Embed Size (px)
Citation preview
STRUCTURAL AND FUNCTIONAL CHARACTERIZATION OF THE HIN200 FAMILY MEMBERS IFI16 AND MNDA
by
Desmond Ka Wing LauB.Sc. (Honor), MBB, Simon Fraser University, 2005
THESIS SUBMITTED IN PARTIAL FULFILLMENT OFTHE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE
In the Department ofMolecular Biology and Biochemistry
© Desmond Ka Wing Lau 2008
SIMON FRASER UNIVERSITY
Fall 2008
All rights reserved. This work may not bereproduced in whole or in part, by photocopy
or other means, without permission of the author.
APPROVAL
Name: Desmond Ka Wing LauDegree: Master of Science Title of Thesis: Structural and functional characterization of the
HIN200 family members IFI16 and MNDA
Examining Committee:Chair: Name
[Correct title – Consult your Grad Secretary/Assistant
________________________________________
NameSenior SupervisorCorrect title – Consult your Grad Secretary/Assistant
________________________________________
NameSupervisorCorrect title – Consult your Grad Secretary/Assistant
________________________________________
Name[Internal or External] ExaminerCorrect title – Consult your Grad Secretary/AssistantUniversity or Company (if other than SFU)
Date Defended/Approved: ________________________________________
ii
ABSTRACT
Our discovery of the death domain PAAD shows not only its involvement
in cell death but in other biological processes. For example, we demonstrated a
DNA repair function similar to Replication protein A for the PAAD family member
IFI16 (Interferon-Inducible protein 16) which also contain two HIN-200 domains
by functional complementation between both individual domains. However it is
not known if the discovered ssDNA binding function is general to the HIN200
family. Here I show by using the same biochemical and biophysical approaches
on MNDA (Myeloid Nuclear Differentiation Antigen), another HIN200 family
member that recognizes dsDNA. The PAAD domain of MNDA has similar but
distinct DNA binding properties compared to IFI16-PAAD. To further map the
protein-nucleic acids interface involved in these interactions, I designed
mutagenesis and chemical shift mapping experiments and show that specific
amino-acids side chains are critical to ssDNA and dsDNA recognition and
nucleic-acids stabilization.
Keywords:
Subject Terms:
iii
EXECUTIVE SUMMARY
An executive summary is optional. It may also be called “Reader’s
Summary” An executive summary is longer than an abstract, and intended to
provide an overview,
describe the key features of the project and its results,
and persuade the reader of the value of your work.
Subheadings and bullet paragraphs may be used. Normally, references are
not.
An executive summary must be written carefully, cogently and in an
accurate and balanced fashion, in case the busy reader, usually one higher up
the hierarchy than oneself, is unable to read the full report, yet must still depend
on your reporting here to make a decision. The ability to write an effective
executive summary is a valuable professional skill.
iv
DEDICATION
A dedication is optional. If you do not wish to write one, just delete this
heading and text entirely, and update your Table of Contents.
To someone or something which has inspired you. Usually brief, but
written from the heart. Need not be an ordinary indented paragraph. May be
styled more artistically, or may be left- or right-aligned, instead of indented, and
lower on the page. If written for someone whose “language of the heart” is not
English, it may be written in that language first, and in English second. The
English need not be a word-for-word translation: simple and graceful is best.
When you have made your choices of text and artistry, the heading
“Dedication” may look inappropriate and redundant. How to get rid of it? No
problem. Note that this heading is required, technically, on this page so that the
word Dedication and its page number can appear in the Table of Contents, as
required. To make the heading non-printing, but still functional in the Table of
Contents, highlight the text of the heading, and use the Font colour button on
the menu bar to select the colour white.
v
ACKNOWLEDGEMENTS
Thank you to those who have supported and encouraged you, especially
in your intellectual endeavours and this work, in particular. Usually written after
one’s oral defence. It is important for your future to acknowledge your intellectual
debts. This can help maintain your network in your career field.
Personal acknowledgements may be included if desired, including
acknowledgement in more detail (“let me count the ways”) of the person to whom
you [briefly] dedicated the work.
vi
TABLE OF CONTENTS
Approval............................................................................................................... iiAbstract............................................................................................................... iiiExecutive Summary........................................................................................... ivDedication............................................................................................................vAcknowledgements............................................................................................viTable of Contents..............................................................................................viiList of Figures......................................................................................................xList of Tables.....................................................................................................xiiGlossary............................................................................................................xiii1: Introduction...................................................................................................14
1.1. Overview of the HIN-200 family members.........................................141.2. Domain organization of the HIN-200 protein.....................................161.3. Interferon-γ inducible protein 16 (IFI16)............................................18
1.3.1 The role of interferon and IFI16 in cell cycle arrest........................181.3.2 IFI16 involvement in disease and its binding partners...................201.3.3 IFI16 is an RPA like protein...........................................................211.3.4 The PAAD domain of IFI16 is a novel ssDNA binding domain......23
1.4. Myeloid Nuclear Differentiation Antigen (NMDA)..............................251.4.1 MNDA expression and interaction profile.......................................25
1.5. Overview of objectives......................................................................28
2: Materials and methods.................................................................................302.1. Cloning and expression.....................................................................302.2. Mass spectroscopy (ESI and MALDI-TOF).......................................312.3. Circular dichroism (CD).....................................................................322.4. Intrinsic tyrosine fluorescence...........................................................322.5. Comparative modeling......................................................................332.6. Electrophoretic mobility shift assay...................................................332.7. UV cross linking.................................................................................342.8. Chemical cross linking.......................................................................352.9. Fluorescence quenching assay.........................................................362.10. Double stranded DNA melting...........................................................362.11. Fluorescence resonance energy transfer..........................................372.12. Site-directed mutagenesis.................................................................38
vii
2.13. Nuclear magnetic resonance titration................................................392.14. Flow diagram for in vitro GFP directed evolution of IFI16-PAAD......402.15. Mutants expression...........................................................................412.16. Far UV and thermodynamic parameters assessment using
circular dichroism..............................................................................412.17. Chemical stability assessment using circular dichroism....................41
3: Results...........................................................................................................423.1. Spectroscopic property of MNDA-PAAD...........................................42
3.1.1 Rationale........................................................................................423.1.2 Expression and purification of MNDA-PAAD.................................423.1.3 Secondary structure determination using Circular Dichorism........433.1.4 Thermodynamic parameters of the PAAD domain.........................463.1.5 Intrinsic fluorescence – tertiary structure unfolding of MNDA-
PAAD.............................................................................................503.1.6 Polydispersity determination of MNDA-PAAD using dynamic
light scattering................................................................................523.1.7 Comparative Modeling of IFI16-PAAD and MNDA-PAAD
reveals discrepancy in helix 3........................................................533.2 The nucleic acid interaction property is conserve to another
PAAD domain family member, MNDA...............................................553.2.1 Rationale........................................................................................553.2.2 MNDA-PAAD is able to binds ssDNA as IFI16-PAAD...................563.2.3 Further assessment of the ability of PAAD domain to form
stable complex with ssDNA...........................................................603.2.4 Binding affinity determination using fluorescence quenching
assay.............................................................................................693.2.5 MNDA-PAAD failed to wrap or stretch ssDNA unlike IFI16-
PAAD does using Fluorescence Resonance Energy Transfer (FRET)...........................................................................................72
3.2.6 PAAD domains are able to destabilize duplex in hyperchromicity assay...................................................................77
3.2.7 The ability to oligomerize from IFI16-PAAD may explain the variations in binding constants and ability to modify ssDNA..........78
3.2.8 Critical residues involved in the interaction with ssDNA can be revealed using Nuclear Magnetic Resonance (NMR)...............81
3.2.9 HIN domain of MNDA is potentially another RPA like protein........863.3 Directed evolution converge to certain mutations that can
change the conformation and stability of IFI16-PAAD.......................903.3.1 Rationale........................................................................................903.3.2 More structured IFI16-PAAD mutants also have higher
thermo and chemical stability.........................................................90
4: Discussion.....................................................................................................974.1 The variations of structure property of the PAAD domain
confer to different stability.................................................................97
viii
4.2 The nucleic acid interaction property is conserved to another PAAD domain family member, MNDA...............................................99
4.3 Directed evolution converge to certain mutations that can change the conformation and stability of IFI16-PAAD.....................103
Appendices..........................................................................................................1Appendix A or 1..................................................................................................1Appendix B or 2: CD-ROM Data........................................................................1
Reference List......................................................................................................2Template Appendices.........................................................................................8Appendix 1: Help with this Template In MSWord 2007....................................9
Saving your document......................................................................................10Tools in this template.......................................................................................10Getting control in MSWord 2007......................................................................11
View features in MSWord.............................................................................11Styles list - making styles visible and accessible..............................................12
Cleaning up a cluttered styles list.................................................................13
Appendix 2: Modifying Template, Document Features, and Styles..............15How to make changes quickly, easily, efficiently..............................................17Modifying fonts and font size............................................................................18
Standard fonts...............................................................................................18Margins 20Modifying page orientation...............................................................................22
Appendix 3: Headings.......................................................................................23General Styling Tips.........................................................................................23Heading Levels.................................................................................................26
Heading 1 style.............................................................................................27Modifying automatic numbering in headings....................................................27
Clear numbering...........................................................................................28Add or change numbering.............................................................................28
Appendix 4: Paragraphs...................................................................................30The trouble with “Normal”.................................................................................30Regular text paragraphs...................................................................................30
Paragraph spacing........................................................................................31Specialized paragraphs....................................................................................31
“Para” – The “regular” paragraph is a specialized style................................31Other paragraphs and font styles provided by this template.........................32How to create new paragraph styles to suit your needs...............................35
Appendix 5: Tables, Figures and Captions.....................................................39Treating “Table Grid” – the default table setup – as a “style”...........................40
A default font style for tables.........................................................................42
ix
LIST OF FIGURES
Figure 1.1: Domain organization of the human HIN-200 family members include IFI16, MNDA, AMI2 and the newly identified IFIX....................17
Figure 1.2: Schematic representation of the involvement of IFI16 in cell cycle arrest(Ludlow et al., 2005)...........................................................20
Figure 1.3: PAAD domain of IFI16 and MNDA has a six helix bundle motif but IFI16 has a disordered region. This is the superimposition of the NMR structure of MNDA PAAD (2DBG; Blue) and model of IFI16 PAAD (Orange) built from NALP1 PAAD (1PN5) as the template. The superimposition was performed using Pymol align command. RMSD of the superimposition is 3.9Å.................................28
Figure 3.1. Size exclusion chromatography of MNDA-PAAD using SuperDex 75.........................................................................................44
Figure 3.2. Far UV spectra of the PAAD domains...............................................45
Figure 3.3. Thermal denaturation of the PAAD domain.......................................48
Figure 3.4. MNDA-PAAD did not regain secondary structure after thermodenaturation..............................................................................49
Figure 3.5. Tyrosine spectroscopic property of MNDA-PAAD.............................51
Figure 3.6. Dynamic light scattering of MNDA-PAAD..........................................53
Figure 3.7. Superimposition of IFI16-PAAD and MNDA-PAAD showing the six helix bundle and disordered helix region.........................................55
Figure 3.8. EMSA of MNDA-PAAD with different single stranded DNA...............58
Figure 3.9. Integrated shift pattern in the EMSA experiment and curved fitted to a one site binding model..........................................................59
Figure 3.10. . UV cross linking of MNDA-PAAD with ssDNA...............................61
Figure 3.11. Calibration curve of protein ladder ran in each UV cross linking gel..............................................................................................62
Figure 3.12. Mass Spectroscopy of the PAAD domain to verify complex formation using MALDI-TOF.................................................................66
Figure 3.13. Western blot of the PAAD domain illustrating the complex formed is not contamination.................................................................67
x
Figure 3.14. UV cross linking of MNDA-PAAD to different length of polydT (5-19mer)..............................................................................................68
Figure 3.15. Tyrosine fluorescence quenching assay of MNDA-PAAD using individual base enriched sequence demonstrate no preference for nucleotide base.............................................................72
Figure 3.16. Schematic representation of the FRET experiment.........................74
Figure 3.17. Fluorescence resonance energy transfer suggests that MNDA-PAAD does not pack or extend single stranded DNA...............75
Figure 3.18. The maximum emission of the donor Quasar 570 (at 564nm) and acceptor Quasar 670 (at 667nm) is plotted against the molar ratio of MNDA-PAAD reveals no energy was transferred during the titration............................................................................................76
Figure 3.19. Melting depression of dsDNA by MNDA-PAAD...............................78
Figure 3.20. Chemical cross linking of MNDA-PAAD to T70...............................80
Figure 3.21. ssDNA T13 binds to specific area of the MNDA-PAAD core module..................................................................................................84
Figure 3.22. Thermal denaturation of MNDA-PAAD when ssDNA is added. The addition of ssDNA to MNDA-PAAD affects the thermostability of the protein slightly. The protein remains a two state unfold mechanism and the thermodynamic parameters are listed in Table.......................................................................................85
Figure 3.23. Purified MNDA-HIN ran in 15% SDS-PAGE gel..............................87
Figure 3.24. EMSA of MNDA-HIN reveals the ability to recognize ssDNA..........88
Figure 3.25. UV cross linking of MNDA-HIN to ssDNA confirms the formation of protein-DNA complex. In all gels, lane 1 represents 2µg (77pmol) of MNDA-HIN without cross linking, lane 2 is MNDA-HIN cross linking without DNA, lane 3-8 represent MNDA-HIN cross linking with ssDNA in 0.1:1, 0.2:1, 0.5:1, 1:1, 2:1, 5:1 DNA:protein molar ratios. (A) polydT(25), (B) polydA(25), (C) Guanine rich 5’ 35mer, (D) Cytosine rich 3’ 35mer. M – Monomer, D – Dimer, T – Trimer, C – Complex,..................................89
Figure 3.26. Model of IFI16-PAAD illustrating the disordered helix 3 and the four mutation positions...................................................................92
When you add figure captions, just click on the grey area (click where it reads “Error! No table of figures entries found) and hit the F9 button (or right/mouse/update field) to select “update the entire table” then “Okay”. This will update your list of figures. Delete this instructional text from your final document.
xi
LIST OF TABLES
Table 1-1: Motifs used to differentiate HIN-200 domains. Amino acids (K,R), (I,L), (D,E), (Y,F), (V,A) are considered equivalent. Bolded amino acids are common to all subclasses and underlined amino acids can be used to discriminate between them(Ludlow, Johnstone, & Clarke, 2005)..................................................................17
Table 3-1. Experimental molecular weight determination of IFI16-PAAD-nucleic acid complexes after SDS-PAGE analysis and UV cross linking with ssDNA................................................................................63
Table 3-2. The dissociation constant and maximum binding constant from fluorescence quenching experiment.....................................................71
Table 3-3. Thermodynamic parameters of MNDA-PAAD in the absence and presence of ssDNA........................................................................85
Table 3-4. Secondary structure assessment and thermodynamic stability of 3rd round shuffled IFI16-PAAD mutants. The percent helix was calculated by cdPRO with far UV spectra. ΔH, ΔS, and ΔGfolding
25°C were calculated by VanHoff’s analysis of thermal denaturation..........................................................................................94
Table 3-5. Four mutants determined to influence IFI16-PAAD’s structure and stability the most. ΔGH20
25°C of the four selected mutants was obtained by chemcical denaturation and monitors by CD at 222nm. Cm and ΔASA were calculated by the correlation proposed by Myers (Myers et al., 1995)...............................................95
Table 3-6. Summary of the nucleic acid binding properties of MNDA and IFI16.....................................................................................................96
When you add table captions, just click on the grey area (click where it reads “Error! No table of figures entries found”) and hit the F9 button (or right/mouse/update field) to select “update the entire table” then “Okay”. This will update your list of tables. Delete this instructional text from your final document.
xii
GLOSSARY
Put terms here. No heading row required.
Add definitions here. Bolding of terms is perfectly acceptable. Definition best left unbolded.The table columns will stretch to fit. Text will wrap to the next line within the row as required. If you wish to control the length of any line, i.e. to make the term go to two or more lines, use shift/enter ( the hard line break) where desired. And drag the column line to suit your wishes.
Delete this feature and heading if you are not using a glossary in your thesis.
Critical note: Never delete the section break below !!!!! This break enables the differential page numbering between the preliminary roman numeral section and the main body of your document, in Arabic numbering.
If you cannot see the section break line, turn on the “Show/Hide button on your menu bar. Do NOT delete this reminder until just before printing final document. DO delete these paragraphs of instructional text from your final document.
xiii
1: INTRODUCTION
1.1. Overview of the HIN-200 family members
The first murine HIN-200 (Hematopoietic Interferon-inducible Nuclear
proteins with 200 repeats) gene was identified in 1982 and since then,
extensive research has been going on in the discovery and characterization of
HIN-200 genes. Currently there are five murine and four human HIN-200
family members identified and they are initially grouped together simply
because they share common structural motifs and are interferon inducible.
Murine HIN-200 protein includes p202a, p202b, p203, p204 and p205, while
human HIN-200 members include IFI16 (Interferon-Inducible protein 16),
MNDA (Myeloid Nuclear Differentiation Antigen), AIM2 (Absent In Melanoma
2) and IFIX (Interferon-Inducible protein X). The HIN-200 proteins possess
similar structural domain where they all contain a PAAD/DAPIN/Pyrin domain
at their N-termini except p202a and p202b, and followed by either one or two
copies of the HIN domain except IFIXγ isoform that lacks any HIN domain.
The ability to be induced by interferon suggests HIN-200 family members are
involved in antiviral and immunomodulatory activities because interferon is a
type of cytokine, which is produced by the cell in response to viral infection or
abnormal cell growth such as tumor(Choubey, Deka, & Ho, 2008). There are
substantial amount of researches trying to determine the involvement of HIN-
200 proteins in diseased patient. For example, IFI16 expression was lost in
tumor samples including prostate carcinoma(Xin, Curry, Johnstone, Nickoloff,
14
& Choubey, 2003) and malignant breast epithelial cells(Fujiuchi et al., 2004)
suggesting IFI16 is a tumor suppressor. More studies on the HIN-200 family
members revealed that they share similar hemopoietic expression, nuclear
localization and a characteristic of 200 amino-acids domain (HIN domain) with
unknown functions. All three human HIN-200 members are localized to
human chromosome 1q21-23 and their closely linked in syntenic loci implies
the family member are arose by gene duplication(R. C. Briggs et al., 1994;
DeYoung et al., 1997; Trapani et al., 1992). There is no unique characteristic
representing HIN-200 protein because the classification is appropriate for one
member in the family but not the other. Some examples of exceptions to the
characteristics of HIN-200 proteins discussed above include; the gene
transcript of Ifi202a is constitutively expressed in mice’s spleen lacking
interferon receptors indicates it is interferon independent(H. Wang et al.,
2002), while Ifi205 gene expression is induced by agents other than interferon
such as lipopolysaccharide (LPS) and tumor necrosis factor α (TNFα)
(Hamilton, Bredon, Ohmori, & Tannenbaum, 1989). Moreover, IFI16 is found
in epithelial cells of the skin and ducts of breast tissue suggest HIN-200 is
also expressed in non-hemopoietic system(Gariglio et al., 2002; Wei et al.,
2003). HIN-200 proteins was thought to be localized exclusively in the nucleus
as mediated by a recognized nuclear localization signal (NLS)(L. J. Briggs et
al., 2001), but MNDA and AIM2 both lacking the NLS. Even with the lack of
consistency in HIN-200 protein classification, summarizing the results found in
the literature regarding HIN-200 protein converged in suggesting HIN-200
protein have a role in regulating cell proliferation and differentiation.
15
1.2. Domain organization of the HIN-200 protein
As introduced earlier, HIN-200 proteins have a unique characteristic of
containing one or two repeats of a C-terminal 200 amino acids domain (HIN
domain) as well as an 85-100 amino acid PAAD domain at their N-termini.
There are three different types of the HIN domain, α, β, and γ, what separates
them are their amino-acid sequence and specific motifs. The details of the
various motifs of each type are listed in Table 1. Some HIN-200 proteins have
their domains separated by a spacer region with unknown function but vary in
overall sequence and size. The HIN-200 proteins have several highly
conserved peptide motifs such as the MFHATVAT motif, which locates in the
HIN domain and proposed to be involved in protein-protein interaction(Koul,
Obeyesekere, Gutterman, Mills, & Choubey, 1998). Another highly conserved
motif is the LXCXE pRB binding motif that also locates on the HIN
domain(Choubey & Lengyel, 1995), more detail of this motif is discussed in
subsequent section.
16
Figure 1.1: Domain organization of the human HIN-200 family members include IFI16, MNDA, AMI2 and the newly identified IFIX.
Residue α domain β domain γ domain14-20 EYESPEX TYDXXEX E(C/F)ETQEG32-39 M(F/L)HATVA(T/S) M(F/L)HATVAT (I/M)FHATVAT33-28 X(S/T)QYFH ETEFFR ETDFFF63-71 (E/K)XXGILE(I/V)N GCNGFLEIY (R/W)HSXFXEV(T/N)
98-103 XTPKIX ATPKIS ETPKIS152-158 IXC(E/K)(E/K)GD (I/V)XCEPG(D/X) (T/M)KC(E/K)EGD162-168 LFCF(H/R)L(R/K) L(V/F)CFEL(T/S) LTFF(E/T)(V/L)S176-187 LV(C/S)GXHSFIKX LRSVRHSYMQV LKSGX(C/H)SXXKV
Table 1-1: Motifs used to differentiate HIN-200 domains. Amino acids (K,R), (I,L), (D,E), (Y,F), (V,A) are considered equivalent. Bolded amino acids are common to all subclasses and underlined amino acids can be used to discriminate between them(Ludlow, Johnstone, & Clarke, 2005).
17
1.3. Interferon-γ inducible protein 16 (IFI16)
1.3.1 The role of interferon and IFI16 in cell cycle arrest
As discussed above, HIN-200 proteins can be induced by interferon.
There are three types of interferon identified that modulate biological activities
during viral infection, these inteferons include Type I (IFN-α and IFN-β) and
Type II (IFN-γ). A well know mechanism describing how interferon mediate
transcriptional activation during host defense was determined by Stark.
