58
What’s does the cancer genome look like and what might we be trying to find? Department of Pathology and CRUK Cambridge Institute, University of Cambridge Paul Edwards

What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

  • Upload
    others

  • View
    5

  • Download
    0

Embed Size (px)

Citation preview

Page 1: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

What’s does the cancer genome look like and

what might we be trying to find?

Department of Pathology and CRUK Cambridge Institute, University of Cambridge

Paul Edwards

Page 2: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

1. How does cancer develop?

Page 3: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Development of a cancer

NormalCell

SlightlyAbnormal

MoreAbnormal Malignant

Gene changes

Page 4: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Development of a cancer

NormalCell

SlightlyAbnormal

MoreAbnormal Malignant

Gene changes mutations + epigenetic change + viruses

all kinds of and mobile elements

Page 5: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Development of a cancer

NormalCell

SlightlyAbnormal

MoreAbnormal Malignant

Gene changes

Cancer develops in multiple stages

Some stages can be seen

Page 6: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Colon/rectum cancer: malignant

Precursor

Malignant

Page 7: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Development of a cancer

NormalCell

SlightlyAbnormal

MoreAbnormal Malignant

Gene changes/mutations

accelerated by Genetic Instability

?

?

Page 8: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

chromosome instability ‘CIN’

chromosomes stable

Tumour A

Tumour B

Sequence instability 100X rate sequence mutations

Sequences (nearly) stable

Many different types of Genetic Instability

Page 9: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

How could genetic instability come about?

Sequence instability

chromosome instability

Failure to repair DNA damage √ √

Errors in replication or mitosis √ √

e.g. mismatch repair

e.g. lagging chromosomes

e.g. polymerase epsilon mutant

e.g. BRCA1, BRCA2

......and there is probably Epigenetic instability as well e.g. DNMT, IDH mutations

=> Genetic instability may determine the pattern of mutation and be a target for therapy, so it’s one of the things we can look for

Page 10: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

NormalCell

SlightlyAbnormal

MoreAbnormal Malignant

Gene changes / mutations

Genetic Instability

OR

hereditary predisposition

• •

NOT QUITE

Page 11: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

NormalCell

SlightlyAbnormal

MoreAbnormal Malignant

ABCDABCA

Gene changes

Passengers versus Drivers

AB Y

Z

α β γ

X X X X Y Y Y Z

Z

α α γ

Random “passenger” mutations

Page 12: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

We usually distinguish gain of function and loss of function mutations: Oncogenes and Tumour Suppressor genes

Definitions vary but one is:

Oncogene mutations are overactivity mutations - dominant in the cell, I.e. only one copy mutated Tumour Suppressor Gene mutations are loss of function mutations

- generally both copies are mutated, recessive in the cell

Page 13: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Oncogenes versus Tumour Suppressor Genes Normal Abnormal

Somewhat Abnormal

Oncogene

Tumour suppressor gene

Tumour suppressor genes, e.g. p53

classic

some

Page 14: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Tumour Suppressor Genes – loss of two copies often results in loss of heterozygosity “LOH”,

i.e. region around tumour suppressor becomes homozygous

Tumour suppressor gene

2 mutations

loss of normal

copy mutant region

loss of

heterozygosity “LOH”

Page 15: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

2. What do cancer mutations look like?

Small-scale changes

Large-scale changes

Sequence changes, e.g. TCGAGCTATGTGTCTCTAGGTCGGT

TCG

TCGAGCTATGAGTCTCTAGGTCGGT

STRUCTURAL changes

- Deletion - Duplication, Tandem or Foldback

- Amplification (lot of copies of gene)

- Inversion

- Chromosome translocation

- Mobile element insertion

Page 16: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Duplication and amplification

‘Amplified’ gene

Gene e.g. EGFR

EGFR EGFR EGFR EGFR EGFR EGFR

Tandem Duplication Fold-back Duplication

Page 17: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Duplication and amplification

