Detection of small intragenic deletions usingtargeted comparative genomic hybridization
Today’s agenda
Welcome — Dr. Mike Evans
Detection of small intragenic deletions using targeted comparative genomic hybridization — Dr. Madhuri Hegde
Closing remarks
Innovative clinical genetics and diagnostic solutions to advance molecular medicine
• Founded by Ed Southern in 1995• 64 people• State-of-the-art facilities• 3 core brands
OGT Begbroke: Corporate offices and high throughput labs
OGT Southern Centre: Biomarker discovery
CytoSure cytogenetics range
high quality data
meaningful results
standardisation
• Arrays• ISCA, UPD and Syndrome Plus• Chromosome X• Aneuploidy• DMD*• Oligome custom arrays • New! Modified Emory panel designs
• Labelling kits / sample tracking spikes
• Software
• Reagents and consumables
• Full automation options
• CytoSure Services
* Not available in USA
The OGT aCGH design process
aCGH arrays
All possible human genome probes
OligomeTM database
Further selection based on OGT probe rating and desired coverage and content
Selection based on specificity, Tm, GC, etc.
Design & hyb two different aCGH arrays
Optimised aCGH design = PRODUCT
Selection of best performing probes based on experimental results
Today’s agenda
Welcome — Dr. Mike Evans
Detection of small intragenic deletions using targeted comparative genomic hybridization — Dr. Madhuri Hegde
Closing remarks
Detection of Small intragenic Deletions Using Targeted
Comparative Genomic Hybridization
MadhuriHegde, Ph.D., FACMGAssociate Professor
Scientific Director, Emory Genetics LaboratoryDepartment of Human Genetics
Emory UniversityAtlanta, GA
Scherer et al. (2007)Nat Genet 39:s7-s15
GenomicVariation
G-banded karyotype
FISH
Microarray
(~5 Mb)
aCGH
FISH
MLPA
Real-Time PCR
Deletion/Duplication Detection Methodology in clinical diagnostics
PurposeWith the help of few examples of small deletions mapped in our laboratory,
-illustrate the success of this technology-demonstrate the detection limits, and-discuss the lessons learnt thus far
Scope
Small intragenic deletions (~2.5 kb and shorter)
Outline
Introduction-Array design @ EGL-Examples of deletions
Examples of small deletions mapped-Autosomal recessive disease gene PAH-Autosomal dominant disease gene SKT11-X-linked gene HPRT1 and EMD
obvious ones
Near the detection
limit
A. GeneTargeted
C. Whole Genome
B. GeneTargetedwith Backbone
Probe distribution
Probe densityKeeping a balance: decrease redundancy while not compromising of sensitivity
Duplication of Ex44
Exon-centric multi-gene high density array
Designed to detect CNVs encompassing single and multiple exon
Increase the cost-effectiveness without compromising on sensitivity
4x180k 4x180k 8x60k EGL_XLIDplus_v2 EGL_NMD_NBSplus_v2 EGL_DMDplus_V2
ASD 8784 ASD 8784 Cancer 9598 Cancer 9598 CDG 4908 CDG 4908
Congenital abnormality 13373 Congenital abnormality 13373
Congenital heart disease 16421 Congenital heart disease 16421 Cystic 12271 Cystic 12271 Diabetes 941 Eyes 961 Eyes 961 Growth disorder 51 Growth disorder 51 Hearing Loss 2392 Hemoglobinopathy 42 Hemoglobinopathy 42 Leukodystrophy 2273 LSD 6596 Metabolic 8742 Mitochondrial 485 Mitochondrial 485 MR 7704 NBS 14149 NMD 47414 NMD 47414Others 5874 Others 5874 XLMR 77999 DMD 12713
Examples of intragenic deletions
Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC)
Autosomal dominant inheritance37 year old male personal and a family history of multiple cutaneousleiomyomatosis
exons 10 9 8 7 6 5 4 3 2 1
Familial mutation:Deletion ~ 19 kb encompassing exon 2 to 9 of the FH gene
FH gene (~22 kb)
+1
-1
0
Deletion ~ 19 kb
2 year old East Indian male with a biochemical diagnosis of MSUD.