Briefly, interferon is a cytokine produce by infected cells as an anti-viral
response, which the interferons secrete into the cytoplasm triggering the anti-
viral response of the neighbor cells. This is done by binding of an interferon to
the corresponding cell surface receptor. Upon binding to interferons, the
surface receptor activates tyrosine kinase (JAK1) and JAK1 then
phosphorylates and activates signal transducer and activator of transcription
protein (STAT). A well studied HIN-200 family member, IFI16, is also found to
be involved in gene regulation and cell cycle arrest. Typically, IFI16 arrest cell
growth in the G1 to S phase with the E2F-mediated transcription pathway
involving regulatory protein such as p53, pRb, c-Myc and cyclin A(Ludlow et
al., 2005). In normal human cell, cell cycle progression in the E2F pathway is
lead by activated cyclin-dependent kinase 2 (cdk), which phosphorylates pRb
and turns pRb into its hyper-phosphorylated state (ppRb). The hyper-
phosphorylated pRb (ppRb) is no longer able to bind to transcription factor
E2F, therefore E2F is active and cell cycle progress. Certain stimuli such as
DNA damage often causes cell cycle arrest via p53 dependent pathway,
where p53 and p21 are over-expressed as a respond to the stimuli.
18
Transcription factor p53 is also known as a tumor suppressor that the role of
p53 is to activate other regulatory protein such as p21, a cyclin-dependent
kinase inhibitor protein. When p21 is active, it inhibits the phosphorylation
activity of cdk, hence causing pRb in its hypo-phosphorylated state. In this
state, pRb is able to bind to transcription factor E2F and represses it, and
cells lacking E2F cannot progress from G1 to S phase during cell cycle. IFI16
has been shown to interact with most of the proteins mentioned above in the
E2F pathway, namely Rb, E2F and Rb. Xin et al. in 2003 found that IFI16 is
able to specifically bind to Rb and E2F1 by GST pulldown assay(Xin et al.,
2003). It has been established that HIN-200 proteins possess at least one
conserved LXCXE motifs, which is a putative Rb binding motif. However IFI16
contains a closely related IXCXEE motif but Mahnaghi and co-worker
implicated that the closely related motifs is accountable for the binding to
Rb(Magnaghi-Jaulin et al., 1998; Trapani et al., 1992). In an attempt to find a
link between the function of IFI16 and its mouse homolog p202, Johnstone
revealed that IFI16 also binds transcription factor p53 using immune-
precipitation as well as enhancing the DNA binding activity of p53(Johnstone,
Wei, Greenway, & Trapani, 2000). Interestingly, besides the ability to form
protein-protein interaction, IFI16 was also thought to have a putative DNA
binding site and its DNA binding ability was demonstrated by Dawson and
Trapani(Dawson & Trapani, 1995). The DNA binding ability of IFI16 is further
characterized by Dalal and Yan as they tested individual domain of IFI16 and
concluded that the HIN domain of IFI16 DNA binding property behaves like
RPA (replication protein A), another single stranded DNA binding protein
19
containing OB fold (oligonucleotides/oligosaccharide binding) (Yan et al.,
2008).
(Figure obtained by Ludlow)
Figure 1.2: Schematic representation of the involvement of IFI16 in cell cycle arrest(Ludlow et al., 2005).
1.3.2 IFI16 involvement in disease and its binding partners
There are many studies showing the importance of IFI16 in human
cancer. In 2003, Fujiuchi showed that normal human epithelial cell expresses
detectable amount of IFI16 protein, where as in breast cancer patient the level
of IFI16 mRNA and protein were relatively decreased(Fujiuchi et al., 2004).
The lost of IFI16 in breast epithelial cell was thought to be the cause of breast
cancer. Congruently in the same year, Xin showed the human prostate cancer
cells do not express or reduce level of IFI16 compared to the normal prostate
epithelial cells(Xin et al., 2003). In the same study, the authors showed that
IFI16 is linked to cellular senescence by over expressing functional IFI16 in
prostate cancer cells and revealed that the colony formation was inhibited, but
activated the production of senescence-associated β galactosidase, a
20
biochemical marker for cellular senescence. Moreover, IFI16 was found to be
involved in DNA repair as IFI16 interacts with BRCA1 in BASC (BRCA1
Associated Surveillance protein Complex)(Aglipay et al., 2003). BRCA1 locus
encodes a large, multifunctional nuclear phosphoprotein that has an N-
terminal RING finger and C-terminal BRCT domain(Bork et al., 1997; Koonin,
Altschul, & Bork, 1996; Miki et al., 1994). The BRCA1 and associated proteins
are called BASC and by mass spectrometry, Wang discovered BASC contain
tumor suppressor and DNA repair proteins, namely MSH2, MSH6, MLH1,
ATM, BLM, and DNA replication factor C (RFC), which all of them are able to
interact with DNA (Y. Wang et al., 2000). Interestingly, every member of the
BASC could also recognize abnormal DNA structure and damaged DNA
suggesting this complex is a sensor for DNA damage. Aglipay et al. revealed
that only the α domain of IFI16 is responsible for the binding to BRCA1. Since
every member in BASC is able to interact with nuclei acid, it is expected that
IFI16 also possess DNA binding property. Not surprisingly, IFI16 is able to
bind to double stranded DNA but the binding property needs further
characterization(Choubey & Gutterman, 1996; Dawson & Trapani, 1995;
Johnstone, Kerry, & Trapani, 1998; Luu & Flores, 1997).
1.3.3 IFI16 is an RPA like protein
As discussed above, IFI16 full length has the ability to bind to nucleic
acid but there is no evidence showing which part of IFI16 is responsible for
the binding. Comparative modeling of IFI16 predicted the two HIN domains (α
21
and β) contain human RPA OB fold and later x-ray crystallography confirmed
that the α domain of IFI16 has 2 OB folds. As mentioned previously, human
RPA contains OB fold, which it is considered as a single stranded DNA
binding protein that involved in DNA replication, recombination and
repair(Wold & Kelly, 1988). Although the α domain has 2 OB folds, the
sequence similarity between the α domain and RPA is less than 10%. When
the sequence similarity is less than 25% between the two proteins, which is
below the twilight zone, their function tends to diverge. However with its
identical structural motif, it is interestingly to know if the α domain exhibits any
trace of OB fold function. Generally RPA plays a critical role in preventing
DNA being damaged and ensuring the repair process is properly proceeded.
As a ssDNA binding protein, it keeps the damaged DNA in its single stranded
form and prevent it to re-anneal until the repair process is completed(Binz,
Lao, Lowry, & Wold, 2003). RPA is also able to interact with other DNA
processing proteins and adopt different binding modes in order to facilitate the
repairing process(Fanning, Klimovich, & Nager, 2006). Human RPA70 is a
well characterized example of RPA that displays OB fold properties include;
oligomerization via its OB folds changes the binding mode of RPA to nucleic
acid, strong preference to ssDNA and RNA over dsDNA as well as the length
of the oligonucleotides(Bochkareva, Belegu, Korolev, & Bochkarev, 2001;
Kim, Paulus, & Wold, 1994), and most importantly the ability to destabilize
and unwind dsDNA to initiate DNA replication(Brosh et al., 2000; Treuner,
Ramsperger, & Knippers, 1996). Recently a study from Yan illustrated some
key features of RPA displayed in the α domain of IFI16. Yan showed the α
domain binds preferably to ssDNA with G,C rich oligonucleotides as assayed
22
by fluorescence quenching. Yan also showed the α domain can oligomerize
upon binding to ssDNA as well as wrap and stretch the ssDNA. However as
most of the experiments in Yan’s paper suggest IFI16 α domain is an RPA
like, OB fold, nucleic acid binding protein, a critical property is missing. If the
assumption of IFI16 is a DNA repair protein like RPA, it should at least binds
ssDNA and destabililze dsDNA as those properties are often found on DNA
repair protein. Nevertheless IFI16 α domain was found to slightly stabilize
dsDNA instead of destabilize it(Yan et al., 2008). Despite that IFI16 α domain
lacks the property to destabilize duplex, it resembles an RPA like protein well
and points toward being another DNA repair protein, which the deficient to
destabilize duplex could be compensated by other domains of IFI16.
1.3.4 The PAAD domain of IFI16 is a novel ssDNA binding domain
The PAAD domain is another conserved domain through out the
HIN200 family, which is also belong to the death domain super family. Every
member of the death domain super family has a conserved domain composed
of 85-100 amino acids that involved in protein-protein interaction to initiate or
execute apoptosis and inflammation pathway(Liu, Rojas, Ye, & Godzik, 2003).
Members in the death domain super family include; the death domain (DD),
the death effector domain (DED), the caspase recruitment domain (CARD)
and the Pyrin, AIM, ASC, Death domain like (PAAD). X-ray crystallography
revealed that the death domains have a conserved 6 helix bundle which
folded into a Greek key motif(Liang & Fesik, 1997). Each member with this
23
typical structural motif is found to be able to dimerize or interact with other
members under the same sub-family. For example, the CARD domain of
caspase-9 is able to dimerize when inactive as well as interact with the CARD
domain of Apaf-1 during caspases activation, a well regulated apoptosis
mechanism via protein-protein interaction(Bao & Shi, 2007). However, as
there is no structure solved for the PAAD domain of IFI16, comparative
modeling predicted that it has a six helix bundle motif compatible with other
death domain except with a disordered helix 3 (Dalal, unpublished). The
function of the PAAD domain sub-family was well characterized and not
surprisingly, it has been shown to be involved in protein-protein interaction
during apoptosis and inflammation(Pawlowski, Pio, Chu, Reed, & Godzik,
2001). Through the protein-protein interaction of the PAAD domain with other
cell cycle regulatory factors, it can cause cell cycle arrest. For example, the
PAAD domain of IFI16 can bind to the C-terminus of the Breast Cancer
Associated gene I (BRCAI) (Aglipay et al., 2003) and p53 that associate with
the BASC complex (Y. Wang et al., 2000). As discussed previously, the
formation of this complex is a result of DNA damage and subsequent DNA
repair pathway is initiated. In addition to protein-protein interactions, it has
recently been shown that the PAAD domain of IFI16 could also interact with
nuclei acids (Dalal, unpublished). The DNA binding characteristics of the
PAAD domain are similar to the α domain of IFI16, which they both recognize
single stranded DNA better than double stranded and able to oligomerize
upon binding to DNA. The PAAD domain is able to wrap around a stretch of
ssDNA and Dalal has proposed a model where multiple copies of the PAAD
domain are being wrap by a stretch of ssDNA (Dalal, unpublished). A very
24
important aspect of the PAAD domain in interacting with nucleic acid is that it
can destabilize DNA duplex, which is the key property of RPA’s OB fold that’s
the α domain is missing. Here we evidenced the lost of a function of the α
domain but compensated by the PAAD domain in IFI16, a good
demonstration of a protein to function as a whole by combining functions from
different domains. A very interesting aspect of the PAAD domain of IFI16 is
the partially folded structure. As mentioned previously, PAAD domains have
similar structure compare to other death domains except for NALP1, which is
another member of the PAAD domain sub-family but possess only 5 helices.
Helix 3 in NALP1 is disordered and therefore it cannot fold properly into an α
helix. The model of the PAAD domain of IFI16 used NALP1 NMR structure as
the best template. Dalal has shown that the PAAD domain of IFI16 adopt a
partially disordered structure as characterized by thermodynamics and
circular dichorism(Dalal & Pio, 2006). The same author suggested that the
partially folded structure may confer with the ability to bind nucleic acid in his
recently unpublished work and this hypothesis can be tested by comparing its
nucleic acid binding properties with another PAAD domain family member,
MNDA.
1.4. Myeloid Nuclear Differentiation Antigen (NMDA)
1.4.1 MNDA expression and interaction profile
MNDA belongs to the HIN-200 family as it contain one copy of the HIN-
200 domain, the α domain. MNDA also belongs to the death domain super
25
family because it has a PAAD domain in its N-terminus and potentially links to
other death domains involve in signaling pathways in apoptosis and
inflammation(R. C. Briggs et al., 2006). A unique characteristic of MNDA that
is not found in other HIN-200 family members is its pattern of expression.
MNDA expression is restricted specifically in the hemopoietic system such as
granulocytes and monocytes, which previous studies showed that MNDA is
involved in myeloid differentiation but not expressed in lymphoid cells (R.
Briggs et al., 1994). MNDA expression has been characterized using human
leukemic cell line HL-60 (human promyelocytic leukemia cells) and
Goldberger with his collegues have found that MNDA expression increases
during granulocytes differentiation triggered by retinoic acid but not found in
less differentiated HL-60 cells(Goldberger, Brewer, Hnilica, & Briggs, 1984).
Unlike IFI16, MNDA is not expressed by nonhematopoietic cells.
MNDA possesses most of the structural properties that are found within
the HIN-200 family. The NMR structure of the N-terminus PAAD domain is
solved (2DBG) and determined to have the 6 helix bundle in its monomeric
form, and is able to dimerize via its imperfect leucine zipper motif(Xie, Briggs,
& Briggs, 1997). The PAAD domain of IFI16 and MNDA share similar
structure with roughly 56% sequence identity. MNDA PAAD domain has a
well folded, highly helical content with an imperfect leucine zipper whereas
IFI16 PAAD domain has a partially folded structure. The model of the PAAD
domain of IFI16 illustrates that it has a disordered region between helix 2 and
4 generating a large loop but the PAAD domain of MNDA has a complete
helix 3. Structure superimposition of the two PAAD domains clearly reveals
the disordered region. Since loop between two helices tends to have an
26
important role in binding to other ligands such as the helix loop helix motif of
transcription factor that is accountable for binding to nucleic acid. It underlies
the potential difference of protein-ligands interaction between the PAAD
domain of IFI16 and MNDA. Furthermore, MNDA is found to bind to the
nuclear proteins such as nucleolin (C23) and nucleophosmin (Xie, Briggs,
Morris et al., 1997), which these nuclear proteins interact with transcription
factor YY1. Xie showed that upon binding of MNDA to YY1, the DNA binding
activity of YY1 is enhanced. The same author also showed that MNDA can
bind to YY1 independent of the MNDA or YY1 interaction with nucleolin and
nucleophosmin. Moreover, MNDA is known to interact with nucleic acid but
this interaction does not enhance YY1 DNA binding, instead by binding the
PAAD domain of MNDA directly to YY1 is sufficient to enhance YY1 DNA
binding activity (Xie, Briggs, & Briggs, 1998).
27
Figure 1.3: PAAD domain of IFI16 and MNDA has a six helix bundle motif but IFI16 has a disordered region.
This is the superimposition of the NMR structure of MNDA PAAD (2DBG; Blue) and model of IFI16 PAAD (Orange) built from NALP1 PAAD (1PN5) as the template. The superimposition was performed using Pymol align command. RMSD of the superimposition is 3.9Å.
1.5. Overview of objectives
The PAAD domain sub family have diverge structural property compare
to other Death domain super family and this divergence may confer to
different functions. The recent discovery of the PAAD domain of IFI16 is an
ssDNA binding protein is a very good example that the PAAD domain adopts
other ligands interactions beside protein-protein interaction. Although not
every member of the PAAD domain sub-family have solved their structure,
their structural property may be reflective from their thermodynamic stability.
Moreover, the establishment of the α domain of IFI16 is an RPA like protein
that exhibits most of the OB fold DNA binding characteristics has provide a
link between IFI16 and DNA repair. However the α domain does not
28
destabilize DNA duplex makes it an incomplete fit to the OB fold.
Nevertheless this property is redeemed by the N-terminus PAAD domain as
the PAAD domain of IFI16 demonstrates OB fold properties as well. Lastly,
the partially folded structure of the PAAD domain of IFI16 may confer to
different thermodynamic behaviors and protein-ligand interaction compare to
other PAAD domain family members. To determine if the OB fold properties
are also conserved within the PAAD domain family, especially the ability to
destabilize DNA duplex, and the structural/stability difference between
members of the PAAD domain, we ask the following questions.
1. Do the variations of structural property of the PAAD domain family confer
to different thermodynamic stabilities?
2. Are the newly identified OB fold-like properties of the PAAD domain of
IFI16 conserved within the PAAD domain family?
3. Which amino acids of the PAAD domain responsible for the partially folded
conformation?
To address the above questions, we chose the PAAD domain of MNDA
for the structural and thermodynamic comparison with the PAAD domain of
IFI16.
29
2: MATERIALS AND METHODS
2.1. Cloning and expression
The DNA fragments that encode the amino acids sequence of the
PAAD domain of MNDA (1-90, NP_002423) and IFI16 (1-102, CAI15085)
were amplified using PCR and inserted into expression vector pET28b via 5’
BamH1 and 3’ NdeI cut site. HIN domain of MNDA (205-398, NP_002423)
was also PCR amplified and inserted into pET28b but via 5’Nde1 and 3’
EcoR1 restriction sites. The proteins were produced as a fusion protein that
fused with a 6x histidine tag in their N-terminus using bacterial Escherichia
coli BL21(DE3) as their host strain. The culture was induced with 1mM IPTG
when the O.D600nm reached 0.6 and the induction took 4 hours at 37°C. The
culture was pelleted by centrifuging at 4000 rpm with JLA10.5 (Beckman) at
4°C for 20 mins. The pellet was resuspendend in lysis buffer (50mM
NaH2PO4, 300mM NaCl, 10mM imidazole, 100µM PMSF, pH 8.0) and
sonicated at approximately 20 Volts. The lysate was further centrifuged at
30000xg for 1 hour at 4°C and the cleared lysate was purified according to the
QIA-expressionist protocol (QIAgen) using Ni-NTA beads. The proteins were
allowed to bind onto the beads and washed with 25mM imidazole and eluted
with 250mM imidazole. The proteins after elution were immediately subjected
to dialysis overnight with the buffer that gave the optimal solubility to avoid
precipitation and aggregation. The PAAD domain of IFI16 was dialyzed
30
against 50mM sodium acetate, 14.4mM β-mercaptoethanol, pH 4.0 and both
MNDA-PAAD and MNDA-HIN were dialyzed with 5mM Tris, 100mM NaCl,
14.4mM β-mercaptoethanol, pH 8.0. IFI16-PAAD was subjected to second
round of purification using cation exchange. The running buffer used was
50mM sodium acetate, pH 4.0 and a gradient from 0M to 2M NaCl over 100
min was used to elute the protein. Eluted proteins were immediately dialyzed
with 50mM sodium acetate, 14.4mM β-mercaptoethanol, pH 4.0 and stored at
-80°C. MNDA-PAAD was further purified using size exclusion chromatography
with Superdex 75 (Amersham). The running buffer was 5mM Tris, 100mM
NaCl, pH 8.0. 14.4mM β-mercaptoethanol was added after the protein has
been eluted and the protein was stored in -80°C. All proteins were
concentrated to approximately 8mg/ml using an Amicon Ultra centrifugation
filter with a 5K Dalton molecular weight cut off.
2.2. Mass spectroscopy (ESI and MALDI-TOF)
The mass spectra were collected from two sources, Chemistry
Department in Simon Fraser University and Genome BC Proteomics Center in
University of Victoria. The ESI was performed in SFU using Varian 4000
GC/MS/MS and the MALDI-TOF was performed in UVic using Applied
Biosystems 4800 Voyager MALDI-TOF/TOF mass spectrometers. In the ESI
experiment, approximately 50mM of IFI16-PAAD was loaded with 5mM of
sodium acetate, pH 4.0 and trace amount of β-mercaptoethanol. The MALDI-
TOF used to detect protein-DNA complex used 140pM of IFI16-PAAD and
150pM of MNDA-PAAD. The same molar concentration of ssDNA was UV
cross linked (same as section 2.7)to the protein prior to mass spectroscopy,
T25 and T13, respectively. The matrix used was sinipinic acid and cyano-4-
31
hydroxycinnamic acid (CHCA). Some complexes were prepared and
concentrated using C18 Zip-tip and eluted using 1µl of 90% acetonitrile and
the 1µl was loaded onto the matrix.
2.3. Circular dichroism (CD)
JASCO-J-810 spectropolarimeter equipped with a peltier type PFD-
425S constant temperature cell holder was used to collect all CD spectra of
PAAD and HIN domains. IFI16-PAAD was diluted to 40µM using 5mM sodium
acetate pH 4.0 while MNDA-PAAD and MNDA-HIN were diluted to 46µM and
22µM, respectively, using 5mM Tris 100mM NaCl, pH 8.0 for far UV
measurement. Far UV was measured from 260nm to 190nm at 200nm/min
scan rate with 100mdeg sensitivity and 0.1s response time. The temperature
was kept constant at 20°C over the whole process to minimize stability
fluctuation and a 0.05cm path length quartz cell was used. The units obtained
from the raw measurement were converted into mean residue ellipticity and
expressed in deg cm2 decimol-1. A negative control with buffers only was
subtracted from all spectra to correct the baseline. The secondary structure
assessment was performed using cdPRO with three different algorithms,
CDSSTR, CONTINLL, and SELCON3. CDSSTR was liable to all secondary
structure assessment due to its high accuracy with α helix prediction of
proteins with known structures. cdPRO gave an assessment of α helical
content with two different categories, regular helix and disordered helix. The
percent α helix in our results were the sum of the two categories.
32
2.4. Intrinsic tyrosine fluorescence
Tyrosine fluorescence was obtained using SLM4800 spectofluorimeter
equipped with a single wavelength monochomator. 7µM of MNDA-PAAD in
5mM Tris, 100mM NaCl, pH 8.0 was used in the experiment. The protein was
excited at 275nm (λex of tyrosine) and the emission spectrum was monitored
from 250nm to 350nm. Denatured protein sample contained the same initial
material with an addition of 6M urea. Denature protein sample was incubated
overnight at 25°C to allow equilibrium at standard temperature to establish.
The cuvette path length was 1cm and the data were collected at a gain of
100, 600 Volts with bandwidths of 8nm in all four slits. A baseline was
subtracted from both the native and denatured sample with the respective
buffers.
2.5. Comparative modeling
The homology model of IFI16 was built by Dalal and it was based on
the template from NALP1 (PDB code 1PN5). The NMR structure of MNDA-
PAAD (PDB code 2DBG) was superimposed to the model of IFI16-PAAD
using the align command in PyMol.