‘Amplified’ gene

Gene e.g. EGFR

EGFR EGFR EGFR EGFR EGFR EGFR

Tandem Duplication Fold-back Duplication

Page 18: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Chromosome translocation

OR

reciprocal translocation

unbalanced translocation

Page 19: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Mobile element insertion

LINE-1 (L1) element

mRNA AAAAAAAA

transcription

reverse transcription, integration

AAAAAAAA

genome

copy of L1 inserted, variable

AAAAAAAA

AAAAAAAA

AAAAAAAA

Page 20: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

L1 transduction looks like multiple translocations

Chr 22 TTC28

Page 21: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

L1 transduction looks like multiple translocations

Chr 22 TTC28

unique sequence downstream of L1

Page 22: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

L1 transduction looks like multiple translocations

Chr 22 TTC28

unique sequence downstream of L1

Page 23: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

2. What do cancer mutations look like?

Small-scale changes

Large-scale changes

Sequence changes, e.g. TCGAGCTATGTGTCTCTAGGTCGGT

TCG

TCGAGCTATGAGTCTCTAGGTCGGT

STRUCTURAL changes

- Deletion - Duplication, Tandem or Foldback

- Amplification (lot of copies of gene)

- Inversion

- Chromosome translocation

- Mobile element insertion

Page 24: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

3.Methods available

Page 25: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

3.Methods available

Sequencing: PCR+Sanger, Illumina, long-read methods Cytogenetics FISH Chromsosome sorting Arrays: CGH, SNP arrays (mainly copy number counting) Mapping, HAPPY mapping and 10X Epigenetics: bisulphite sequencing

Page 26: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Metaphase chromosomes

Page 27: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic
Page 28: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Philadelphia chromosome

Page 29: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Philadelphia chromosome

9

22 22:9

9:22

(reciprocal) chromosome translocation t(9:22) of chronic myeloid leukaemia, creates BCR-ABL

Page 30: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Pandis et al (1998) Genes Chromosomes Cancer 22, 122

Breast Cancer Karyotype, from primary culture

Page 31: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

100kb bitOf Chr 2includingN-MYC gene

Amplification of N-MYC

‘ FISH’ fluorescence-in situ hybridisation

Page 32: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

100kb bitOf Chr 2includingN-MYC gene

Amplification of N-MYC

Chr 12

‘ FISH’ fluorescence-in situ hybridisation

Page 33: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

One copy N-MYC

‘Amplification’ of N-MYC

Hundreds of copies

Mira Grigorova

Page 34: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

‘ FISH’ fluorescence-in situ hybridisation

chr2

chr3

Joanne Davidson

Page 35: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Joanne Davidson

‘SKY” or ‘M-FISH’

Page 36: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Breast Cancer Cell Line HCC1143

Mira Grigorova

Page 37: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Fibre-FISH

BAC ABAC B

Genome sequence

Page 38: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

HCC1187

36 peaks sorted

Chromosome sorting and Array Painting

Karen Howarth

Amplification Hybridise to

genomic DNA array

Array painting scheme

Page 39: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Copy number by hybridization: CGH

Hybridise to genomic DNA

array

Normal DNA Tumour DNA

Page 40: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Search for deletions and amplifications: measure copy number

Num

ber o

f cop

ies

Genome position

glioblastoma

Deletion P16/CDKN2A/INK4A

Amplification EGFreceptor (ERBB/HER-1)

2 1 0

Page 41: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Search for deletions and amplifications: measure copy number

Num

ber o

f cop

ies

Genome position

glioblastoma

Deletion P16/CDKN2A/INK4A

Amplification EGFreceptor (ERBB/HER-1)

2 1 0

Also must be a structural variant

at copy number step

log2 ratio = copy number divided by average copy number

0 2 4

Page 42: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Mapping approaches

Page 43: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

HAPPY mapping, also 10X, GAM

Page 44: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

4. More on rearrangements:

Fusion genes

Page 45: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Chromosome translocation: classic source of fusion genes

translocation

beginning of gene A end of gene B

Page 46: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Philadelphia chromosome

