in calves from a region i n New Zealand experienci ng i ntensification of dairying . New
Zealand Veterinary Journal 56 , 1 5-20, 2008
Wohlfender FD, Barrelet FE, Doherr MG, Straub R , a nd Meier H P. Di seases in neonatal
foals. Part 1 : The 30 day incidence of disease and the effect of prophylactic anti m icrobial drug
treatment during the fi rst th ree days post partum. Equine Veterinary Journal 41 , 1 79-85, 2009
Xiao L, Alderisio K, Limor J, Royer M, Lal AA. Identification of species and sources of
Cryptosporidium oocysts in storm waters with a smal l-subunit rRNA-based diagnostic and
genotyping too l . Applied and Environmental Microbiology 66, 5492-98, 2000
Xiao L, Fayer R. Molecu lar characterisation of species and genotypes of Cryptosporidium and
Giardia and assessment of zoonotic transmission. International Journal of Parasitology 38,
1 239-55, 2008
Xiao L, Fayer R, Ryan U, U pton S. Cryptosporidium taxonomy: Recent advances and
Impl ications for public health. Clinical Microbiology Reviews, 1 7 , 72-97 , 2004
Xiao L, Feng V. Zoonotic cryptosporidiosis. FEMS Immunology and Medical Microbiology 52,
309-23, 2008
Xiao L, Herd RP. Epidem iology of equine Cryptosporidium and Giardia i nfections. Equine
Veterinary Journal 26 , 1 4-1 7 , 1 994
Xiao L, Ryan U. Molecular epidem iology. I n : Fayer R, Xiao L (eds . ) , Cryptosporidium and
Cryptosporidiosis, 2 nd Edtn Pp 1 1 9-63. CRC Press and lW A Publish ing , Boca Ratan FL, USA,
2008
1 3 1
Xiao L, Zhou L, Santin M, Yang W, Fayer R . D istribut ion of Cryptosporidium parvum subtypes
in calves i n eastern United States. Parasitology Research 1 00, 70 1 -06 , 2007
Zintl A, Proctor AF, Read C, Dewaal T, Shahaghy N , Fanning S, M u lcahy G. The prevalence
of Cryptosporid ium species and subtypes i n human faecal samples i n I re land . Epidemiology
and Infection 1 37 , 270-7, 2009
1 32
CH APTER 4
AN OUTBREAK OF CRYPTOSPORIDIOSIS AMONG A COHORT OF YOUNG
ADULTS : MOLECULAR AND DESCRIPTIVE EPIDEMIOLOGY AND RISK
FACTOR ANALYSIS
This chapter describes the i nvestigation of an outbreak of gastrointest inal i l lness amongst a
class of veterinary students at Massey University in 2006. The outbreak was i nvestigated by
combin ing traditional epidem iological and molecular techn iques. Apart from a number of
d iagnostic tests performed by commercial laboratories as acknowledged in the text, all the
laboratory analyses were performed at Massey University.
4.1 Summary
An explosive outbreak of gastroi ntestinal i l l ness, which occu rred in New Zealand in 2006 among
a cohort of 96 veter inary students, instigated laboratory and questionnaire-based
epidemiological investigations . There were 25 c l in ical cases among 80 respondents to the
questionnai re (31 % attack rate) . Cryptosporidium parvum was isolated as the sole
enteropathogen from fou r out of seven faecal specimens analysed. A rare G P60 //a A2 1 G4R 1
al lele was identified in two out of two C. parvum isolates successful ly subtyped , indicating a
poi nt-source of i nfection. The results of the laboratory and epidemiological investigations ruled
out a water-borne cause, leaving di rect contact with newborn calves dur ing a calf-handl ing
practicum as the most l i kely point-source of exposure .The investigation fai led to ident ify C.
parvum i n faecal specim ens taken from calves on the farm that provided animals for the
practicu m , but revealed a DNA sequence very simi lar to the 1 8S ribosom al RNA gene of
Cryptosporidium bovis i n one specimen. Assuming that exposure to C. parvum occurred dur ing
the calf-handl ing practicum , the median i ncubation period was 5 days ( range 0-1 1 days) . Al l the
cases were self- l im it ing and m anifested with diarrhoea, abdominal discomfort, and in a smal l
proport ion of cases, vom it ing. Among the putative r isk factors analysed, or ig i nat ing from a rural
background and previous contact with rum inants, were associated with a decreased risk of
i l lness in m ales, but not in fem ales.
4.2 Introd uction
Protozoan parasites belong ing to the genus Cryptosporidium, i n particular Cryptosporidium
parvum and Cryptosporidium hominis, are common causes of gastrointesti nal d isease i n
humans worldwide (Fayer 2008 ) . Whi lst C . parvum i nfects humans and young l ivestock and can
be transmitted zoonotical ly, C. hominis is thought to cycle primarily among humans. Both
species can be transmitted through the i ngest ion of water or food contaminated with oocysts. As
the oocysts are excreted sporulated and ful ly infectious in the faeces , transmission through
di rect contact with infected hosts is also possible.
1 33
Cryptosporidiosis may m anifest sporadical ly or as epidemic outbreaks. Outbreaks as a resu lt of
person to person transmission, ingest ion of contaminated water supply or food, fol lowing
exposure in swimm ing pools and water parks, and contact with farm animals, including among
veterinary students, have been described (Aipert et al . 1 986 ; Combee et a l . 1 986; Pohjola et al .
1 986; Heijbel et al . 1 987 ; R eif et al . 1 989 ; Shield et a l . 1 990; Miron et a l . 1 99 1 ; Mi l lard et a l .
1 994; Anonymous 2000 ; Hel lard et al . 2000; Stefanogiann is et a l . 2001 ; Preiser et a l . 2003;
Mathieu et al . 2004; Causer et al. 2006 ; Jones et al . 2006 ; Ne i ra-Munoz et al . 2007; Turabel idze
et a l . 2007; Wheeler et a l . 2007; Gait et a l . 2008 ; H ajdu et al. 2008; Beaudeau et a l . 2008;
Hoek et a l . 2008 ; Ethelberg et a l . 2009) . Although in m any countries cryptosporidiosis is a
notifiable d isease, the outbreaks are often protracted and difficult to detect because of delays in
the investigations (M iron et a l . 1 99 1 ; M i l lard et al . 1 994; Hel lard et al . 2000 ; Anonymous 2000;
Preiser et a l . 2003 ; M athieu et al . 2004; Causer et a l . 2006; Ne i ra-Munoz et a l . 2007;
Turabel idze et al . 2007 ; W heeler et a l . 2007 ; Hajdu et a l . 2008 ; Beaudeau et al . 2008,
Valderram a et a l . 2009) . I n addition , most previous cryptosporidiosis outbreak invest igat ions
have dealt with outbreaks in open commun ities (Aipert et a l . 1 986; Pohjola et al . 1 986; Levine et
al . , 1 988 ; Reif et al . 1 989 ; Mi ron et al . 1 99 1 ; M i l lard et a l . 1 994; Anonymous 2000; Hel lard et a l .
2000; Preiser et a l . 2003; M athieu et a l . 2004; Causer et a l . 2006; Neira-Munoz et a l . 2007;
Wheeler et a l . 2007; Beaudeau et al . 2008; Hajdu et a l . 2008; Hoek et al . 2008) , requir ing the
use of case-contro l stud ies, which are m ore prone to u ncontrollable confounding than cohort
studies (Anonymous 2000 ; Crombie et a l . 1 981 ; Vonberg and Gastmeier 2007) . Traditional ly,
the most compell ing reason to investigate the outbreaks has been to determ ine the source of
infection in order to prevent further transmission, and l im ited efforts have been d i rected towards
the collect ion of cl in ico-epidemiolog ical data dur ing outbreaks. Little documented c l in ico
epidemiolog ical i nformation on infect ions in immunocom petent hosts exists (reviewed by
Warren and Guerrant 2008), and knowledge about the natural history of cryptosporidiosis has
m ain ly been obtained fro m experimental i nfection trials i n human volu nteers (Chappel l et a l .
1 999, 2001 ; Okhuysen et al . 1 999) . Furthermore, apart from immunosuppression ( Hunter and
N ichols 2002) , the constitut ional risk factors for cryptosporidiosis are not understood.
I n 2006, the author investigated an outbreak of gastrointesti nal i l lness in a c lass of 96 veterinary
students, i n which C. parvum was isolated as the sole agent from mu lt iple faecal specimens.
The synchronous exposu re of a cohort of young adu lts to wi ld C. parvum faci l itated the
collect ion of cl in ico-epidemiological data and an assessm ent for the presence of exposure and
constitut ional risk factors for cryptosporidiosis in the context of a retrospective cohort study.
The epidem iological features of the outbreak and the resu lts of a risk factor analysis are
reported in th is section .
4.3 Materials and Methods
Sequence of events. On October 9, 2006 ( Day 1 3) , three students from a class of 96 enrol led
in the second year of the Bache lor of Veterinary Science program of Massey University, New
1 34
Zealand, reported a gastrointestinal i l lness to the reg ional public health service. As a result ,
faecal specimens from these students were subm itted for analysis for Campylobacter and
Cryptosporidium to a diagnostic laboratory associated with the same publ ic body. The
specimens tested negative for Campylobacter and one tested positive for Cryptosporidium. The
presence of a s ingle Cryptosporidium-positive specimen precluded the identification of an
outbreak by the authorit ies at that stage. On October 1 0 (day 1 4) , a concerned student f rom the
same class i nformed a faculty member of the Institute of Veterinary, An imal and Biomedical
Sciences ( IVABS) of Massey U n iversity, about the occurrence of several cases of i l l ness among
students enrol led in the same c lass. The student inferred that the cases appeared to be l inked
to a practicum held on Septem ber 26 ( Day 0) in the Large Animal Teaching Un it (LATU) , i n
which the students handled you ng calves o f less than o n e month of age. Duri ng the practicum ,
groups o f students stayed i n a calf barn for about 20 m inutes to practise thoracic auscu ltations ,
as wel l as measuring the rectal temperature and respiration rate. No g loves were provided, but
the students were able to wash hands at the end of the practicum . No other academic or
recreational act ivities had occurred that could have resu lted in exposure of the class to
enteropathogens, and there were no other known cases of gastroenteritis among students from
other classes during the same period. On October 1 1 ( Day 1 5) , an urgent request to conduct an
outbreak investigation was sol ic ited by the author. The request was approved by Massey
University's H uman Eth ics Committee on October 1 3 (Day 1 7) . The same day, the author
addressed the class and i nvited the students to anonymously submit stool speci mens to the
m icrobio logy laboratory of IVABS during the weekend of October 1 3- 1 5 . The d iagnosis of
cryptosporidosis was released the morning of Monday 1 6 October (Day 1 8) . An environmental
investigation at the LATU was i nstigated on October 1 7 (Day 2 1 ) . On October 1 9 (Day 23) , the
author and a un iversity health and safety officer delivered a quest ionnaire to the class. A
second supplementary questionnaire was del ivered on May 25, 2007.
Environmental i nvestigation. The LATU was visited on October 1 7 . No calves were present
in the faci l ity at the t ime of the v isit. The faci l ity received potable water from a non-artesian bore,
which was m ai ntained by u niversity staff. The depth of the bore was 200 m below ground leve l .
Water sanitat ion consisted o f treatment with utravio let l ight a t the point o f use. A 1 OOL water
sample was col lected at one of the dr inking water taps and fi ltered on-site usin g a commercial
f i lter (Fi ltaMax®, ldexx Laborato ries, USA) . Flow rate was adjusted to 2Umin through the f i lter.
The sample was tested for the p resence of Cryptosporidium oocysts as described below.
The dairy farm from which the newborn calves were obtained was visited the same day in order
to assess whether C. parvum was cycl ing in calves. The farm was situated about 5 km from the
teaching faci l ity. The calves actually used for the practicum had been sold , and thus could not
be traced. As the calv ing season had ended in September, other calves less one month of age
were not present on the farm . H owever, faecal specimens from nine calves older than 30 days
of age were col lected and subm itted on ice to the m icrobiology laboratory of IVABS.
