Transcript
Page 1: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

Chapter 13An Introduction to Cloning and

Recombinant DNA

Page 2: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

Southern Blot Technique

Page 3: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

Southern Blot Technique

• Used to determine the structure of a geneor DNA sequence of interest

• May be used to analyze different alleles,related genes, and gene evolution

Page 4: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

Southern Blot Technique

• Steps– Isolate genomic DNA–Cut DNA with restriction enzymes–Separate DNA by size using

electrophoresis–Transfer DNA to a membrane–Probe with sequence of interest that is

radioactively labeled–Visualize with X-rays

Page 5: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

Fig. 13.19

The SouthernBlot Technique

Page 6: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson LearningCredit: © Inga Spence/Visuals Unlimited 212643

DNA Hybridization Blot on BioRad Gel Doc 1000 Imager.

Page 7: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

DNA Sequencing

Page 8: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

GTACACTTACGTACTCCTCAACGGATC

DNA Sequencing

Page 9: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

+ primer CATGT

GTACACTTACGTACTCCTCAACGGATC

DNA Sequencing

Page 10: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

GTACACTTACGTACTCCTCAACGGATCCATGT

DNA Sequencing

Page 11: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

GTACACTTACGTACTCCTCAACGGATC

+ DNA polymerase+ A, C, T, G

CATGT

DNA Sequencing

Page 12: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

GTACACTTACGTACTCCTCAACGGATCCATGT

+ DNA polymerase+ A, C, T, G

GTACACTTACGTACTCCTCAACGGATCCATGTGAATGCATGAGGAGTTGCGTAG

DNA Sequencing

Page 13: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

GTACACTTACGTACTCCTCAACGGATCCATGT

+ DNA polymerase+ A, C, T, G+ T

DNA Sequencing

Page 14: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

DNA polynucleotide chain5’ endO-

O- -P = OO

CH2

Base

O

H

3’ H H

H

5’

O-

O- -P = OO

CH2

Base

H

3’ H H

H

O5’

OH 3’ end

Page 15: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

DNA polynucleotide chain5’ endO-

O- -P = OO

CH2

Base

O

H

3’

H

5’

3’ end

O-

O- -P = OO

CH2

Base

H

3’

H

O5’