2.6. Electrophoretic mobility shift assay
Prior to perform electrophoretic mobility shift assay (EMSA), each
oligonucleotides were labeled with 32P using T4 kinase from Invitrogen. The
labeling reaction composed of 500pmol of oligonucleotides in a 1x forward
kinase buffer , 50µCi of 32P γ-ATP and 10 units of T4 kinase. The labeling
reaction took 1 hour at 37°C and stopped by heating the sample to 65°C for
33
10 minutes or adding 1mM of EDTA as suggested in the manual. The reaction
mixtures were gel purified by loading into a denaturing polyacrylamide gel,
which the gel consist of 8M urea with 20% acrylamide and 1x TBE. The gel
ran at 250 Volts until the dye front reached 1/5 from the bottom of the gel. UV
shadowing was used to verify the position of the oligonucleotides and the
excision of the band was crushed and soaked in TE buffer with 300mM NaCl
at 37°C overnight. The gel debris was removed from the solution and the
eluted DNA was cleaned by ethanol precipitation. Air dried oligonucleotides
were resuspended in 1x TE buffer and the concentration of the labeled
oligonucleotides were approximately 5-10µM. To prepare for the shift assay, a
two fold serial dilution of MNDA-PAAD and MNDA-HIN from 210mM to
0.83mM using 20mM HEPES, pH 7.5 were made and each dilution was
incubated with a fixed amount of probe (360nM) for 30 minutes at room
temperature. The negative control having the probe only along with other
samples were loaded into a 10%, 1x TBE native gel and ran for 1 hour at 100
Volts. The gel was disassembled from the gel apparatus and wrapped with
saran wrap, then the gel was placed in a cassette and exposed to a phosphor
screen (Amersham) overnight. The phosphor screen was scanned using a
Typhoon 9410 variable mode imager (Molecular Dynamics) with highest
sensitivity and varied resolution (200-50). The images were loaded into
ImageQuant software version 2.2 for an integration of the shifted band and
obtained the relative intensity. The intensity of the shifted bands were
corrected with the background and the relative value of each band was
converted into fraction bound. The fraction bound was plotted against the
34
concentration of the protein in the corresponding fraction and the plot was
analyzed using GraphPad Prism verison 4.03.
2.7. UV cross linking
All UV cross linking of proteins to nucleic acids were conducted in the
same fashion. 2µg of proteins were individually mixed with 0, 0.1, 0.2, 0.5, 1,
2, 5 molar concentration of nucleic acids in 20mM HEPES, pH 7.5 and the
mixtures were incubated at room temperature for 10 minutes. The mixtures
were put into the Stratalinker 1800 cross linker and was allowed to irradiate
with UV light at 254nm at a distance of 20cm for 15 minutes at 1000J/min.
The samples were loaded into a 15% SDS-PAGE gel and the gel ran for 50
minutes at 200 Volts. The gels were visualized by silver staining. The ladder
used in each gel was PAGE ruler from Fermantas and the Rf of each ladder in
each gel was plotted in a calibration curve (Log molecular weight vs Rf). In
each gel, the molecular weight of each species was identified by measuring
the Rf and plotted in the corresponding calibration curve.
2.8. Chemical cross linking
Protein-protein interactions were promoted using two different cross
linker, glutaaldehyde and formaldehyde. 10µg of proteins were mixed with 0,
0.1, 0.2, 0.5, 1, 2, 5 molar concentration of T25 and T70 oligonucleotides in
20mM HEPES, pH 7.5. The total volume of the mixture was 200µl, they were
allowed to incubate at room temperature for 10 minutes, and 8µl of 25% w/v
chemical cross linker was added into the mixtures. The cross linking reactions
took 2 minutes and stopped by adding 10µl of freshly prepared quenching
buffer (2M NaBH4, 0.1M NaOH) and incubated for 20 minutes. 9µl of TCA
35
(78% w/v) was added to precipitate the proteins for 5 minutes at 4°C and
centrifuged in a table top centrifuge at 13000 rpm for 10 minutes. Pellets were
washed with ice cold acetone two times and centrifuged in between washes.
The pellets were air dried and resuspended using 1x laemmli buffer and
loaded into 15% SDS-PAGE gel. Gels were ran at 200 Volts for 1 hour and
silver stained for visualization.
2.9. Fluorescence quenching assay
Tyrosine quenching assay was performed using SLM4800
spectofluorimeter equipped with a single wavelength monochomator. 7µM of
MNDA-PAAD in 5mM Tris, 100mM NaCl, pH 8.0 was used in the experiment.
MNDA-PAAD was titrated with single stranded DNA A25, T25, GC-5, GC-3
and double stranded DNA AT25, and GC5-3 in 20mM HEPES, pH 7.5.
Titration started at 0 molar concentration of nucleic acids and increased up to
4 molar concentration. 0.1 molar concentration increment was used from 0 – 1
and 1 molar concentration increment was used from 1 – 4. Each sample’s
relative tyrosine fluorescence emission was measured by first excited the
sample with λex 275nm and monitored the emission spectra from 250nm to
350nm. Each curve was plotted and the relative value at λem 304nm was
selected and converted to percentage quenched, the percentage quenched
was plotted against the concentration of nucleic acids titrated and curve fitting
was done using this plot with GraphPad Prism version 4.03.
The plot was fitted into either a one site binding model (Y =
BmaxX/(KD+X)) or a two site binding model (Y = Bmax1X/(KD1+X) +
Bmax2X/(KD2+X)) using non-linear regression fit, where Bmax correspond to
36
maximal binding and KD correspond to dissociation constant. A F-test was
performed to determine the preferred binding model.
2.10. Double stranded DNA melting
The guanine and cytosine rich oligonucleotides were selected to test
the ability of the proteins to destabilize DNA duplex. GC-5 and GC-3 are
single stranded oligonucleotides that complementary to each other. They
were annealed by mixing equal molar concentration of each oligonucleotides
in an annealing buffer (20mM HEPES, 133mM NaCl, pH 7.5), heat at 95°C for
10 minutes, then gradually cool down to 20°C at a rate of 1°C per minute. A
Cary 300 Bio UV-Visible spectrophotometer equipped with a temperature
regulator was used to measure all melting depression experiments, which
monitored the absorbance at 260nm from 20°C to 100°C at 1°C per minute.
10µM of dsDNA was mixed with 0, 1, 2, 3, 4, 5 molar concentration of proteins
in each individual run. The hyperchromicity of the dsDNA was measured at
UV 260nm at each titration. The absorbance at 260nm that contributed to the
hyperchromicity of the dsDNA was corrected by subtracting to the absorbance
at 260nm of the blank containing protein only. The absorbance at 260nm was
converted into fraction denatured by making the assumption that the lowest
value correspond to all double stranded form and the highest value
correspond to all single stranded form. The melting temperature was
estimated by plotting the 50% fraction denatured corresponding value.
37
2.11. Fluorescence resonance energy transfer
Fluorescence resonance energy transfer (FRET) was used to monitor
the change in ssDNA conformation, which specially designed FRET
oligonucleotides was used to demonstrate the extension or compaction of the
ssDNA. A schematic representation of the FRET oligo is in Figure. Briefly, a
18 base pair oligonucleotides is labeled with an acceptor fluorophore at its
5’end (sequence: 5’ QUASAR670 – GCCTCGCTGCCGTCGC CA-3’) and a
58 base pair oligonucleotides is labeled with a donor fluorophore at its 3’ end
(sequence: 5’ TGGCGACGGCAGCGAGGC-(T)40 – QUASAR570 T3’) were
generated from University of Calgary DNA Core Services. The two
oligonucleotides are partially complementary to each other except the stretch
of polydT40 tail. The fluorescence property of the donor Cy3 analog QUASAR
570 has a λex = 548nm and λem = 567nm, while the acceptor Cy5 analog
QUASAR 670 has a λex = 648nm and λem = 667nm. Equal molar concentration
of the two oligonucleotides are mixed in an annealing buffer (20mM Tris,
400mM NaCl, pH 8.0) and annealed by heating to 95°C for 10 minutes and
gradually cool down to 20°C at 1°C per minute. The annealing of the DNA
was confirmed by running each single stranded form with the annealed
product in 15% native gel. The gel was ethium bromide stained and visualized
(data not shown). The FRET measurement was monitored by excited the
sample at 548nm (λex of donor) and the emission spectrum was monitored
from 500nm to 700nm. The cuvette path length was 1cm and the data were
collected at a gain of 100, 600 Volts with bandwidths of 8nm in all four slits. A
baseline was subtracted from all spectra with the respective buffers. 300nM of
annealed FRET oligonucleotides in 20mM of HEPES, pH 7.5 was used and it
38
was titrated with increasing molar concentration of protein from 0 – 20 with 1
molar concentration increment.
2.12. Site-directed mutagenesis
A cysteine residue was mutated to a serine in MNDA-PAAD to remove
the single free cysteine that potentially increases the amount of aggregation.
MNDA-PAAD mutant was generated as described in the QuickChange® II
Site-Directed Mutagenesis Kit manual. The sequence of the mutant was
verified by sequencing in Macrogen (Korea). Forward primer (5’-
GCGTTGCCTCTCTAGACAAACTAATAGAACTTGCCAAAGATATG – 3’),
reverse primer (5’ –
CATATCTTTGGCAAGTTCTATTAGTTTGTCTAGAGAGGCAACGC – 3’).
2.13. Nuclear magnetic resonance titration
MNDA-PAAD mutant plasmid was transformed into bacterial cell strain
BL21(DE3) and the pre-culture was grew in LB media. The pre-culture grew
overnight to allow it to reach saturation. Cells were pelleted by brief
centrifugation in an Eppendorf 5810R centrifuge with rotor A-4-62 at 4000rpm
for 20 minutes. 5ml of fresh LB was used to resuspend the pellet and
subsequently used to inoculate into M9 media. 1mM IPTG was added to
induced protein production when O.D reached 0.2 and the induction took 4-8
hours at 37°C. Cells were lysed and purified as described in section 2.1.
The NMR spectra with protein only were recorded at 25°C on a Bruker
Avance-600 NMR spectrometer. The reference point of the 2D HSQC on the
39
Bruker 600MHz was set using a 15N labeled T4 lysozyme. 1.7mg/ml
(0.13mM) of MNDA-PAAD placed in 5mM Tris, 100mM NaCl, pH 8, 10% D2O
and subjected to 1H/15N 2D HSQC using water flip-back pulse, 2D H-1/X
correlation via double inept transfer with sensitivity improvement, phase
sensitive using Echo/Antiecho-TPPI gradient selection, with decoupling during
acquisition. The NMR spectra of the protein titration with ssDNA were
recorded at 25°C on a Varian Inova 500 NMR spectrometer ran VNMRJ 1.1D,
with 4 channels, equipped with an XYZ-gradient or Z-gradient HCN 5mm
probe. HSQC gradient sensitivity enhanced version for N15, TROSY = y with
flip-down pulse H2Osinc_t.RF on N15/H1. Coherence transfer gradients may
be z or magic-angle (using triax probe). Pulse sequence was used as listed in
BioPack by professor Lewis Kay (Kay, Keifer, & Saarinen, 1992). 5mM HCN
was used to set as the reference point for the 2D HSQC. 0.21mM of MNDA-
PAAD was titrated with 0.1, 0.2, 0.3, and 0.4 molar concentration of polydT13
ssDNA and each titration the 2D HSQC was recorded.
40
2.14. Flow diagram for in vitro GFP directed evolution of IFI16-
PAAD
2.15. Mutants expression
Expression of IFI16-PAAD mutants are the same as listed in section
2.1. Only affinity chromatography using Ni-NTA was performed to purify the
proteins.
41
Error prone PCRInsert into GFP fusion vectorTransform mutant library into bacterial cell strain BL21(DE3)Express mutant proteins and select 40 brightest coloniesIsolate plasmid DNA from the 40 brightest coloniesPCR both wild type and PAAD mutantDNA digestion and reassemblyPCR of reamssembled templatesInsert into GFP fusion vector, transform into BL21(DE3)Exress protein from 3x shuffled DNA and select 40 brightest coloniesIsolate plasmid from each colony, excise PAAD DNA fragment using NDE1 and BamH1Insert DNA fragment into pET28b expression vectorExpress PAAD mutants, protein purification, stability and structural analysis3 rounds DNA shuffling
2.16. Far UV and thermodynamic parameters assessment us-
ing circular dichroism
Same as section 2.3.
2.17. Chemical stability assessment using circular dichroism
Same as section 2.3.
42
3: RESULTS
3.1. Spectroscopic property of MNDA-PAAD
3.1.1 Rationale
The PAAD domain of IFI16 was thought to have a disordered helix 3 by
comparative modeling. Details about the secondary structure and stability of
the protein were determined using circular dichorism by Dalal (Dalal & Pio,
2006). Dalal concluded that IFI16-PAAD followed a two state folding
mechanism but possess a partially folded structure with an overall lower
stability of the protein. The structure of MNDA-PAAD has been solved (2DBG)
but MNDA-PAAD has a well ordered helix 3. It will be best to compare the two
PAAD domains in order to assess if IFI16-PAAD’s lower stability is due to the
unfolding of helix 3.
3.1.2 Expression and purification of MNDA-PAAD
The human DNA sequences of MNDA-PAAD and IFI16-PAAD was
PCR amplified and cloned into expression vector pET28-b. The PAAD
proteins were fused with a 6x-HIS tag and expressed using bacterial cell line
BL21(DE3). The fusion proteins were first purified using Ni-NTA column.
However the purity of the proteins was not good because other contamination
bands could be seen on a 15% SDS-PAGE assessment gel that stained by
43
Commassie blue (data not shown). Therefore each protein was subjected to
second round of purification. The PAAD of IFI16 was subjected to ion-
exchange chromatography and the PAAD of MNDA was subjected to gel
filtration. Other purification strategies were used in the second round of
purification but the chosen one gave us the maximum recovery of the
proteins. The purity of the proteins after two rounds of purification were
estimated by SDS-PAGE (Figure 3.4). illustrated the size exclusion
chromatography and purity of MNDA-PAAD.
3.1.3 Secondary structure determination using Circular Dichorism
The structure of MNDA-PAAD and IFI16-PAAD consist of 6 helices
linked with loops, the helices are arranged in anti-parallel fashion and is
recognized as a greek key motif. Circular dichroism was used to evaluate the
amount of secondary structure, hence determine the proteins expressed
would have the same structural feature. Far UV spectra were made between
190nm and 260nm at 20°C. The protein concentration used in the Far UV
experiment was 46 M and the degree of ellipticity was transformed into mean
residue ellipticity. The respective far UV spectra of MNDA and IFI16 PAAD
were superimposed and it clearly showed that there were two local minima at
222nm and 208nm in both spectra indicating the protein contains strong
helical content (Figure 3.5). However, the deepness of IFI16-PAAD is
shallower than MNDA-PAAD denotes less helical content and the secondary
structure content of the proteins were estimated by cdPRO. This program
calculates the amount of secondary structure based on 3 individual algorithms
44
- CDSSTR, SELCON3, and CONTINLL. All three individual algorithms agreed
that MNDA-PAAD contains ~60% α-helix and IFI16-PAAD has ~40% α-helix.
0 2 4 6 8 10 12 14 16 18 200
500
1000
1500
2000
2500MNDA-PAAD Gel Filtration
Elution Volumn (mL)
Abso
rban
ce 2
80nm
(m
AU)
Figure 3.4. Size exclusion chromatography of MNDA-PAAD using SuperDex 75.
The peaks were annotated by taking the elution volume and plotted in the calibration curve (see appendix) to obtain the molecular weight of the corresponding peak. MNDA-PAAD eluted at 14.6 mL and a single sharp peak was observed. The peak was collected and the sample was ran into a 15% SDS-PAGE gel. The gel is shown as an insert.
45
170 180 190 200 210 220 230 240 250 260 270
-15000-10000-5000
05000
10000150002000025000
FarUV Spectra
MNDA PAAD
IFI16-PAAD
Wavelength (nm)
Mea
n re
sidu
e el
liptic
ity
Figure 3.5. Far UV spectra of the PAAD domains.
A superimposition of IFI16-PAAD and MNDA-PAAD’s far UV spectra reveals a higher α helical content of MNDA than IFI16. The α helical content is estimated by observing the two local minima at 208nm and 222nm and their respective mean residue ellipticity.
46
3.1.4 Thermodynamic parameters of the PAAD domain
The thermodynamic properties of MNDA-PAAD and IFI16-PAAD were
obtained using circular dichorism by measuring the CD signal at 222 nm over
a temperature range from 20ºC to 100ºC. All curves were fitted to a two state
equilibrium folding model (Figure 3.6). MNDA-PAAD has a melting
temperature of 58.7 ºC, ΔH = -36.7(kcal mol-1), ΔS = -0.111(kcal mol-1 K-1)
and ΔGfolding25℃ = -3.7(kcal mol-1) and IFI16-PAAD has a Tm of 42.4 ºC,
ΔH = -27.2(kcal mol-1), ΔS = -0.086(kcal mol-1 K-1) and ΔGfolding25℃ = -
1.5(kcal mol-1). These thermodynamic parameters were obtained after fitting
the denature curve into a two state folding model and linear extrapolated the
transition state. The reversibility of the folding-unfolding transition was also
tested using circular dichroism (Figure 3.7). The PAAD of IFI16 was
determined to be able to reverse its unfolded state into its native state after
thermal denaturation and the Tm of the denature and renature curves were
nearly identical (Dalal, thesis), however this is not the case for the PAAD
domain of MNDA. The renature curve of MNDA-PAAD showed that MNDA-
PAAD did not renature into its initial state, which the protein had lost its
secondary structure as less ellipticity was observed at 20°C. Although MNDA-
PAAD has higher stability and secondary structure compare to IFI16-PAAD,
MNDA-PAAD does not refold after being thermo- denatured. The high
percentile of helical content and increased thermal stability of MNDA-PAAD
over IFI16-PAAD was thought to be the difference in helix 3 from both
proteins. Proteins under the death domain superfamily such as NALP1 and
47
ASC have the overall same structure as MNDA but they all differ in helix 3,
which NALP1 has a disordered region between helix 2 and 4 but MNDA has a
complete helix 3. Until the structure of MNDA-PAAD had been solved in 2006,
IFI16-PAAD was predicted to have a disordered region much like NALP1. Our
data also support with the less secondary structure and stability of IFI16-
PAAD compare to MNDA-PAAD. However, recently we have found IFI16-
PAAD is predicted to have an ordered helix 3 by comparative modeling but
our parameters best fit with the disordered helix 3 hypothesis.
48
10 20 30 40 50 60 70 80 90 100-0.2
0
0.2
0.4
0.6
0.8
1
1.2Thermal Denaturation of PAAD
MNDA PAAD
IFI16 PAAD
Temperature (°C)
Frac
tion
Unfo
lded
Figure 3.6. Thermal denaturation of the PAAD domain.
The CD signal of far UV at 222nm is monitored over a temperature from 20°C to 100°C. The ellipticity is transformed in to fraction unfolded of the protein where 1 = 100% unfolded. Both PAAD domains unfolded via a two state unfolding mechanism where IFI16-PAAD is less stable than MNDA-PAAD. Their respective thermodynamic parameters is listed in table
49
10 20 30 40 50 60 70 80 90 100
-120
-100
-80
-60
-40
-20
0
Reversibility of MNDA-PAAD
Denaturation curveRenature Curve
Temperature (°C)
Ellip
ticity
(mde
g)
Figure 3.7. MNDA-PAAD did not regain secondary structure after thermodenaturation.
MNDA-PAAD is first heated from 20°C to 100°C and then cooled back to 20°C. The ellipticity at 222nm is monitored over the entire process. The protein is not able to regain its original amount of secondary structure after heated to 100°C.
50
3.1.5 Intrinsic fluorescence – tertiary structure unfolding of MNDA-PAAD
The intrinsic fluorescence properties could serve as an indication of the
folding of the protein. Typically tryptophan gives the most reliable and
strongest measurement of the intrinsic fluorescence property of a protein,
however there is no tryptophan in the protein sequence of MNDA-PAAD.
Therefore we measured the unfolding process of the protein using 6M urea
while monitoring the tyrosine fluorescence. Tyrosine absorbs light at 275nm
and emits at 304nm and aromatic residues absorb and emit in a higher
efficiency when they are buried inside the protein core due to their non-
polarity. When the aromatic residues expose to solvent during denaturation or
in close proximity with a quencher, the fluorescence emission is quenched
due to the intermolecular interaction (Zhuang et al., 2000). Urea is used as
the denaturant and the tyrosine emission of the protein in the absence and
presence of urea is measured. Urea is very effective in disrupting non
covalent bonds in protein and we observed a slight decrease in MNDA-PAAD
tyrosine emission at 304nm when it’s denatured with 6M urea. In both the
native and denature protein fluorescence spectra we observed a single peak
at 304nm (Figure 3.8). The decrease in fluorescence indicates the protein was
folded, had tertiary structure and possibly very rigid thru hydrogen bonds in its
native state and possibly another denaturant such as guanidine hydrochloric
acid would help disrupt the hydrogen bonds in the protein, hence denature it.
IFI16 observed similar results and the data were collected by Dalal (Dalal,
thesis).
51
280 290 300 310 320 330 340 3500
1
2
3
4
5
6
7
8
9
10
Native MNDA-PAADDenatured MNDA-PAAD
Wavelength (nm)
Rela
tive
Fluo
resc
ence
(RU)
Figure 3.8. Tyrosine spectroscopic property of MNDA-PAAD.
The tyrosine fluorescence emission spectra of native and denatured protein (λex = 275nm). The protein is denatured using 6M urea. There is a slight decrease at the emission peak of tyrosine (λem = 304nm) after the protein being denatured, indicating the tertiary structure if the protein is changed.
52
3.1.6 Polydispersity determination of MNDA-PAAD using dynamic light scattering
The hydrodynamic radius, polydispersity, and presence of aggregation
of MNDA-PAAD were determined using dynamic light scattering. 0.5 mg of
MNDA-PAAD was injected into Superdex 75 and allows the sample to
separate by size exclusion. The size exclusion column was attached to a
dynamic light scattering apparatus and the light scattered by the proteins was
detected once the proteins had eluded out from the column. The size
exclusion chromatography observed a single sharp peak with an apparent
molecular mass of 1.29e+4g/mol that correspond to the monomer of MNDA-
PAAD (Figure 3.9). According to the light scattering data, greater than 90% of
the light scatter came from the monomeric form of MNDA-PAAD and the
remaining percentile came from a shallow peak that correspond to the dimeric
form of MNDA-PAAD when referenced back to the size exclusion
chromatography. The polydispersity value was 1 and this indicates the protein
was mono-dispersed in solution. Lastly, the hydrodynamic radius of MNDA-
PAAD was calculated to be 1.9nm in its monomeric form.
53
Figure 3.9. Dynamic light scattering of MNDA-PAAD.
A single sharp peak again observed during the size exclusion chromatography in DLS and DLS determined the protein in that peak to be monodispered with 1.9nm of hydrodynamic radius.
3.1.7 Comparative Modeling of IFI16-PAAD and MNDA-PAAD reveals discrepancy in helix 3
The structure of IFI16-PAAD was predicted by metaserver which
utilizes fold recognition, function recognition and local structure prediction
method. Metaserver predicted the best model of IFI16-PAAD is built using
2DBG as the template, which 2DBG is the NMR structure of MNDA-PAAD.