1 35
M ic ro biological analysis. Smears from the human and bovine stoo l specimens were exam ined
m icroscopically for the presence of Cryptosporidium oocysts and Giardia using a com mercial
imm unofluorescence test kit (MeriFiuor C/G , Mediridian B ioscience, C inc in nat i , Ohio, USA). In
addit ion, the human specimens were tested for the presence of Salmonella spp . , g roup A
rotavirus, norovirus genog roups 1 and 2, and Campylobacter spp.
Testing for Salmonella spp. and g roup A rotavirus was performed as previously described
( Section 3 . 1 ). Testing for norovi rus genogroups 1 and 2 was performed by means of reverse
t ranscriptase real-time PCR at the New Zealand Norovirus reference laboratory ( I nstitute of
E nvironmental Science and Research, Porirua City) . Test ing for Campylobacter was performed
o n ly in three human speci mens that had been subm itted to the diagnostic laboratory associated
with the publ ic health service (see above) us ing routine d iagnostic procedures.
Testing for Cryptosporidium oocysts in dr inking water was performed by Mr . Anthony P ita,
Protozoa Research Un it , Massey Un iversity. Briefly, the f i lter was taken apart and the foam
disks were homogenised with elution buffer. The eluant was col lected and centrifuged at 1 500g
or 1 5 m in . The pel let vo lume was recorded and supernatant aspirated from the tube unti l the
volume above the pellet was 5 m l . Water was added so the pellet vo lume was 5% or less in a
1 0 m l sample. An anti- Cryptosporidium and anti -Giardia immunomag netic separat ion kit
(Dynabeads® GC-Combo IMS kit: l nvitrogen , Carlsbad, CA, USA) was used for the separation
of the oocysts. The sample was then dried onto a sl ide, stai ned with F ITC label led anti- Giardia
and anti- Cryptosporidium antibod ies (Aq uaGio™ G/C kit, Waterborne Inc . , New Orleans, LA,
U SA) and screened m icroscopically for the presence of apple-green oocysts us ing an
epif luorescence m icroscope .
In October 2007, genomic DNA was extracted from the Cryptosporidium-positive human
specimens and from the n ine bovine specimens us ing DNA extraction kits as described in
Section 3 . 5 . For the taxonomic identif ication of Cryptosporidium, a fragment of the 1 8S
ribosomal RNA ( 1 8S rRNA) gene was amplified using a nested PCR fol lowed by sequence
analysis . The identified Cryptosporidium were subjected to subtyping by means of PCR
fol lowed by sequencing of the polymorphic reg ions of the sporozoite 60-kDa g lycoprotein
(G P60) and the 70 kDa heat shock protein (HSP70) genes. The PCR and sequenci ng
procedures for the 1 8S r R NA and HSP70 genes have been described in Sections 3 .2 and 3 .5 .
The GP60 sequences were al igned with other s im i lar sequences reported in Genbank.
Questionnaires. Two questionnaires were del ivered to the c lass on different dates and were
anonymously completed i n the classroom by interested students . The fi rst questionnaire (01 ;
Appendix 4 . 1 ) was de livered on 1 9 October 2006. The responses to 01 were used to el icit the
epidemic curve and the demographics and d istribution of the cli nical s igns, and assess the
sign ificance of putative constitutional r isk factors for i l l ness, such as gender, nationality, chronic
1 36
use of m edicat ion, domestic background (rural or u rban) , and the frequency of previous physical
contact with rum inants . A calendar report ing the dates of the main academic activities held
between September 1 8 and October 1 8 was provided , in order to faci l itate the correct
identification of the dates of i l l ness by the affected students . In order to m in im ise response bias,
01 did not i nclude specific questions addressing the calf-handling pract icu m . Thus, i n order to
assess the rate of attendance at the calf-handl ing practicu m and the source of dr inking water
(tap water, other) consumed by the students during the practicum, a second supplementary
questionnai re {02) was n ecessary. Th is question naire was delivered on 24 May 2007and
included on ly three stra ightforward questions (Appendix 4 .2 ) .
Analys i s o f t h e data. Responses to 0 1 and 02 were manipulated us ing an electronic
spreadsheet and used for the description of the demographics of the outbreak, the natural
h istory of d isease, the epidemic curve , and for a risk factor analysis. A case was defi ned as any
student report ing abdom inal discomfort, and/or diarrhoea, and/or vomiti ng between September
1 8 and October 1 8 2006, in 01 .
The statistical s ign ificance of the differences between proportions was assessed using the two
tailed Fisher's exact test. For the analysis of risk factors, the strength of associat ion between
exposure or constitutional variables and the outcome bi nary variable (case; non-case) was
assessed us ing the relative risk (RR) and its probabi l i ty u nder a nu l l model of R R= 1 , and the
95% confidence interval (C l ) . Variables used were : gender, national ity (New Zealand cit izens;
non-New Zeal_anders) , background (rura l ; urban) , h istory of previous physical i nteraction with
rum inants (no interact ion ; less than one-two interactions/year; more than o ne/two
interact ions/year) , taking chronic medicat ion (yes; no) , attendance at the calf handl ing practicum
(attended ; not attended ) , drinking tap water at the same practicum (yes; no) (see Appendices
4 . 1 -4.3 ) . The presence of bivariate interactions between i ndependent variables was explored
by stratif icat ion of the data i nto 2x4 tables and calcu lation of the Wald's stat istic for homogeneity
of strata ( Rothman et al. 2008). Adjusted M antei-Haenszel relative risks ( Mantel and Haenszel
1 959) were calculated for the comparisons not showing heterogeneity of strata by the Wald's
test (as indicated by p > 0 .05) . All the calculations were performed using Rothman's Episheet
software ( http ://members .aol .com/krothm an/episheet .x ls , downloaded 27 August 2005) . The
modest sample size precluded a more complex mu ltivariate analysis (see below) .
4.4 Results
Response to the req uest for co-operation. Seven students subm itted stool specimens to
IVABS between 1 4- 1 5 October 2006. One of the specimens, of a l iquid consistency, had been
collected by a student on October 8 and s ince then held in a home refrigerator. Th ree formed
specimens col lected on October 9 by the students who contacted the reg ional public health
service (see above) were reclaimed by the same students and resubmitted to IVABS. An
addit ional three formed specimens were d ispatched to I VABS on October 1 5, with no
1 37
accompanying i nformation . A total of 80 {83%) students completed 0 1 , and 64 (67%)
completed 02. 0 1 was fully answered by 75 {93%) students (Appendix 4 .3 ) .
M icrobiological findings. Al l the human specim ens tested negative tor g roup A rotavi rus,
Salmonella spp. , norovirus and Giardia. Four specimens tested positive tor Cryptosporidium
oocysts by immunofluorescent stain . One Cryptosporidium-positive specimen had been
col lected on October 8 , two on October 9, and one October 1 4. One Cryptosporidium-positive
specimen collected on October 9 had previously tested positive also at the diagnostic laboratory
(see above) .
Only three out of tour Cryptosporidium-positive specimens yielded editable 1 8S rRNA gene
sequences. Two of the positive sequences were i ndist ingu ishable from the C. parvum Type A'
1 8S rRNA gene sequence reported in Genbank u nder accession number L 1 6996 (Johnson et
al . 1 995) ; the th i rd sequence was indistingu ishable from the Type B' polymorphic copy of the
1 8S rRNA gene of C. parvum ( Le Blanq et a l . 1 997) .
The GP60 locus could be ampl ified from two Cryptosporidium-positive human specimens and
the HSP70 from all tour specimens. Al l the ed ited GP60 and HSP70 sequences were longer
than 740 and 380 base pairs, respectively, and com prised the polymorphic repeat reg ions
(Appendix 4 .4) . The two GP60 sequences were indisti nguishable, and belonged to the al lel ic
g roup //a A21 G4R 1 (according to the nomenclature proposed by Sulaiman et a l . 2005) . There
were no previous reports of th is G P60 sequence in New Zealand, and a search in Genbank
revealed that it h ad only been reported in some calves in the Un ited States (GenBank
accession number 006305 1 4) . Most interest ing ly, the same sequence was also found in an
isolate from an unpublished outbreak of cryptosporidiosis among veterinary students in the
U nited Kingdom (GenBank accession number EU262602. 1 ) .
There were two different al leles at the HSP70 locus , differ ing by the addit ion of a s ing le thym i ne
downstream of the repeat region . One HSP70 al lele was common to three isolates, and the
second was only present in one isolate. The same polymorph ism was conserved after re-edit ing
of the second sequence in 2009, arg u ing against an in itial edit ing error (Appendix 4.4) .
Al l the bovi ne specimens from the source farm were negative tor Cryptosporidium oocysts, but
one specimen yielded an amplicon of a sequence that was 99% sim i lar to the 1 8S rRNA gene
of C. bovis (Santin et al . 2004) (Appendix 4 .4) . An identical sequence was not retrieved in
Genbank. No Cryptosporidium oocysts were observed in drinking water collected dur ing the
visit to the large anim al teaching faci lity.
Clin ico-epidemiologal features of the outbreak. The demographic characteristics of the
class, as el icited from the responses to 01 , are reported in Table 4 . 1 . Seventy percent of the
1 38
respondents to 01 were female and 28% were non-New Zealand cit izens. These values were
very s imi lar to those of the entire class rol l ( not shown) . The range and mean of the age of the
students were very s im i lar in both genders. There was no statistical ly-s ign ificant d ifference
between the proport ions of m ales and females com ing from a rural or u rban background (two
tai led Fisher's exact P=0 .3 ) . The proport ions of males and females that had never handled
ruminants prior to the calf-handl ing practicum were not s ign i ficantly different (P=0 . 1 9) . In both
genders, the proportion of students that had previously handled ruminants more than once
twice was greater in students from a rural background (not shown) . A greater proportion of
males had previously hand led ruminants more than once-twice a year than females (P=0.0096) .
There were 25 cases among the 80 respondents to 01 (3 1 %) , and 1 5 among the 64
respondents to 02 (23%) . The difference in the proportion of cases between 01 and 02 were
not statistical ly significant (two-tailed Fisher's exact P=0.35) . N ine out of 25 (36%) cases sought
medical advice during the course of the i l lness . All the respondents to 02 had attended the calf
handl ing practicum and none reported having d runk tap water at LATU, ru l ing out a water-borne
source of infection there .
The duration of i l l ness and distribution of the c l in ical signs, as elicited by the responses to 0 1 ,
are reported i n Fig ure 4. 1 . N otice that the median duration of the i l lness was 5-6 days (range 2-
26 days) , and that the m ajority of cases suffered from diarrhoea and abdom inal d iscomfort ,
whi lst vomiti ng was only reported in six cases. The epidemic curve is reported in F igure 4.2 .
Only 2 out of 25 (8%) cases reported an i l lness start ing before the date of the calf-handl ing
practicu m ; the median and mode of the date of onset of the i l l ness coincided on Day 5 after the
same practicu m .
Risk factor a nalysis. The resu lts o f the analysis for the presence o f risk factors are
summarised in Table 4 .2 . There were no differences in the proportion of cases between m ales
and females (p=0.8) , New Zealand cit izens and non-New Zealanders , overall (P=0 .3) , and in
each gender separately. I n both genders, the habit of not wash ing hands after practicums was
not significantly associated with an i ncreased r isk of i l l ness (P=0.4 in females and 0.6 in m ales) .
No s ign ificant difference in the risk of i l l ness was observed between students from rural or
u rban background (P=0.3) . However, there was a reduction of the r isk of i l l ness in males from
rural backg round as compared to their urban counterparts ( R R=O.OO; p=0 .008), as wel l as
compared to rural and urban females (the statistical comparisons between rural males and rural
and urban females not shown but the data are reported in Table 4. 1 ) . I n agreement with this
finding , there was a greater risk of i l lness in males that had n ot handled rum i nants (P=0 .0 1 ) , or
handled rumi nants up to twice a year (p=0 .0 1 ) as compared with thei r counterparts, but these
associations were not seen among females. However, as said, a greater proportion of males
from rural background had reported handl ing ruminants more than once-twice a year than
females (Table 4 .2 ) .
