Personal Genome Project Study Guide Personal Genome Project Study Guide Personal Genome

Personal Genome Project Study Guide

Welcome to the Personal Genome Project StudyGuide Website

Here you will find lessons and practice tests to helpyou pass the Personal Genome Project (PGP) entranceexam. The PGP is a project from Harvard MedicalSchool.

In 2001, the Human Genome Project published aworking draft of the human genome sequence, thusproviding unprecedented advances in our knowledge ofhow a human works.

The PGP makes sequencing personal. Just like thepersonal computer brought information technology toindividuals, the PGP brings DNA sequencing toindividuals. To enroll in the project, participants mustpass an entrance exam. The Alan and PriscillaOppenheimer Foundation developed the PersonalGenome Project Study Guide to help people pass theexam.


The Personal Genome Project (PGP) is a project fromHarvard Medical School that is sequencing key piecesof the DNA of its volunteers and publishing the resultswith extensive information about the volunteers' traitsand medical history. The data are being made available on the Internet sothat researchers can test hypotheses about therelationships among genes, traits, and environment.Harvard hopes to enroll 100,000 participants from thegeneral public in the project. To enroll, participants must pass an entrance examthat tests basic genetics literacy, informed consentexpertise, and knowledge about the rights andresponsibilities of human research subjects.


The goal of this study guide is for you to pass thePGP entrance exam so that you can give trulyinformed consent to participate in the PGP.

The entrance exam has six major topics. The studyguide has a part for each of those topics. Click on apart button to the left to study the topics. Each parthas one or more lessons and practice tests.

It is recommended that you study the parts in order,but that's not absolutely necessary. If you alreadyknow some of the subjects, for example, you couldskip ahead.

http://www.personalgenomes.org/

http://www.oppenheimerfoundation.org/



Question: Where do I take the actual PGP entranceexam?Answer: Information about registering for the actualexam is available here.

Question: What is the passing score for the entranceexam?Answer: As of this writing, the passing score is100%.

Question: Where can I find more information aboutthe policies and procedures of the PGP?Answer: More information is available here.

Question:How many questions does the entranceexam have?Answer: About 60

Question: What types of questions are on theentrance exam?Answer: Multiple-choice, matching, and true/false.Most of the multiple-choice questions are the classictype that you probably remember from school whereyou had to select one correct answer out of choices A,B, C, and D. In some of the multiple-choice questions,however, you may be asked to select multiple correctanswers.

Question: Why do I have to take an exam toparticipate in the PGP?Answer: The PGP takes informed consent veryseriously and believes that an exam is the best wayto ensure that you have the knowledge necessary tounderstand the benefits and risks associated withparticipating in the project.

Question: I missed a question on a PGP Study Guidepractice test, but I think I should have gotten it right.Where can I send feedback regarding the study guide?Answer: You can send feedback to pgpstudy atoppenheimerfoundation dot org.


For questions about the study guide, or to send feedbackabout the study guide, please send email to:

pgpstudy at oppenheimerfoundation dot org

For questions about the PGP, please send email to:

general at personalgenomes dot org

For questions about the Alan and Priscilla OppenheimerFoundation, please send email to:

info at oppenheimerfoundation dot org

http://www.personalgenomes.org/participate.html

http://www.personalgenomes.org/howitworks.html


The Personal Genome Project Study Guide wasdeveloped by a set of dedicated professionals onbehalf of the Alan and Priscilla OppenheimerFoundation.

The Foundation would like to thank the PersonalGenome Project of Harvard Medical School, andespecially Jason Bobe, for the opportunity to work onthe project. The Foundation would also like to thankKathleen Page, Joan O. Weiss, Grace Richter, LindaSturgeon, and many others who provided valuableadvice and support.

All writing Copyright (c) 2009 Alan and PriscillaOppenheimer Foundation


Kathleen Page, Ph.D., is the author of the bulk of thelessons in the Study Guide. Dr. Page earned her B.A.in 1978 from the Department of Biochemistry,University of California, Berkeley; her M.A. in 1981from the Department of Biological Sciences, Universityof California, Santa Barbara; and her Ph.D. in 1988from the Department of Microbiology andImmunology, University of California, Los Angeles.

Dr. Page's current research interests involve theisolation and identification of bacteria associated withenvironmentally-damaging acid mine drainage.


Joan Oppenheimer Weiss, M.S.W., is the author of theGenetics and Society lessons.

Ms. Weiss was the founder of the Genetic Alliance andis co-author of "Starting and Sustaining GeneticSupport Groups", The Johns Hopkins University Press,1996.

http://thepersonalgenome.com/about/

http://hms.harvard.edu/


http://www.oppenheimerfoundation.org/

http://www.amazon.com/Starting-Sustaining-Genetic-Support-Groups/dp/0801852641/

http://www.geneticalliance.org/


Priscilla Oppenheimer is the Executive Editor for the StudyGuide and the author of the Project Literacy lessons.

Ms. Oppenheimer works in the computer networking field asa consultant and instructor, and is the author and co-author of five books on computer networking.

Ms. Oppenheimer earned her M.S. in Information Sciencein 1980 from the University of Michigan and is intrigued byDNA because it's information technology for nature.


Grace Y. Richter, Ph.D., edited and reviewed the lessonsand practice tests. Dr. Richter earned her B.A. in Biology in1986 from Reed College and her Ph.D. in Biology in 1995from Oregon State University. She currently works for LifeTechnologies in Eugene, Oregon.


Linda Sturgeon was the Website Designer andComputer Programmer for the Study Guide. Ms.Sturgeon earned her B.S. in Computer Science in 2007 from Southern Oregon University.