9

22

22:9

9:22

Creates BCR-ABL fusion

Page 47: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

There are fusion genes in common epithelial cancers (not just leukaemias)

TMPRSS2-ERG ~50% prostate cancers

Chr. 21

TMPRSS2- ERG fusion

Deletion

ERG TMPRSS2

promoter only (intact) transcription factor

Page 48: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

BRAF KIAA1549

duplication

Astrocytomas

KIAA1549 BRAF KIAA-BRAF

About 2 Mb

Genome direction is reversed to make it easier to unserstand, both are -ve strand genes

Tandem duplications causing gene fusion of BRAF

Page 49: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

chr A

gene X gene Y

1 2

Fusions aren’t the only consequence of interest!

chr B

Most often, genes are simply disabled

Page 50: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

chr A

chr B gene X gene Y gene Z

1 2 2 1 1 2

Fusions may not be immediately obvious, e.g. ‘Run-through’ Fusions*

1 2 2 3 4 5Fusion transcript

Page 51: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

chr A

chr B gene X gene Y gene Z

1 2 2 1 1 2C

Fusions may not be immediately obvious, e.g. ‘Run-through’ Fusions*

cryptic exon

1 2 2 3 4 5Fusion transcript

Fusion transcript C1 2 2 3 4 5

Page 52: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

chr A

chr B gene X gene Y gene Z

1 2 2 1 1 2

Gene X broken but RNA transcription will continue until a polyA site encountered Cannot splice into the exons of gene Y as they are in the wrong orientation but splicing into exon 2 of gene Z will often be successful and create an X-Z fusion, Exon 1 of gene Z will not be in the fusion as first exons do not usually have splice acceptors not uncommon for additional unknown cryptic exons such as C to be spliced in Note that there might be a fusion in the oposite orientation, beginning at gene Y

C

Fusions may not be immediately obvious, e.g. ‘Run-through’ Fusions*

X – Y fusions 1 2 2 3 4 5

C1 2 2 3 4 5

cryptic exon

chr A

chr B gene X

gene Y gene Z

1 2 2 1 1 2C12

gene Q!

1 2Y-Q fusion

Page 53: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

4. More on rearrangements:

Rearrangements are often complex

•  Shards•  Fragile sites•  L1 insertions in rearrangement junctions•  Breakage-fusion-bridge cycles•  Chromothripsis•  Kataegis

Page 54: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Shards

sequence J 700bp

gene Y

Deletion about 6okb

7kb

Rearrangements often have small fragments inserted into the junctions, from somehwere else, e.g.

Alsop et al, Genes Chromosomes Cancer, 2008

copy of J inserted into deletion junction

copy

Page 55: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

CommonFragileSitesSites in the genome which are prone to breakage in cells under ‘replication stress’ Debatisse et al: regions with few replication origins High density of rearrangements in the region, not clear whether passengers or not

Page 56: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Breakage-fusion-bridgecycles(BFB)

•  oneoftheknownmechanismsofamplificaDon

chromosome breakage -> joining of chromatids -> dicentric chr. -> breaks again

A B C D

B C D

B C

C

-> repeated fold-back duplications, amplification of region C

Page 57: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Chromothripsis•  ShaEeringandrepairofachromosome

–  orregionsof(a)chromosome(s)

Wikipedia

shattering

repair of some bits in random order

Page 58: What’s does the cancer genome look like and what might we be …... · 2018-01-21 · What’s does the cancer genome look like and what might we be trying to find? ... => Genetic

Kataegis•  ClusterofSNVs,someDmesclosetoarearrangement

Kataegis rainfall plot from Nik-Zainal et al Cell 2012

how

clo

se n

eigh

bour

ing

mut

atio

ns a

re, l

og s

cale