1 39
Five students reported us ing chronic med ication , of which three were defined as cases
(Appendix 4 .3 ) . In terestingly, these three cases spontaneously reported the chron ic use of anti
asthma inhaled steroids (not shown) .
Age range (mean)
Nu mber of students that sought med ica l advice during the i l lness/total
respondents
Number of students that subm itted a faecal
specimen/tota l respondents
Smokers
Students of rural backgrou nd/u rban
background
Nu mber of students that never h and led
ru m i na nts/total respondents
Number of students that hand led ru m i nants more
than once-twice a year/tota l respon dents
Males Females
1 9-34 (22.5) 1 8-37 (22 .5)
1 /24 8/56
1 /24 6/56
0
1 1 /23 1 9/56
7/24 25/56
1 3/24 1 3/56*
Table 4.1 Demographic characteristics of the outbreak of cryptosporidiosis among a class of veterinary
students reported in Section 4. 1 . Asterisks denote a signif icant d ifference between the proportions in both
genders ( Fisher's exact test, p<0. 05}
1 40
2
2
- -Abdominal Diarrhoea
discomfort
4 5 6 8 1 0 1 4 1 5 1 6 1 7 26
Duration of illness (in days)
1 5
6
0 0 0
Vomiting Abdominal Abdom inal Diarrhoea + Abdominal
discomfort + discomfort + vomiting discomfort +
diarrhoea
Sym ptoms
vomiting diarrhoea +
vomiting
Figure 4.1 Duration of i l l ness (upper graph) and distribution of symptoms (lower graph) in the outbreak of
cryptosporidiosis, as el icited from the responses to questionnaire 0 1 . The number of respondents in the
lower g raph is reported above each bar.
1 41
1 0
: I 7 '
6
5
4 '
3
2
I I 1 �1 I -8 -7 -6 -5 -4 -3 -2 - 1 0 2 3 4 5 6 7 8 9 1 1
Figure 4.2 Epidemic curve of the outbreak of cryptosporidiosis as e l icited by the responses to 01
1 42
Putative risk factor Factor Factor RR (Cl ; p- x2 (questionnaire number) present absent value) Wald
test Number of Number of cases/total cases/total
resQondents resQondents ExQosure factors Attended the calf-handling practicum (02) 1 5/64 n/a n/a n/a
Drank tap water during the calf-handling 010 1 5/64 n/a n/a practicum (02)
Do not wash hands after practicums (01 ) all 4/1 3 2 1 /67 0.98 (OA - 2 A ;0.9)
females 2/4 1 6/52 1 .6 (0.5 - 4. 7; OA) p=0.30 males 2/9 5/1 5 0 .66 ( 0 . 1 - 2 . 7 ; 0 . 6)
MHrr 1 .03 (OA - 2 . 5; 0.95)
Constitutional factors Gender = male 7/24 1 8/56 0.9 (OA - 1 .9 ; 0.8) n/a
Non New Zealander (01 ) all 9 /23 1 6 /57 1 A (0. 7 - 2.7; 0.33) females 5 /1 5 1 3 /4 1 1 .0 (OA - 2 A ; 0.9)
P=0.22 males 4 /8 3 /1 6 2.7 ( 0 . 7- 9. 1 ; 0 . 1 2)
MHrr 1 A (0 . 7-2 .7 ; 0.33)
Rural background (01 ) all 1 7/49 7/30 1 .5 (0. 7 - 3 . 1 5; 0.3) females 7/19 1 1 /37 1 .2 (0 .5 - 2.7; 0 . 6) n/c males 0/1 1 6/1 2 0 ; P=0.008
MHrr 0.7 (0.3- 1 A ; 0. 3 1 )
Never handled ruminants (01 ) all 1 3/32 1 2/48 1 .6 (0.9 - 3. 1 ; 0. 1 4) females 8/25 1 0/31 1 (0.5 - 2 . 1 ; 0.98) P=0.025 males 5/7 2/1 7 6 ( 1 . 5 - 24; 0 . 0 1 )
MHrr not calculated
Handled ruminants up to twice a year, or never (01 )
all 20/54 5/26 1 .9 (0.8 - 4.6; 0 . 1 ) females 1 4/43 4/1 3 1 .05 (OA - 2.7; 0.9) P=0.07 males 6/1 1 1 / 1 3 7 ( 1 - 50; 0 . 0 1 )
MHrr 1 .8 (0.8 - 4 ; 0 . 1 1 )
Table 4.2 Risk factor analysis of the outbreak of cryptosporidiosis reported i n Sect ion 4. 1 . R R , relative
r isk; MHrr, Mantei- Haenszel relative ri sk; C l , 95% confidence intervals; n/a, not appl icable;nlc=not
calcu lated due to a value of zero in the data
4.5 D iscussion
The present outbreak provided a un ique opportunity to perform the i nvestigation in the context
of a retrospective cohort study. As in other investigations of outbreaks of cryptosporidiosis ( Reif
et a l . 1 999 ; Anonymous 2001 ; Mathieu et al . 2004; Wheeler et a l . 2007), the avai labi l ity of on ly
four laboratory-confi rmed cases was a l im i tation, which could have had implicat ions o n the
specificity of the case defin it ion. For i nstance, two cases reported an i l lness before the
1 43
practicum (F igure 4 .2) but nevertheless, were i ncluded in the analysis. Their i nclusion was
necessary because the same students may have also suffered from cryptosporidiosis. On the
other hand, the fact that the investigation could be performed with on ly short delay was a
strength , which most l ikely prevented recal l bias i n 01 .
The finding of C. parvum as the sole agent i n multiple specimens corroborated the occurrence
of an outbreak caused by th is parasite species. The outbreak was in it ial ly overlooked by the
health authority, as on ly one out of three faecal speci mens from the students tested positive for
Cryptosporidium at the diagnostic laboratory, which precluded the identification of a cluster of
cases. In this case, the authorities m ay have over-emphasized the value of the laboratory test
results. To the author's knowledge , the diagnostic laboratory used a commercial ant igen
detection kit for the analysis of cryptosporidiosis, whereas the the same specimens were tested
us ing immunofluorescence at M U . Due to the potential for massive outbreaks of
cryptosporidiosis, it would be prudent to assess the sensitivity of the d iagnostic methods
employed by the d iagnostic laboratories in New Zealand.
The resu lts of the molecular analysis of the C. parvum isolates supported the hypothesis of a
point source oubreak, as in New Zealand the l ikel ihood of f inding such a rare G P60 al lele i n
isolates from indiv iduals acquir ing infections from i ndependent sources wou ld have been very
smal l . The results of the responses to 02 and the water testing ruled out a water-borne
outbreak, leaving the direct contact with newborn calves at the practicum as the on ly l i kely route
of transmission.
Excluding the two cases with an onset on Days ( -4) and ( -8) (wh ich were probably unrelated to
the outbreak), if transmission dur ing the calf-handl ing practicum is assumed, the median and
mode of the incubat ion period coincide at five days post transm ission , and the range is between
0- 1 1 days post-exposure (F igure 4. 1 ) . These values fit the median and range observed in
experimental infect ion trials i n human volunteers for which most current knowledge of the
natural history of cryptosporidiosis is derived (Chappel l et a l . 1 999; Chappel l and Okhuysen
2006; Okhuysen et al . 1 999}, and t hose extrapolated in an early retrospective outbreak
invest igation (M i l lard et al. 1 994) . The self- l imit ing diarrhoea! i l l ness accompan ied by abdominal
discomfort and in a small proport ion of cases also vom it ing (Figure 1 ) were consistent with the
resu lts of previous retrospective studies in immunocompetent populations (Wolfson et al. 1 985 ;
Mac Kenzie e t a l . 1 994 ; Mathieu e t a l . 2004; Anonymous 200 1 ; Causer et a l . 2006} . However,
vom it ing had been reported by 82% of the cases in one outbreak of cryptosporidiosis from
fresh-pressed apple cider (M i l lard et al. 1 994} .
As i n other published cryptosporidiosis outbreak i nvestigations (Hel lard et a l . 200 0 ; Anonymous
2001 ; Turabel idze et al . 2007} , an environmental source of i nfect ion could not be
microbiologically traced. Unfortunately, calves less than one month of age were not avai lable for
1 44
sampl ing , and so C. parvum cou ld not be detected, as i n calves the oocyst shedding period is
usual ly short and concentrated in the fi rst three weeks of l ife (see Section 1 .6 . 1 ) . The f inding of
a nucleotide sequence mostly sim i lar, but n ot identical to the sequence of the 1 8S rRNA gene of
C. bovis in calves was not surpris ing , given the extensive genetic diversity revealed i n genus
Cryptosporidium since the advent of molecular tools for the genetic characterisation of the
isolates . This sequence remains of uncertain taxonomic position ing and pathogenic
sign if icance . Also the s ing le nucleotide polymorph ism observed i n the H SP70 locus was not
surpris ing . I ndeed, genetic differences between Cryptosporidium isolates had been documented
in previous outbreaks in humans (G iaberman et al . 2002; Leoni et a l . 2007) , and in our previous
investigations of enzootic cryptosporidiosis in foals (see Section 3.2) . In th is case the genetic
polymorphism in the HSP70 locus m ay have reflected a PCR or sequencing artefact, or the
presence of genetical ly heterogeneous parasites.
In the p resent outbreak, no sign ificant associations between any exposu re or constitutional
factor and the r isk of i l l ness were observed at the bivariate level, but some associations reached
a statistical sign ificance after stratif icat ion of the data. In particular, males com ing from a rural
background had a lower risk of i l lness than urban males and rural and urban fem ales (Table
4.2) . This risk-reduction should not be viewed as evidence of an effect of gender on the
susceptib i l ity to C. parvum, as this effect was confounded by the presence of a g reater
proport ion of males reporting frequent contact with ruminants than females (Table 4 . 1 ) . A
plausible explanation for the risk-reduction i n males from rural backgrou nd could be that of the
presence of a greater rate of immunity to C. parvum i n males, acqu i red throug h previous
exposures d uring repeated contacts with ruminants . Unfortunately, the modest size of this
cohort p recluded a more exhaustive m u ltivariate analys is to disentangle the relat ionships
between the variables, as in it ial explorat ion of logistic regression models including the
independent variables of gender, backg round and the frequency of handling ruminants, resu lted
in an unbalanced design , perhaps due to the small size of the cohort ( not shown) . l t is ,
however, noteworthy, that the effect of previous exposure on the susceptibi l ity to
cryptosporidiosis is not wel l understood. So far th is effect has only been i nvestigated by m eans
of experimental infections in human volu nteers, with confl ict ing resu lts. As would be expected,
vo lunteers experimental ly pre-exposed to C. parvum showed a partial resistance to re- infection
in one study (Okhuysen et al . 1 999) . However, in another experimental infection study,
volunteers with pre-existing anti- Cryptosporidium antibodies exhibited a more severe disease
than their sero-negative counterparts (Chappel l et al. 1 999) .
I n conclus ion , an explosive outbreak of cryptosporidiosis i n New Zealand caused by a rare
subgenotype of C. parvum is reported. The attack rate was 3 1 %. The infections were most
l ikely transm itted through di rect contact with young calves . The i l lness was self- l im iting i n al l
cases, with a median incubation period of 5 days. Symptoms included diarrhoea and abdomina l
discomfort, and vom iting in a l im ited proport ion of cases. A sig nificant d isease-risk-reduction in
1 45
m ales comi ng from a rural background, attributable to an immunity acqu i red through previous
exposures to C. parvum i n the farm environment, was observed . To the author's knowledge,
th is is the first study in which a constitut ional risk factor for cryptosporidiosis other than
immunosuppression was identified . However, due to the modest size of the cohort, th is study
can be viewed as a hypothesis-generati ng rather than test ing, and so the results should be
corroborated by large-scale epidemiological studies .