Ms. Sturgeon has over 20 years experience working inthe 3D animation/special effects (games/film),multimedia, publishing, and advertising industries. Sheis the owner of Sturgeon Advertising, located in

http://www.sturgeonadvertising.com/

Southern Oregon.


Part I: Genetic Material


Part I: Genetic Material Lesson 1: Introduction to Cells, DNA, and Genes

Upon completion of this lesson, you will be able to:

Recall that genetic information is stored in DNAExplain that different cell types have differentfunctions because different genes are active indifferent cellsRecall that DNA resides in every cell's nucleusRecall that some DNA resides in a cell'smitochondriaExplain the relationships among DNA, genes,and chromosomesExplain, in general terms, that genes play a rolein determining traits and inherited diseases



The human body consists of trillions of cells. How dothose cells know what function to carry out for yourbody?

Each cell has programs encoded in its DNA. Theprograms are sets of genes that become activated indifferent cell types (such as muscle cells versusnerve cells). These programs are permanentlyembedded in cells, but their activity can be turnedup or down according to a person's age, lifestyle,and environment. The programmed information ingenes is so critical that slight changes in genes canlead to inherited diseases, or make us more inclinedto develop some diseases.


Part I: Genetic Material Lesson 1: Introduction to Cells, DNA, andGenes

Different sets of genes are active in different celltypes. Although your muscle cells and nerve cellscontain the same DNA sequences, they activatedifferent sets of genes to give them differentfunctions. Each cell type runs different programs.Muscle cells activate the genes needed to makemuscle fibers. Nerve cells activate the genesneeded to make neurotransmitters and connectionswith other nerve cells.

Muscle cell

Nerve cell



Different sets of genes are active during differenttimes of a person's life. The human body develops

from the time of fertilization to old age. The changesthat occur in our bodies as we develop are often dueto changes in gene activities that are regulated by ourstage of development. This is known asdevelopmental gene regulation. Different sets ofgenes are turned on and off as we develop and age.For the most part, the genes themselves remainconstant.



Sets of genes encode cellular programs, also called cellular activities. Genes are made of DNA. DNA is theabbreviation for the chemical deoxyribonucleic acid. DNA is a very long molecule. It looks like two strandswrapped around each other, resembling a twisted ladder or double helix. DNA is coiled into chromosomes,found in the nucleus of every cell. There is also a little bit of DNA in another part of cells, organelles calledmitochondria.



Mitochondria are tiny, almost cell-like structures inthe cytoplasm of cells. Mitochondria produceenergy for cell functions. They have a smallamount of DNA in the form of mitochondrial genes.

Only a tiny fraction of human DNA is found inmitochondria. Mitochondrial DNA is transmittedonly from mother to child, because the child onlyinherits its mother's and not its father'smitochondria. Mutations in the mitochondrial DNAsequence can be used to determine maternallineage.



The vast majority of a cell's DNA is within thenucleus, a large compartment that containschromosomes and enzymes needed for the functionof DNA as a cellular blueprint. In the nucleus, DNAcan be copied into more DNA or copied into RNA, amolecule that carries DNA's programmedinformation outside the nucleus for the purpose ofmaking the proteins needed for cellular activities. Each gene is a section of DNA that has theinformation needed to make a protein.



Genes play a role in human disease. Some diseasesare caused by a mutation (an alteration) in the DNAsequence of a single gene. In these cases a singleprotein is altered, and that is enough to causedisease. Some diseases are caused by infection ordamaging environments. Many diseases havecomplex causes that involve multiple geneticmutations and/or environmental factors. Musculardystrophy is an example of a disease caused by amutation in a single gene. Asthma is an example ofa disease with complex causation.



Muscular dystrophy, a muscle-wasting disorder, iscaused by mutations in the DMD gene. The DMDgene codes for a protein called dystrophin that isnecessary for muscle cells to maintain their shape. When this protein is missing, muscle cells literallyburst as material from outside the cell membraneleaks in, raising cell pressure. Mutations in the DMDgene can cause Duchenne muscular dystrophy or itsmilder form, Becker muscular dystrophy. Peoplewho are born with muscular dystrophy experiencegradual, severe muscle loss and become unable towalk by age 10. Sequencing the DMD gene canreveal who will develop muscular dystrophy.

Striated muscle



Asthma is caused by a complex set of genes andenvironmental factors. Asthma is a chronic lungdisease that causes a person's airways to tightenand inflame when exposed to different irritants ortriggers.

Asthma is complicated because it is affected by theenvironment a person lives in and mutations in atleast five different genes. People with asthma havedifferent kinds of mutations in these genes. Asthmaruns in families, but because of its complex natureit is not yet possible to predict who will develop thedisease. DNA sequencing can only reveal who mightbe at increased risk, and even then, the risk factorcannot yet be calculated. This disease is caused byboth genetic and environmental factors.



