Transcript
Page 1: Blood study guide due next class!!!!!!!!!

Blood study guide due next class!!!!!!!!!

Page 2: Blood study guide due next class!!!!!!!!!

Do Now!• Write 1 thing you know about DNA on the

board !

Page 3: Blood study guide due next class!!!!!!!!!

DNA Profiling

Page 4: Blood study guide due next class!!!!!!!!!
Page 5: Blood study guide due next class!!!!!!!!!
Page 6: Blood study guide due next class!!!!!!!!!
Page 7: Blood study guide due next class!!!!!!!!!
Page 8: Blood study guide due next class!!!!!!!!!
Page 9: Blood study guide due next class!!!!!!!!!

•Identify or eliminate suspects

•Exonerate wrongly accused

•Identify victims of crimes or catastrophes

•Establish paternity

•Link crime scenes together

Page 10: Blood study guide due next class!!!!!!!!!

Paternity Cases• Who’s your daddy?1.

2.

1. 2.

Page 11: Blood study guide due next class!!!!!!!!!

Exoneration• Kirk Bloodsworth

– Convicted in 1985 for the rape and strangulation of a 9-year old girl and sent to death row

– In 1992, defense attorneys were successful in having a dime-sized semen stain on the girl’s underpants tested against Bloodsworth’s DNA

– He was exonerated

Page 12: Blood study guide due next class!!!!!!!!!

DNA Profiling• “I didn’t understand the DNA stuff at all. To

me, it was just a waste of time. It was way out there and carried absolutely no weight with me at all.”

• Post-trial commentary from a juror in the O.J. Simpson trial: V. Bugliosi, Outrage (New York: Dell Publishing, 1996).

• “In a forensic setting, ... an innocent suspect has little to fear from DNA evidence, unless he or she has an evil twin.”

• N. Risch & B. Devlin, “On the Probability of Matching DNA Fingerprints” (1992) 255 Science.

Page 13: Blood study guide due next class!!!!!!!!!
Page 14: Blood study guide due next class!!!!!!!!!

RFLPs• DNA is cut by molecular “scissors” – enzymes

which recognize particular sequences of nucleotides

• These enzymes identify short sequences of DNA, then snip it

• Because everyone’s DNA is different, enzymes cut in different places

• The resulting samples contain DNA fragments of different size (Restriction Fragment Length Polymorphisms)

Page 15: Blood study guide due next class!!!!!!!!!

RFLP: Gel Electrophoresis

• DNA is visualized using electrophoresis• Negatively charged DNA moves through a gel with a

current• Smaller DNA moves faster than larger DNA fragments

Page 16: Blood study guide due next class!!!!!!!!!
Page 17: Blood study guide due next class!!!!!!!!!

Results?

Page 18: Blood study guide due next class!!!!!!!!!
Page 19: Blood study guide due next class!!!!!!!!!
Page 20: Blood study guide due next class!!!!!!!!!
Page 21: Blood study guide due next class!!!!!!!!!

How unique are these profiles?

• The probability of 2 people having exactly the same DNA profile is between

1 in 5 million to1 in 100 billion

(greater than the population of humans on earth)• This number becomes even larger if you

consider more regions of DNA

• Thus, the odds that the DNA evidence from a crime scene will match your DNA profile is astronomically small (unless you have an evil identical twin)

Page 22: Blood study guide due next class!!!!!!!!!
Page 23: Blood study guide due next class!!!!!!!!!
Page 24: Blood study guide due next class!!!!!!!!!
Page 25: Blood study guide due next class!!!!!!!!!

PCR allows us to use STRs

• Short Tandem Repeats– Newer method than RFLPs– Faster– Uses 13 different primers to isolate the 13

different loci as identified by the FBI

Page 26: Blood study guide due next class!!!!!!!!!
Page 27: Blood study guide due next class!!!!!!!!!
Page 28: Blood study guide due next class!!!!!!!!!

For example, D7S280 is STR that repeats ‘GATA’

• CTAACGATAG ATAGATAGAT AGATAGATAGATAGATAGAT AGATAGATAG ATA

• How many GATA’s? • So at this loci (location) the person’s # is

_______

Page 29: Blood study guide due next class!!!!!!!!!

Narrowing it down

• You can calculate the probability that two people would have same # of STR’s for EACH of the 13 loci…..it’s nearly impossible!

Page 30: Blood study guide due next class!!!!!!!!!
Page 31: Blood study guide due next class!!!!!!!!!
Page 32: Blood study guide due next class!!!!!!!!!
Page 33: Blood study guide due next class!!!!!!!!!
Page 34: Blood study guide due next class!!!!!!!!!
Page 35: Blood study guide due next class!!!!!!!!!
Page 36: Blood study guide due next class!!!!!!!!!

Case Study: The First Use of DNA Evidence

• Two teenage girls raped and murdered in Leicestershire, England

• Semen from the victims indicated a male with Type A blood and a rare enzyme = 10% of the local male population

• A local boy, Richard Buckland, confesses upon interrogation

• Police use DNA fingerprinting to confirm, but DNA profiles of Buckland and crime scene DNA do not match

• Ironically, Buckland becomes the first person exonerated by DNA evidence

Page 37: Blood study guide due next class!!!!!!!!!

Case Study: The First Use of DNA Evidence

• Police request DNA samples from all adult males in 3 nearby villages (5000 men)

• 6 months later – no results!• A year later, police are informed by a

bakery worker that they overheard a co-worker bragging they had given a DNA sample for another man

• Police obtain DNA from Colin Pitchfork and obtain a perfect match

Page 38: Blood study guide due next class!!!!!!!!!

The Result?• In 1988, Colin Pitchfork was tried and

convicted and sentenced to life in prison for the double rape and homicide based in large part to the DNA evidence

Page 39: Blood study guide due next class!!!!!!!!!

O.J. Simpson Trial-Discussion Q’s

• What was the crime?• What was the evidence?• What was the defense

team’s strategy?• What can future

prosecution teams learn from this trial?


Recommended