4.6 R EFERENCES
Alpert G, Bell LM, Kirkpatrick CE, Budnick LD, Campos JM, Friedman HM, Plotkin SA.
Outbreak of cryptosporidiosis in a day-care center. Pediatrics 77, 1 52-7, 1 986
Anonymous. Protracted outbreaks of cryptosporid iosis associated with swimming pool use -
Ohio and Nebraska, 2000. Centers for Disease Control and Prevention . Morbidity and Mortality
Weekly Report 200 1 ; 50 : 406-4 1 0 .
http ://www.cdc.gov/mmwr/preview/m mwrhtml!m m50 20a3 .htm. Accessed February 2009
Beaudeau P, de Valk H, Vail lant V, Mannschott C , Ti l l ier C, Mouly D, Led rans M . Lessons
learned from ten investigations of waterborne gastroenteritis outbreaks, France, 1 998-2006.
Journal of Water and Health 6, 491 -503, 2008
Causer LM, Handzel T, Welch P, Carr M , C u l p D, Lucht R, M udahar K, Robinson D,
Neavear E, fenton S, Rose C, Craig L, Arrowood M Wahlquist S, Xiao L, Lee YM, M i rel L,
Levy D, Beach MJ, Poquette G, Dworkin MS. An outbreak of Cryptosporid ium hom in is
infection at an I l l ino is recreational waterpark. Epidemiology and Infection 1 34, 14 7-1 56, 2006
C happell CL, Okhuysen PC. Cryptospor id iosis in health adu lt volu nteers. I n :
Cryptosporidiosis, t h e analytical chal lenge. M . S m ith and K C Thompson (eds) . The Royal
Society of Chemistry, Cambridge, UK, Pp 62-72, 200 1
Chappell CL, Okhuysen PC, Sterl ing CR, Wang C, Jakubowski W, DuPont H L . I nfectivity of
Cryptosporidium parvum in healthy adu lts with pre-exist ing anti -C. parvum serum
immunoglobul in G. A merican Journal of Tropical Medicine and Hygiene 60, 1 57-64, 1 999
Combee CL, Col l i n ge ML, B ritt EM. Cryptosporidiosis in a hospital-associated day care
center. Pediatric Infectious Diseases 5, 528-32, 1 986
Crombie IK. The l imitations of case-control stu dies In the detection of environmental
carcinogens, Journal of Epidemiology and Community Health 35, 28 1 -7, 1 98 1
1 46
Ethel berg S. Lisby M , Vestergaard LS, Enemark HL, Olsen KEP, Stensvold CR, Nielsen
HV, Porsbo LJ , Plesner AM, Molbak K. A foodborne outbreak of Cryptosporidium hominis
i nfection . Epidemiology and Infection, 1 37 , 348-56, 2009
Fayer R. Biology. I n : Fayer , R . , Xiao, L. ( Eds.) , Cryptosporidium and Cryptosporidiosis, second
ed. C R C Press and lW A Publ ishing, Boca Ratan, FL, pp. 1 -42, 2008
Gait R, Soutar RH, Hanson M, Fraser C, Chal mers R. Outbreak of cryptosporidiosis among
veterinary students . Veterinary Record 1 62 , 843-5, 2008
Glaberman S, Moore JA, Lowerly CJ, Chalmers R , Sulaiman I , Elwin K , Rooney PJ,
Mil lar BC, Dooley J S G, Lal AA, X i ao L. Three dri nking-water-associated cryptosporidiosis
outbreak, Northern I reland. Emerging Infectious Diseases 8, 631 -3, 2002
Hajdu A, Void L, Ostmo TA, Helleve A, Hel gebostad S R , Krogh T, Robertson L, d e Jong
8, Nygard K. I nvest igatio n of Swedish cases reveals an outbreak of cryptosporidiosis at a
Norweg ian hote l with possible l i nks to in-house water systems. BMC Infectious Diseases 8, 1 52,
2008
Heij bel H, Slaine K, Seigel B, Wall P, McNabb SJ, G i bbons W, lstre G R . Outbreak of
diarrhea in a day care center with spread to household m embers: the role of Cryptosporidium.
Pediatric Infectious Diseases Journal 6 , 532-5, 1 987
Hellard M E , Sinclair Ml, Fairley CK, And rews RM, Bai ley M, Black J , Dharmage SC, Kirk
MD. An outbreak of cryptosporidiosis in an urban swim ming pool : why are such outbreaks
difficult to detect? Australian and New Zealand Journal of Public Health 24, 272-5, 2000
Hoek M R , Ol iver I, Barlow M, Heard L, Chalmers R, Paynter S. Outbreak of Cryptosporidium
parvum among chi ldren after a school excursion to an adventure farm , south west Eng land.
Journal of Water and Health 6, 333-8, 2008
Hunter PR, Nichols G. E pidemiology and cl in ical featu res of Cryptosporidium i nfect ion in
immu nocomprom ised patients. Clinical Microbiology Reviews 1 5 , 1 45-54, 2002
Johnson DW, Pieniazek NJ, Griffi n DW, Misener L, Rose JB. Development of a PCR
protocol for sensit ive detection of Cryptosporidium oocysts in water samples Applied and
Environmental Microbiology 6 1 , 3849-55, 1 995
1 47
Jones M, Boccia D, Kealy M , Salkin 8, Ferrero A, Nichols G, Stuart J M . Cryptosporidium
outbreak l inked to interactive waterfeature, UK : Importance of guidel ines. EuroSurveil/ance 1 1 ,
1 26-8, 2006
LeBiancq SM, Khramtsov NV, Zamani F, Upton SJ, Wu TW. R ibosomal RNA gene
organization in Cryptosporidium parvum. Molecular and Biochemical Parasitology 90, 463-78,
1 997
Leoni F, Mallon ME, Smith HV, Tait A, McLauchl in J. Mult i locus analysis of Cryptosporidium
hominis and Cryptosporidium parvum isolates from sporadic and outbreak-related human cases
and C. parvum iso lates from sporadic l ivestock cases in the U nited Kingdom . Journal of Clinical
Microbiology 45: 3286-94, 2007
Levine JF, Levy MG, Walker RL, Crittenden S. Cryptosporid iosis i n veterinary students.
Journal of the A merican Veterinary Medical Association 1 93, 1 4 1 3-4, 1 988
Mantel, N. , Haen szel, W. Statistical aspects of the analysis of data from retrospective studies
of disease. Journal of the National Cancer Institute 22, 7 1 9-7 48, 1 959
M athieu E, Levy DA, Veverka F, Parrish M, Sarisky J, Shapiro N, Johnston S, Handzel T,
H ightower A, X iao L, Lee V, York S, Arrowood M, Lee R , Jones JL. Epidem iolog ic and
environmental i nvestigation of a recreational water outbreak caused by two genotypes of
Cryptosporidium parvum in Oh io in 2000 . American Journal of Tropical Medicine and Hygiene
7 1 , 582-9, 2004
M i l lard PS, Gensheimer KF, Addiss DG, Sosin DM, Beckett G A, Houc k-Jankoski A,
H udson A. An outbreak of cryptosporidiosis from fresh-pressed apple cider. Journal of the
A merican Medical Association 2 72, 1 592-6, 1 994
M i ron D, Kenes J, Dagan R . Calves as a sou rce of an outbreak of cryptosporidiosis among
young chi ldren in an agricultural closed comm unity. Pediatric Infectious Diseases Journal 1 0,
438-41 , 1 99 1
Neira-M unos N , Okoro C , M cCarthy NO. Outbreak of waterborne cryptosporidiosis associated
with low oocyst concentrations . Epidemiology and Infection 1 35, 1 1 59-64, 2007
Okhuysen PC, Chappell CL, C rabb JH, Sterl i ng CR, Du Pont HL. Virulence of three distinct
Cryptosporidium parvum isolates for healthy adu lts. Journal of Infectious Diseases 1 80 , 1 275-
8 1 , 1 999
1 48
Pohjola S, Oksanen H, Jokipii L, Jokipi i AM . Outbreak of cryptosporidiosis among veterinary
students. Scandinavian Journal of Infectious Diseases 1 8 , 1 73-8, 1 986
Preiser G , Preiser L, Madeo L. An outbreak of cryptosporidiosis among veterinary science
students who work with calves. Journal of the A merican College Health 5 1 , 2 1 3-5, 2003
Reif JS, Wimmer L, Smith JA, Dargatz DA, Cheney J M . Human cryptosporidiosis associated
with an epizootic in calves. A merican Journal of Public Health 79, 1 528-30, 1 989
Rothman KJ, G reen land S, Lash T . I n : Modern Epidemiology. Lippincott Wi l l iams and Wi lk ins ,
Phi ladelph ia, PA, USA, p. 227, 2008
Santin M, Trout JM, Xiao L, Zhou L, G reiner E, Fayer R. Prevalence and age-related
variat ion of Cryptosporidium species and genotypes in dairy calves Veterinary Parasitology
1 22, 1 03- 1 7 ' 2004
Shield J, Baumer JH, Dawson JA, Wilki n son PJ. Cryptosporidiosis - an educatio nal
experience. Journal of Infection, 2 1 , 297-30 1 , 1 990
Sulaiman IM, H i ra PR, Zhou L, AI-Ai i FM, AI-Shelahi F A, Shweiki HM, lqbal J, Kha lid N,
Xiao L. Un ique endemicity of cryptosporidiosis in ch i ldren in Kuwait. Journal of Clinical
Microbiology 43, 2805-09, 2005
Stefanogiannis N, Mclean M , Van M i l H. Outbreak of cryptosporidiosis l i nked with a farm
event. New Zealand Medical Journal 1 1 4, 5 1 9-2 1 , 2001
Turabelidze G, Lin M, Weiser T, Zhu BP. Communitywide outbreak of cryptosporid iosis i n
rural M issouri associated with attendance at ch i ld care centers . Archives of Pediatric and
Adolescent Medicine 1 6 1 , 878-83 , 2007
Valderrama AL, Hlavsa MC, C ronq uist A, Cosgrove S, Joh nston SP, Roberts JM, Stock
ML, Xiao L, Xavier K, Beach MJ. Multiple risk factors associated with a large statewide
i ncrease in cryptosporidiosis . Epidemiology and Infection 27, 1 -8 , 2009
Vonberg RP, Gastmeier P. Quality of outbreak descriptions in medical literature. The Lancet
Infectious Diseases 7, 699-700, 2007
Warren CA, G uerrant R L. Clinical disease and patho logy. In : Cryptosporid ium and
cryptosporidiosis (editors : R. Fayer and L . Xiao ) , 2nd edit ion, Pp. 235-8, CRC press, Boca
r�on, FL, USA, 2008
1 49
Wheeler C, Vugia DJ, Thomas G, Beach MJ, Carnes S, Maier T, Gormam J, X i ao L,
Arrowood MJ G il l i ss D, Werner SB. Outbreak of cryptosporidiosis at a Cal ifornia waterpark:
employee and patron roles and the long road towards prevention. Epidemiology and Infection
1 35, 302-1 0 , 2007
Wolfson JS, R ichter J M , Waldron M A, Weber DJ, McCarthy DM, Hopki n s CC.
Cryptosporidiosis in imm unocompetent patients. New England Journal of Medicine 3 1 2 , 1 278-
82, 1 985
1 50
CHAPTER 5
GENERAL DISCUSSION
The f irst publ ications by Tyzzer defined most of the knowledge about the biology of
Cryptosporidium parasites, whi lst the recent advent of mo lecu lar tools for the genotyping of the
isolates is currently enabl ing a clearer understand ing of the epidemiology of cryptosporidiosis.