However, previous work on IFI16-PAAD illustrated that the best template to
breed IFI16-PAAD model would be 1PN5, the NMR structure of another
PAAD protein, NALP1 (Dalal & Pio, 2006). Using Swisspdb viewer, the
superimposition of the model to the template was made and the RMSD is
calculated to be 0.3Å (Figure 3.10). There is a slight discrepancy between the
54
Mol
ar M
ass
(g/m
ol)
Volume (ml)
model of IFI16-PAAD from Dalal et al. (Dalal & Pio, 2006) to the model I
generated. Dalal et al. claimed that IFI16-PAAD has a disorder region in helix
3 from his model, yet the model I proposed has a complete but rather short
helix 3. Globplot is a computer program that is able to predict the protein’s
tendency to be order/globularity and disorder (Linding, Russell, Neduva, &
Gibson, 2003). Globplot illustrated that IFI16-PAAD has a disordered region
near the N-terminus but the rest of the protein is well ordered. The predicted
disorder region agrees with my model and the structural sequence of the
protein, due to a possible cause of the 6x histidine-tag on the N-terminus of
the protein. It is intriguing to know if the disordered region exist in IFI16-
PAAD, but we concluded that it does have a disordered region based on the
thermodynamic parameters and secondary structure assessment using
circular dichroism.
55
Figure 3.10. Superimposition of IFI16-PAAD and MNDA-PAAD showing the six helix bundle and disordered helix region.
The model of IFI16-PAAD is generated as a homology model NALP1-PAAD (1PN5) as the template. PDB ID of MNDA-PAAD is 2DBG. The superimposition was done in SwissPDBViewer with a RMSD = 0.3Å. Blue cartoon represent 2DBG and the model of IFI16-PAAD is in orange cartoon. The disordered helix 3 is shown on the most right of the figure.
3.2 The nucleic acid interaction property is conserve to another PAAD domain family member, MNDA.
3.2.1 Rationale
As shown by Xie (Xie et al., 1998; Xie, Briggs, Olson, Sipos, & Briggs,
1995), MNDA has the ability to bind to transcription factor YY1 and nucleic
acid only with its N-terminal half (Xie et al., 1998), presumably the PAAD
domain region. Nevertheless how MNDA-PAAD interacts with nucleic acid
has not been investigated in extensive detail. With the discovery that IFI16-
PAAD recognizes nucleic acids with specificities, it would be worthwhile to
know if these properties are conserved across the PAAD domain. These
properties include binding to ssDNA with nucleotides preference,
oligomerization upon DNA binding, destabilization of dsDNA, wrapping and
stretching of DNA, which all of these properties are usually exhibited by
protein that contain OB fold. The HIN α domain was previously characterized
by Yan and she concluded it is a RPA like protein that possessed most of the
OB fold DNA recognition properties (Yan et al., 2008). This sparks the interest
of knowing whether both the PAAD and HIN α domain of MNDA also possess
similar properties. As a result, by investigating the nuclei acids binding
56
properties of MNDA might gain a better understanding of how it interacts with
DNA and if these properties are conserved with in the PAAD domain family.
3.
3.1.
3.2.
3.2.1.
3.2.2 MNDA-PAAD is able to binds ssDNA as IFI16-PAAD
Electrophoretic mobility shift assay (EMSA) was performed to verify
MNDA-PAAD could form protein-nuclei acid complexes. We used different
single stranded oligonucleotides such as polydA25 (A25), polydT25 (T25),
guanine rich 5’ 35mer (GC - 5) and cytosine rich 3’ 35mer (GC - 3) in this
assay. These oligos used were 32P labeled on their 5’OH group using T4
polynucleotide kinase. The reaction mixtures were prepared by mixing a fixed
amount of 32P oligonucleotides (10pmol) with a series of 2 fold serial dilution
of MNDA-PAAD (210µM – 0.83µM). The EMSA showed that despite any type
of oligonucleotides, the addition of MNDA-PAAD resulted in a shifted band
compared to the free probe (Figure 3.11). Although the shifted band only
migrated 5 mm into the gel, the intensity of the band decreased as the amount
of protein decreased, suggesting that the shifted band composed of MNDA-
PAAD and the labeled oligonucleotides. Moreover, as IFI16-PAAD is able to
bind to RNA, we further tested whether MNDA-PAAD also has the ability to
bind to RNA. We used a 32P random RNA library (79mer) for another shift
assay. The result indicates MNDA-PAAD could also bind to RNA regardless
of the RNA sequence. Although IFI16-PAAD used a different random RNA
57
library (49mer), similar shifting pattern were seen with all probes in the EMSA
experiment. An estimation of the binding affinities to each of the
oligonucleotides were obtained by analyzing the EMSA shift pattern using
ImageQuant 2.2. The software integrated the bands correspond to the bound
fraction and we expressed the value in percentage. The percent bound was
plotted against their respective MNDA-PAAD concentrations and the curves
were input into GraphPad. GraphPad fitted all curves into a one site binding
model and calculated the statistics for the non-linear regression fit (Figure
3.12). The results indicate MNDA-PAAD has slight preference to theronine
and RNA nucleotide as their affinities appear greater than the rest (KD =
9.05µM and KD = 1.76µM, respectively). All other oligonucleotides affinities
are; A25 = 88.08µM, GC - 5 = 34.66µM, GC – 3 = 146µM. Although no
specific conclusion can be made with these numbers, more characterization
of MNDA-PAAD affinity to different nucleotides were performed using
fluorescence quenching (See section 3.2.4).
58
Figure 3.11. EMSA of MNDA-PAAD with different single stranded DNA.
Lane 1 represents 7-10pmol of free 32P end labelled oligonucleotides. Lane 2 beyond are 2 fold serial dilution of MNDA-PAAD starting with 210µM to 0.83µM mixed with constant amount of probe (varies from 7-10pmol depending on which oligonucleotide). F – free probe, C – Complex. (A) polydT(25), (B) polydA(25), (C) Guanine rich 5’ 35mer, (D) Cytosine rich 3’ 35mer, (E) random 79mer RNA library.
59
Figure 3.12. Integrated shift pattern in the EMSA experiment and curved fitted to a one site binding model.
Each graph represent one oligonucleotides used in the EMSA experiment as Figure 3.8. The intensity of the shifted band (upper) in each lane was integrated and expressed in percent bound. (A) polydT(25) Kd = 9.05µM, (B) polydA(25) Kd = 88.08µM, (C) Guanine rich 5’ 35mer Kd = 34.66µM, (D) Cytosine rich 3’ 35mer Kd = 146µM, (E) random 79mer RNA library Kd =1.76µM.
60
3.2.3 Further assessment of the ability of PAAD domain to form stable complex with ssDNA
UV cross linking could cause two transient interactions covalently
linked. Hence it was used to detect the interaction between proteins and
nucleic acids. The same sets of oligonucleotides were used along with UV to
examine the ability of MNDA-PAAD to bind to nucleic acid. In this experiment,
2µg of protein (153 pmol) was titrated against 0, 0.1, 0.2, 0.5, 1.0, 2.0 and 5.0
molar ratio of ssDNA. The reactions were exposed to UV light at 254 nm for
15 minutes at 1000 J/min. Each reaction mixture was loaded on a 15% SDS
PAGE along with a standard protein ladder and visualized using silver stain.
The molecular weight of the bands that corresponded to MNDA-PAAD
monomer, dimer and complex were calculated based on the calibration curve
generated by measuring the Rf of the standard protein ladder
(Figure 3.14).
61
Figure 3.13. . UV cross linking of MNDA-PAAD with ssDNA.
In all gels, lane 1 represents 2µg (150pmol) of MNDA-PAAD without cross linking, lane 2 is MNDA-PAAD cross linking without DNA, lane 3-8 represent MNDA-PAAD cross linking with ssDNA in 0.1:1, 0.2:1, 0.5:1, 1:1, 2:1, 5:1 DNA:protein molar ratios. M – Monomer, D – Dimer, T – Trimer, C – Complex, T70 – PolydT(70)
62
Figure 3.14. Calibration curve of protein ladder ran in each UV cross linking gel.
Each calibration curve correspond to the protein ladder ran in each gel represented in figure 3.10.
63
Table 3-2. Experimental molecular weight determination of IFI16-PAAD-nucleic acid complexes after SDS-PAGE analysis and UV cross linking with ssDNA.
Columns are experimental molecular weight for: (M) MNDA-PAAD monomer; (D) MNDA-PAAD dimer; (O) oligonucleotide; (C) MNDA-PAAD-nucleic acid complex. (Expected) Expected MNDA-PAAD-nucleic acid molecular weight as determined by the sum of experimentally calculated M with O; (Deviation) Absolute difference between C and Expected molecular weight protein-ssDNA complexes.
Oligonucleotide M(kDa)
D(kDa)
O(kDa)
C(kDa)
Expected Complex
Weight (kDa)
Deviation from
expected weight (kDa)
A25 13.2 27.3 - 21.6 20.7 0.9
T25 13.2 27.1 - 22.3 20.5 1.8
GC5 13.1 26.9 - 26.4 23.8 2.6
GC3 13.3 27.2 - 25.0 23.5 1.5
T70 13.4 27.0 25.8 42.5 37.2 5.3
dimer + T70 13.4 27.0 - 53.7 53.3 0.4
trimer + T70 13.4 27.0 - 64.3 62.8 1.5
The calculated molecular weight of each species was within ±1 kDa of
the expected molecular weight. Table 3-2 summarized the expected and
experimental determined molecular weight of each species. The monomeric
form of MNDA-PAAD has a molecular weight of 12951 Da and the respective
complex molecular weight to different oligonucleotides is listed in. The gels
clearly showed that the complex started to appear at 0.1:1 molar ratio of
DNA:protein. The cross linking of MNDA-PAAD with A25, T25, GC5 and GC3
generated only one complex band that can be seen on the SDS-PAGE
(Figure 3.13). The lower band corresponds to the monomeric form of MNDA-
PAAD which has an experimental molecular weight of 13.0 kDa. The top
band corresponds to the dimeric form of MNDA-PAAD as the experimental
64
molecular weight determined to be 26.0 kDa. The band in between the
monomer and dimer form of MNDA-PAAD is the protein-DNA complex. There
was a different staining pattern on the T70 gel that presumably corresponds to
polydT70 oligonucleotides, other nucleotides (A25, T25, GC5, and GC3)
staining was also seen on the 15% SDS PAGE if the dye front did not run off
the gel (data not shown). The complex band’s intensity increased as the
concentration of ssDNA increased indicating the formation of the complex.
Strikingly in an attempt to find out if more than 1 molecule of MNDA-PAAD
could bind onto a single stretch of ssDNA, the protein was UV cross linked to
a 70mer of poly thymine. Multiple bands showed up in the SDS-PAGE and
their respective molecular weight is approximately the size of a monomer
(12.9 kDa), dimer (25.8 kDa), monomer plus T70 (12.9 kDa + 24 kDa), dimer
plus T70 (25.8 kDa + 24 kDa), trimer plus T70 (38.7 kDa + 24 kDa). This
indicates that more than 1 PAAD domain are bound onto a single stretch of
T70. Similar results were obtained with IFI16-PAAD (Dalal thesis). To rule out
contamination or aggregation caused the complex formation, we used mass
spectroscopy to determine the exact size of the different species after UV
cross linking and western blot to verify the complex protein is the PAAD
domain. 50µM of IFI16-PAAD was subjected to electrospray-ionization mass
spectrometry. The molecular weight of IFI16-PAAD was determined to be
14.4kDa, which is 0.1kDa less then the expected (data not shown). We tried
to perform ESI of IFI16-PAAD after UV cross linked to T25 but the complex
did not ionized for unknown reason, therefore we switched to MALDI-TOF.
The result obtained from MALDI-TOF has a slight discrepancy compared to
ESI, which the monomer is now determined to be 15.7kDa, roughly 1.2kDa
65
higher than expected. Nevertheless, a small but significant peak observed at
a higher mass to charge ratio which was expected to be the complex (Figure
3.15 B). The experimental weight of the complex is 23.7kDa and the expected
is 22.4kDa, again the weight is roughly 1.3kDa off. Moreover, MNDA-PAAD
was subjected to MALDI-TOF after UV cross linked to a different length of
poly thymine, T13 (Figure 3.15 A). The expected size of the MNDA-PAAD is
12.9 kDa and T13 is 3.9 kDa. As expected, monomeric MNDA-PAAD gave a
molecular weight of 12.9 kDa and the complex was 16.9 kDa. The error of the
complex is roughly within 1 kDa for the 2 PAAD domains after UV cross linked
to oligonucleotides as determined by mass spectroscopy.
66
5000 12000 19000 26000 33000 40000Mass (m/z)
0
5.9E+4
0
10
20
30
40
50
60
70
80
90
100
% In
tens
ity
Voyager Spec #1=>BC=>RSM500[BP = 12803.7, 59398]
12805.2212873.42
13010.19
6400.15
6503.04 16910.25
25763.98
6613.20 10502.08 29835.748424.905867.27 20992.55
9999.0 13999.4 17999.8 22000.2 26000.6 30001.0Mass (m/z )
0
5527.3
0
10
20
30
40
50
60
70
80
90
100
% In
tens
ity
Voyager Spec #1=>BC=>SM5[BP = 15771.1, 5527]
15830.09
15881.85
15927.29
15564.84
15973.2215455.61
15297.64
15157.07
16094.9723655.47
16201.0710570.1011938.00 16282.2810525.45
Figure 3.15. Mass Spectroscopy of the PAAD domain to verify complex formation using MALDI-TOF.
50µM of MNDA-PAAD and IFI16-PAAD have been UV cross link to equal molar ratio of T13 or T25, respectively. Panel A is the mass spectrum of MNDA-PAAD and panel B is IFI16-PAAD. In both spectra, the sharp and highest peak is observed and the calculated molecular weight of that peak is (A) 12.9 kDa and (B) 15.7 kDa. The complex molecular weight of MNDA-PAAD to T13 is observed and detected to be at 16.9 kDa. The 25.8 kDa peak is the dimer of MNDA-PAAD. The complex molecular weight of IFI16-PAAD to T25 is observed at 23.7 kDa.
67
In the western blot, the PAAD domain of both MNDA and IFI16 were
UV cross linked to A25, T25, GC5, and GC3 and ran in a 15% SDS-PAGE
gel. Using anti-histidine antibody, we managed to visualize the monomer and
dimer of each PAAD domain as well as the complex with A25 and T25 (Figure
3.16). However, western blot did not detect the complex with GC5 and GC3
and this could be because when the nucleic acids bound on the protein, it also
blocks the antibody binding site. Nevertheless the complex formation of the
PAAD domain with nucleic acid is not a cause of aggregation or
contamination as demostrated by mass spectroscopy and western blot.
Figure 3.16. Western blot of the PAAD domain illustrating the complex formed is not contamination.
A western blot of the PAAD domain using anti-histidine tag antibody. Proteins were subjected to UV cross linking as previously described (Figure 3.10) at 1:1 molar ratio. In the absence of oligonucleotides, no complex is detected in both SDS-PAGE and western blot even UV has applied. Complex is detected only when both oligonucleotides and UV cross linking applied. C – Complex.
68
To further characterize the ability of MNDA-PAAD to interact with
nucleic acid, we used different length of poly thymine ranging from 19mer to
5mer and apply UV cross-linking as described above to determine the minimal
length of single stranded nucleic acid that MNDA-PAAD recognize. Similar
types of band pattern were obtained compare to T25 except with the band
that corresponds to the complex, which would migrate differently depending of
the size of the oligonucleotides. We also observed the complex band intensity
got weaker and eventually disappeared as the oligonucleotides length got
shorter indicating no complex formed (Figure 3.17).
Figure 3.17. UV cross linking of MNDA-PAAD to different length of polydT (5-19mer).
Each gel represents a different length of polydT and UV cross linking is applied in similar fashion as Figure 3.10. No complex can bee seen in T7 and T5 even the ssDNA is at 5 molar excess.
69
The weakest intensity of the complex could be seen with 11mer of
ssDNA suggests that one molecule of MNDA-PAAD could bind to one
molecule of ssDNA with at least 11mer in length.
3.2.4 Binding affinity determination using fluorescence quenching assay
Previously we have found that the tyrosines in MNDA-PAAD could be
quenched upon denaturation. We decided to quench the tyrosine
fluorescence by titrating it with ssDNA to obtain a more accurate binding
constant for MNDA-PAAD-nucleic acid complexes. The result indicated the
tyrosine fluorescence could be quenched upon addition of oligonucleotides.
The concentration of MNDA-PAAD was kept constant at 0.1 mg/ml (7.8mM)
and it was titrated against an increasing concentration of oligonucleotides
from 0:1 to 4:1 molar ratio with 0.1 molar increments. The samples were
excited at 275 nm and recorded the emission spectrum from 250nm to
350nm. The emission peaks at 304nm were transformed into relative
percentage quenched and plotted against their respective molar ratio of
nucleic acid added. The resulting curves were analyzed by GraphPad to curve
fit it into a one site or two site binding model and determine the binding
constant (Error: Reference source not found). All the curves were
preferentially fitted to a one site binding model with non-linear regression.
MNDA-PAAD is binding to each of the oligonucleotides with similar Kd at
micro molar range affinity, which is considered as low affinity and it could be
non-specific binding. There is a Bmax value indicating the percentage of
70
substrate bound with each Kd obtained. However, MNDA-PAAD only fits to
one site binding model regardless of the different nucleotides used, therefore
the Bmax value for each Kd with each nucleotide is almost 1. Each of the
oligo we used in the experiment are unique in either thymine rich, adenine
rich, cytosine rich, guanine rich, single stranded or duplex, yet their affinity to
MNDA-PAAD are similar. This denotes MNDA-PAAD has no preference to
nucleotides base and single stranded or double stranded, which contrasted to
the result found with EMSA. It is important to note that the two experimental
techniques have essential different pitfall in determining the binding affinity,
which will be discussed in subsequent section. The saturation binding curve of
the tyrosine fluorescence showed a plateau region when above 80% (data not
shown), meaning all of the tyrosines’ fluorescence in MNDA-PAAD have been
quenched. The quenching could be either due to the exposure of tyrosine to
the solvent or another molecule in close proximity to the tyrosine. The
conformational change of MNDA-PAAD upon binding to nucleic acid is further
characterized by NMR and is discussed in subsequent section. However,
IFI16-PAAD was shown to prefer GC rich sequence and has two binding
modes. The calculated Kd and Bmax values for each protein and each
nucleotide is listed in Table 3-3.
71
Table 3-3. The dissociation constant and maximum binding constant from fluorescence quenching experiment.
72
Oligonucleotide Kd (M) Bmax (%)
A25 1.725 ×10-6 ± 0.053 1.117 ± 0.030
T25 1.453 ×10-6 ± 0.091 1.103 ± 0.027
GC-3 (Mut3) 1.470 ×10-6 ± 0.506 1.114 ± 0.036
GC-5 (Mut5) 1.269 ×10-6 ± 0.301 1.108 ± 0.022
AT25 1.804 ×10-6 ± 0.132 1.017 ± 0.025
GC 5-3 1.783 ×10-6 ± 0.120 0.997 ± 0.023
Figure 3.18. Tyrosine fluorescence quenching assay of MNDA-PAAD using individual base enriched sequence demonstrate no preference for nucleotide base.
MNDA-PAAD tyrosines were titrated by (A) A25, (B) T25, (C) GC-5, (D) GC-3 from 0 to 15µM of DNA. The emission peak at 304nm of tyrosine was plotted against the concentration of DNA in each titration and their affinity was analyzed using GraphPad. The insert is the scatchard plot represent the preferential binding mode for each set of oligo.
3.2.5 MNDA-PAAD failed to wrap or stretch ssDNA unlike IFI16-PAAD does using Fluorescence Resonance Energy Transfer (FRET)
FRET was used to assess if MNDA-PAAD has the ability to change
DNA conformation as IFI16-PAAD does (Kush Thesis). 58bp oligonucleotides
that consist of 18bp double strand and 40mer poly thymine overhang was
used in this experiment. The 5’ end was labeled with Cy5 (Quasar670)
73
fluorescence tag and the 3’ poly thymine overhang was labeled with Cy3
(Quasar570) fluorescence tag. A schematic representation of the FRET oligo
is shown in Figure 3.19. The corresponding excitation and emission
wavelength of Cy5 and Cy3 are 650nm 670nm and 550nm 570nm,
respectively. The energy transfer was measured between the donor and
acceptor by exciting the donor at 548nm and recording the emission spectra
at 667nm. A fixed amount of FRET oligo (300nM) was titrated with MNDA-
PAAD in 300 nM increments to a final molar ratio of 20:1 PAAD:oligo. The
poly thymine overhang is flexible so that it could warps around the protein or
extends depending on the ability of the protein. RPA protein has the property
to wrap or stretch the ssDNA it’s binding to; therefore we speculate MNDA-
PAAD as an ssDNA binding protein could also wrap or stretch ssDNA like
RPA. If MNDA-PAAD wraps the poly thymine overhang, the energy
transferred from the donor to the acceptor should increase. On the other
hand, if it’s being stretched, the energy transfer should decrease with the
addition of protein because the distance between the donor and acceptor
increased. The result showed the donor Cy3 energy was quenched in a dose
dependent manner with increasing protein concentration and the energy from
the excited donor was lost with no specific reason (Figure 3.20, Figure 3.21).
It could be that the light energy has changed into other forms of energy such
as heat, which was not measured. Another plausible reason to explain the
decrease in transfer could be the duplex was dissociated from each other,
therefore increasing the distance between the donor and the acceptor. This
hypothesis was later support by the dsDNA melting experiment.
74
Figure 3.19. Schematic representation of the FRET experiment.
18 nucleotides region of the FRET oligo is double stranded and 40 nucleotides are single stranded. The scenario on the left represents packing of the ssDNA (wrapping) and therefore the acceptor and donor come close together and energy can be transferred. The scenario on the right represents extending (stretching) of the ssDNA where the two fluorophores distance increased, hence decreased in energy transfer.
75
Donor (Quasar 570)
Acceptor (Quasar 670)
Acceptor Donor (Cy5)
5.00E+02 5.52E+02 6.04E+02 6.56E+020
1
2
3
4
5
6
7
8
0:11:12:13:14:15:16:17:18:19:110:111:112:1
Emission wavelength (nm)
Fluo
resc
ence
em
issi
on (R
U)
Figure 3.20. Fluorescence resonance energy transfer suggests that MNDA-PAAD does not pack or extend single stranded DNA.
FRET measurements were performed at a constant concentration of 300nM double-stranded oligonucleotide in response to increasing MNDA-PAAD concentration. Total Fluorescence scan at different wavelength and PAAD:dsDNA ratio.