The video and animation from the National Human Genome Research Institute (NHGRI) called "Our MolecularSelves" is a great introduction to the role our genome plays in shaping who we are. The NHGRI, which is partof the U.S. National Institutes of Health (NIH), developed the Human Genome Project in collaboration with theU.S. Department of Energy. The video can be viewed at http://www.genome.gov/25520211.

http://www.genome.gov/25520211



Lesson 1: Introduction to Cells, DNA, and Genes Practice Test Question 1:Genes have __________ that act(s) as ablueprint for the making of __________ . A. A chromosome/cellular activities B. DNA codes/protein C. Cellular activities/chromosomes D. DNA/chromosomes

Question 2:The human body has many different celltypes. Nearly all cell types in the sameindividual have the same __________ . A. Proteins B. Cellular activities C. Functions D. DNA sequences

Question 3:As we grow and mature, our genes__________ . A. Disintegrate B. May increase or decrease their level of expression or activity C. Gradually decrease their level of expression D. Gradually turn into protein

Question 4:Mitochondria are A. The structure that houses the chromosomes B. The structure that produces energy for cells C. A type of DNA D. Proteins

Question 5:Which statement about genes and humandisease is most accurate? A. Knowing the DNA sequence of all your genes is sufficient information to predict the occurrence of any genetic disease. B. Genetic diseases are most reliably predicted by family history rather than DNA testing. C. Whereas some genetic diseases can be predicted based on the presence of a particular gene sequence, other genetic diseases are too complex to be predictable at this time. D. Environmental factors have more influence than gene sequence on disease occurrence.

Submit Reset


Part I: Genetic Material Lesson 2: The Structure of DNA


Recognize the DNA double helix structure and itsmain componentsMatch vocabulary words to their definitions,including DNA, double helix, nucleotide, basepair, gene, intergenic region, genome, andchromosomeEstimate the amount of genetic material in atypical human cell in terms of the number ofbase pairs, genes, and chromosomesEstimate the level of similarity in the DNA ofhumans



The information in DNA is stored as a code made of four chemicalbases: adenine (A), guanine (G), cytosine (C), and thymine (T). Thissystem of encoding information is very similar to the way a sequence ofletters encodes a meaningful sentence.

A single strand of DNA is made of the bases (or letters) A, C, G, and T:

ATGCTCGAATAAATGTGAATTTGA

The letters make a code for the building blocks of proteins. You canthink of these as words:

ATG CTC GAA TAA ATG TGA ATT TGA

The words combine in a long string to make the code for completeproteins. You can think of these as sentences:

<ATG CTC GAA TAA GCC CAT CCC TGA> <ATG TGA AAA TGT GGG ATTTGA>

These "sentences" are protein-coding DNA sequences called genes.Genes are the blueprint for cellular production of proteins. Proteins arerequired for the structure, function, and regulation of the body's cells,tissues, and organs.



The DNA duplex molecule, also called the doublehelix, consists of two strands that wind aroundeach other. The strands are held together bychemical attraction of the bases that DNA is madeof. A bonds to T and G bonds to C. The bases arelinked together to form long strands by a"backbone" chemical structure. The DNA bases andbackbone twist around to make a duplex spiral.

The backbone structure is shown in orange andyellow.

The bases are shown as sticks and the backbonestructure is shown as ribbons.



The association of DNA bases on twostrands, A:T and C:G, is called base pairing. The two strands of DNA are complementary. Knowing the base sequence of one strandautomatically provides the sequence of theother strand. The duplex DNA of the humangenome consists of about 3 billion basepairs, and about 99.9 percent of those basesare the same in all people.



Individual DNA bases are also called nucleotides.Technically speaking, a nucleotide is a DNA base plusits backbone segment. The terms base and nucleotideare often used interchangeably. For example, analteration (mutation) in DNA sequence can be called abase substitution or a nucleotide substitution.

Adenine nucleotide, the letter "A" in DNA sequencesplus its backbone segment

Adenine base, the letter "A" in DNA sequences



The human genome has 3 billion base pairs(equivalent to 6 billion bases total). Thegenome is divided into 22 regular(autosomal) chromosomes, two differentkinds of sex chromosomes (X and Y), and atiny amount of DNA that resides inmitochondria (see Lesson 1). Thechromosomes vary in size and in the numberof genes they encode. The Y chromosome isthe smallest, with about 50 million base pairsand 200 genes. Chromosome 1 is thelargest, with about 240 million base pairs and3000 genes. The total number of genes inthe human genome is estimated at 20,000-25,000.



Women have, normally, two copies of everychromosome except the Y chromosome. Women do not have the Y chromosome. Menhave, normally, two copies of every regular(autosomal) chromosome and only one copyeach of the X and Y chromosomes. Humanshave a total of 46 chromosomes inside nearlyall of their cells. There are 22 pairedautosomal chromosomes and a pair of sexchromosomes, making 23 pairs ofchromosomes. Because the genes are thesame on each pair of autosomalchromosomes, we have a backup copy of mostof our genes.

Each different kind of chromosome is colored differently inthis diagram of the chromosomes found in a woman. Thetwo X chromosomes (pink) are in the lower right corner.



Only some of the DNA in chromosomes encodes genes. Most of the DNA sequences in the human genomeare seemingly useless because they do not contain any information needed to produce proteins. Thesenoncoding DNA sequences are interspersed between coding sequences (genes) and are called intergenicregions.



Lesson 2: The Structure of DNA

For a more in-depth look at chromosome structure watch thevideo "Chromosome 11 flyover" narrated by Doug Thomas.

http://www.dnalc.org/ddnalc/resources/chr11a.html



Lesson 2: The Structure of DNA Practice Test Question 1-11:Type in the letter of the most appropriatephrase (on the right) to match the termsbelow 1. Double helix 2. Gene 3. Intergenic region 4. Autosomal chromosomes 5. X and Y chromosomes 6. Base pairs 7. Nucleotide 8. Genome 9. Nucleus 10. Mitochondria 11. Protein

Question 12: About how many genes are in the human genome? -

Question 13: Does most of the DNA in the human genome code for protein? (Y/N)

Question 14: How many chromosomes does a typical human cell have, in total? Question 15: Which human chromosome is absent in females?