The studies presented in th is thesis were performed dur ing a period of rapid expansion i n the
use of molecu lar tools for the study of Cryptosporidium, and applied a variety of such too ls .
Chapter 2 reports two studies that analysed m u!ti !ocus genotype data to explore the popu lation
genetic structure of C. parvum and C. hominis. For the analys is of the data, classic analytical
techniques of population molecular genetics and rarefact ion analysis - a stat istical test
traditional ly used in ecological and paleonto logical stud ies - were combined . Conversely,
Chapter 3 reports straightforward studies that applied simple genotyp ing schemes for
epidem iolog ical source-tracki ng . U lt imately, the epidemiological and molecular expert ise
acqui red by the author over the years was used to investigate an outbreak of cryptosprid iosis i n
humans in N e w Zealand.
The studies presented in Chapter 2 contribute to the discuss ion on the population structure of
C. parvum and C. hominis i n several ways. Fi rstly, the resu lts of the study i n Section 2 .2 provide
statistical support to the emerging idea of the existence of anth roponotic C. parvum cycles that
do not i nvolve local cattle reservoirs in Scotland. Unfortunately, the modest sample s ize
precluded a comparative analys is between human and bovi ne C. parvum in New Zealand us ing
rarefaction analysis. Also the use of different genetic m arkers by the research groups in
Scotland (Wellcome Centre for Molecular Parasitology) and the USA (Tufts University)
precluded a d i rect comparison between the sam ples from Scotland and New Zealand. However,
anthroponotic C. parvum cycles could not be identified in New Zealand. I ndeed, a str ik ing
homogeneity in the genetic repertoire of C. parvum was seen i n this country using multi locus
genotyping, with bovine and human isolates from North and South Island composing a s ing le
star-l ike eBURST network ( Section 2 .2) . Th is homogeneity was later corroborated by
comparative analysis of human , bovine and equine isolates us ing single and bi locus genotyp ing
schemes in the studies presented in Sections 3 .2- 3.5. I n addition, putative anthroponotic C.
parvum parasites carrying G P60 al leles belong ing to the a l lele fami ly 1/c could not be identified
in N ew Zealand.
Secondly, the study in Section 2.2 provides new data on the structuring role of geography in C.
parvum and C. hominis popu lations. On the whole, the resu lts show that gene flow is not
sufficient to erase genetic divergence among geographical ly separated parasite populations,
which basical ly remain al lopatric. This result was somewhat surprising because C. parvum and
C. hominis are cosmopol itan m icroorganisms smal l enoug h to be transported mechanically, or
1 51
through overt o r subcl in ical i nfections, thus enabling m ix ing of oocysts from different sources.
In the same study, the clear identification of five C. hominis isolates introduced to the UK f rom
Pakistan via travel a lso demonstrate the feasibil ity of tracking C. parvum and C. hominis
parasites to thei r country of or ig in using multi locus genotyp ing . The author hypothesises that the
ecology of cryptosporidiosis may have selected for the best-adapted parasites in each
environment, and that imported parasites would be un l ikely to spread if environmental factors
are unfavourable .
Lastly, the results of the study i n Sect ion 2 .2 are inconsistent with a strict categorization of C.
parvum and C. hominis as either clonal or panmictic. I nstead, they support the notion of the eo
occurrence of both mutational and recombi natorial diversification, with geography playing an
important structuring role. In some regions where sanitary cond itions are good (as in the UK) ,
selfing seems to prevai l , g iv ing rise to what is often referred to as a "clonal" popu lation ,
characterized by the occurrence of a smal l number of m u ltilocus genotypes and a h igh ly
abundant putative founder type. Conversely, i n some developing regions (as i n Uganda) the
genetic d iversification of C. parvum and C. hominis seems to be accelerated by recombination
between genetical ly-heterogeneous gametes. This may be due to suboptimal sanitation and
h igh H IV prevale nce , which en hance i nfections with envi ronmental oocysts or ig inat ing from
m ultiple sou rces . The process generates a so-cal led 'panmictic' population, characterized by
the occurrence of a large number of mu lt i locus genotypes and the absence of an obvious
founder type. These differences in the structu res of C. parvum and C. hominis popu lations
between cou ntries may plausib ly explain - at least i n part - the severity of cryptosporidiosis
observed in some developi ng reg ions, as the accelerated diversification by recombination could
enhance the frequent appearance of novel, h i ghly viru lent genetic variants. However, the
cl in ico-epidem iogical impl icat ions of these differences remain to be establ ished, taking into
account confounding factors related to the host, such as the higher prevalence of H IV-related
immunosuppression in some developing countries.
lt is relevant to h ighlight here the l im itations of the above and previously publ ished studies of
popu lation genet ic structure of C. parvum and C. hominis. In al l these studies, the structures
have been inferred based on the observed genetic variation between isolates, as revealed
fol lowing PCR am plification of mu ltiple polymorphic markers. However, th is approach m ay
introduce bias, as the true genetic variation in Cryptosporidium is between the sporozoites,
with in the isolates . Unfortunately, this variat ion is diff icult to assess using PC R , due to the
problem of preferential ampl ificatio n of the templates, as discussed in Sect ion 1 .3 .
The studies presented i n Sections 3 . 1 -3 .3 defi ned the basic molecu lar and cl in ico
epidem iolog ical aspects of cryptosporidiosis in foals and, to the author's knowledge, represent
the most comprehensive series of studies of cryptosporidiosis in these hosts reported in the
l i terature. The study in Sect ion 3 . 1 represents the f i rst known descript ion of the d isease in foals
1 52
which i ncludes cl in ico-epidemiological and pathological data, as well as the genetic
identificat ion of the iso lates as C. parvum. At the t ime the study was done, genetic subtyping
tools for Cryptosporidium were sti l l embryon ic and so the characterisat ion of the isolates was
l imi ted to the defin it ion of the taxon . In the fol lowing years, the suggestion that a
Cryptosporidium 'horse genotype' exists and the notion of the occurrence of anthroponotic C.
parvum cycles triggered the study presented in Section 3 .2 . The genetic characterisation of n i ne
Cryptosporidium-positive specimens col lected from foals for that study resu lted in the
identification of C. parvum in al l cases. Therefore , the notion of the occurrence of a
Cryptosporidium ' horse genotype' in horses could not be validated . After identifyi ng C. parvum
as the dominant species parasitis ing young foals in New Zealand, it was necessary to perform a
comparative genetic siudy of the isolates from foals, calves, and humans, in order to i nfer the
transm ission routes and assess the zoonotic potential of cryptosporidiosis in foals. Such a study
was then feasible, as numerous polymorphic loci in the genome of C. parvum had already been
reported . The results of the genetic comparison of diarrhoeagenic C. parvum isolates from foals,
humans and cattle indicated the three host-species were infected with genetically-s imi lar
parasites, and so cryptosporidiosis in foals should be considered potent ia l ly zoonotic. Final ly ,
the study presented in Sect ion 3.3 was m otivated by the lack of knowledge about the incidence
of cryptosporidiosis in foals. The detection of a new outbreak i n a broodm are farm situated near
Massey Un iversity in the course of the study faci l i tated a longitudinal observation of fou r
affected foals . The resu lts i ndicate that the cryptosporidiosis in foals is l i kely to be more
com mon than thought. The observed short patent period and self l im it ing nature of
cryptosporidiosis in foals suggest the condit ion may be underdiagnosed, and m ay account for a
proport ion of cases empirica l ly diagnosed as foal-heat diarrhoea. I n the two documented
outbreaks in foals, the ani mals co-existed with ruminants on the same land. However, newborn
calves are considered the main amplifiers of C. parvum i n nature, but such an imals were not
present on the farms dur ing the foal ing season , and no specimens from o lder ruminants were
analysed. In addition , an environmental source of infection, such stream water, was also l ikely.
Further studies to assess the i mpact of cryptosporidiosis in neonatal d iarrhoea of foals in New
Zealand are warranted.
The study presented in Section 3.4 was motivated by the paucity of data on the dairy-farm
prevalence of C. parvum in New Zealand, which contrasted with the huge i mportance of
dairying in th is country. Despite the short and concentrated calving seaso n , Cryptosporidium
oocysts were detected in 40 percent of the surveyed farms. However , it is acknowledged that
the phenotypic identification of the parasites in th is study did not stand the test of t ime. In fact, a
novel 1 8S rRNA gene sequence, most s imi lar to the sequence of C. bovis, was identif ied i n a
faecal specimen from a calf in the successive study reported i n Section 4, ind icat ing that non
parvum Cryptosporidium parasites do cycle in young cattle in New Zealand. Nevertheless, a
large amount of data from overseas indicate C. parvum as the most com mon taxon cycl ing in
unweaned calves and so it is l ikely that most parasites isolated i n the study i n Section 3 .4 were
1 53
i ndeed C. parvum. Although not designed to est imate the farm level prevalence, the successive
f inding of C. parvum in a large number of farms in the Waikato in the study presented in Section
3.5 clearly indicates that this potentia l ly zoonotic species is widespread in cattle in New
Zealand.
Many questions related to the incidence of i nfections with C. parvum i n cattle and the immun ity
deve lopi ng as a result of cryptosporidiosis remain unanswered. Likewise, l i ttle is known about
the effect of the age on the susceptibi l ity to C. parvum i nfections in calves which are not
exposed to the i nfection in the perinatal period. In previous studies (which were not included this
thesis} , this and other authors have observed an i ncidence of cryptosporidiosis in 1 00% of the
calves on farms with year round calvin g (see Section 1 .6 . 1 ) . However, the same may not
necessari ly occur in New Zealand, where the short and concentrated cavi ng season m ight
prevent - at least in theory - the accummulatio n of the pathogen in the farm environment.
The absence of oocysts in the samples from farms rear ing Jersey cattle in the study presented
in Section 3 .4 was intr igu ing . To the author's surprise, th is seem ingly m inor f inding has been
later corroborated in a study in the USA (Starkey SR , Zeig ler PE, W ade SE , et a l . Factors
associated with shedd ing of Cryptosporidium parvum versus Cryptosporidium bovis among
dairy cattle i n New York State . JAVMA 229 , pp. 1 623-26, 2006}, which tr iggered a successive
letter to the editor of JAVMA by the author (JAVMA 23, p. 339, 2007} . The f inding of low
infection rates in Jersey cattle in independent studies i n d ifferent countries would suggest an
effect of the breed on the susceptibi l ity to C. parvum, which warrants further i nvestigation .
The study presented in Section 3 .5 represents the fi rst systematic genetic com parison between
human and bovine C. parvum i n New Zealand us ing h igh ly discriminatory sub-typing tools. The
results of the study indicate a significant homogeneity of the genetic repertoi re of bovine and
human C. parvum. Despite the wide spectrum of C. parvum G P60 al leles in circulat ion, two
alleles - belong ing to al lele fami l ies //a A1 8G3 R 1 and //a A1 9G4 R 1 - persistently dominated the
samples, each year. As hypothesised in the study presented in Section 3 .4 us ing microscopy
only, the author postu lates that the cyclic dom inance of these subgenotypes is due to the
selection of a 'rapacious' phenotype, able to rapidly f i l l the niche during the calvi ng season and
survive between seasons. The pathways of survival of C.parvum i n the New Zealand ecosystem
between the calving seasons remain to be establ ished.
Final ly, Chapter 4 reported the i nvestigat ion of a serendipit ious outbreak of a gastrointestinal
i l l ness among a cohort of young adults. Cryptosporidium parvum was the only enteropathogen
identified from mu ltiple faceal specimens. The explosive nature of the outbreak and the h igh
attack rate observed underscore the potential publ ic health hazard posed by C. parvum i n New
Zealand. As in many other investigations of outbreaks of cryptosporidiosis publ ished in the
scientific literature , the sou rce of i nfection could not be traced, presumably due to the delay i n
1 54
the i nvest igation . I ndeed, the outbreak was init ial ly overlooked b y the local health authorit ies
based on the laboratory test resu lts, which precluded the occurrence of a cluster of cases.