76
0 2 4 6 8 10 120
1
2
3
4
5
6
7
8
donor EM (564nm)
acceptor EM (670nm)
Molar ratio protein : 1 dsDNA
Fluo
resc
ence
em
issi
on (R
U)
Figure 3.21. The maximum emission of the donor Quasar 570 (at 564nm) and acceptor Quasar 670 (at 667nm) is plotted against the molar ratio of MNDA-PAAD reveals no energy was transferred during the titration.
77
3.2.6 PAAD domains are able to destabilize duplex in hyperchromicity assay
Since MNDA-PAAD can bind to double stranded DNA and potentially
destabilize DNA duplex, we tested the ability of MNDA-PAAD to destabilize
DNA duplex by measuring the melting point of a duplex in the absence and
presence of MNDA-PAAD. The duplex used in this experiment was prepared
by annealing 100 M GC5’ and 100 M GC3’ in an annealing buffer. The
spectrophotometer records the hyperchromicity of 66 M dsDNA (dsGC) at
UV 260nm over a temperature range from 20C to 100C. The melting point of
the duplex decreased as more MNDA-PAAD was added and at 5 molar
excess of MNDA-PAAD, the melting point showed a 20 degree depression
(Figure 3.22). This clearly illustrated that MNDA-PAAD has the ability to
destabilize double stranded DNA, which supports the preceding result that
MNDA-PAAD destabilized the FRET oligo (Cy3Cy5 labeled). Nevertheless,
IFI16-PAAD could also destabilize duplex DNA but not as potent as MNDA-
PAAD.
78
20 40 60 80 1000
0.2
0.4
0.6
0.8
1
Temperature (°C)
% U
V260
nm
(x10
0)
Figure 3.22. Melting depression of dsDNA by MNDA-PAAD.
Double strand GC was prepared first by heating to 95°C for 10mins and cool down to 20°C at approximately 0.5°C/min. Increasing MNDA-PAAD was used in each round of melting depression and the Tm of the duplex was 61.5°C without protein. At 5 molar excess of protein, the Tm of the duplex drops to 41.9°C.
3.2.7 The ability to oligomerize from IFI16-PAAD may explain the variations in binding constants and ability to modify ssDNA.
The PAAD domain family was found to be able to form homodimer for
activation. Combining previous results suggests that MNDA-PAAD is able to
bind to ssDNA much like IFI16-PAAD, yet IFI16-PAAD also oligomerize upon
binding to DNA after chemical cross link (Dalal thesis). Here we observed a
small portion of MNDA-PAAD formed dimer after UV-cross linking indicating
the ability to form dimer is retained. However, many DNA binding proteins
79
(regulatory protein) were known not only dimerize, but oligomerize. Therefore
we tested if MNDA-PAAD oligomerize upon binding to nucleic acid by
chemical cross-linking it with T25 and T70. We used formaldehyde as the
cross linker since formaldehyde cross links between the nitrogen atom at the
end of the side-chain of lysine and the nitrogen atom of a peptide linkage. 2
g of MNDA-PAAD was incubated with 1% v/v formaldehyde in the absence
and presence of T25 and T70. The samples were loaded on a 15% SDS
PAGE gel and visualized by silver staining. When MNDA-PAAD is chemically
cross linked in the absence of ssDNA, the dimeric and trimeric form of the
protein showed an increased intensity indicating the protein has been cross
linked into multimeric form. The oligomerization state of MNDA-PAAD in the
presence of ssDNA remains the same suggests that unlike IFI16-PAAD,
MNDA-PAAD does not form oligomers upon binding to ssDNA regardless of
the length of the ssDNA (Figure 3.23).
80
Figure 3.23. Chemical cross linking of MNDA-PAAD to T70.
Protein without cross linker in lane1. Protein with cross linker without ssDNA in lane2. Lane3 has both the cross linker and ssDNA but MNDA-PAAD does not increase its oligomerization state except trimer. M –MNDA-PAAD monomer, D – MNDA-PAAD dimer, Tr – MNDA-PAAD trimer.
81
3.2.8 Critical residues involved in the interaction with ssDNA can be revealed using Nuclear Magnetic Resonance (NMR)
It will be best to know which amino acids in the protein are involved in
the interaction with the nuclei acids. Since the NMR structure of MNDA-PAAD
has been solved, the assignment of the chemical shift on a 1H/15N 2D HSQC
would be a relative straight forward task to do. We uniformly labeled the
nitrogen atoms in the protein with 15N isotope using M9 minimal media. The
labeled protein was purified using his-tag purification and gel filtration as
described previously. We set the reference point of the 2D HSQC on the
Bruker 600MHz using a 15N labeled T4 lysozyme. In the actual 2D HSQC
experiment, 1.7mg/ml (0.13mM) of MNDA-PAAD in 5mM Tris, 100mM NaCl,
pH 8 10% D2O was subjected to 1H/15N 2D HSQC using water flip-back at
25C. Of the 110 amino acids, the cross-peaks of approximately 78 backbone
amides in the 2D spectrum were observed. Most of the peaks are evenly
spread, indicating the protein is folded properly. To determine if any residue in
MNDA-PAAD interacts or in close proximity to nucleic acid when bound, a
titration of the protein with a single stranded DNA was performed and
monitored by a series of HSQC spectra. A different instrument was used in
the titration because of technical issue. Nevertheless, the Varian 500MHz
gave similar 2D HSQC spectra with MNDA-PAAD alone (0.23mM). We
titrated the protein using 0.1 molar ratio of ssDNA (0.023mM) to protein
(0.23mM) as each increment up to 0.4 molar ratio. We selected a shorter
ssDNA, T13, to be used in the NMR titration experiment to minimize the noise
that could be generated during the NMR measurement. The experiment was
82
stopped at 0.4 molar ratio because the protein was denatured/aggregated at
that point. It is clear to see that most of the peaks collapsed towards 8 ppm on
the 1H dimension at 0.4 molar ratio indicating the protein being
denatured/aggregated. A superimposition image of each of the titration 2D
HSQC spectra is shown in . The overall protein conformation is changed after
the second titration and we believed that the protein at that point started to
denature. Nonetheless some peaks remain unchanged after titration and we
highlighted 3 peaks got shifted upon addition of ssDNA. Their orientations are
(1H 6.84 ppm, 15N 123.2 ppm), (1H 7.36 ppm, 15N 116 ppm), (1H 7.51 ppm,
15N 117.2 ppm) (Figure 3.24). The fact that specific amino acid peaks got
shifted indicates it is in close proximity to the nucleic acid added and resulted
with a change of the chemical environment of that amino acid. This
demonstrated that the binding of nucleic acid is specific to certain amino acid
and potentially changed the overall conformation of the protein upon binding.
There could be multiple reasons that contributed to the denaturation of the
protein during the NMR experiment, potentially the addition of ssDNA leads to
destabilization of the protein. To test if the addition of ssDNA caused the
denaturation of the protein, a thermo stability test was performed. Similar to
thermo denaturation as previsouly described, MNDA-PAAD was heated from
20°C to 100°C with equal molar of ssDNA. The melting processed was
monitored by circular dichroism at 222nm (Figure 3.25). In the presence of
ssDNA, the melting point of the protein is 55.9°C and ΔGfolding is -2.47 kcal mol-
1. The protein is slightly less stable in the presence of ssDNA, which affects
the time of the protein to remain soluble in solution. Table 3-4 summarizes the
thermodynamic parameter of MNDA-PAAD in the presence and absence of
83
ssDNA. Although the simplest way to assign the cross-peaks is to reference
to the NMR structure of the protein, yet the chemical shift assignment and the
reference paper has not been published since the structure deposited into
protein data bank in 2006. Despite the lack of resource from the structure, we
decided to perform a 3D 1H/15N TOCSY-HSQC, which would allow us to
assign the cross-peaks on the HSQC to specific amino acid using TOCSY
data. TOCSY allows us to observe the correlations between all protons in a
spin system in space, presumably all the protons of a side chain in each
amino acid and their neighbor protons in the tertiary structure.
84
Figure 3.24. ssDNA T13 binds to specific area of the MNDA-PAAD core module.
Top left: 1H/15N 2D HSQC titration spectra of 0.23mM MNDA-PAAD in 5mM Tris 100mM NaCl pH 8.0 10% D2Oand 25°C. Titration spectra is color coded, where red = no ssDNA added, blue = 0.1 molar ratio of ssDNA added, green = 0.2 molar ratio, purple = 0.3 molar ratio, orange = 0.4 molar ratio. The significantly affected peaks are highlighted and zoomed in on the top right (1H 6.84 ppm, 15N 123.2 ppm), bottom left (1H 7.36 ppm, 15N 116 ppm) and bottom right (1H 7.51 ppm, 15N 117.2 ppm), where their movement are obvious in the first two titration and the movement stopped at the last titration point.
85
10 20 30 40 50 60 70 80 90 100-0.2
0
0.2
0.4
0.6
0.8
1
1.2
Thermal Denaturation of MNDA-PAAD with ssDNA
MNDA PAAD
MNDA-PAAD + T25
Temperature (°C)
Frac
tion
Unfo
lded
Figure 3.25. Thermal denaturation of MNDA-PAAD when ssDNA is added.
The addition of ssDNA to MNDA-PAAD affects the thermostability of the protein slightly. The protein remains a two state unfold mechanism and the thermodynamic parameters are listed in Table
Table 3-4. Thermodynamic parameters of MNDA-PAAD in the absence and presence of ssDNA.
Tm
(°C)ΔGfolding
25°C
(kcal/mol) ΔH (kcal/mol) ΔS (kcal/mol/k)
MNDA-PAAD 58.7 -3.7 -36.7 -0.11MNDA-PAAD + T25 55.9 -2.5 -26.3 -0.08
86
3.2.9 HIN domain of MNDA is potentially another RPA like protein
One of the HIN domains of IFI16 was identified to be an RPA like
protein that recognizes ssDNA better, oligomerizes upon binding, wraps and
stretches ssDNA and have the same binding polarity as RPA (Yan et al.,
2008). We started to characterize the ssDNA binding property of MNDA-HIN
by first asking the question, does MNDA-HIN recognize ssDNA? MNDA-HIN
was expressed and purified in similar fashion as MNDA-PAAD except only
one round of affinity chromatography was done to purify MNDA-HIN. The
purity of MNDA-HIN can be seen in . We verified MNDA-HIN is able to bind to
ssDNA as illustrated by EMSA and UV cross linking. In the EMSA experiment,
32P γ ATP is used to label the same set of oligonucleotides, polydT(25),
polydA(25), Guanine rich 5’ 35mer, Cytosine rich 3’ 35 mer. The titration used
a fixed amount of radiolabeled probe (~10uM) and titrated against a 2 fold
serial dilution of MNDA-HIN from 210mM to 0.83mM. A shifted band is
observed in the first few titration points, where there were enough protein to
form complex with the probe and caused a change in migration in the gel.
This shifting pattern is similar to the EMSA of MNDA-PAAD (Figure 3.27),
which a common problem arose was the complex did not penetrate into the
gel matrix. Therefore we used UV cross linking to assess the complex
formation of MNDA-HIN to ssDNA. As expected, a band corresponds to the
complex molecular weight was observed in the UV cross linking gel. Besides
the formation of complex, MNDA-HIN also formed dimer without UV cross
linking but the portion of dimer increased when MNDA-HIN was UV cross
87
linked. The complex band was observed between the monomer and dimer of
MNDA-HIN, where the intensity of the complex band increased as the amount
of ssDNA increased (Figure 3.28).
Figure 3.26. Purified MNDA-HIN ran in 15% SDS-PAGE gel.
The protein is estimated to have a molecular weight of 26 kDa and a prominent band is observed at the correct molecular weight.
88
Figure 3.27. EMSA of MNDA-HIN reveals the ability to recognize ssDNA.
Each panel represents a set of oligonucleotides used in the EMSA experiment. In all gel, the most left lane contain free probe alone. Protein concentration decreases by half in each lane from left to right starting from 210mM. The shifted band on the top of the gel corresponds to the protein-DNA complex. F – Free probe, C – Complex. (A) polydT25, (B), polydA(25), (C) Guanine rich 5’ 35mer, (D) Cytosine rich 3’ 35 mer.
89
Figure 3.28. UV cross linking of MNDA-HIN to ssDNA confirms the formation of protein-DNA complex.
In all gels, lane 1 represents 2µg (77pmol) of MNDA-HIN without cross linking, lane 2 is MNDA-HIN cross linking without DNA, lane 3-8 represent MNDA-HIN cross linking with ssDNA in 0.1:1, 0.2:1, 0.5:1, 1:1, 2:1, 5:1 DNA:protein molar ratios. (A) polydT(25), (B) polydA(25), (C) Guanine rich 5’ 35mer, (D) Cytosine rich 3’ 35mer. M – Monomer, D – Dimer, T – Trimer, C – Complex,
90
3.3 Directed evolution converge to certain mutations that can change the conformation and stability of IFI16-PAAD
3.3.1 Rationale
The ability of IFI16-PAAD to bind to BRCA1 involved in DNA repair
suggests it involvement in apoptosis and inflammation (Y. Wang et al., 2000),
while analysis of MNDA reveals the interactions with transcription factor YY1
and the promoter region interacts with transcription factor SP1 giving rise to
the myelomonocytic lineage-specific activation. Despite these protein-protein
interactions, the PAAD domains also bind nucleic acid with varying
characteristics. These protein-ligands specificity differences could caused by
the different level of structural integrity of the PAAD domains since the
conformation of a protein is critical for its function. The reasons for the
disordered third helix in IFI16-PAAD are currently unknown. The secondary
structure of a protein may fluctuate and adopt dynamic side-chain interactions
when the protein interacts with other ligands (Daggett & Fersht, 2003).
Therefore explaining the reason that causes the partially folded helix 3 can
consolidate the differences in ability to oligomerize and ssDNA binding
properties of IFI16-PAAD and MNDA-PAAD.
91
3.
3.1.
3.2.
3.3.
3.3.1.
3.3.2 More structured IFI16-PAAD mutants also have higher thermo and chemical stability
3.3.2.1 GFP directed evolution could generate a more helical and stable form of IFI16-PAAD
The plausible explanation of the variations between IFI16-PAAD and
MNDA-PAAD in binding to ssDNA rose from the disordered helix 3 of IFI16-
PAAD. Dalal investigated the structural basis of IFI16-PAAD and determined
the PAAD domain fold by a two state mechanism and undergo different
partially folded conformations when induced by secondary structure promoting
agents such as TFT and SDS (Dalal & Pio, 2006). Dalal previously attempted
to perform GFP directed in vitro evolution to identify a more structured and
stable form of IFI16-PAAD. Dalal generated mutations in IFI16-PAAD through
random PCR mutagenesis and DNA shuffling, followed by fusing the mutants
to GFP in order to assess the increased folding of the mutants (Cabantous et
al., 2005; Waldo, 2003; Waldo, Standish, Berendzen, & Terwilliger, 1999).
Here, we selected several mutants that had the most increased fluorescence
intensity to test their structural and stability properties. The secondary
structure contents of each mutant were assessed by far UV and cdPRO
analysis, the stability of the mutants were obtained by recording their thermal
denaturation and chemical denaturation. The denaturation curves were fitted
92
to a two state unfolding model by linear extrapolation. My work on IFI16-
PAAD directed evolution has bring to a conclusion that mutations (I46N, L28F,
K88E) together generated the most helical content enhancement (% helix =
44.7 ± 4.6) and stable (ΔGfolding25°C = -2.44 ± 0.51 kcal/mol) form of IFI16-
PAAD, on the other hand, mutations (I46N, E15K, L28P) produced the least
stable (ΔGfolding25°C = -0.77 ± 0.07 kcal/mol) and decreased helicity protein
(% helix = 22.9 ± 2.0). These mutations can be seen on the model of IFI16-
PAAD illustrated in Figure 3.29. All other mutations’ thermodynamic
parameter and percent of secondary structure are listed in Table 3-5
Figure 3.29. Model of IFI16-PAAD illustrating the disordered helix 3 and the four mutation positions.
Four mutations generated by random mutagenesis and DNA shuffling tested to have the most significant affect on the structure and stability of IFI16-PAAD are E15 (red), L28 (purple), I46 (brown), K88 (green).
93
Four mutants thought to influence the structure and stability the most
were further tested using chemical denaturation and monitored the CD
spectra at 222nm. ΔGH2O25°C of each mutant was calculated using VanHoff’s
analysis and the Cm and ΔASA value were obtained using the correlation
proposed by Myers (Myers, Pace, & Scholtz, 1995). The interesting
phenomenal observed is that the increased stability and structure mutations
does not lie in helix 3 region, but the neighboring amino acids, namely L28
and I46 could be responsible for the helix propagation by a structural shift.
The thermo and chemical stability parameter of the four mutants are listed in
Table 3-6.
94
Table 3-5. Secondary structure assessment and thermodynamic stability of 3rd round shuffled IFI16-PAAD mutants. The percent helix was calculated by cdPRO with far UV spectra. ΔH, ΔS, and ΔGfolding
25°C were calculated by VanHoff’s analysis of thermal denaturation.
Clone % helix Tm (°C) ΔH (kcal/mol) ΔS (kcal/mol/K) ΔGfolding25°C
(kcal/mol) n Mutation 1
Mutation 2
Mutation 3
4 44.7 ± 4.6 47.80 ± 1.18 -34.80 ± 4.87 -0.109 ± 0.015 -2.44 ± 0.51 3 I46N L28F K88E6 44.2 ± 1.3 44.78 ± 0.75 -29.41 ± 2.64 -0.091 ± 0.008 -1.84 ± 0.18 3 I46N V89E9 44.0 ± 4.3 45.03 ± 2.86 -28.14 ± 2.32 -0.089 ± 0.007 -1.77 ± 0.34 3 I46N A93T8 42.9 ± 0.8 45.18 ± 0.75 -25.60 ± 3.92 -0.080 ± 0.012 -1.63 ± 0.27 3 I46N R96G17 41.5 ± 2.2 46.70 ± 0.90 -26.94 ± 1.65 -0.084 ± 0.005 -1.83 ± 0.18 3 I46N T81A K88E15 41.2 ± 0.9 39.47 ± 1.21 -23.44 ± 2.47 -0.076 ± 0.007 -1.36 ± 0.40 3 I46S R96G
Wild Type 40.4 ± 0.2 42.43 ± 0.50 -27.17 ± 2.50 -0.086 ± 0.008 -1.52 ± 0.12 3 none16 39.8 ± 0.5 33.63 ± 0.88 -27.34 ± 8.95 -0.089 ± 0.029 -0.89 ± 0.20 3 I46S E15K30 39.8 ± 1.0 35.72 ± 0.58 -25.93 ± 5.27 -0.084 ± 0.017 -1.14 ± 0.07 3 I46N E15K22 38.9 ± 0.9 46.74 ± 2.41 -28.32 ± 3.13 -0.089 ± 0.009 -1.94 ± 0.41 3 I46N27 38.6 ± 0.5 43.41 ± 0.99 -24.94 ± 8.10 -0.079 ± 0.026 -1.45 ± 0.44 3 E15K29 22.9 ± 2.0 31.38 ± 0.61 -20.51 ± 1.04 -0.067 ± 0.003 -0.77 ± 0.07 3 I46N E15K L28P
11 20.1 ± 4.2 31.48 ± 2.11 -58.78 ± 56.52 -0.193 ± 0.185 -1.36 ± 1.41 3 I46N R96G I17V
95
Table 3-6. Four mutants determined to influence IFI16-PAAD’s structure and stability the most. ΔGH2025°C of the four selected mutants was obtained
by chemcical denaturation and monitors by CD at 222nm. Cm and ΔASA were calculated by the correlation proposed by Myers (Myers et al., 1995)
Clone ΔGfolding25°C
(kcal/mol)ΔGH20
25°C
(kcal/mol)
Tm (°C) ΔH (kcal/mol)
ΔS (kcal/mol/K)
m (kcal/mol/M
)Cm
(M)ΔASA (Å2)
Mutation 1
Mutation 2
Mutation 3
4 -2.44 ± 0.51 -2.22 47.80 ±
1.18-34.80 ±
4.87-0.109 ±
0.015 -1.12 1.99 1186 I46N L28F K88E
6 -1.84 ± 0.18 -2.26 44.78 ±
0.75 -29.41 ±
2.64-0.091 ±
0.008 -1.12 2.01 1186 I46N V89E
Wild Type -1.52 ± 0.12 -1.75 42.43 ±
0.50 -27.17 ±
2.50-0.086 ±
0.008 -1.7 1.03 3822 none
22 -1.94 ± 0.41 -1.56 46.74 ± 2.41
-28.32 ± 3.13
-0.089 ± 0.009 -0.96 1.6
4 3550 I46N
29 -0.77 ± 0.07 -1.09 31.38 ± 0.61
-20.51 ± 1.04
-0.067 ± 0.003 -0.76 1.4
4 2640 I46N E15K L28P
96
Table 3-7. Summary of the nucleic acid binding properties of MNDA and IFI16.
MNDA-PAAD MNDA-HIN200α IFI16-PAAD IFI16- HIN200α
Binds ssDNA, RNA ssDNA ssDNA, dsDNA, RNA ssDNA, dsDNA, RNA
ssDNA/dsDNA ratio ~1 N/A 10-2~10-1 102~103
Nucleotide types preference No N/A G, C G, C
Binding mode 1 N/A 2 2
Oligomerization No No Yes Yes
wrap/stretch ssDNA No Compact/extend ssDNA compact ssDNA Compact/extend ssDNA
Destabilize dsDNA Yes N/A Yes No
97
4: DISCUSSION
4.
5.
4.1 The variations of structure property of the PAAD domain confer to different stability
There are not many structures of the PAAD domain have been solved
but from the solved structures, PAAD domain can be generally divided into
two group. The first group would have a complete six helix bundle (2DBG,
2HM2) and the second group would have a disordered region (1PN5, 2DO9).