Maple Syrup Urine DiseaseAutosomal Recessive inheritance
c.871C>T (p.R291X) nonsense mutation in exon 7 of DBT gene identified
exons 11 5 4 3 2 1
Deletion ~ 3.7 kb encompassing exon 5of the DBT gene
DBT gene (~63 kb)
+1
-1
0
Deletion 3.7 kb
-0.6
~-0.8
Even Shorter Intragenic Deletions (< 2.5 kb)
PAHPhenylketonuria (PKU)
Autosomal recessive inheritance- two mutations in trans
Metabolic disorder- biochemical profile adds to clinical suspicion
PKU case 1
• Age: 6.6 years• Gender: male• Ethnicity: Hispanic
Established patient of PKUCurrently enrolled in the Kuvan study at Emory
One copy of the c.838G>A (p.E280K) missense mutation in exon 7 of PAH gene
PKU case 2
• Age: 4 months• Gender: female• Ethnicity: Hispanic
Picked up on NBS, Elevated plasma phenylalanine.
One copy of the IVS12+1G>A splice donor site mutation
Patient
ReferenceGAA GlutamicacidAAA Lysine
Patient
Reference
Exon 12 Intron 12
exons
PAH gene (~79 kb)
13 9 6 3 1
PKU case 1
PKU case 2
868 bp
1,286 bp
Exon 6Exon 7
Two unrelated individuals with the same deletion
PKU case 1
PKU case 2
PAH gene
Allele 1 1134 bp
Allele 2 ~350 bp
100
200300
case 1 case 2
Allele specific PCR
Green: Repeat masker
Red: polymorphisms (SNP)
CAPITAL: exon
Underlined: primers
Breakpoint within a SINE: MIRb family
Breakpoint within a exon 6
Red box: “CT” is the microhomology at breakpoints.
868 bp
1,286 bp
800 bp800 bp Partial exon 6 deletion
Exon 6Exon 7 Intron 6
PKU case 1
PKU case 2
Note: breakpoint within an element
STK11Peutz-Jeghers syndrome (PJS)
Autosomal dominant inheritance- one mutation
Clinical Presentation & Family History
• Age: 30 years• Gender: female• Ethnicity: Caucasian
Personal history of polyps and intussusceptions and
family history of cancer; paternal aunt with breast cancer and paternal grandmother with pancreatic cancer.
exons
STK11 gene (~22 kb)
+1
-1
0
1 2 3 4,5 6 7 8 9 10
1076 bp
exons 2 3 4AluY
+1
-1
0
Exon3Intron2 Intron3Exon2 Exon 4Intron1
INT1_1F ex2_1F INT2_1F INT2_2F INT2_3F INT3_1R INT3_2R INT3_3R INT3_4R andINT3_5R
Possible deletion encompassing exon 3
Designing allele specific PCR
Exon3Intron2 Intron3Exon2 Exon 4Intron1
INT2_2F INT3_1R INT3_2R INT3_3R INT3_4R andINT3_5R
Data indicates a possible deletion of ~1kb.
Expected band size in bp 678 1130 1324 1580 1595
Possible exon 3 deletion
Proximal breakpoint 1170072 in intron 2
Distal breakpoint 1171039 in intron 3
Reference
Reference
Patient
Patient
exons 2 3 4
1076 bp
967 bp
AluY
+1
-1
0
Note: breakpoints outside of element
A few probes that did not perform ideally were unique
HPRT1Lesch-Nyhan Syndrome
X-linked inheritance- one mutation
Clinical Presentation & Family History
Lesch-Nyhan case
Pending prenatal24 year old female for carrier testing for afamilial HPRT1 mutation
?