However , a point source i nfection could be determined fol lowing the identification of a rare
subgenotype of C. parvum in two isolates. Also the c i rcumstantial evidence and the epidemic
curve strong ly suggested a poi nt-source zoonotic transm ission through d i rect contact with
calves dur ing a calf-hand l i ng practicu m . it is hoped that the lessons learned dur ing the
investigat ion of this outbreak will en hance preparedness.
In addit ion to the valuable data on the natural h istory of cryptospor id iosis obtained duri ng the
investigation , a h istory of previous i nteractions with ruminants in the farm environment was
signif icantly associated with a reduct ion of the risk of cryptosporidiosis in males. This result
reinforces the intu itive not ion that exposure to C. parvum confers some protective immun ity.
However, in this study the effect of previous i nteractions with rumi nants on the susceptibi l i ty to
cryptosporidiosis may have been confounded, and should therefore be corroborated i n large
scale epidemiolog ical studies.
Many important questions on cryptosporidiosis remain u nanswered . Future studies of the
popu lation genetic structure of Cryptosporidium should address the question of the intra-isolate
genetic d iversity, which is technically d ifficult to assess us ing PCR. I n the author's opin ion , th is
diversity could be captured using increas ing ly-accessible PCR-free sequencing techno logies.
Large-scale epidemiolg ical studies are needed in o rder to assess the impact of
cryptosporidiosis, and other infections, on the health of newborn foals. A re-assessment of the
farm-prevalence of C. parvum i n New Zealand using molecular tools, as wel l as incidence
studies with long itudinal studies of large cohorts of calves in m ult iple farms would also be
necessary in order to define the farm-level prevalence and animal-level incidence of
cryptosporidiosis caused by C. parvum i n New Zealand, and elsewhere. Such studies, if
adequately powered, could also assess the presence of risk factors for C. parvum i nfect ions at
the farm-leve l . Finally, stud ies assessing the potential zoonotic impact of Cryptosporidium
parasites cycl ing in other dominant domestic and wild species in New Zealand, such as sheep,
deer, possums and birds, are also warranted.
1 55
APPENDICES
APPENDIX 2.1 Mult i locus genotypin g results o f the study reported i n Section 2 .2 .
M LG_I D: identif ier of the mu lti locus genotype; eBU RST code: code used in the s i ngle locus
variant networks using eBU RST software.
Numbers represent the allele s izes in base-pairs. The markers are those described in Section
2.2. N otice that the iso lates from the USA were not included in the eBU RST diagrams .
These data are a lso avai lable a s a n on- l ine supplement t o the publ ished paper at
http ://aem .asm .org/
1 00
1 00
1 36
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
266
274
274
308
1 56
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 68
1 68
1 68
209
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
205
1 75
1 75
1 75
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
250
280
306
1 66
250
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
235
244
244
244
244
244
244
244
244
244
244
244
244
244
244
244
244
244
382 298
382 298
382 298
394 228
382 283
382 283
382 283
382 283
382 3 1 6
382 3 1 6
382 3 1 6
382 3 1 6
382 3 1 6
382 3 1 6
382 283
382 274
382 283
382 283
382 283
382 283
382 283
382 283
382 283
382 283
382 283
382 283
382 283
382 283
382 283
382 283
382 298
382 298
1 56
1 71
1 84
1 84
1 7 1
1 77
1 77
1 77
1 77
1 77
1 77
1 77
1 77
1 77
1 77
1 74
1 77
1 74
1 74
1 74
1 74
1 77
1 77
1 77
1 77
1 77
1 77
1 77
1 77
1 77
1 77
1 77
1 77
1 79
1 92
1 92
1 79
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
U K 1
U K 2
U K 3
UK4
UG5
UG6
6
6
UG7
UG7
UG7
UG7
UG7
UG7
UG8
UG9
UG 1 0
U G 1 0
UG 1 0
U G 1 0
UG1 1
UG1 1
UG1 1
U G 1 1
U G 1 1
U G 1 1
U G 1 1
UG1 1
UG1 1
UG1 1
1 2
1 2
39
39
39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
39
39
39
39
39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
1 65
245
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 84
1 84
1 87
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
244
244
244
250
250
250
250
250
250
250
250
250
250
1 95
244
239
244
244
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
382
382
382
382
382
298
3 1 6
3 1 6
283
283
382 283
382 283
382 283
382 283
382 283
382 283
382 283
382 307
484 283
382 334
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
382 298
1 57
1 77
1 77
1 77
1 74
1 77
1 77
1 77
1 77
1 77
1 77
1 77
1 77
1 77
1 94
1 77
1 7 1
1 71
1 7 1
1 71
1 7 1
1 7 1
1 7 1
1 7 1
1 7 1
1 7 1
1 7 1
1 7 1
1 7 1
1 71
1 7 1
1 7 1
1 7 1
1 7 1
1 7 1
1 7 1
1 71
1 7 1
1 7 1
1 7 1
1 71
1 71
1 71
1 71
1 71
1 71
1 71
1 71
1 71
1 71
1 7 1
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 82
1 85
1 92
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 2
1 3
1 3
1 4
1 5
1 5
1 5
1 5
1 5
1 5
1 5
1 6
1 7 1 8
1 9
20
2 1
2 1
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
U G 1 2
UG 1 3
UG 1 3
UG 1 4
UG 1 5
UG 1 5
UG1 5
UG 1 5
UG 1 5
UG 1 5
UG 1 5
UG 1 6
UG 1 7 UG 1 7
UK20
UK21
UK21
UK22
UK22
UK22
UK22
UK22
UK22
UK22
U K22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
39
39
39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
1 39
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
266
274
274
274
274
274
274
274
274
274
274
274
276
276
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 52
1 52
1 52
1 52
1 52
1 52
1 52
1 68
1 68
1 68
1 68
1 68
1 68
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
1 75
1 75
205
205
205
205
205
1 75
205
205
205
1 35
205
250
250
250
250
250
250
250
250
250
250
250
250
250 250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
250
306
244
244
244
244
244
268
244
244
244
244
244
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
460
460
382
382
382
382
382
382
382
382
382
382
382
382
382
1 58
298
298
298
298
298
298
298
298
298
298
298
298
298
298
298
298
298
298
298
298
298
298
298
298
298
298
298
298
298
298
298
3 1 6
3 1 6
325
325
298
298
298
298
298
298
298
3 1 6
3 1 6
274
298
298
298
274
274
1 71
1 71
1 71
1 71
1 7 1
1 7 1
1 71
1 7 1
1 7 1
1 7 1
1 7 1
1 7 1
1 7 1
1 7 1
1 71
1 71
1 7 1
1 7 1
1 7 1
1 7 1
1 71
1 7 1
1 7 1
1 7 1
1 71
1 71
1 7 1
1 71
1 84
1 84
1 84
1 7 1
1 7 1
1 7 1
1 7 1
1 7 1
1 7 1
1 7 1
1 7 1
1 7 1
1 71
1 7 1
1 7 1
1 7 1
1 84
1 7 1
1 71
1 71
1 77
1 77
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 92
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 79
1 92
1 92
1 79
1 79
1 79
1 79
1 79
1 92
1 79
1 79
1 79
1 79
1 79
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
22
23
24
24
24
25
25
26
26
27
27
28
29
30
30
30
3 1
3 1
32
33
33
33
34
35
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK22
UK23
U K24
U K24
U K24
U K25
U K25
UK26
U K26
U K27
U K27
U K28
U K29
UK30
UK30
U K30
UK31
UK31
U K32
UK33
U K33
U K33
39
39
39
39
39
39
39
39
39
39
39
39
39
39
39
39
39
39
39
39
39
39
39
39
39
39
39
39
39
39
39
39
285
286
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
291
1 52
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 68
1 82
1 82
1 75
1 75
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 74
1 35
1 74
280
280
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
239
244
244
244
244
244
244
244
244
244
244
244
244
244
244
244
248
248
248
248
248
248
250
250
250
250
250
268
248
382
382
382
382
382
382
382
382
382
382
382
382
382 382
382
382
382
382
382
382
472
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
382
1 59
298
325
286
286
298
307
307
307
3 1 5
3 1 5
3 1 5
3 1 6
3 1 6 3 1 6
3 1 6
3 1 6
3 1 6
3 1 6
3 1 6
3 1 6
3 1 6
298
274
274
274
274
283
283
283
283
283
283
286
298
3 1 5
3 1 6
3 1 6
283
283
286
297
307
3 1 6
274
286
297
298
325
274
297
1 84
1 84
1 77
1 77
1 77
1 74
1 77
1 77
1 74
1 74
1 77
1 74
1 74
1 74
1 74
1 77
1 77
1 77
1 77
1 77
1 77
1 77
1 77
1 77
1 77
1 77
1 74
1 74
1 77
1 77
1 77
1 77
1 74
1 77
1 74
1 74
1 77
1 77
1 77
1 77
1 74
1 77
1 77
1 50
1 77
1 74
1 77
1 77
1 74
1 74
1 79
1 92
1 82
1 82
1 82
1 85
1 82
1 85
1 85
1 85
1 85
1 85
1 85
1 85
1 85