Previously Dalal have used helix inducer such as SDS and TFE to increase
the amount of helical content in IFI16-PAAD (Dalal & Pio, 2006). They have
also compared the thermodynamic parameters of the PAAD domain to
another death domain family, CARD. They found that the PAAD domain is
generally less stable with higher conformational entropy compare to CARD
family members. This is consistent to the fact that some PAAD domains are
partially folded. With the extensive characterization of the PAAD domain of
IFI16 by Dalal, we have decided to characterize another PAAD domain family
member to make a general comparison between them. We chose the PAAD
domain of MNDA because IFI16-PAAD has the highest sequence identity with
MNDA-PAAD (56%) and we would like to know if high sequence identity
correlates with similar structural property, stability and function. In addition,
98
MNDA-PAAD expression level is moderate and the purification difficulty is low
made it less problematic. The structure of MNDA-PAAD shows that it has a
complete six helix bundle, which makes it a perfect candidate to compare the
thermodynamic parameters with IFI16-PAAD. As expected, the secondary
structure assessment and thermodynamic parameters agreed that MNDA-
PAAD has higher helical content as well as higher stability. It is important to
note that after the thermo denaturation of the PAAD domains, IFI16-PAAD is
able to regain its secondary structure when it cooled back to 20°C while
MNDA-PAAD cannot. This suggests that MNDA-PAAD may be trapped in the
unfolded state and other folding elements such as chaperone may be needed
in order to refold its structure. To furthermore characterize the structural
integrity of MNDA-PAAD, we used urea to denature the protein and observed
the change in the intrinsic fluorescence property. The decrease in tyrosine
fluorescence and the blue shift (304nm – 302nm) indicates the protein has
denatured and exposed the tyrosine residue to the non-polar environment
(Yang, Yang, Zhang, Yu, & An, 2007). Although MNDA-PAAD’s structure
seems to be well folded and stable, we tried to enhance its structure and
stability by introducing small molecules such as osmolyte (data not shown).
Osmolyte are small organic molecule that presence in the cell to
protect/promote proteins from denaturation (Bolen & Rose, 2008). The
secondary structure and thermo stability of MNDA-PAAD remain unchanged
in the presence of osmolyte, indicating the protein is well folded in it native
state. On the other hand, IFI16-PAAD’s structure and stability can be modified
by helix promoting agent such as SDS or TFE as demonstrated by Dalal,
99
which agreed with the hypothesis that IFI16-PAAD adopts a disordered region
(helix 3) and therefore has the flexibility to change its structure.
4.2 The nucleic acid interaction property is conserved to another PAAD domain family member, MNDA.
It was hypothesized by Dalal that IFI16-PAAD may have diverged
function in the PAAD domain family as its structure differ from other PAAD
domain family members. Dalal has identified that IFI16-PAAD is a novel single
stranded nucleic acid binding protein as IFI16-PAAD exhibits several ssDNA
binding protein properties which include; higher affinity to single stranded
DNA than double stranded DNA, have nucleotides preferences, packing
(wrapping) of ssDNA, oligomerize upon binding to ssDNA, and destabilize
dsDNA. Surprisingly, these ssDNA binding properties are also known as OB
fold ssDNA binding properties, which these properties are displayed by
protein contains OB fold such as Replication Protein A (RPA). The HIN
domain of IFI16 (α domain) was also identified to be a RPA like protein
exhibiting OB fold binding properties (Yan et al., 2008), yet there are several
distinct differences of the OB fold DNA binding properties between the two
domains. IFI16-HIN (α domain) binds to nucleic acid with higher affinity to
single stranded over double stranded, extends and compact ssDNA, forms
protein oligomers upon binding to ssDNA, and lastly recognizes ssDNA in the
same orientation as RPA. These properties have proven the α domain of
IFI16 is a RPA like, OB fold, nucleic acid binding protein. However, a critical
property is missing from IFI16-HIN (α domain) that RPA has is the ability to
destabilize dsDNA. RPA destabilizes and unwinds dsDNA to the single
100
stranded form during DNA replication initiation (Brosh et al., 2000; Treuner et
al., 1996), a common property that most ssDNA binding proteins has. It is
important to note that the PAAD domain of IFI16 has the ability to destabilize
dsDNA, which provides the missing piece to the α domain to become more
alike to RPA. Therefore the full length of IFI16 would have most of the OB fold
properties along with the ability to destabilize dsDNA to perform its functions,
presumably to assist DNA repair in the BASC complex. It is not known
whether this functional complementation is conserved to the HIN200 family
members that contain both PAAD and HIN-200 domains, therefore we
explored the DNA binding properties of another HIN200 family member,
MNDA, that has not been shown to be involve in DNA repair.
In the case for MNDA, the PAAD domain also exhibits ssDNA binding
properties but quite differ from IFI16-PAAD. MNDA-PAAD does not have
preference to nucleic acid nucleotides, does not prefer single stranded or
double stranded, does not oligomerize upon binding to ssDNA, does not
extend or pack ssDNA, but it does destabilize dsDNA. Here we demonstrated
that two PAAD domains with high sequence identity and similar structure
performed similar function. Both PAAD domains are shown to interact with
nucleic acid and more importantly, the ability to destabilize dsDNA are
consistent with the fact that IFI16 involved in DNA repair and transcriptional
repression (Aglipay et al., 2003). Although there is no evidence showing
MNDA is involved in DNA repair or transcriptional repression, the work I’ve
done with MNDA shed light on how MNDA interacts with nucleic acid and
came to a conclusion that the protein-nucleic acid properties are conserved
between the two PAAD domains with minor discrepancies. As previously
101
mentioned, the amino acid sequence between IFI16-PAAD and MNDA-PAAD
is well conserved, and this conservation in amino acid sequence underlie their
conserved DNA binding property as Luscombe and Thornton have
demonstrated that specific amino acids that interacts with nucleic acid tends
to be well conserved within families (Luscombe & Thornton, 2002). The
differences in binding property are thought to be the cause from their
structural differences, where IFI16-PAAD contains a disordered helix 3 but not
MNDA-PAAD. The disordered helix 3 may generate favorable geometry on
the surface of the protein to form protein-nucleic acid interaction.
EMSA is widely used to detect protein-nucleic acid interaction because
of its simplicity. Protein-nucleic acid complex would cause a shifted band that
migrates differently to the probe but for MNDA, the putative complex migrated
only at most, 2mm into the gel. Protein aggregation can be the cause and this
problem has recently been solved by using a blue native PAGE gel (data not
shown). To verify the existence of protein-nucleic acid complex we used UV
cross linking. UV irradiates thymine to form free radicals and these free
radicals allow for covalent bond with amino acids to generate DNA-protein
cross links (Perrier et al., 2006). The UV cross linking experiment shows
MNDA-PAAD only forms complex with ssDNA but not dsDNA. However,
MNDA binds to dsDNA is an inevitable fact as supported by fluorescence
quenching and dsDNA melting experiment. A plausible explanation to the
failure to detect dsDNA complex with UV cross linking is that the bases in a
double stranded nucleic acids stack together by covalent hydrogen bonding.
Therefore it makes UV harder to irradiate the thymine to form free radicals
and cross link to the protein. The affinity to ssDNA and dsDNA derived from
102
fluorescence quenching experiments concludes that MNDA-PAAD has
roughly the same affinity for both (micro molar range), and the fact that
MNDA-PAAD causes more than 20°C decrease in dsDNA melting point
denote the ability of MNDA-PAAD to bind to dsDNA despite the lacking
evidence from UV cross linking. In fact, the ability to destabilize DNA duplex
can be the cause of the negative result from the FRET assay, which the
energy from the donor did not transferred to the acceptor because the
experimental FRET oligo has been destabilized or separated, increased the
distance of the donor to the acceptor dramatically and the energy can never
be transferred. We rule out the possibility that contamination or aggregation is
the cause of the protein-DNA complex formation by western blot and mass
spectrometry. Moreover, I’ve demonstrated the ssDNA binds to specific region
on MNDA-PAAD by NMR titration. The peaks gradually moved as MNDA-
PAAD being titrated and this gradual movement is a characteristic of fast
exchange, which indicates the ligand’s binding affinity is in the micro molar
range and considered as weak binding (Lian, Barsukov, Sutcliffe, Sze, &
Roberts, 1994). This result is consistent with the finding from fluorescence
quenching experiment as both techniques agree that MNDA-PAAD is weakly
binds to nucleic acid.
During transcription, transcription factor recruits other regulatory
proteins to make up the transcription machinery such as transcriptional
activator or repressor, and RNA polymerase. For example, in yeast, the
transcription machinery compose of RNA polymerase II, transcription factors
II, suppressor of RNA polymerase B mutations and Gal11, each of which has
their own function that contributes to the initiation of transcription (Ptashne &
103
Gann, 1997). The RNA polymerase in eukaryotes does not unwind the DNA
duplex to initiate transcription, instead the transcription factor performs the
duty, specifically transcription factor II H (Lee & Young, 1998; Ptashne &
Gann, 1997). Transcription factors consist of TBP (TATA Binding Protein) and
TAFs (TBP Associated Factors), which the role of TBP is to bind to the core
promoter region including the TATA element and TAFs may assist TBP in this
process in basal transcription, serve as coactivators, function in promoter
recognition or modify general transcription factors (GTFs) to facilitate complex
assembly and transcription initiation (Thomas & Chiang, 2006). Since MNDA
is binding to transcription factor YY1 and only the N-terminal region
(presumably the PAAD domain) of MNDA is require for the enhanced affinity
of YY1 to DNA (Xie et al., 1998), here we provide evidence that MNDA-PAAD
can destabilize/melts double stranded DNA, which in fact may serve as a
general cofactor with transcription factor YY1 during transcription initiation.
Moreover, a recently proposed DNA binding model of the Lac repressor
shows that non-specific DNA binding was a necessary step in order to
position the DNA binding domain for high affinity interaction with the cognate
recognition sequence in the Lac operator (Kalodimos et al., 2004).
4.3 Directed evolution converge to certain mutations that can change the conformation and stability of IFI16-PAAD
This project was initially started by Dalal and the goal was to find
mutations in IFI16-PAAD that could re-order the disordered region. Proteins
require a properly folded three dimensional structure to function, and
mutations that alter the protein structure can be deleterious to the protein
104
function. Generally mutations occur naturally under selective pressure to
enhance the protein activity or stability. However the native conformation of
IFI16-PAAD can be modulated by different chemicals suggests its flexibility in
its helix 3 region (Dalal & Pio, 2006). Here we have identified four amino acid
mutations that have the greatest impact on IFI16-PAAD secondary structure
and stability using a combination of error prone PCR, DNA shuffling and GFP
selection. The generation of IFI16-PAAD mutants DNA library was completed
by Dalal, which my contribution was to verify each mutant’s secondary
structure and stability using both circular dichorism and fluorescence
measurement. The selection of mutants was based on increased fluorescence
intensity of the GFP since fluorescence intensity usually attributes to solubility.
Only 40 brightest colonies were selected and moved into the next round of
mutagenesis to maximize the sample size but remain manageable. The
mutagenesis stopped when the mutations converged towards specific
locations, but it is important to note that none of the mutations lie in the helix 3
region. The four mutations (E15K, L28P, I46N and K88E) identified to have
the highest impact on IFI16-PAAD structure and stability could change the
helix propensity, hence promote a more structured protein. Strikingly that
most of the disorder region prediction software such as Globplot, DISOPRED,
VL3H-Disport, DisEMBL, RONN (See Appendix), have predicted that IFI16-
PAAD contains no disordered helix 3. These data may imply that helix 3 has
the potential to fold into an α helix but is prevented by the lack of entropic
effect. If the disordered helix 3 of IFI16-PAAD is expected to refold into an α
helix, its secondary structure should be similar to MNDA-PAAD. However the
changes of the secondary structure from the mutants are very subtle,
105
therefore helix 3 may not yet refold into an α helix. Instead, the subtle
increase in helical content of mutant 4 can be explained by helix capping. The
N-terminus of helix 1 is very close to the K88E mutation and the negatively
charged glutamic acids may neutralize the helix dipole moment created by the
carbonyl group of the peptide bond, therefore stabilizes the helix. I46N/S is
presented in all of the mutants regardless of increased or decreased structure
and stability suggests the importance of this amino acid. An intriguing
mutation that leads to decrease secondary structure and stability is the E15K.
The positively charged lysine is positioned very close to the C-terminus of
disordered helix 3 and this in fact could form favorable C-terminal helix
capping. However these results suggest that E15K is not improving the
protein structure but deteriorating it, which also indicates that improving
solubility does not always translate into better folded structure. Nevertheless,
a correlation between improving protein structure with enhancing stability can
be seen from both thermo and chemical stability data. In an attempt to
determine if more stable proteins confer higher functional capacity, we
demonstrated that the two mutants with the most improved structure and
stability also destabilize DNA duplex in a greater extent compared to the wild
type. If the preceding speculation of helix capping is true, it also implies that
helix may be important in DNA duplex destabilization.
106
APPENDICES
Appendix A or 1To start every appendix on a new page, modify the format of the style “Head2_no number” to add “Page Break before.” This will leave the heading “Appendices” alone on the page. To make it clear to the reader not to expect additional text on this page, click on the heading, and use format/paragraph to add additional “space before” to this one heading, to lower it on the page. See example of “templates appendices” heading. Try about 204-224 pts of “space before’. Also consider making it “right aligned” instead of left.
To start only later appendices on a new page, use Head2_no number” and use format/paragraph/ to add “Page Break before” to each of the headings, or use page breaks where desired.
Only one Appendix? Then use only the “Appendices” heading, but change it to the singular, i.e. “Appendix”, delete all the instructional text on this page, and start your content on this page.
Appendix B or 2: CD-ROM DataThe CD-ROM attached forms a part of this work.
Data file can be opened with MSExcel or other spreadsheet program. The PDF file
was created with Adobe Acrobat, but may be opened in any PDF program.
Data Files: Ergonomic measurements 10 KB Keyboard Efficiency Measurements 20 KB Interview items – tables and graphs 15 KB
PDFs: Photographs of User A at work, before, after 50 KB Photographs of User B at work, before, after 45 KB
This text asserts inclusion of data in the thesis, under the same authorship, and under the author’s copyright.
Sample text. Provides guidance to reader of how to access data.
Functions as a table of contents to the disk.
Examples of types of lists of content you may need. Provides details of titles of files and functions as a table of contents to the disk.
How to set up a CD ROM Appendix:Standard Appendix headingBrief (no more than one page) title and text indicating ownership, type of disk and what files are on it.
CD ROM label:Title of Thesis, short if necessary, plus word “Appendix”Copyright symbol © Author Name, year.
Delete all these blue Instructional boxes when no longer needed.
1
REFERENCE LIST
Aglipay, J. A., Lee, S. W., Okada, S., Fujiuchi, N., Ohtsuka, T., Kwak, J. C., et al. (2003). A member of the Pyrin family, IFI16, is a novel BRCA1-as-sociated protein involved in the p53-mediated apoptosis pathway. On-cogene, 22(55), 8931-8938.
Bao, Q., & Shi, Y. (2007). Apoptosome: a platform for the activation of initiator caspases. Cell Death Differ, 14(1), 56-65.
Binz, S. K., Lao, Y., Lowry, D. F., & Wold, M. S. (2003). The phosphorylation domain of the 32-kDa subunit of replication protein A (RPA) modulates RPA-DNA interactions. Evidence for an intersubunit interaction. J Biol Chem, 278(37), 35584-35591.
Bochkareva, E., Belegu, V., Korolev, S., & Bochkarev, A. (2001). Structure of the major single-stranded DNA-binding domain of replication protein A suggests a dynamic mechanism for DNA binding. Embo J, 20(3), 612-618.
Bolen, D. W., & Rose, G. D. (2008). Structure and energetics of the hydrogen-bonded backbone in protein folding. Annu Rev Biochem, 77, 339-362.
Bork, P., Hofmann, K., Bucher, P., Neuwald, A. F., Altschul, S. F., & Koonin, E. V. (1997). A superfamily of conserved domains in DNA damage-re-sponsive cell cycle checkpoint proteins. Faseb J, 11(1), 68-76.
Briggs, L. J., Johnstone, R. W., Elliot, R. M., Xiao, C. Y., Dawson, M., Trapani, J. A., et al. (2001). Novel properties of the protein kinase CK2-site-reg-ulated nuclear- localization sequence of the interferon-induced nuclear factor IFI 16. Biochem J, 353(Pt 1), 69-77.
Briggs, R., Dworkin, L., Briggs, J., Dessypris, E., Stein, J., Stein, G., et al. (1994). Interferon alpha selectively affects expression of the human myeloid cell nuclear differentiation antigen in late stage cells in the monocytic but not the granulocytic lineage. J Cell Biochem, 54(2), 198-206.
Briggs, R. C., Briggs, J. A., Ozer, J., Sealy, L., Dworkin, L. L., Kingsmore, S. F., et al. (1994). The human myeloid cell nuclear differentiation antigen gene is one of at least two related interferon-inducible genes located on chromosome 1q that are expressed specifically in hematopoietic cells. Blood, 83(8), 2153-2162.
Briggs, R. C., Shults, K. E., Flye, L. A., McClintock-Treep, S. A., Jagasia, M. H., Goodman, S. A., et al. (2006). Dysregulated human myeloid nuc-lear differentiation antigen expression in myelodysplastic syndromes: evidence for a role in apoptosis. Cancer Res, 66(9), 4645-4651.
2
Brosh, R. M., Jr., Li, J. L., Kenny, M. K., Karow, J. K., Cooper, M. P., Kur-eekattil, R. P., et al. (2000). Replication protein A physically interacts with the Bloom's syndrome protein and stimulates its helicase activity. J Biol Chem, 275(31), 23500-23508.
Cabantous, S., Pedelacq, J. D., Mark, B. L., Naranjo, C., Terwilliger, T. C., & Waldo, G. S. (2005). Recent advances in GFP folding reporter and split-GFP solubility reporter technologies. Application to improving the folding and solubility of recalcitrant proteins from Mycobacterium tuber-culosis. J Struct Funct Genomics, 6(2-3), 113-119.
Choubey, D., Deka, R., & Ho, S. M. (2008). Interferon-inducible IFI16 protein in human cancers and autoimmune diseases. Front Biosci, 13, 598-608.
Choubey, D., & Gutterman, J. U. (1996). The interferon-inducible growth-in-hibitory p202 protein: DNA binding properties and identification of a DNA binding domain. Biochem Biophys Res Commun, 221(2), 396-401.
Choubey, D., & Lengyel, P. (1995). Binding of an interferon-inducible protein (p202) to the retinoblastoma protein. J Biol Chem, 270(11), 6134-6140.
Daggett, V., & Fersht, A. R. (2003). Is there a unifying mechanism for protein folding? Trends Biochem Sci, 28(1), 18-25.
Dalal, K., & Pio, F. (2006). Thermodynamics and stability of the PAAD/DAPIN/PYRIN domain of IFI-16. FEBS Lett, 580(13), 3083-3090.
Dawson, M. J., & Trapani, J. A. (1995). The interferon-inducible autoantigen, IFI 16: localization to the nucleolus and identification of a DNA-binding domain. Biochem Biophys Res Commun, 214(1), 152-162.
DeYoung, K. L., Ray, M. E., Su, Y. A., Anzick, S. L., Johnstone, R. W., Trapani, J. A., et al. (1997). Cloning a novel member of the human in-terferon-inducible gene family associated with control of tumorigenicity in a model of human melanoma. Oncogene, 15(4), 453-457.
Fanning, E., Klimovich, V., & Nager, A. R. (2006). A dynamic model for replic-ation protein A (RPA) function in DNA processing pathways. Nucleic Acids Res, 34(15), 4126-4137.
Fujiuchi, N., Aglipay, J. A., Ohtsuka, T., Maehara, N., Sahin, F., Su, G. H., et al. (2004). Requirement of IFI16 for the maximal activation of p53 in-duced by ionizing radiation. J Biol Chem, 279(19), 20339-20344.
Gariglio, M., Azzimonti, B., Pagano, M., Palestro, G., De Andrea, M., Valente, G., et al. (2002). Immunohistochemical expression analysis of the hu-man interferon-inducible gene IFI16, a member of the HIN200 family, not restricted to hematopoietic cells. J Interferon Cytokine Res, 22(7), 815-821.
3
Goldberger, A., Brewer, G., Hnilica, L. S., & Briggs, R. C. (1984). Nonhistone protein antigen profiles of five leukemic cell lines reflect the extent of myeloid differentiation. Blood, 63(3), 701-710.
Hamilton, T. A., Bredon, N., Ohmori, Y., & Tannenbaum, C. S. (1989). IFN-gamma and IFN-beta independently stimulate the expression of lipo-polysaccharide-inducible genes in murine peritoneal macrophages. J Immunol, 142(7), 2325-2331.
Johnstone, R. W., Kerry, J. A., & Trapani, J. A. (1998). The human interferon-inducible protein, IFI 16, is a repressor of transcription. J Biol Chem, 273(27), 17172-17177.
Johnstone, R. W., Wei, W., Greenway, A., & Trapani, J. A. (2000). Functional interaction between p53 and the interferon-inducible nucleoprotein IFI 16. Oncogene, 19(52), 6033-6042.
Kalodimos, C. G., Biris, N., Bonvin, A. M., Levandoski, M. M., Guennuegues, M., Boelens, R., et al. (2004). Structure and flexibility adaptation in nonspecific and specific protein-DNA complexes. Science, 305(5682), 386-389.
Kay, L., Keifer, P., & Saarinen, T. (1992). Pure absorption gradient enhanced heteronuclear single quantum correlation spectroscopy with improved sensitivity. J. Am. Chem. Soc., 114(26), 10663-10665.
Kim, C., Paulus, B. F., & Wold, M. S. (1994). Interactions of human replication protein A with oligonucleotides. Biochemistry, 33(47), 14197-14206.
Koonin, E. V., Altschul, S. F., & Bork, P. (1996). BRCA1 protein products ... Functional motifs. Nat Genet, 13(3), 266-268.
Koul, D., Obeyesekere, N. U., Gutterman, J. U., Mills, G. B., & Choubey, D. (1998). p202 self-associates through a sequence conserved among the members of the 200-family proteins. FEBS Lett, 438(1-2), 21-24.
Lee, T. I., & Young, R. A. (1998). Regulation of gene expression by TBP-as-sociated proteins. Genes Dev, 12(10), 1398-1408.
Lian, L. Y., Barsukov, I. L., Sutcliffe, M. J., Sze, K. H., & Roberts, G. C. (1994). Protein-ligand interactions: exchange processes and determin-ation of ligand conformation and protein-ligand contacts. Methods En-zymol, 239, 657-700.
Liang, H., & Fesik, S. W. (1997). Three-dimensional structures of proteins in-volved in programmed cell death. J Mol Biol, 274(3), 291-302.
Linding, R., Russell, R. B., Neduva, V., & Gibson, T. J. (2003). GlobPlot: Ex-ploring protein sequences for globularity and disorder. Nucleic Acids Res, 31(13), 3701-3708.
Liu, T., Rojas, A., Ye, Y., & Godzik, A. (2003). Homology modeling provides insights into the binding mode of the PAAD/DAPIN/pyrin domain, a fourth member of the CARD/DD/DED domain family. Protein Sci, 12(9), 1872-1881.