a. DNA that encodes a proteinb. Product of gene expressionc. House(s) most of the cell's DNAd. House(s) a small fraction of the cell's DNAe. All of the cell's DNAf. Duplex DNAg. DNA not involved in coding for proteinh. Sex chromosomes i. Present as matched pairs in both men and womenj. A base plus backbone structurek. 3 billion in the human genome

http://www.dnalc.org/ddnalc/resources/chr11a.html

Question 16: What percentage of base pairs are the same in every person? Provide your answer with one number after the decimal point. (Example: 15.9) Submit Reset


Part I: Genetic Material Lesson 3: DNA's Role in Determining Your Traits


Recognize that both genes and environment playa role in defining a person's traitsRecall that most human DNA sequence variationis in the form of single nucleotide polymorphisms(SNPs)Explain the relationship among genes, alleles,genotypes, and phenotypesExplain that variations in DNA sequence result indifferent versions of genes within the humanpopulationMatch vocabulary words to their definitions,including trait, allele, genotype, phenotype,single nucleotide polymorphism (SNP), geneticpotential, and penetrance



The genome sequence of each person is unique, withthe exception of identical twins. Although thefrequency of base pair substitutions betweendifferent individuals is only 0.1%, obvious differencesin physical traits are seen from person to person. Atrait is an observable characteristic of a person, suchas height or temperament. Genes encode proteinsthat direct the cells in our body to develop certaintraits. The environment we live in also influencesthe development of traits. For example, your DNAmay encode proteins that allow you to grow tall, butpoor nutrition, certain infections, and traumaticaccidents may prevent you from ever becoming tall.



A typical human gene has about 1000 base pairsthat code for one protein. On average, we expectthat one of the base pairs in any gene would vary inat least 1% of people. This kind of variation iscalled a single nucleotide polymorphism or SNP forshort.

"Poly" means many and "morphism" means form. Apolymorphic DNA sequence is a sequence that hasmore than one form in different people. A SNP is alocation along a genomic sequence that varies fromperson to person. SNPs are responsible for many ofthe different traits we observe among people. Youinherit your SNPs from your parents. Everyone hasthousands of SNPs, but they are not found in allgenes.



When a particular gene occurs in slightly differentforms (sequences) in some people, the gene is saidto be polymorphic. Most gene polymorphisms do notproduce new traits, although some of them do. Forexample, the gene that encodes the ABO blood typetrait is polymorphic; it has several SNPs and over180 sequence variants. But all variants can beclassified into the 3 groups, A, B, and O. In thisexample, there are 3 blood group traits. The trait isdetermined by a single gene that has SNPs. The SNPvariants are classified into 3 different classes ofalleles. An allele is a variant form of a gene thatproduces variation in a trait. Most human geneshave a single known allele; the traits they produceappear the same in everyone.

SNPs = Polymorphisms

Genes have manypolymorphisms but few

alleles.

Variant alleles cause varianttraits.



Biomedical researchers are still in the early stages oflearning about SNPs. Although most SNPs do notproduce noticeable physical changes in people, someSNPs predispose people to particular diseases. Ourunderstanding of the relationships between SNPs andtraits is certain to increase greatly over the next fewyears.


Part I: Genetic Material Lesson 3: DNA's Role in Determining YourTraits

Interestingly, genes were known to have allelicvariation long before any DNA sequences weredetermined. This is because some traits wereknown to vary according to rules of geneinheritance, such as the color of petals in the peaplant, as shown in the graphic on the right.

Geneticists often use the terms "genotype" and"phenotype" when referring to alleles and traits.

Genotype is defined as the alleles present inan individual's genome.Phenotype is defined as the traits present inan individual.



Penetrance is defined as the percentage ofindividuals carrying a particular allele who alsoexpress the particular trait associated with thatallele. For example, 95% of people who have theallele for Huntington's disease actually develop thetrait (the disease) known as Huntington's. Othergenes have alleles with high penetrance as well. Anexample is the ability to taste the bitter compoundPTC. There are two alleles for the PTC gene, tasterand non-taster. The taster allele shows almost 100%penetrance. This means that almost everyone whohas the taster allele has the trait of being able totaste the compound PTC as bitter.

Many genes have alleles with low penetrance. Anexample is the HLA gene allele DR4. 20% of peoplewho have the DR4 allele develop rheumatoid arthritisas they age.


Part I: Genetic Material Lesson 3: DNA's Role in Determining YourTraits

Because most traits are influenced by several genesand environmental factors, it is not possible topredict all the traits that will develop in anindividual, even when the person's genotype isknown. In addition, the low penetrance of manyalleles means that only a low percentage of peoplewith any particular allele will have the associatedtrait.

The term genetic potential is used to describe theinformation in a person's genome (their genotype)that could produce particular traits if environmentalfactors were favorable for the development of thosetraits. For example, if a person has the DR4 allele,they have the genetic potential to developrheumatoid arthritis, but other factors in addition tothat allele must come into play before the diseasewill occur. Most of us have the genetic potential toproduce strong muscles and a lean body, but thosetraits typically do not appear unless a fitnessprogram and diet regime are followed.

Another common way of describing the influence ofalleles on traits is to determine the risk that aparticular allele has on development of a particulardisease. For example, about 2% of adults over age50 have rheumatoid arthritis. About 20% of peopleover age 50 with the DR4 allele have rheumatoidarthritis. Although most people with DR4 do not getrheumatoid arthritis, if you have DR4, you are tentimes more likely to get the disease than if you donot have DR4.