1 82
1 82
1 85
1 85
1 85
1 85
1 87
1 82
1 82
1 87
1 92
1 85
1 87
1 82
1 82
1 85
1 85
1 85
1 92
1 85
1 85
1 82
1 82
1 82
1 82
1 85
1 85
1 85
1 79
1 82
1 85
1 82
1 82
1 87
1 85
36
3 7
39
39
40
4 1
42
43
44
44
45
46
46
46
46
47
47
48
48
48
49
50
5 1
5 1
52
53
54
55
56
56
57
57
58
59
60
6 1
62
63
63
64
65
66
67
68
69
70
7 1
72
73
74
UK36
UK37
UG39
UG39
UG40
UG41
UG42
UG43
UG44
UG44
UG45
UG46
UG46
UG46
UG46
UG47
UG47
UG48
UG48
UG48
UG49
UG51
UG5 1
UG54
UG55
UG56
UG56
UG57
UG57
UG58
UG60
UG61
UG62
UG63
UK63
UK64
UK65
UK66
UK67
UG69
UG70
UG71
UG72
UG74
1 88 1 88 1 88
1 88 1 88
291
291
297
300
300
300
300
322
274
276
276
279 279 279 279
279 279
1 88 279 1 88 279 1 88 279
1 88 279
1 88 279 188 279 188 279 1 88 279
1 88 279 1 88 279 1 88 279 1 88 279 1 88 279 188 279 188 279 1 88
1 88
279
279
279 279 279 322
324
333
333 333
333 345 274
322
1 82
1 87
1 52
1 68
1 68
1 68
1 68
209
1 87
209
225
225
1 87
1 87
1 87
1 87
1 87
1 87
1 87
1 87
1 87
1 87
1 87
1 87
1 87
1 87
1 87
1 87
1 87
1 87
1 87
1 87
1 87
1 87
1 87
1 87
225
232
225
209
1 87
1 87
1 87
1 87
1 87
232
209
1 74
1 74
1 75
1 75
1 75
1 75
1 75
205
232
232
1 98
1 98
205
205
205
232
232
232
232
232
232
232
232
232
232
232
232
232
232
232
232
232
232
232
232
232
232
232
1 98
232
232
232
232
232
205
1 98
232
250
244
268
226
244
256
280
250
1 95
1 95
2 1 4
2 1 4
1 95
1 95
1 95
1 95
1 95
1 95
1 95
1 95
1 95
1 95
1 95
1 95
1 95
1 95
1 95
1 95
1 95
1 95
1 95
1 95
1 95
1 95
1 95
235
1 95
1 95
2 1 4
1 95
1 95
1 95
1 95
1 95
1 66
2 1 4
2 1 4
382 274
382 283
382 298
382 298
382 334
382 274
382 298
460 298
534 229 528 229
454 1 79
460 1 79
504 229 534 229 540 229 382 229
484 229 492 229 504 229 522 1 93 528 229
528 229
528 229 528 229 534 229 534 229
534 229 534 229 534 2 29 534 229 534 229 534 229 534 229 540 229
546 229
528 229 528 229 472 229 460 1 79
472 229
466 1 93
466 1 93 484 229
484 229 492 1 93 474 1 79
528 229
1 60
1 77
1 77
1 84
1 84
1 84
1 94
1 84
1 65
1 94
1 94
1 50
1 50
1 94
1 94
1 94
1 94
1 94
1 94
1 74
1 94
1 94
1 94
1 94
1 94
1 74
1 94
1 94
1 94
1 94
1 94
1 94
1 94
1 94
1 94
1 94
1 94
1 94
1 74
1 50
1 74
1 74
1 74
1 94
1 94
1 74
1 50
1 50
1 87
1 85
1 92
1 92
1 92
1 92
1 92
230
21 3
2 1 3
220
220
2 1 3 2 1 3
2 1 3 1 85
2 1 3 2 1 3 2 1 3 2 1 3 2 1 3
21 3
2 1 3
2 1 3 187 2 1 3
2 1 3
2 1 3
2 1 3 2 1 3 2 1 3 2 1 3 2 1 3 2 1 3
2 1 3
2 1 3 2 1 3
2 1 3
220
1 8 7
1 87
1 8 7 1 87
187 2 1 3 220
220
75
76
77
78
79
80
8 1
82
UG76
UK77
UK78
UK79
UK80
UK81
UK82
UG1 1
UG 1 2
UG 1 3
UG 1 3
UG 1 3
UG 1 3
UG 1 4
UG 1 5
U G 1 5
UG 1 5
UG 1 5
UG 1 5
UG 1 5
324
324
324
324
324
324
324
274
274
276
322
322
322
322
322
322
322
322
322
322
322
322
322
322
322
322
322
322
322
322
322
322
322
322
322
322
322
322
322
322
324
324
324
324
324
324
324
324
324
324
225
232
232
232
232
225
232
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
1 98
1 98
1 98
1 98
1 98
1 98
1 98
1 98
205
1 98
1 98
1 98
1 98
1 98
1 98
1 98
1 98
1 98
1 98
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
205
1 98
1 98
1 98
1 98
1 98
1 98
1 98
1 98
1 98
1 98
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
21 4
2 1 4
21 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
454
474
474
474
474
454
460
460
460
460
447
454
460
460
460
460
460
460
460
460
460
460
460
460
460
460
460
460
460
460
460
460
460
460
460
460
460
460
460
472
447
447
447
447
447
447
447
447
447
447
1 6 1
1 93
1 75
1 79
1 79
1 85
1 93
1 79
1 79
1 93
1 79
1 93
1 93
1 93
1 93
1 93
1 93
1 93
1 93
1 93
1 79
1 79
1 79
1 79
1 79
1 93
1 93
1 93
1 93
1 93
1 93
1 93
1 93
1 93
1 93
1 93
1 93
1 93
1 93
1 93
1 93
1 93
1 93
1 93
1 93
1 93
1 93
1 93
1 93
1 93
1 93
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
223
223
220
220
220
220
220
220
223
220
220
223
223
223
223
223
223
223
223
223
223
223
223
223
223
223
223
223
223
223
223
223
223
223
223
223
223
223
236
223
220
220
220
220
220
223
223
223
223
223
28
29
30
30
3 1
32
33
34
35
36
37
38
39
39
39
39
39
39
39
40
40
40
40
40
4 1
4 1
4 1
4 1
4 1
4 1
4 1
4 1
4 1
4 1
4 1
4 1
4 1
4 1
42
43
44
44
44
44
44
45
45
45
45
45
IL28
TR29
TR30
TR30
TR3 1
I L32
TR34
NZ35
TR36
IL37
NZ40
NZ40
NZ40
NZ40
NZ40
NZ41
NZ41
NZ41
NZ41
NZ41
NZ41
NZ4 1
NZ4 1
NZ4 1
NZ4 1
NZ41
NZ41
NZ41
NZ4 1
NZ42
NZ43
IL44
IL44
IL44
IL44
I L44
I L45
I L45
I L45
I L45
I L45
324
324
324
324
324
324
324
324
324
340
340
279 322
322
322
322
322
322
322
324
324
324
322
322
322
324
324
324
340
322
322
322
324
324
225
225
225
225
225
225
225
225
225
225
225
1 87
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
225
1 98
1 98
1 98
1 98
1 98
1 98
1 98
1 98
1 98
205
205
232
1 98
1 98
1 98
1 98
1 98
1 98
1 98
1 98
1 98
1 98
1 98
1 98
1 98
1 98
1 98
1 98
1 98
1 98
1 98
1 98
1 98
1 98
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
1 95
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
2 1 4
447 1 93
454 1 93
454 1 93
454 1 93
454 1 93
460 1 93
460 1 93
474 1 79
474 1 79
385 333
460 1 93
5 3 4 229 447 1 93
447 1 93
447 1 93
447 229
454 1 93
454 1 93
454 206
447 1 93
472 229
472 229
4 1 5 229
447 220
454 1 93
4 1 5 229
447 229
472 206
447 229
447 229
454 229
454 229
447 1 93
447 229
1 62
1 70
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 94
1 50
1 70
1 70
1 70
1 70
1 70
1 50
1 70
1 50
1 70
1 50
1 50
1 70
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
1 50
2 1 3
220
220
220
223
220
223
223
223
223
223
2 1 3
236
236
236
236
236
236
236
236
236
236
236
236
236
236
236
236
236
236
21 3
236
236
236
A P P E N D I X 3 . 5 The G P60 sequences identified in bovine and human C. parvum i n the study i n Sect ion 3 .5
>lla A1 8G3R 1 , bovine a n d hu man C. parvum
ATTTAAAGGATGTTCCTGTTGAGGGCTCATCATCGTCATCGTCATCGTCATCATCATCATCATCATCAT
CATCATCATCATCATCATCAACATCAACCGTCGCACCAGCAAATAAGGCAAGAACTGGAGAAGACGCA
GAAGGCAGTCAAGATTCTAGTGGTACTGAAGCTTCTGGTAGCCAGGGTTCTGAAGAGGAAGGTAGTG
AAGACGATGGCCAAACTAGTGCTGCTTCCCAACCCACTACTCCAGCTCAAAGTGAAGGCGCAACTAC
CGAAACCATAGAAG CTACTCCAAAAGAAGAATGCGGCACTTCATTTGTAATGTGGTTCGGAGAAGGTA
C CCCAGCTGCGACATTGAAGTGTGGTGCCTACACTATCGTCTATGCACCTATAAAAGACCAAACAGAT
CCCGCACCAAGATATATCTCTGGTGAAGTTACATCTGTAACCTTTGAAAAGAGTGATAATACAGTTAAA
ATCAAGGTTAACG GTCAGGATTTCAGCACTCTCTCTGCTAATTCAAGTAGTCCAACTGAAAATGGCGG
ATCTGCGGGTCAGGCTTCATCAAGATCAAGAAGATCACTCTCAGAGGAAACCAGTGAAGCTGCTGCA
ACCGTCGATTTGTTTGCCTTTACCCTTGATGGTGGTAAAAGAATTGAAGTGGCTGTACCAAACGTCGA
AGATGCATCTAAAAGAGACAAGTACAGTTTGGTTGCAGACGATAAACCTTTCTATACCGGCGCAAACA
GCGGCACTACCAATGGTGTCTACAGGTTGAATGAGAACGGAGACTTGGTTGATAAG
> /la A 18G3R 1 , h u man C. parvum
TGTTCCTGTTGAGGGCTCATCATCGTCATCGTCATCGTCATCATCATCATCAICATCATCATCATCATCA
TCATCATCAACATCAACCGTCgCaCCAg eAAATaAGG CAAGAaCTGgAGAAGACGeAGAAGGCAGTCAA
GA TTCTaGTGGTaCTGAaGCTTCTGGT AGCCAGGGTT e TGAAGAGGAAGGTag TGAAGACGATGGCCA
AACTagTGCTGCTTCCCaACCCACTACTCCaGCTCAAAGtGaAGGCGCAACTACCGAAACCATAGAAgC
T ACTCCAAAAGAAGAA TGCGGeaCTT ea TTTGTaATGTGGTT eGgAGAAgGtACCCCaGCTGCGACA TTG
AaGtGTGGtGCCTACACTATCGTCTATGCACCTATAAAAGACCAAAeAGATCCCGCAC CAAgATATATCT
CTGGTGAAGTTACATCTGTAACCTTTGAAAAGAGTGATAATACAGTTAAAATCaAG GTTAACGGTeAGG
ATTTCAgCaCTCTCTCTGCTAATTCAAGTAgTCCAACTGAAaATGGeGGATCTGCGGGTeAgGCTTCATC
AaGATCAAGAAGATeACTCTCAGAgGAAACCagTGAAGCTGCTGCAACCGeCgATTTGTTTGCCTTTACe
CTTGATGGTGGTAAAAGAATTGAAGTGGCTGTACCAAACGTCGAAGATGCATCTAAAAGAGACAAGTA
CAGtTTGGTIGCAGACGATAAACCTTTCTATACCGGCGCAAACAGCGGeACTACeaATGGTGTCTACAG
GTTGAATGAgAACGGAGAC
>lla A1 9G4R 1 , bovine C. parvum
CTTTAAaGGATGTTCCTGTTGAGGGCTCATCATCGTCATCGTCATCGTCATCGTCATCATCATCATCAT
CATCATCATCATCATCATCATCATCAACATCaaCCGTCgCACCAGCaAATaAGGeAAGAaCTGGAGAAGA
CGCAGAAGGCAGTCAAGATTCTaGTGGTACTGAAGCTTCTGGTAGCCAG GGTTCTGAAGAGGAAGGT
aGTGAAGACGATGGCCaAACTagTGCTGCTTCCCaACCCACTACTCCAGCTCAAAGTGaAGGCGCAAC
T ACCGAAACCA T AGAAGCT ACTCCAAAAGAAGAA TGCGGeaCTT ea TTTGTaAtGTGGtTeGgAGAAGGT A
CCCCAGCTGCGACATTGAaGtGTGGTGCCTACACTATCGTCTATGCACCTATAAAAGACCAAAeAGATC
CCGCACCAAgATATATCTCTGGTGAAGTTACATCTGTAACCTTTGAAAAGAGTGATAATACAGTTAAAA
TCaAGGTTAACG G TCAGGATTTCAgCACTCTCTCTGCTAATTCAAGTAGTCCAACTGAAaATGGeGGAT
CTGCGGGTeAGGCTICATCAAGATCAAGAAGATeACTCTCAGAGGAAACCAGTGAAGCTG CTGCAACC
GTC GATTTGTTTGCCTTTACCCTTGATGGTGGTAAAAGAATTGAAGTGGCTGTACCAAACGTCGAAGA
TGCATCTAAAAGAGACAAGTACAGTtTGGTTGeAGACGATAAAeCTTTCTATACCGGCGCAAACAGCGG
eACTACeaATGGTGTCTACAGGTTGAATGAgAACGGAGACTTGG
1 63
APPENDIX 4.1 Questionnaire 01 ( See Section 4 .3) .