4
Ludlow, L. E., Johnstone, R. W., & Clarke, C. J. (2005). The HIN-200 family: more than interferon-inducible genes? Exp Cell Res, 308(1), 1-17.
Luscombe, N. M., & Thornton, J. M. (2002). Protein-DNA interactions: amino acid conservation and the effects of mutations on binding specificity. J Mol Biol, 320(5), 991-1009.
Luu, P., & Flores, O. (1997). Binding of SP1 to the immediate-early protein-re-sponsive element of the human cytomegalovirus DNA polymerase pro-moter. J Virol, 71(9), 6683-6691.
Magnaghi-Jaulin, L., Groisman, R., Naguibneva, I., Robin, P., Lorain, S., Le Villain, J. P., et al. (1998). Retinoblastoma protein represses transcrip-tion by recruiting a histone deacetylase. Nature, 391(6667), 601-605.
Miki, Y., Swensen, J., Shattuck-Eidens, D., Futreal, P. A., Harshman, K., Tav-tigian, S., et al. (1994). A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science, 266(5182), 66-71.
Myers, J. K., Pace, C. N., & Scholtz, J. M. (1995). Denaturant m values and heat capacity changes: relation to changes in accessible surface areas of protein unfolding. Protein Sci, 4(10), 2138-2148.
Pawlowski, K., Pio, F., Chu, Z., Reed, J. C., & Godzik, A. (2001). PAAD - a new protein domain associated with apoptosis, cancer and autoim-mune diseases. Trends Biochem Sci, 26(2), 85-87.
Perrier, S., Hau, J., Gasparutto, D., Cadet, J., Favier, A., & Ravanat, J. L. (2006). Characterization of lysine-guanine cross-links upon one-elec-tron oxidation of a guanine-containing oligonucleotide in the presence of a trilysine peptide. J Am Chem Soc, 128(17), 5703-5710.
Ptashne, M., & Gann, A. (1997). Transcriptional activation by recruitment. Nature, 386(6625), 569-577.
Thomas, M. C., & Chiang, C. M. (2006). The general transcription machinery and general cofactors. Crit Rev Biochem Mol Biol, 41(3), 105-178.
Trapani, J. A., Browne, K. A., Dawson, M. J., Ramsay, R. G., Eddy, R. L., Show, T. B., et al. (1992). A novel gene constitutively expressed in hu-man lymphoid cells is inducible with interferon-gamma in myeloid cells. Immunogenetics, 36(6), 369-376.
Treuner, K., Ramsperger, U., & Knippers, R. (1996). Replication protein A in-duces the unwinding of long double-stranded DNA regions. J Mol Biol, 259(1), 104-112.
Waldo, G. S. (2003). Improving protein folding efficiency by directed evolution using the GFP folding reporter. Methods Mol Biol, 230, 343-359.
Waldo, G. S., Standish, B. M., Berendzen, J., & Terwilliger, T. C. (1999). Rapid protein-folding assay using green fluorescent protein. Nat Bio-technol, 17(7), 691-695.
5
Wang, H., Ding, B., Liu, C. J., Ma, X. Y., Deschamps, S., Roe, B. A., et al. (2002). The increase in levels of interferon-inducible proteins p202a and p202b and RNA-dependent protein kinase (PKR) during myoblast differentiation is due to transactivation by MyoD: their tissue distribution in uninfected mice does not depend on interferons. J Interferon Cy-tokine Res, 22(6), 729-737.
Wang, Y., Cortez, D., Yazdi, P., Neff, N., Elledge, S. J., & Qin, J. (2000). BASC, a super complex of BRCA1-associated proteins involved in the recognition and repair of aberrant DNA structures. Genes Dev, 14(8), 927-939.
Wei, W., Clarke, C. J., Somers, G. R., Cresswell, K. S., Loveland, K. A., Trapani, J. A., et al. (2003). Expression of IFI 16 in epithelial cells and lymphoid tissues. Histochem Cell Biol, 119(1), 45-54.
Wold, M. S., & Kelly, T. (1988). Purification and characterization of replication protein A, a cellular protein required for in vitro replication of simian virus 40 DNA. Proc Natl Acad Sci U S A, 85(8), 2523-2527.
Xie, J., Briggs, J. A., & Briggs, R. C. (1997). MNDA dimerizes through a com-plex motif involving an N-terminal basic region. FEBS Lett, 408(2), 151-155.
Xie, J., Briggs, J. A., & Briggs, R. C. (1998). Human hematopoietic cell spe-cific nuclear protein MNDA interacts with the multifunctional transcrip-tion factor YY1 and stimulates YY1 DNA binding. J Cell Biochem, 70(4), 489-506.
Xie, J., Briggs, J. A., Morris, S. W., Olson, M. O., Kinney, M. C., & Briggs, R. C. (1997). MNDA binds NPM/B23 and the NPM-MLF1 chimera gener-ated by the t(3;5) associated with myelodysplastic syndrome and acute myeloid leukemia. Exp Hematol, 25(11), 1111-1117.
Xie, J., Briggs, J. A., Olson, M. O., Sipos, K., & Briggs, R. C. (1995). Human myeloid cell nuclear differentiation antigen binds specifically to nucle-olin. J Cell Biochem, 59(4), 529-536.
Xin, H., Curry, J., Johnstone, R. W., Nickoloff, B. J., & Choubey, D. (2003). Role of IFI 16, a member of the interferon-inducible p200-protein fam-ily, in prostate epithelial cellular senescence. Oncogene, 22(31), 4831-4840.
Yan, H., Dalal, K., Hon, B. K., Youkharibache, P., Lau, D., & Pio, F. (2008). RPA nucleic acid-binding properties of IFI16-HIN200. Biochim Biophys Acta, 1784(7-8), 1087-1097.
Yang, Z. C., Yang, L., Zhang, Y. X., Yu, H. F., & An, W. (2007). Effect of heat and pH denaturation on the structure and conformation of recombinant human hepatic stimulator substance. Protein J, 26(5), 303-313.
Zhuang, X., Ha, T., Kim, H. D., Centner, T., Labeit, S., & Chu, S. (2000). Fluorescence quenching: A tool for single-molecule protein-folding study. Proc Natl Acad Sci U S A, 97(26), 14241-14244.
6
May be called “Bibliography.” A bibliography may have subsections, including “Works Cited” (the actual reference list), “Works consulted” (works that influenced your writing but not cited), “Websites Consulted” to list gen-eral website URLs referred to, or described (web documents cited need to be in “Works cited” with their full URL). “Legal Sources,” etc, as cus-tomized to your needs.
This style is “para-refs,” the style customized for references to have a hanging indent, and the space between, plus “Keep lines together” to prevent breaking at the bottom of the page. Keep each reference in a single, whole paragraph, with no “enter” marks between the line, to permit use of Table/sort to sort references alphabetically. The style may be further customized to suit the form prescribed by the manual or recommended by your supervisor or department.
Author, title, publication details, in style of your Discipline. Please consult the manual prescribed or recommended by your supervisor or department, and the Library website for help with referencing. Note, however, that you need not use the line spacing prescribed for raw manuscripts in your final document. For instance, APA requires double spacing, as for all text. This is not necessary in your submission to the library, as this is not a “raw”, but rather a “finished” document (see Chapter 6 of the APA manual).
7
TEMPLATE APPENDICES
By Penny Simpson, Assistant for Theses, SFU Library
A tutorial section you can delete when no longer needed.
8
APPENDIX 1:HELP WITH THIS TEMPLATE IN MSWORD 2007
This template is a very minary “emergency fix” for those working in
MSWord 2007 on a PC, who need reliable numbered headings, and reliable
captions, in particular. MSWord 2007 (MSW07) has a radically different initial
interface and vocabulary from MSWord 2003 (MSW03) which makes the
learning curve frustrating for users. You will need to forget the old ways fast
to avoid fatigue and frustration. My apologies if I have not answered all yor
most urgent questions.
Generally, while the pathways are changed, the functions are present,
if not obvious. In general, you can be confident that while you must
familiarize yourself with one or two layers of icons, after that, the menus and
tools are basically the same, with one or two exceptions. For example, the
styles list is no longer found through a “Format” menu button, but on the
“Home” menu with the word “Styles” listed below some view windows, and the
“More” arrow button reduced in size to be almost invisible. turning yellow
only when your cursor touches it . Also, the sequence for inserting
tables/figures and their captions is reversed.
The user will need to consult the HELP MENU often to find how and
where to access these functions and tools by the new means provided by the
software. For immediate help, you can find links on the Theses office
webpage to Microsoft’s guide to how to find in Word 07 the tools you know in
Word 2003. An online manual is also available now from the SFU Library:
9
Go to SFU Library Catalogue: http://www.lib.sfu.ca/
Author Search by: Wempen, Faithe
Sort by “newest first” and find year: 2006
Find and click title to see full record:
Special edition using Microsoft Office Word 2007
Access online: Click the link for online access
Saving your document
If moving between MSWord 2003 and 2007, please be sure to always
save your document as an MSWord 2003-compatible document, so it can
open easily in both programs without blockages, crashing, or radical shifts in
looks. This can be very important when sharing electronic documents with
your supervisor or team.
Tools in this template
The following text is provided for a quick introduction or refresher in
basic formatting before you start your document. You may wish to retain it
while writing, or alternately, delete this material after a quick review to avoid
too many megabytes in your document. If you find you again need this
material, just click on the template to quickly generate a new document. This
new document will contain all these notes once again.
Tables and figure skills are not addressed in depth here. Styles used
in table and figure placement are explained in
Appendix 5. “Strategies for Figures and Tables” PDF) and workshop notes
are both still useful. A new edition of “Strategies for Figures and Tables” will
be developed in 2008.
10
Getting control in MSWord 2007
View features in MSWord
Margins
To view margins, go to the
“Office” button, Word
Options/Advanced/Show
document content,and tick
Show text boundaries. In Mac
Word, this can be found under
“Word/Preferences.”
Non-printing marks
To check formatting, and to find out why the text in your document is
behaving strangely, it is necessary to be able to review “non printing marks”
such as paragraph breaks and space markers. You may have chosen to keep
these marks invisible while you write, because
they make your page look “busy” or cluttered,
but they seriously affect how text or graphics
behave on the page. Turn on the “Show all” button, found through the Home
menu, Paragraph section. It is in the form of a backward P
Many hard-to-fix glitches are caused by repeat use of empty
paragraphs (repeat hits of the “Enter” key) to create space. They look like
backward “P,” as on the right:
Repeated character spaces, like these , are caused by hitting
the space bar repeatedly, or multiple tabs like this to create
11
space, However, they also make the flow of text unpredictable or inflexible
later. To review and clean out these invisible and frustrating glitches, click the
“Show/Hide” [¶] button on the Home menu bar.
Styles list - making styles visible and accessible
You will be using a variety of preformatted paragraph and heading
styles that will help you maintain consistency of design and spacing
throughout your document, and to save the work of trying to remember the
many choices of spacing, font,
indentation, numbering, etc., etc. every
time you want to use this type of
paragraph or heading. For instance to
create a block style paragraph for
quotations, it is easier to simply click the
preset style called “para_block_quote”
than it is to clean out a regular
paragraph’s line spacing, indentation, and before and after spacing, and make
the many choices to set up a block quote paragraph, every time you want one
of these. How to modify the looks of these styles is found in Template
Appendix 2.
To use the set of preformatted styles, first find, on the Home menu, the
Styles section. There are small box “panes” (small windows) illustrating each
style. More can be seen using the using the pulldown/slider on the right side.
More systematic is the “Styles window” found by using Styles List button to
open and keep open the entire list of styles for this template.
12
Cleaning up a cluttered styles list
Note that in MSW07, this list now permits clustering by use rather than
just alphabetical listing. This has enabled me to manage which styles are
visible, and group the caption styles with the related paragraph styles used
with figures and tables. This is important, as, unlike MSW03, the style list
does not move the recently used styles to the top of the list. This is the way
MSW permits you to group styles. You can
change the sequence, and make other styles
visible, by clicking the “Manage Styles” button at
the bottom of the styles list. Go to the “Recommend” tab to select any styles
you wish from the list and click “show”.
Turn off “Keep track of formatting”
The styles list can be frustrating to search and use because too many
choices are featured in the form of
para plus 12 ptpara plus 12 pt plus italicspara plus 10 pt
These choices result from the
feature, “Keep Track of formatting”
making every transient, manual
adjustment of fonts, paragraphs, etc.
show permanently on the styles list,
even such minor adjustments as
italicizing one word.
13
If you don’t turn this off, it will make the styles list too laborious to use.
Turn this feature off by going to the “Office” icon and then to Word Options
down at the bottom, then: Advanced/ Editing Options to find and untick “Keep
Track of formatting” and OK.
Keeping styles visible in your thesis
Sometimes, if you cut out this Template glossary, SFU template styles
will disappear from the list. This is because you have not yet used those
styles. Just use the Styles Manager” button to go to the “Recommend” tab to
select any styles you wish from the list and click “show”
14
APPENDIX 2: MODIFYING TEMPLATE, DOCUMENT FEATURES, AND STYLES
The aim of this template is to make it as easy as possible for you to
attain a professional quality thesis/project report or essays document, which
matches your career field and discipline. Remember always that your
document is going to be available in full text on the Library website’s
“Institutional Repository” in the form you submit to the library. The Library will
not audit for professional quality of the main body text of your submission.
However, we do offer this template, in-depth instructional and review PDFs,
helpsheets and advising to help you attain that quality.
For reasons of professional quality and personal taste, you may want
to make adjustments of the “styles” and document features in this template.
This is easy to do because the basic “styles” – types of paragraphs -- are
already “built” for you in the template. The looks of each style are easily
adjusted or “repainted” to suit your preferences.
This template, in particular, takes care of most of the requirements we
do audit for (see “Reviewing Your Own” PDF) , as well as providing these pre-
designed paragraphs called “styles” to get you 95% of the way toward a
professional quality document. However, because this SFU Library template
is designed for use by all students in all disciplines, it has to be “middle-of-the-
road” in design, and cannot fit everyone’s needs perfectly. Only you can
accurately evaluate the needs of your final document to attain professional
15
quality presentation of your work in public and for use in your discipline of
career field, and then adjust the template to match.
In addition, personal taste is important in your document. It is quite
common to discover your own evolving sense of design as you write.
Adjustments may also be needed once the textual and graphic content
starts to reshape the basic document. For example, you may need to adjust
styles or single paragraphs, especially captions, to “massage” or squeeze the
contents in the final edition to reduce the number of pages (departments may
care about this; the Library does not) or fit figures and tables better. You are
welcome to adjust the looks of your document by modifying styles and adding
new choices to the styles list for functionality. See also the “Final Tidying”
helpsheet to make adjustments at the end.
Note that if you want a thesis or report style that is highly variant from
this conventional format, please contact the Assistant for Theses early. There
are many precedents for this, so we can assist you in your desire to “push the
envelope” artistically, to accommodate qualitative research styles, or to make
your thesis more resemble journal articles. Please do not depend on past
theses in your department for precedents. These copies may have gone
uncorrected as the Theses Office requires error correction only to the library
and archive copies. In addition, greater evolution of style and formatting may
have occurred in other departments. A search of the SFU Library online
collection called the “Institutional Repository” is a better way to check out
alternate formats.
16
How to make changes quickly, easily, efficiently
The easiest and quickest way to make adjustments is to first click on
an example of the style you want to change. Then open the Styles List,
where that style will be seen in a box. Move your mouse to the right side of
that box to access the down-arrow “more” symbol, click to find the Modify
button, then the format button. Then just choose font, paragraph, or other
features to change the looks of any style. See the illustration below. This can
take less than one minute. Be sure to click the “change the template” radial
button and OK. By doing this, all the paragraphs which share this
designated “style” [sometimes called a “stylesheet”] will change
together.
Examples
Reduce the space-before on “Caption” or the space-after in
“Caption_below_Figures”
17
Add a page break before to Head2_no numbering for use as appendix
headings.
Have different font in the headings, use format/styles, and change the
font in each of the heading styles, instead of changing “Normal.”
If you do not like what you have done, it is just as easy to change it
again. This is quicker, easier, easier to remember, and more consistent than
trying to find and change each paragraph of that type one by one (by one, by
one…) at one minute each.
Modifying fonts and font size
Standard fonts
Arial style is used in this template only because it is easier to read on
screen than Times Roman.
Arial and Times Roman are considered “standard” primarily because
these two fonts are included in all word processing softwares, and are
therefore the most easily transferred without accidental changes (including to
page layout), from one computer to anther. For that reason, Arial or Times
Roman is recommended if you are sharing electronic documents in the draft
stage.
Changing to other fonts
You (or your supervisor) may prefer a different font for working
purposes, or you may prefer a different font for the final edition.
Font choices are shaped by issues of maintaining clarity of the
document, serving the reader, and congruence with content, author, and
author career focus. Note that some fonts are not crisp and clear at small
18
sizes. Be careful of small sizes in the highly condensed fonts which, when
PDFed and microfilmed, smear and become unreadable. Be careful also of
using too complex a font or too many different fonts in one document. Your
goal is to make reading easy and pleasant for the [critical-minded] reader.
Different fonts offer different “looks” and degrees of condensation. See length of word “thesis”. Serif Fonts at 12 pts San Serif Fonts at 12 pts Notes
Thesis: GaramondThesis: SylfeanThesis: Times New RomanThesis: CalifornianThesis: PalatinoThesis: GeorgiaThesis: Book AntiquaThesis: GeorgiaThesis: Lucida BrightThesis: Bookman
Thesis: Arial NarrowThesis: TrebuchetThesis: GautamiThesis: Microsoft Sans SerifThesis: ArialThesis: ShrutiThesis: TahomaThesis: Antique OliveThesis: Verdana
Some fonts cannot be used in small sizes because they are already small and/or highly condensed. Be careful with:GaramondSylfeanArial Narrow
Special functions:computer codeinner voiceraw materialchildren’s voicesraw interview quotes
Special function fonts:Thesis: CourierThesis: MS Reference San SerifThesis: Comic Sans
Try for congruence with dignity, function and content.
Font sizes
Twelve point font size is conventional, but can vary depending on font
styles. Arial, for example appears larger at 12 pts than Times Roman.
To reduce the length of the final edition of your document by about
30%, or just make the whole look more cohesive, use format/styles to change
the “para” style from 12 pt font and double spacing, to 11 pt font and 1.5
spacing. All paragraphs in the “para” style will change together.
19
Smaller font sizes can have “diminishing returns” in clarity and readabilityFont
SizeTimes Roman Garamo
ndTahoma Arial Arial Narrow Gill
SansCommon sizes from standard text size in main body (12 pt – 10 pt)
13 123456 123456 123456 123456 123456 12345
612 123456 123456 12345
6 123456 123456 123456
11 123456 123456 123456 123456 123456 123456
10.5 123456 123456 123456 123456 123456 12345610 123456 123456 123456 123456 123456 123456Small sizes can put data at risk of blurring so reader cannot obtain the information.9.5 123456 123456 123456 123456 123456 1234569 123456 123456 123456 123456 123456 1234568 123456 123456 123456 123456 123456 1234567 123456 123456 123456 123456 123456 123456
A global font change is very easy: Just go to the Styles list then select
the “Normal” style near the bottom of the list, move your mouse to the right
right to see the down-arrow head , click there to find “modify”, and then
select a different font for this global style. Okay and “Add to Template.” Okay.
This will change the font of most styles in the entire document.
If you are only changing the font for working purposes (e.g. when you
differ in taste from your supervisor for onscreen viewing, and need to send
your supervisor an electronic copy). For a print edition, you would also need
to change the “Page Number” and “Hyperlink” and “Followed hyperlink” styles,
to obtain full consistency.
Margins
In brief: Do not modify them.
The margins are unequal, on purpose, and are required for submission
to the library. The wider left margin is needed for hard cover binding. The 1
20
inch on the other sides and the half-inch allowance for the page number
prevent text, running heads, and page numbers being trimmed off in the
bookbinding. The generous left margin also prevents the spine of your thesis
from being broken when others squash your book on the photocopier. The
overall, 6 inch wide text body is the maximum for microfilming.
Metric measurements are as follows:
Margin Location Inches MetricLeft 1.50 in. 3.81 cmRight 1.00 in 2.54 cmTop 1.00 in 2.54 cmBottom 1.00 in 2.54 cmPage numbers and running heads: measure-ment from edge(s) of paper Min. 0.6 in. Min. 1.52 cm
These settings are also designed to allow for variations in paper
feeding and “image shifting” in printers and copiers. These differences
between machines are impossible to predict and control directly. These
onscreen document settings take care of this unpredictability, and save you
worry when you are printing to meet a deadline:
If you are creating documents (such as questionnaires), tables, and
images early in your research or writing process, which will be needed later in
your thesis, be sure to design them to fit the 6 inches
Margin flaws are the #1 flaw that blocks approval for publication of a
thesis, research report or extended essays. It is also the single most costly
error for a student, involving re-printing and copying of all sets of the
thesis/project/ pages in order to correct the error (200 pages x 10¢/page x 5
sets = $100.00).
21
Modifying page orientation
Extra wide figures and tables may need a wider page to accommodate
them. “Landscape oriented” 8.5x11 pages or fanfolded 1x17 pages are
permitted in SFU theses. Legal sized (8.5x14) pages are not permitted
because they cannot be bound into the overall 8.5x11 book size.
Under the “Page Layout” tab, find the “Page Setup” group, and click on
“Breaks” to find the section break. Insert a section break before and at the end
of the pages you wish to re-orient. Then use the other items in the section to
configure the section.
22
APPENDIX 3: HEADINGS
Headings are specialized paragraph styles used to separate chapters,
indicate structure in one’s textual argument or steps, to provide signals of
change of direction in thinking, and set up “breathers” for the reader.
Headings, when featured in the Table of Contents, provide the reader
with an overview of the work as a whole, as well as a topics index to the
pages.
In MSWord, they are used to build that Table of Contents, and provide
clickable navigation aids through a “Document Map.” In MSWord 2007
(MSW07), see the “View/ tab in the “Show/Hide group; tick “ Document
Map”.
General Styling Tips
Headings “styles” in this template all have pre-configured font size,
bolding and “space before” and “space after” so you, the user, does not have
to remember these micro-details to obtain consistency of looks. It is possible
to amend the built-in “space before” by the regular Home/Styles/modify route.
In MSW07 this is found through the Home menu, in the Styles section, click
the arrow . See next page to view the pathway .
Headings also have “Keep with next” and “widow and orphan control”
in the paragraph style (See Home/Styles//Modify/Format/Paragraph/Line
and page breaks) to ensure that any headings will automatically move to the
23
top of the next page to accompany the text it refers to, without needed a
manual page break inserted.