Lesson 3: DNA's Role in Determining Your Traits Practice Test Question 1:All genes have ______ A. At least one allele B. Multiple alleles C. SNPs D. Genotypes

Question 2:The existence of multiple alleles of a particulargene A. Always results in mutation of the genome B. Indicates that multiple phenotypes may be possible C. Indicates a high SNP frequency in the gene D. Increases the penetrance of the alleles

Question 3:The higher the penetrance of an allele A. The more common it is among people

B. The more variation it has in its sequence C. The more likely it is to result in a variant trait D. The more likely it is to result in a favorable traitQuestion 4:Type in the letter of the most appropriatephrase (on the right) to match the termsbelow 1. Trait 2. Allele 3. Genotype 4. Phenotype 5. SNP 6. Genetic potential 7. Penetrance

Submit Reset

a. DNA polymorphismb. The likelihood of an observable effect on a traitc. Characteristicd. Gene variant that encodes an observable difference in some individualse. Theoretically possible outcome of a particular genotypef. The set of characteristics in an individualg. The set of alleles in an individual


Part II: Gene Transmission


Part II: Gene TransmissionLesson 4: Gene Expression and Personal Traits


Recall that humans have two copies of mostgenes, except for those found on the sexchromosomesDefine the terms diploid, haploid, multigenictrait, dominant allele, recessive allele,homozygous, heterozygous, and co-dominanceRecognize that genes and environment both playa role in determining a person's traits, especiallycomplex traits



Nearly all cells in the human body contain 46chromosomes. There are 2 copies of each of the 22autosomal chromosomes, and 2 sex chromosomes. Women have 2 copies of the X chromosome, thefemale sex chromosome, whereas men have one Xchromosome and one Y chromosome, the male sexchromosome. There are hundreds to thousands ofgenes on each chromosome. Because there are 2copies of the autosomal chromosomes, there aretwo copies of each gene present on them. If thetwo gene copies are the same allelic form, theperson is said to be homozygous for that gene. Ifthere are different alleles present, the person is saidto be heterozygous for that gene. For example,everyone has 2 copies of the PTC gene (the gene fortasting the bitter compound PTC). There are 2different alleles of this gene, the taster allele andthe non-taster allele. You might be homozygous forthe PTC gene (have 2 of the same alleles) or youmight be heterozygous for the PTC gene (have oneof each kind of allele).



When a cell has two sets of chromosomes, it isdiploid. Humans cells are generally diploid. When acell has only one set of chromosomes, it is haploid. Sperm and egg cells are normally haploid. Duringfertilization, a sperm cell and an egg cell fuse,leading to a diploid embryo. Each parentcontributes one of the two sets of chromosomes.



In diploid cells, each of the two copies of aparticular gene can produce a protein. If there aretwo different alleles present, two slightly differentproteins will be made that may influence thedevelopment of traits differently. Alleles can becategorized as dominant, recessive, or co-dominant.

Dominant alleles produce their observable trait, evenwhen a different allele is also present.

Recessive alleles produce their observable trait onlywhen no other differing allele is present. That is,the recessive trait can only be observed when bothalleles are the same (homozygous).

For example, the PTC taster allele is dominant,whereas the PTC non-taster allele is recessive. Ifyou have two copies of the taster allele(homozygous dominant), or if you are heterozygoustaster/non-taster, you taste PTC as a bitter. If youare homozygous recessive (non-taster/non-taster),you do not taste PTC as bitter.



Co-dominant alleles produce their observable trait incombination with differing alleles. Co-dominantlyexpressed traits may seem like a blend of differenttraits.

The A and B blood group alleles are examples of co-dominant alleles. If you have one A allele and oneB allele (A/B heterozygous), your blood group typewill be AB. The O allele is recessive. If you haveone A allele and one O allele (A/O heterozygous),your blood group type will be A. Only if you arehomozygous recessive O/O will you have O typeblood.



The genetics of traits such as PTC tasting or ABOblood group type are fairly easy to explain becausethey are influenced by single genes with fewalleles. They are monogenic traits. Most humantraits are complex because they are influenced bymultiple genes, some with several alleles. Traitssuch as eye color and height are polygenic, complextraits. All of the different genes and alleles thatcontribute to these traits are not yet known. Geneticists are making steady progress towardunderstanding how polygenic traits are produced.

Genetic diseases and genetic disease susceptibilitiesthat are monogenic can be categorized asdominant, co-dominant, or recessive. For example,Huntington's disease is a monogenic dominant trait. Sickle cell disease is a monogenic co-dominanttrait. Cystic fibrosis is a monogenic recessive trait.

Many genetic disease susceptibilities are complex,polygenic traits. Inherited susceptibility to cancer orcardiovascular disease can be monogenic orpolygenic. In addition, environmental factorsgreatly influence the risk of developing somediseases.


Part II: Gene Transmission Lesson 4: Gene Expression and Personal Traits Practice Test Question 1:A haploid cell has A. Autosomal chromosomes only B. Two copies of autosomal chromosomes and one sex chromosome C. Sex chromosomes only D. One copy of each autosomal chromosome and one sex chromosome

Question 2:Most cells in the human body A. Have 2 copies of each autosomal chromosome and no sex chromosomes B. Have one copy of each autosomal chromosome and no sex chromosome C. Have 2 copies of each autosomal chromosome and two sex chromosomes D. Have 2 copies of each autosomal chromosome and one sex chromosomesQuestion 3:If you are heterozygous for a gene that hasone recessive and one dominant allele, your

body is most likely to A. Develop the dominant trait B. Develop a partial version of the dominant trait C. Develop the recessive trait and dominant trait D. Develop the recessive trait

Question 4:A polygenic trait is produced by A. A gene that has multiple alleles B. A gene that is present as multiple copies in the genome C. Contributions from multiple different genes D. A gene that is influenced by multiple environmental factors

Question 5 - 10:

For human blood group types, A and B are co-dominant alleles whereas O is recessive. Matcheach genotype to its corresponding phenotype(on the right).