?
exons
HPRT1 gene (~40.5 kb)
1 2 3 4 5 6 7,8 9
+1
-1
0
-5
?
?
2,780 bp
Exon 5 is 18 bp
+1
-1
0
-5
Exon 5
Max (2757bp)
Min (381bp)
Int4_1
Int4_2
Int4_3
Int4_4
Intron 4 Intron 5
Int5_4
HPRT_Int5_5R
Int5_6Int5_2
Int5_1 Int5_3 Int5_5
HPRT_Int4_1F
HPRT_Int4_2F HPRT_Int5_5R
2745 bp fragment expected in wild type
2657 bp fragment expected in wild type
88bp size difference 500-400-300-
500-400-300-
Mapped a total of 380 bp in the amplicon157 bp of intron 4 69 bp insertion154 bp of intron 5
157 bp of intron 4 69 bp insertion
The Inserted 69 bpsequence match best on a gene desert on Chromsome 5.
ATTCTAGTGATGTTTTCAGGCCTCAGGGGGCGGGTTGGGGGTGGTGGAGGTGGTGTGTATAATATCACT
EMD case
• Age: 46 year• Gender: male• Ethnicity: caucasian
Wt
Ex1 Ex2 Ex3 Ex1 Ex2 Ex3 Ex1 Ex2 Ex3
Pt. water
Exon 1 and 2 did not amplify for the patient
exons
EMD gene (~2 kb)
+1
-1
0
1 2 3 4 5 6
-2
-3
-4
-5
exons 1 2
252 bp+1
-1
0
-5
Forward Primer 1F 1FReverse Primer 2R 3R
Wt Pt. H2O Wt Pt. H2O 1kb+
-100
-200
-300-400-500-650-850-------1000
Wt expected band with 1F/2RWould be 480 bp
For Wt expected band with 1F/3RWould be 677 bp
Band ~370 bpSuggesting~300 bp deletion
Band ~170 bpSuggesting~300 bp deletion
exon1
exon2
Red nucleotides are deleted. Exons are capitalizedMicrohomology is limited to two nucleotides, “GC”
exons 1 2
252 bp
366 bp
+1
-1
0
-5
Deletion encompassing Partial exon 1 and entire exon 2
ConclusionsaCGH has come light years ahead from MLPA days
We cover all the genes that we sequence (except two that have pseudogenes)
Array design has been a continuous processTime to assess individual probe performance
Small Intragenic deletions (<2.5 kb) data is valuable Insight into the mechanism
Most breakpoints have 2-3 bases of microhomology at breakpoints
Duplications?
Acknowledgements
Directors:Bradford Coffee Ph.D. FACMGLora Bean Ph.D. FACMGKatie Rudd Ph.D. FACMGAlice Tanner Ph.D. C.G.C.
SyedHussainAskree, MBBS, PhDEphremLip Hon Chin, BS (Tech), CLSp (MB)
Today’s agenda
Welcome — Dr. Mike Evans
Detection of small intragenic deletions using targeted comparative genomic hybridization — Dr. Madhuri Hegde
Closing remarks
Modified Emory panel designs — available now!
Modified Emory panel designs now available from OGT• Including complimentary class-leading CytoSure Interpret Software
Visit booth 416 for disorder lists and special introductory offer
Disorders covered
• Autism Spectrum Disorders• Congenital Abnormalities• Congenital Disorders of Glycosylation• Congenital Heart Disease• Cystic Disorders• Diabetes• Duchenne Muscular Dystrophy*• Eye Disorders• Hearing Loss
• Hemoglobinopathy• Inheritable Cancer• Intellectual Disability (MR)• Leukodystrophy• Lysomal Storage Disorders• Metabolic Disorders• Mitochondrial Disorders• Neuro Muscular Dystrophy• X Linked Intellectual Disabilities
* Not available in US.
55
Thank youwww.ogt.co.uk