H

dideoxy base

chaintermination

HH

HH

Page 16: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

GTACACTTACGTACTCCTCAACGGATCCATGT

+ DNA polymerase+ A, C, T, G+ T

GTACACTTACGTACTCCTCAACGGATCCATGTG

DNA Sequencing

Page 17: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

GTACACTTACGTACTCCTCAACGGATCCATGT

+ DNA polymerase+ A, C, T, G+ T

GTACACTTACGTACTCCTCAACGGATCCATGTGA

DNA Sequencing

Page 18: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

GTACACTTACGTACTCCTCAACGGATCCATGT

+ DNA polymerase+ A, C, T, G+ T

GTACACTTACGTACTCCTCAACGGATCCATGTGAA

DNA Sequencing

Page 19: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

GTACACTTACGTACTCCTCAACGGATCCATGT

+ DNA polymerase+ A, C, T, G+ T

GTACACTTACGTACTCCTCAACGGATCCATGTGAAT

DNA Sequencing

Page 20: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

GTACACTTACGTACTCCTCAACGGATCCATGT

+ DNA polymerase+ A, C, T, G+ T

GTACACTTACGTACTCCTCAACGGATCCATGTGAATCATGTGAAT

DNA Sequencing

Page 21: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

GTACACTTACGTACTCCTCAACGGATCCATGT

+ DNA polymerase+ A, C, T, G+ T

GTACACTTACGTACTCCTCAACGGATCCATGTGAATCATGTGAATGCAT

DNA Sequencing

Page 22: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

GTACACTTACGTACTCCTCAACGGATCCATGT

+ DNA polymerase+ A, C, T, G+ T

GTACACTTACGTACTCCTCAACGGATCCATGTGAATCATGTGAATGCATCATGTGAATGCAT

DNA Sequencing

Page 23: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

GTACACTTACGTACTCCTCAACGGATCCATGT

+ DNA polymerase+ A, C, T, G+ T

GTACACTTACGTACTCCTCAACGGATCCATGTGAATCATGTGAATGCATCATGTGAATGCATGAGGAGT

DNA Sequencing

Page 24: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

DNA Sequencing

Page 25: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

T

DNA Sequencing

Page 26: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

GTACACTTACGTACTCCTCAACGGATCCATGT

+ DNA polymerase+ A, C, T, G+ T

GTACACTTACGTACTCCTCAACGGATCCATGTGAATCATGTGAATGCATCATGTGAATGCATGAGGAGT

DNA Sequencing

Page 27: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

GTACACTTACGTACTCCTCAACGGATCCATGT

+ DNA pol+ A, C, T, G+ T

+ DNA pol+ A, C, T, G+ A

+ DNA pol+ A, C, T, G+ G

+ DNA pol+ A, C, T, G+ C

DNA Sequencing

Page 28: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

T A G C

DNA Sequencing

Page 29: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

T A G C

G

DNA Sequencing

Page 30: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

T A G C

GA

DNA Sequencing

Page 31: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

T A G C

GAA

DNA Sequencing

Page 32: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

T A G C

GAAT

DNA Sequencing

Page 33: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

T A G C

GAATGCATGA

DNA Sequencing

Page 34: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

GTACACTTACGTACTCCTCAACGGATCCATGTGAATGCATGAGGAGTTGCCTAG

DNA Sequencing

Page 35: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

T A G C

GAATGCATGA

CTTACGTACT

DNA Sequencing

Page 36: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

Improvements in SangerSequencing

• Four-color fluorescent dyes• Use of scanners to read laser-induced

fluorescence as products run off• Improvements in sequencing reaction

enzymes• Replacement of slab gel electrophoresis

with capillary gel electrophoresis

Page 37: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

GTACACTTACGTACTCCTCAACGGATCCATGT

+ DNA pol+ A, C, T, G+ T

+ DNA pol+ A, C, T, G+ A

+ DNA pol+ A, C, T, G+ G

+ DNA pol+ A, C, T, G+ C

DNA Sequencing

Page 38: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

GTACACTTACGTACTCCTCAACGGATCCATGT

+ DNA pol+ A, C, T, G+ T

+ DNA pol+ A, C, T, G+ A

+ DNA pol+ A, C, T, G+ G

+ DNA pol+ A, C, T, G+ C

DNA Sequencing

Page 39: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

DNA Sequencing

GTACACTTACGTACTCCTCAACGGATCCATGT

+ DNA pol+ A, C, T, G+ A, C, T, G

Page 40: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

Automated DNA Sequencing

Fig. 13.20

Page 41: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

Automated Sequencer

Page 42: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

Sequencing is just the start…

Page 43: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

DNA Microarrays

Page 44: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

Goal: To get at complete expression profile in a cell/tissueat given time

Step 1: Make or purchase microarray

Need gene sequences and sequenced genomes

PCR up real and predicted ORFs

Spot on glass slide/chip

DNA Microarrays

Page 45: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

DNA Microarrays

Page 46: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

Isolate RNA from 2 different kinds of cells to be compared

Cell 1 - RNA labeled with red fluorescent tag

Cell 2 - RNA labeled with green fluorescent tag

Step 2: Isolate and label RNA

DNA Microarrays

Page 47: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

Step 3: Hybridize RNA to Microarray

DNA Microarrays

Hybridize chip with red and green RNA

Use scanner to examine fluorescence

Red - RNA present in Cell 1 but not Cell 2Green - RNA present in Cell 2 but not in Cell 1Yellow - RNA present in both

Page 48: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

Microarray Results

Page 49: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings

Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning

Stem cells

SaundersMageeShriner-CahnChatterjeeLawrenceOlson

Prenatal genetic testing

BrowerGorenkoffKwakChoDamianoCheis

Cloning of animals/humans

BondurantLapidesSimonVigneronPradaSiegel

Genetically modified plants/animals

PowersRosenblumLeSotomilCoyleKropp

Too much technology?

SpiwakDavidsonFeiGrossmanMarwellRoth

Behavioral genes

SeplowitzRichLenardCollinsDionneRudberg