Left aligned headings can be pleasantly inviting with some “space
before” to provide white space above it and prevent it from looking “uptight”
against the top margin. You can use up to 172 points of “space before” in the
design, though 60 pts is more common. Centered Heading 1s are common,
even when other heading levels remain left aligned.
The font of headings are not required to be the same as the body text
font. Both font and font style for headings can be amended, but carefully, to
retain coherence of the whole.
Underlining is not recommended because the reader is inclined to view
more than one underlined word as a block, and thus skip reading it for
content. This template uses bolding for headings, with lower font sizes to
indicate lower levels of subheadings. Indentation or centering is generally not
needed with these configurations, as these tend to make headings less
visible. Automatic numbering can be added to all lower level headings if
desired. Italics would not be used when numbering is present, as this creates
“visual clutter.” However, if numbering is not being used, subheadings can
usefully alternate regular bold and italic bold. Since this can be changed
easily using format/styles so that all headings of the same type (style) will
change together and update together, you can try out a change to see if you
like it, and amend it again as your own sense of style evolves.
24
Example: Heading 1 is in “all CAPS” style. If you do not wish this, go to
format/styles/modify/format/font, and simply UNtick the “All caps” feature. If
Upper/Lower case is preferred,
a larger font size is
recommended (18 pt).
Heading 1 and Head1
also have “page break before”
configured to make page
breaks and section breaks
between chapters, preliminary
pages, reference list, and
appendices unnecessary. Head
1 is configured “based on
Heading 1” and will
automatically adopt any
changes you make to Heading 1, to keep them consistent. Sometimes
MSWord will annoyingly add automatic numbering to “Head 1.” Instructions
for how to remove this can be found below.
Headings may be short or long. If long, it is always better to control
where the line breaks rather than just letting them wrap. This is done by
substituting a “shift-Enter,” a hard line break [ ], for a space following major
punctuation, or in front of any preposition (“of”, “with” “before”) or conjunction
(“and,” “but”). This can aid reading, and prevent headings from looking line a
“roadblock” to further reading.
25
Heading Levels
You may wish to use numbered headings down to Heading 3 or
perhaps Heading 4 (Go to a Heading 1,
format/styles/modify/format/numbering/, then go to /customize for additional
options such as control of tabs.)
You may also wish to use minor, unnumbered headings, which you do
not want to appear in your Table of Contents. It is more useful and labour-
saving to re-configure a lower level of heading for this use, than to just use a
regular paragraph. Using a heading style keeps them consistent, and avoids
the repetitious labour of reconfiguring of an ordinary paragraph. This also
makes them visible in “View/Document Map” (Mac: “View Navigation
pane/Document map”). This is useful for avoiding scrolling, which is hard on
the eyes.
However, if you configure your Heading 1, 2, 3 to be numbered, the
following headings (4-9) will also automatically adopt numbering. This is both
annoying and cluttered. It is easy to remove the automatic numbering from
headings to make them usable as minor headings. Just use format/styles/ to
click on the chosen style, then modify/format/numbering, and select “none.” It
will also be necessary to remove the automatic numbering from all following
headings, down to and including Heading 9, to prevent MSWord from
“correcting” your action.
If you do not wish headings below a certain level to appear in the Table
of Contents, you then can configure your Table of Contents
(Insert/reference/Index and Tables/Table of Contents/Level) to show only the
levels you wish to appear there (commonly Headings 1, 2, and 3).
26
Heading 1 style
Heading 1 (for each new chapter) and Head 1(for preliminary pages
and following matter, such as Appendices and Reference List are good with
60 pts of space before. This prevents these primary headings from standing
tight up against the margin, producing an inevitably “up-tight” look.
Heading 1s may be centered or left-aligned, as preferred. ALL CAPS is
not required, but if Upper/Lower case is preferred, larger font size is
recommended (18 pt). In your table of contents, you may wish to differentiate
the preliminary pages from your main body chapters. This is easily done by
typing the Heading 1 text in ALL CAPS (or applying format/Change
case/UPPER CASE to the text).
Heading 1s may be titled “Chapter” if a thesis or dissertation. Normally
projects do not use the term “chapter” unless in a discipline where literary
styles (as in the MLA stylebook) are the norm. Projects and scientific works
commonly use Heading 1 with automatically numbering without the word
“Chapter.”
Modifying automatic numbering in headings
Using automatic numbering instead of numbering manually has several
advantages. It prevents manual error, updates automatically, and permits the
use of chapter-based numbering of figure and table captions.
Unfortunately, modifying the numbering to suit your own taste has been
made more complicated in MSWord 2007, and I am still working on sorting
this out. I believe it involves a different route to configure automatic
numbering from the route needed to cancel the numbering. Anyone who can
27
figure this out systematically is welcome to let me know at
[email protected] This is what appears, so far, to work:
Clear numbering
It is common to want to clear numbering from headings below the level
of Heading 3. To clear automatic numbering from any level of heading, use
the [now] familiar route to modify styles (review the preceding section), then
go to format/numbering, and select “None.”
Add or change numbering
To add numbering or choose a different style of numbering, try clicking
on the highest level of heading in which you wish numbering, then using the
“Multilevel List” tool in the “Home” tab’s “Paragraph” grouping, and choose the
style of list preferred. If the look you want is not there, try “Define New List
Style”. See the following illustration.
Now note in your styles list that
all headings have probably become
numbered. This may not be entirely
desirable, as you may prefer to have
lower levels of headings without
numbers (commonly starting with
Heading 4 or 5). Go back to the
instructions for “Clear numbering”,
and do this again.
Warning: be sure to repeat this
step with ALL levels of headings
28
following: Headings 5, 6, 7, 8, and 9. If you do not remove the numbering from
lower levels, MSWord, which is engineered to correct for consistency, will re-
impose the numbering on all levels of headings above any numbered heading
style that remains numbered.
29
APPENDIX 4: PARAGRAPHS
The trouble with “Normal”
The most basic paragraph style is “Normal.” MSWord is set up so this
is the standard paragraph style. The problem with this “Normal” style is that it
is too global. If you modify it, say making it double-spaced for use as a regular
paragraph, you will change all headings and all other paragraphs also, which
would create a lot of work to re-configure them all. Thus, “Normal” is much
more useful if left plain, single spaced and un-indented, as this style is what
all other styles are based on. Then, you only change “Normal” if you want to
make truly global changes, like changing the font of the whole document.
This template provides specialized paragraph styles, including for
regular paragraphs.
Regular text paragraphs
In this template, the main body paragraph is “para”; all others are
named “para_something..” They all have functional names so the most tired
writer can remember their specialized use. This is better than trying to
remember “Body text 1”, “Body text indent 2” and “block text” late at night. It
also places them alphabetically in the styles list close to Heading and Normal,
to make it less time consuming to search the style list. All of these styles are
“middle of the road” in design, and may not be perfectly configured for your
material. They can be modified to suit, but try them for a while until you get a
feel for what you want.
30
Paragraph spacing
Main text paragraphs may be double-spaced or one-and-a-half line
spacing. 1½ line spacing is preferred for 11 pt font for better cohesion.
Regular paragraphs may be indented or not. Indented paragraphs
provide white space, which indicates a “breather” for the reader.
You may wish to have both indents and an extra line of space, as these
paragraphs do.
If you do not want indents, you need to provide another “signal” to your
reader that you are beginning a new step in your text. For fully left aligned
paragraphs, provide 12-18 pts or more of line spacing “before” and “after.”
Specialized paragraphs
“Para” – The “regular” paragraph is a specialized style
This “para” paragraph style has been created for use as a standard
format for your text, rather than re-configuring “Normal.” This style will be
automatically generated by hitting “Enter” at the end of any heading. It will
also be automatically generated by hitting enter at the end of some
specialized paragraph styles when this is the logical next step. This is how
styles can be configured to make writing smoother for the user.
If you wish to change a style later, it is easy to again use Format/Styles
to change the configuration, font, or structure of your specific paragraph.
Always click “add to template” to ensure MSWord saves the change. When
you “okay” the changes, all paragraphs of that type will change throughout the
document, instead of your having to do this manually.
31
Other paragraphs and font styles provided by this template
The following common styles have been created for you to start with.
You may not require all of them. See the Format/styles list or the “style pane”
on the menu bar, to view the sample paragraph styles provided. Included in
this template are:
Body paragraphs
“para_block”, for long scholarly quotations. These are single spaced and justified to signal that this is previously published material.
“para_block_special_quote” is designed for those thoughtful quotations you may wish to have just below any heading. This
right-aligned,left indented, italicized design, and its space before and space after, is just a preliminary suggestion. These
“looks”, may be adjusted to your own taste with format/styles/modify. Shift/enter (a hard line break within a
paragraph) can be used to control line length Note also that it has a right tab at the right margin for use with Author name on
the same line
Also: “para_interviewee_quote” for quotations from your
research participants. These are provided with a tab to
accommodate names, and hanging indent for even
alignment. Not justified, so they appear more informal
than scholarly quotes. These are 1.5 line spacing, not
single, as these are original material in your work.
1. “para_numbered” for point form or emphasized text that has a
sequential relationship. An extra “normal” enter mark will be necessary
as a spacer after the end of a group of these paragraphs.
“para_bullets” for point form or emphasized material that is clustered
but not essentially sequential. An extra “normal” enter mark will be
necessary as a spacer after the end of a group of these paragraphs. To
create this single empty space paragraph, just hit enter to create
32
another empty “para_bullet,” then click on “clear formatting” in the style
box.
Figure,table, and caption-related styles
Table [#] “Caption style is provided by MSWord, and has been configured for use ABOVE tables or figures. It has bold 10 pt font , built-in spacing above and below, and tab and hanging indent configurations, all of which can be adjusted to suit your taste.
Figure [#] “Caption_below_figures” is provided for those who prefer the traditional look of differential captions: above tables and below figures. First use Insert/reference/caption to insert the caption, choosing the label “Figure”, where you wish it to appear, and then complete the text. The style automatically created will be “Caption”. Finally, click on this “Caption_below_figures”style to obtain the spacing and other featured needed for a caption below: smaller spacing between the figure and this caption, more spacing between this caqption and the following paragraph, and no “keep with next”. This change-over can also be done with the Edit/Replace function, by searching for all “Caption” styles with the word Figure in them, and replacing them with “Caption_below_figures” with the word Figure in them.
Note: Sometimes, in final editing, to adjust the placement of a figure or table to fit on a page, and eliminate excess white space, a single caption needs to have its “space before” or space after” reduced to help squeeze the whole unit into a page. This adjustment can also be made to the “para_spacer & notes” style How? Use format/paragraph to adjust this.
“para_figure_placement” is for placing graphics “in line with text” without interference by the regular paragraph’s first line indent. Alignment of this paragraph is a personal preference, and should reflect your default (most common) usage. .In this template, it is left-aligned, but if centering is preferred, you can change this with format/styles/modify/. It has “keep with next” configured, and will generate “para_spacer & notes_capt_above” if you hit enter at the end of this paragraph, so that standard spacing is provided after all tables, table notes and graphics, and to keep this figure “glued” to both its caption and its notes, as a unit, so they stay together on one page, or when they have to move to a new page.. See Figures section for how to use this style.
Note: To properly insert graphics, you need to set your configurations so that all graphcs drop into a paragraph, instead of being anchored to a page. This enables you to control the sequential relationship fo the graphic, in relation to its caption, notes and to the text referring to it. See Tools/Options/Edit/Insert pictures box. Choose “inline with text”.
33
“para_spacer & notes_tables&figs_capt_above” is the new specific name for “para_spacer & notes_capt_above”. It is designed for use with either tables ro figures, when the caption is inserted above. It is used after a table or figure when the caption is above) to provide for any notes, citation, or copyright information required. It provides standard spacing after tables and figures and prevents this final part of the table or figure unit from moving to the top of the next page. This allows the text on the next page to start right at the top margin, instead of having unsightly irregular spacing caused by an empty paragraph [enter ¶] mark. This keeps the top page margin consistent in the document. Adjustments to the alignment, space before and after, and font are acceptable in this style. Sometimes, in final editing, a “spacer” paragraph following a table or figure needs to have its “space after” reduced to help squeeze the whole table/figure unit into a page. Use format/paragraph to adjust this when needed.
“para_spacer & notes _figs_capt_below” is the new, more specific name for “para_spacer & notes _ capt_below”. It is used only with figures, when the figure caption is inserted below the figure. It is designed to follow “para_figure_placement,” when notes, such as copyright permission notices, are required between the figure and the caption below it. It is therefore not common, and could be deleted if not needed, and it causes you confusion. This style also has “keep with next” to help keep the figure unit together. To use this style, click so your cursor is after the graphic in “para_figure_placement, hit “Enter” to generate a “para_spacer & notes_capt_above”, then on the format/styles list, click this style. You will see a immediate reduction of the “space after”, so that the figure and caption are drawn closer together.
Reference list style
“para_ref_list” is the new, more specific name of “par-refs”. It is the style for reference list entries. They are single spaced with a hanging indent of .5 inch, and with a bit more than one line of space between, to make extra “enter” marks unnecessary. They have “keep lines together” so a reference do not break at the bottom of a page.
Paragraph styles provided by MSWord
Table [#] “Caption” Style is generated when you use Insert/Reference/Caption to create a caption for a table or figure. If you wish to have chapter based numbering, first ensure that you have automatic numbering in Heading 1, then in Insert/Reference/Caption, click “Numbering” button, to select “include chapter number. Select your preferred punctuation, i.e. 1.1 or 1-1. Repeat this when you insert a figure caption, so that both figures and tables have chapter-based numbers. After inserting the caption (and its number), add the punctuation of your choice after, then ALWAYS add a tab. The tab is needed in the List of Tables and Figures. “Caption” is used for all tables and for all figures when the caption is placed above the figure. It is configured to provide consistent spacing between it and the preceding text, and to allow a bit of space before the table or figure. It is also configured with “keep with next” to stay together with the following table or figure. Sometimes, in final editing, a caption needs to have its “space before” reduced to help squeeze the whole table/figure unit into a page. Use format/paragraph to adjust it.
34
“Caption_add text” is the new name for Caption2, available for use after “Caption” if you wish to have only short phrases in your List of Figures or List of Tables, but also wish to have more extensive descriptive material in the text. Use “Caption” or “Caption_below_Figures” for the text you wish in the List of Tables/Figures. When used regularly, it is recommended that you adjust the “space after” of the “Caption” style to eliminate space between these. If used only occasionally, use “format/paragraph on the individual caption to adjust this. This style has “Keep with next”, and so, if used with the “Caption_below_Figures”, will need the “para_spacer & notes” after it to end the effect of the “keep with next” configuration built into the set of sequential paragraph sytles used with figures and tables.
“Footer” or “Header” styles are never used in the body of a document. They are used exclusively for text in the header and footer (see View/Header and Footer), for such features as running heads. “Footnote text” is never used in the body of a document. It is generated when you use
Insert/Reference/Footnote to create a footnote.1 For notes within the body, such as citations and notes after tables and figures, use “para_spacer & notes”. The style can be modified for a tab and hanging indent and space before and after. Footnotes are traditionally 2 pts smaller than the main text. Do not use first line indent, as it makes it hard for the reader to scan through footnote numbers. The hanging indent can be adjusted (format/styles) to adapt it to two or three digit footnote numbers.
How to create new paragraph styles to suit your needs
You can use Format/Styles to set up any additional specialized
paragraph styles you wish. Example: If you wish to have your paragraphs
following headings and block quotes to have no indent, this can be set up to
work smoothly for you, so that you are “segueing” between styles by just
hitting “enter”.. Note, however, that this is a traditional literary style, not
required in most works today.
1 A typical footnote. This is “Footnote Text” style. Be very careful, when pasting text from other documents into a footnote, to avoid copying the ¶ “paragraph mark” or “enter mark” following the text. This enter mark will bring undesirable and inconsistent formatting into the footnotes, and also create an extra empty paragraph that is hard to get rid of. You can check each footnote for this error. Click on any footnote to check the style name in the window pane at the top of the “format/styles” list or the “style” pane on the menu bar. If this little window does not read “Footnote Text”, fix it by clicking the “Footnote Text” style in the format styles list. If you wish to reconfigure the footnote to include more or less space between, to add a tab and matching hanging indent, or to eliminate the hanging indent, click on a footnote, and use format/styles/modify/format/ to make the changes. Do not add “empty” paragraphs for spacing. This “footnote text” style is configured with “keep lines together” to prevent them from breaking onto the next page. This will not prevent them from moving entirely to the next page, if the insertion of the footnote conflicts with a regular paragraph’s “widow and orphan control” – the need to keep two beginning or end lines of a paragraph together. See helpsheet for more problem-solving tips on footnotes.
35
How to create this new style? First, click in a regular indented “para.”
Go to Format/Styles and click the “New Style” button. It will automatically offer
you a menu with “based on para” already configured. Give your new style a
name. Something with “para” then an underscore and the letter a will place it
immediately after “para” in the list. Consider “para_alternate” for example to
place it immediately after “para.”2 Or or “para_no indent” if you want a clearer
name.
Change “Style for following” to “para” to automatically generate the
indented style by hitting enter at the end, and then configure format/paragraph
to change Indent/Special to “None.” Keep all other configurations the same.
Click “Add to template” and Okay. Click on the new style in the list to apply it
to the paragraph where you have your cursor.
With this style available, you can click on “para_ alternate” whenever
needed. However, a minor time investment will make writing even smoother.
Go to each heading style, and to the box called “Style for following
paragraph.” Scroll down the list to find and click on your new “para_
alternate.” Click “Add to template” and Okay. Go to the “para_block,” and any
other style you want followed with this non-indented “para_ alternate,” and do
the same. With these changes, each time you hit enter at the end of a
heading or a block quote, your non-indented paragraph (“para_ alternate”) will
automatically start, and when you hit enter at the end of it, it will automatically
create an indented paragraph (“para”).
2 Note that you are setting up a “menu” list, so it is helpful to cluster your paragraph styles alphabetically, rather than having to search up and down a list to find the different paragraph styles.
36
This is the kind of design thinking behind all such specialized
paragraph styles and their configurations to make writing easier, not just
satisfy end-product “looks”.
37
APPENDIX 5: TABLES, FIGURES AND CAPTIONS
There is one general, and very positive, change in MS Word 2007 for
working with figures and tables. It is now much easier to control tables or
figures and their captions, keeping them together while also “anchoring a
table or figure relative to a page so that text can wrap around it. However, a
significant change of sequence in steps is necessary from the instructions
given in “Strategies for figures and tables. A new edition of “Strategies for
Figures and Tables” will be developed in 2008.
Instead of inserting the caption first, it is necessary to insert the table or
figure first. This can now be found under the “Insert” tab. The default
configuration is “in line with text”. If you wish to change this in order to anchor
the table or figure, now is the time to change this configuration ((through right
mouse/ table properties or right mouse/format picture/layout/square, or other
choice). Then, to add the caption, click on the corner (upper left symbol of a
table) to highlight the entire item, and only then go to the “References” tab to
find “Insert Caption”, and follow the instructions. Note that you need to make
the choice to place it above or below.
If you have previously chosen” in line with text”, the caption will be
inserted to suit, while if you have chosen to change the layout to anchor it on
the page, the caption will also be automatically inserted in a “frame” to match.
Unlike previous versions of Word, where if you used a text box for the caption,
it would not be picked up by the List of Figures, this problem is solved through
38
this automatic use of “frames”, so it now appears to be reliable to anchor
figures (or small tables) together with their captions, and have text wrap
around them.
The problem of having in text reference to these figures or tables is not
resolved, so I still recommend “in line with text” as the easiest way to control
the relationship of your body text to these tables or figures, but if you wish to
venture into this more sophisticated design, it is less painful to do so.
Treating “Table Grid” – the default table setup – as a “style”
When you insert a table in this template, the default table style is
indicated as “Table Grid”. If you wish, you can change the default table style,
or choose a onetime use table style, by going to Table/insert/table, and
clicking the autoformat button to find a list of pre-configured table styles. Just
remember to choose one that will print clearly. It must meet the graphics
quality standards for submission to the library.
Professional tip: consistency in tables throughout the document is
appreciated by readers. However, different styles can be used judiciously, to
signal to the reader that there is a significant difference in the data you are
presenting. For example, simple tables, like “Table Grid” or “Table
Professional” with its white-on black heading row, are good for numeric data,
while “Table Contemporary”, with alternating grey and light grey rows is
excellent for textual tables.
39
These table styles,
once used or set as the
default, are included on the
Format/styles and
formatting sidebar, at the
bottom of the alphabetical
list. Like any paragraph or
heading style, a table style
can be modified to suit your
own tastes. Modify by
going to Format/Styles and
formatting, find the table
style, and go to “modify” to
open the choices box. Note
how much more extensive
the choices are than for
paragraphs. Explore the “Apply formatting to” window, to see how you can
center or bold some rows or columns, but not others. You can adjust the text-
to-lines placement (top, centre of cell, or bottom); change the font and
borders, add tabs such as decimal tabs to align numeric data, and adjust the
table properties such as centering on the page. And much more. Experiment
with these choices. Once configured, these choices will be automatic each
time you insert a table of that style.
Tip: Make one change at a time, and always tick the “add to template”
button. If the change does not happen, go back and do it again, taking care to
40
click on the icon, rather than the text, representing your choice. MSWord can
be a bit cranky about this, but setting your general preferences for all your
tables is an excellent labour (and memory) saver. Avoid over-customizing to
any single table, as you may find yourself manually adjusting too many other
tables.
A default font style for tables
One of the common complaints in MSWord is that too much work is
needed to configure the fonts in tables. This is particularly true if you have
clicked in a specialized paragraph to insert a table, because the table will
promptly adopt the font size and paragraph (including spacing) configurations
of that paragraph within the table, leaving you to clear all that before you can
add your data. Merely using “clear formatting” before or after inserting the
table is not adequate, as this will leave the table with the standard font size of
the “Normal” style, which is usually too large. This “Normal” font size persists
even though a table style may have a better font size pre-configured.
For these reasons, this template edition has a new style called “table
font size_style”. Feel free to modify this style to the font and font size you will
most generally want in your tables.
Then, when inserting a table, first hit “enter” to create a new paragraph,
change the paragraph to “table font size_style”, then use the Table/Insert
table steps to insert the desired table. You can also see that you can apply
the style to a set of tab-delineated data you also wish to turn into an MSWord
table, before using the Table/convert/text-to-table tool, or apply it to an Excel
table you have pasted into the document.
41
Finally, to customize any one table, feel free to modify it with table/
tools and the format/font, /paragraph and other manual tools to fit the data-set
to the page.
42