Question 5: A/A

Question 6: B/B

Question 7: O/O

Question 8: A/O

Question 9: A/B

Question 10: B/O

Submit Reset

a. Ab. Bc. Od. A/B


Part II: Gene Transmission Lesson 5: Meiosis


Distinguish meiosis from mitosisRecognize that meiosis results in the formationof genetically different gametes via independent

assortment and recombinationRelate the following terms to the process offertilization and heredity: meiosis, mitosis,recombination, autosome, and sex chromosomeRecall the number of autosomes and sexchromosomes in sperm, egg, and other celltypes



To grow tissue and renew cells, existing cells divideby mitosis. The steps of mitosis are:

1. Growth in cell size2. DNA replication. The chromosomes duplicate

themselves so that instead of two copies ofevery gene per cell (the normal diploidcondition), there are 4 copies of every gene.

3. The cell's nucleus dissolves, and thechromosomes distribute themselves into twoidentical diploid sets at opposite sides of thecell.

4. Two new nuclei form around the sets ofchromosomes.

5. The cell splits into two cells, each with its ownnucleus and each with a diploid set ofchromosomes.

Mitosis produces genetically identical cells. Cells inthe human body divide by mitosis. The onlyexception occurs during the production of sperm andegg cells. These cells are produced by meiosis.



Sperm and egg cells are produced by meiosis. Thesteps of meiosis are:

1. Growth in cell size 2. DNA replication. The chromosomes duplicate

themselves so that instead of two copies ofevery gene per cell (the normal diploidcondition), there are 4 copies of every gene.

3. The cell's nucleus dissolves and thechromosomes align themselves so thathomologous pairs of chromosomes canexchange bits of DNA.

4. The chromosomes distribute into 2 sets ofchromosomes at opposite sides of the cell.

5. Two new nuclei form around the sets ofchromosomes.

6. The cell splits into two cells, each with itsown nucleus and each with two copies ofevery gene.

7. The cells split again, this time without anynew DNA replication. The resulting cells haveonly one copy of every gene.

The differences between meiosis and mitosis aredescribed in steps 3 and 7.



During the first cell division in meiosis,two chromosomes of a homologous pairmay exchange segments in the mannershown in the diagram, producing newgenetic variations in the chromosomesof sperm and egg. The exchange ofDNA between chromosomes is calledcrossing-over and recombination.Recombination produces new geneticvariation ensuring that each person isgenetically unique (with the exception ofidentical twins).



Comparison of meiosis and mitosis

1. Meiosis produces haploid sperm or egg cells,whereas mitosis produces diploid cells.

2. Meiosis requires two cell divisions, whereasmitosis requires one cell division.

3. During the first cell division of meiosis, thechromosomes duplicate and then pair up sothat recombination between homologouschromosomes can occur. This creates newversions of chromosomes that are hybrids ofthe original maternal and paternalchromosomes.

4. The second cell division of meiosis occurswithout any additional chromosomeduplication such that the resulting cells onlyhave one of each chromosome.

5. The haploid cells produced by meiosis aregenetically unique.



Each egg or sperm has half of the DNA of theperson who produced it. They all have onecopy of each of the 22 autosomes and onesex chromosome. But each of these haploidcells is genetically unique because:

1. The 22 autosomes that they contain area random mixture of chromosomes fromthe father and mother of the personwho produced the sperm or egg. Some

who produced the sperm or egg. Someof the cells have more chromosomesfrom the mother, some have morechromosomes from the father. This isthe concept of independent assortmentof chromosomes during meiosis.

2. Crossing over and recombination duringmeiosis generates new chromosomalvariants in every sperm and egg.

When a sperm and egg fuse, the resultingembryo will have 44 autosomes and 2 sexchromosomes. Half the DNA is from thefather and half the DNA is from the mother.



During fertilization, one sperm and one eggfuse to form a diploid embryo. The fertilizedegg contains one of each of the 22 autosomalchromosomes (autosomes) from each parent,one X chromosome from the mother and an Xor a Y chromosome from the father. Eachsperm cell has either an X or a Ychromosome. All eggs have a single Xchromosome.

Individuals who receive an X chromosomefrom their father become girls. Individualswho receive a Y chromosome become boys. Boys always receive their X chromosome fromtheir mother.


Part II: Gene Transmission Lesson 5: Meiosis Practice Test Question 1:A single round of mitosis produces ____ cellsand a single round of meiosis produces _____cells. A. 4/4 B. 2/4 C. 4/2 D. 4/8

Question 2:Which of the following occurs during the firstcell division of meiosis but does not occurduring mitosis? A. The nucleus dissolves. B. The DNA replicates. C. Pairs of chromosomes exchange DNA. D. Flagella appear.

Question 3:The genetic makeup of any person is such that A. 23 of their chromosomes are from their mother and 23 of their chromosomes are from their father. B. 22 of their chromosomes are from their mother, 22 of their chromosomes are from their father, and their sex chromosome is randomly contributed. C. A random number of chromosomes are from each parent with a total of 46 chromosomes present in each cell. D. The sex chromosomes are from the father and the autosomes are from the mother.