1 - D id you experience one of the following i n the last four weeks? (tick the box)
Abdominal discomfort---
Diarrhoea------------------
Vomiting-----------------
None of the above---------
2 - If you answered yes to Q 1 , please circle the date when you first experienced the symptoms and the date w hen you first felt healthy (the dates of Mechanisms of Disease
Case Scenarios are given for your orientation) :
Date Mechanisms of disease Case Scenario Monday 1 8/09/06--------------------- --- A cat h aving difficulty breathing
Tuesday 1 9/09/06
Wednesday 20/09/06 Thursday 2 1109/06
Friday 2 2/09/06 Saturday 23/09/06
S unday 24/06/06 Monday 25/09/06 ------------------------------- A c alf w ith severe diarrhoea
Tuesday 26/09/06 ------------------------------- Visit to LA TU (calf h andling) Wednesday 27/09/06 Thursday 28/09/06 Friday 2 9/09/06 Saturday 30/09/06 Sunday 0 1 1 1 0/06 Monday 02/ 1 0/06 ------------------------------- A thirsty, balding portly poodle
Tuesday 03/ 1 0/06 Wednesday 04/ 1 0/06
Thursday 05/ 1 0/06
Friday 06/1 0/06 Saturday 07/ 1 0/06 Sunday 08/ 1 0/06 Monday 09/ 1 0/06----------------------------------Il l thrift in a group of lambs
Tuesday 1 0/ 1 0/06 Wednesday 1 11 1 0/06 Thursday 1 2/ 1 0/06 Friday 1 3/1 0/06 Saturday 1 4/ 1 0/06
Sunday 1 51 1 0/06 Monday 1 61 1 0/06----------------------- --------------Dog with hindlimb lamenes s
Tuesday 1 7/ 1 0/06 Wednesday 1 8/ 1 0/06/Today
1 64
3 - Did you seek medical advice? Circle either Yes or No
4 - Did you submit faecal samples for analysis? Yes No
3 - Gender: Male D Female D
4 - Age:
5 -Background: NZ Australia American Asian Other
6 - In general , how do you quench your thirst during practical sessions?
Bottled water Tap water
7 Are you a smoker? Yes No
Soft drink
8 - Is it your habit to wash your hands after practical c lasses where animal s
are handled? Yes No
9 - Are you on any medication for acute or chronic disorders (e.g. insulin,
thyroxine) . Yes No. If yes, could you specify?
1 0 Did you grow u p in: Rural Urban
Other
1 1 -Before starting the Veterinary course, how often did physically handled ruminants :
Never Once/twice a year Monthly Weekly /more
Thank you very much for your help,
1 65
APPENDIX 4.2 Questionnaire 02 ( See Section 4 .3)
Please tick the appropriate box ! Did you declare suffering from abdominal d iscomfort
Did you attend last year's practical "A Did you drink tap water at and/or diarrhoea and/or vomiting in the
calf with severe diarrhoea" at LATU? LATU on that d ay? questionnaire?
YES NO YES NO YES NO I 2
3
4
5
6
7
8
9
1 0
1 1
1 2
1 3
1 4
1 5
1 6
1 7
1 8
1 9
20
2 1
22
23
24
25
26
27
28
29
30
3 1
32
33
34
35
36
37
38
39
40
4 1
42
43
44
45
46
47
48
49
50
5 1
1 66
APPENDIX 4.3 Class responses to questionnai re 01 (See also Tables 4 . 1 and 4.2)
Key to appendix:
Abdom: abdominal d iscomfort: yes= 1 ; no= 0
Diarrhoea : yes= 1 ; no= 0
Vomiting: vomiting . Yes= 1 ; no= 0
Date first: the date of the onset of the symptoms
Date healthy: last day of symptoms
Gender: 1 = m ale; 0= female
Nationality: New Zealand= 1 ; Austral ian= 2 ; U SA= 3; Asia=4 ; other= 5
Tap: dr ink ing tap water duri ng practicals. Yes= 1 ; no= 0
Wash hands: washing hands after practical classes where an imals are hand led. Yes= 1 ; no=O
Chronic med ic: taking chronic medicat ion . Yes= 2 ; no= 0
Rural/urba n : rural= 0 ; urban=1 0,
Handled ruminants: no previous physical i nteraction with rum inants= 0; previous physical
interact ion with ruminants= 1
Frequency handled ruminants: up to once-twice/year= 0 ; m ore than once-twice/year= 1
Diseased Abdom diarrhoea vom Date first Date healthy gender nationality Tap wash hands
Frequenl chronic Handled handle;
medic Rural/urban calves ruminan
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0 0
0 0
0 0
0
0 0
0
0 0
0
0
0 0
0
0
0
0 0
0
0
0
0
0
28/09/2006 6 1 1 0/2006
1 1 1 0/2006 5/1 012006
1 11 0/2006 1 71 1 0/2006
211 0/2006
26/09/2006 2810912006
1 / 1 0/2006 4/1 012006
7/1 0/2006 1 3/1 0/2006
3/1 012006 6/1 0/2006
211 0/2006 1 0/1 0/2006
1 67
0
0
3
3
5
5
3
3
4
0
0
0
Q
0
0 0
0
0
o I 0 0
0
0
o I 0 0 0
0 0 0
0
0
0 0 0
Q 0 0
Q 0
0 0
0
0 0
0
0
0
1 68
APPENDIX 4.4 G P60 and HSP70 sequences of C. parvum isolates from affected students and the 1 88 rRNA
sequence found in a calf dur ing the outbreak investigation reported in Section 4 . 1 .
Key: HSP70_1_student: sequence of the C. parvu m HSP70 gene fou nd in 3 students ;
HSP70_2_students : sequence of the C . parvum HSP70 gene found i n one student ; 1 8S_rRN A_
calf : f the 1 88 rRNA gene sequence found in one calf.
> HSP70_1 _student
ATCTGAAATTGATGAGGCTGAGAAGAAGATCAAGGATGCTCTTGACTGGCTCGAGCACAACCAAACTGCTGAAAAGGACGAGTTTGA
ACATCAACAAAAGGAGATTGAAACTCATATGAATCCACTCATGATGAAGATCTACTCTGCTGAGGGTGGTATGCCAGGTGGAATGCC
AGGTGGTATGCCAGGCGGTATGCCAGGTGGAATGCCAGGTGGTATGCCAGGTGGAATGCCAGGCGGTATGCCAGGTGGTATGCCA
GGTGGT ATGCCAGGTGGTATGCCAGGA TCT AATGGTCCAACTGTTGAAGAGGTCG A C T AA TT .A.TTTT!\GTC.t•.CCA/\AAAAACTCACTC
AAAATGGAAAGTTAAGAACTATTTACACACTTTCAATTTCTAGTTATTTTTTACCAAAATAAGAAGAAAAGCACACTCTCCCTTTAGG
>HSP70_2_student
A TGAgGCTGAGAaGAAGA TCAAGGA TGCTCTTGACTGGCTCGAGCACAACcAAACtGctGAAAAGGACGAGTTTGAACA TCAACAAAAG
GAgATTGAAACTCATATGAATCCACTCATGATGAAGATCTACTCTGCTGAGGGTGGTATGCCAGGTGGAATGCCAGGTGGTATGCCA
GGCGGT ATGCCAGGTGGAATGCCAGGtGGT ATGCCAGGTGGAA TGCCAgGCGGT ATGCCAGGtGGT ATGCCAGGtGGT ATGCCAGGt
GGT ATGCCAgGATcT AatGgtCCAaCTGTTGaAgagGtcGACTAA TtA TTTT AgTCACCtAaaAAAACTcaCTCAAAAtggAAAGtT AAgAACT AttT
ACACACtTtCAaTTTCTagTTaTTTTTTACCAAA
>GP6_student_ 1
GGATGTTCCTGTTGAGGGCTCATCATCGTCATCGTCATCGTCATCGTCATCATCATCATCATCATCATCATCATCATCATCATCATCAT
CATCAACATCAACCGTCGCACCAGCAAATAAGGCAAGAACTGGAGAAGACGCAGAAGGCAGTCAAGATTCTAGTGGTACTGAAGCTT
CTGGTAGCCAGGGTTCTGAAGAGGAAGGTAGTGAAGACGATGGCCAAACTAGTGCTGCTTCCCAACCCACTACTCCAGCTCAAAGT
GAAGGCGCAACTACCGAAACCATAGAAGCTACTCCAAAAGAAGAATGCGGCACTTCATTTGTAATGTGGTTCGGAGAAGGTACCCCA
GCTGCGACATTGAAGTGTGGTGCCTACACTATCGTCTATGCACCTATAAAAGACCAAACAGATCCCGCACCAAGATATATCTCTGGT
GAAGTTACATCTGTAACCTTTGAAAAGAGTGATAATACAGTTAAAATCAAGGTTAACGGTCAGGATTTCAGCACTCTCTCTGCTAATTC
AAGTAGTCCAACTGAAAATGGCGGATCTGCGGGTCAGGCTTCATCAAGATCAAGAAGATCACTCTCAGAGGAAACCAGTGAAGCTGC
TGCAACCGTCGATTTGTTTGCCTTTACCCTTGATGGTGGTAAAAGAATTGAAGTGGCTGTACCAAACGTCGAAGATGCATCTAAAAGA
GACAAGTACAGTTTGGTTGCAGACGATAAACCTTTCTATACCGGCGCAAACAGCGGCACTACCAATGGTGTCTACAGGTTGAATGAG
AACGGAGACTTGG
>GP6_student_3
GAaCTTT AAGGatGTTCCTGTTGAGGGCTCATCA TCGTCATCGTCATCGTCA TCGTcATCAtCA TCATCATCATCATCATCATCA TCATCA
TCA TCA T C a TCAaCA TCaaCCGtCGCACCAgcAAA TaAgGcAAGAaCTGgAGAAGACGcAGaAGGcAGTCAaGA TTCTaGTGGTaCTGAaG
CTtCTGGTAgCcAGGGTtcTG AAGAgGaAGGTagTGAAGACGATGGCCaaACTagTGCTGCTTCCCaACCcACTACTCCaGCTCAAaGTGa
AGGCGCaACT ACCGaAACCA T AGAAGCT ACTCCAAAAGAAGaA TGCGgcaCTT ea TTTGTaAtGTGGtTcGgAGAAGGtACCCCaGCTGCG
ACA TTGAaGtGTGGtGCCT ACACT ATCGTCT A TGCACCTAT AAAAGACCAAACAGATCCCGCACCAAGATATATctCTGGTGAAGtT ACA T
CTGTAACCTTTGAAAAgAGTGATAATACAGTTAAAATCaAGGTTAACGGTCAgGATTTCAgcACTCTCTCTGCTAATTCAAGTAgTCCAA
CTGAaaA TGGcGGA TCTGCGGGTcAGGCTTCA TCAaGA TCAAGAAGA TCACTCTCAGAGGAAACCaGTGaAGCTGCTGCaACCGtCgA T
TTGtTTGCCTTT ACcCTTGA TGGTGGtAAAAGAa TTGAAGTGGCTGT ACCAaACGtCGAAGA TGCA TCT AAAAGAGAcAAGT ACAGttTGG
TTGcAGAcGATAaAcCTTTCT AT ACCGGcGCAAACAGCGGcACTACcaATGGTGTCTACAGGTtGAA TGAgAACGGAgACTT
> l BS_rRNA_ calf
TTTGGTGACTCATAATAACTTTACGGATCACATTATGTGACATATCATTCAAGTTTCTGACCTATCAGCTTTAGACGGTAGGGTATTGG
CCTACCGTGGCTATGACG GGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCTAAGGAAG
GCAGCAGGCGCGCAAATTACCCAATCCTAATACAGGGAGGTAGTGACAAGAAATAACAATACAGAGCCTTACGGTTTTGTAATTGGA
ATGAGTTAAGTATAAACCCCTTAACAAGTATCAATTGGAGGGCAAGTCTGGTGCCAGCAGCCACGGTAATTCCAGCTCCAATAGCGT
ATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTAATTTTCTGTTAATTTTTATATACAATGCTACGGTATTTATATAATATTAACATAA
TTCATATTACTTTTTAGTATATGAAACTTTACTTTGAGAAAATTAGAGTGCTTAAAGCAGGCTATTGCCTTGAATACTCCAGCATGGAAT
AATATTAAGGATTTTTATTCTTCTTATTGGTTCTAGAAT AAAAATAATGATTAATAGGGACAGTTGGGGGCATTTGTATTTAACAGTCAG
AGGTGAAATTCTTAGATTTGTTAAAGACAAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTAGGGG
ATCGAAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCAACTAGA
1 69