Question 4:Males have an X and a Y chromosome. Theyalways get their X chromosome from theirmother and their Y chromosome from theirfather. A. True B. False

Question 5:Females have two X chromosomes and A. One is always from their mother and one is always from their father. B. Both X chromosomes are from their mother. C. Random chance determines if one or both X chromosomes are from their mother.

Submit Reset


Part II: Gene Transmission Lesson 6: Heredity


Determine the likelihood that a child will inheritan autosomal dominant trait from one parent,and how that differs from the likelihood ofinheriting an autosomal recessive traitExplain what it means to be a carrier of a traitExplain what an X-linked disease is, and why X-linked diseases are more common in malesExplain why the likelihood of inheriting acomplex, polygenic trait is not currently possibleto calculate



The diagram displays the chromosomespresent in a male. There are two of eachautosomal chromosome and two differentsex chromosomes. There are two copies ofevery autosomal gene and one copy of eachsex-linked gene. Because one of each typeof chromosome came from each parent,there are likely to be different alleles presentfor many of the genes on the autosomes. The alleles may be dominant, recessive, orco-dominant. Dominant and co-dominantalleles produce observable traits when onlyone copy of the allele is present. Recessivealleles only produce traits when no dominantalleles are also present.



A dominant trait that is encoded by a singlegene (monogenic trait) is passed on tooffspring according to the rules of Mendeliangenetics. For example, if the father of afamily has elevated blood cholesterol evenwhen he follows a very strict diet and doesnot eat any cholesterol-containing foods, hevery likely has a "hypercholesterolemia" allelefor a gene called LDL-R. The allele isdominant, so he has the trait even though healso has a normal LDL-R allele. On average,the father will pass the hypercholesterolemiaallele and the high-cholesterol trait on tohalf his children as shown in the diagram. Because the gene is autosomal (located onan autosome, not a sex chromosome), hisdaughters and sons are equally likely toinherit the trait. By random chance, none,all, or some of his offspring will inherit thetrait, but the probability of passing on thistrait, for each child, is 50%.



A recessive trait that is encoded by a singlegene (monogenic trait) is also passed on tooffspring according to the rules of Mendeliangenetics. For example, if the father andmother of a family each have a cystic fibrosisallele and a normal allele for the CFTR gene,they are not affected by the disease cysticfibrosis, but they are both genetic carriers ofthe disease. The allele is recessive, so thepresence of a normal allele prevents thedisease. On average, each parent will passthe cystic fibrosis allele on to half of his orher children as shown in the diagram. Thereis a 50% probability that a child will receiveone normal and one cystic fibrosis allele. These children will not have cystic fibrosis,but they will be genetic carriers. There is a25% probability that a child will receive twonormal alleles. These children will not havecystic fibrosis or be carriers. There is a 25%probability that a child will receive two cysticfibrosis alleles. These children will developcystic fibrosis.


Part II: GeneTransmission Lesson 6: Heredity

In males, the sex chromosomes arepresent as a single copy of each. This means that recessive traits thatare encoded on the X chromosomeare much more likely to appear inmales than females. These are calledX-linked traits. There are over 1000genes on the X chromosome. Theyencode information needed for traitsin both males and females. X-linkedgenes are responsible for diseasessuch as hemophilia, red-green colorblindness, muscular dystrophy, andfragile-X syndrome. Males get thesediseases far more often than femalesbecause they are recessive traits. Females get X-linked diseases whenthey inherit 2 recessive alleles fromtheir parents. Females who haveone recessive X-linked disease alleleare carriers. They are not affectedby the disease but they can pass thetrait on to their sons.

Inheritance of common hemophilia, an X-linked recessive disorder



If a man has an X-linked recessive disorderand his mate does not carry the allele for it,100% of their daughters will be carriers.None of their sons will inherit the allele.Males always get their X chromosome fromtheir mothers. Only females receive an Xchromosome from their fathers (in additionto the one they receive from their mothers).

If a woman is a carrier of an X-linkedrecessive allele for a disorder and her matedoes not have it, their sons will have a 50%probability of inheriting the disorder. Noneof their daughters will have it, but they willhave a 50% probability of being carriers.

X-linked dominant disorders are extremelyrare, as are Y-linked disorders. The Ychromosome encodes only 89 functionalgenes, mostly involved in masculinecharacteristics and fertility.

X Y X X

girls are XX, boys are XY X Y X X

girls are XX or XX, boys are XY or XY



Many human traits are influenced by morethan one gene. In addition, environmentalfactors such as lifestyle, infectious diseases,and accidents influence traits. Traits that arethe result of multiple genetic andenvironmental factors are called complextraits. The inheritance of complex traitscannot be predicted according to the rules ofMendelian genetics. As outlined below,geneticists do not yet understand all of thevariables involved in complex traits.

The number of different genes thatcontribute to complex traits is difficult todetermine. For example, at least four genesare likely to be involved in skin color, butthere may be more.

The relative contribution of each gene andeach allelic variant to the expression of atrait is usually unknown.

Environmental factors regulate the activity ofsome genes. For example, exposure tosunlight causes skin pigment-producing cellsto increase gene expression, leading toincreased pigment production and darkerskin.

Some environmental factors have a greaterinfluence on trait development than genesdo. For example, although there is a geneticcomponent to obesity, amount of food intakeis the most important factor that controls thedevelopment of obesity.


Part II: Gene Transmission Lesson 6: Heredity Practice Test Question 1:What is the likelihood that a monogenic,autosomal dominant trait will appear in a childwhose mother does not carry the trait and afather who is heterozygous for the trait? A. 25% B. 50% C. 75% D. 100% E. 0%

Question 2:What is the likelihood that a monogenic,autosomal recessive trait will appear in a childwhose mother does not carry the trait and afather who is a heterozygous carrier? A. 25% B. 50% C. 75% D. 100% E. 0%

Question 3:What is the likelihood that the son of a manwho is not color-blind and a woman whocarries an allele for red-green color blindness(an X-linked recessive disorder) will be color-blind? A. 25% B. 50% C. 75% D. 100% E. 0%Question 4:If a woman who carries an allele for red-greencolor blindness and a man who is red-greencolor-blind have a daughter, what is thelikelihood that she will be color-blind? A. 25% B. 50% C. 75% D. 100% E. 0%

Question 5:If both parents are obese (a complex trait),what is the likelihood that their child will beobese? A. 100% B. 50% C. Cannot be calculated

Submit Reset


Part III: Gene Expression


Part III: Gene ExpressionLesson 7: Coding for Proteins


Recall that genes store information in a three-letter codeDefine the terms transcription, translation, andprotein, and explain the relationships amongthese termsExplain why proteins are important to thefunctioning of the human bodyRecognize that the action of several proteins isoften required to produce an observable traitRecall that genes code for proteins, and thatmRNA functions as a copy of a gene's sequenceand codes for proteinsDistinguish between a genome and an exome



DNA encodes information using groups of threebases called codons. There are 4 different basesin DNA: A, C, G, and T. These bases can becombined into 4 , or 64, different triplets. Eachtriplet codon codes for an amino acid. Aminoacids are the building blocks of proteins. Allproteins are made by stringing amino acidstogether into long chains. There are 20 differentamino acids. Although there are 64 possiblecodons, many code for the same amino acid.


3


Proteins are a class of molecules that carry out atremendous variety of functions in cells. Proteinsare made as linear chains of amino acid that foldinto specific shapes. Proteins build physicalstructures in cells. For example they are theprimary components of our muscle fibers, skin, andhair. Proteins direct the formation of our skeletonsand other body features during our development.

Many hormones are proteins. In addition, thesynthesis of non-protein hormones is directed byproteins. Proteins function as enzymes that carryout chemical conversions of all sorts of molecules. For example, enzymatic proteins are responsible forconverting the food we eat into energy or fat.

Cells make thousands of different kinds of proteins. The development of normal traits requires theproper functioning of many different proteins.



Some traits result when a single protein isdefective. An example is a specific type ofdwarfism called achondroplasia. When a genecalled FGFR3 is mutated, a codon changes andan altered protein is made. This defectiveprotein causes less than the normal amount ofcartilage and bone growth, leading to veryshort stature.

Normal human height, on the other hand, is acomplex trait that is influenced by the proteinproducts of several different genes, includingseveral growth factor genes, growth factorreceptor genes, sex hormone genes, boneproportion genes, and genes that regulatedevelopment. A continuous range of normalhuman height is observed because the DNAsequences of these genes vary among people,leading to greater or lesser function of each ofthe different proteins. Geneticists estimatethat height is primarily determined by ourgenes, but environmental influences, especiallynutrition, also affect height.



The process of making a protein using the codefound in DNA can be divided into two steps,transcription and translation.

Transcription is the conversion of the DNA codeinto an mRNA code. mRNA is a moleculesimilar to DNA except that it is single-strandedrather than double-stranded and it uses a basecalled "U" where DNA uses "A".

Transcription is the synthesis of an mRNAmolecule that is complementary in sequence tothe DNA being used as the template.

Translation is the synthesis of protein usingmRNA as a template.



DNA stays inside the nucleus of cells (exceptduring mitosis and meiosis). mRNA is made inthe nucleus and then travels to the cytoplasmof the cell where it binds to a structure calleda ribosome that conducts the process ofprotein synthesis based on the sequence ofcodons in mRNA.

The basics of transcription and translation arereviewed in the video "Our Molecular Selves"from the National Institutes of Health.

More advanced animations of the processes oftranscription and translation can be viewed atthe Molecular and Cell Biology Learning Site:Transcription animation and Translationanimation.



Only a small fraction of the DNA in chromosomes encodes proteins. Most of the DNA sequences in the humangenome seemingly do not contain any information needed to produce proteins. Noncoding DNA sequencesthat are interspersed between genes are called intergenic regions.

http://www.genome.gov/25520211

http://vcell.ndsu.nodak.edu/animations/translation/movie.htm

http://vcell.ndsu.nodak.edu/animations/transcription/movie.htm



Non-protein-coding DNA sequences that areinterspersed within genes are called introns. Introns are transcribed into mRNA along withcoding sequences, but must be removed beforethe mRNA can be used for protein synthesis.

Exons are protein-coding DNA sequences withingenes.

The newly coined term exome refers to theprotein-coding DNA sequences of the genome. The exome constitutes about 1.5% of the humangenome. Because the exome contains all theprotein information about the genome, it isconsidered the most important and mostinterpretable part of the genome. Whereas 3billion bases must be sequenced to yield acomplete genome sequence, only about 45 millionbases need to be sequenced to yield a person'sexome.

Intron removal from mRNA

Introns and exons in genes



Although knowledge about one's personal exomesequence is now within reach, the effects of mostDNA sequence variation are still not known. One ofthe goals of the Personal Genome Project is todevelop tools to interpret exome sequenceinformation and correlate variant sequences withrelated personal medical and biological information.



Part III: Gene Expression

Lesson 7: Coding for Proteins Practice Test Question 1:How many DNA base pairs are needed toencode a protein that is 20 amino acids long? A. 20 B. 40 C. 60 D. 80 E. More than 100

Question 2:The process of using mRNA as a template toproduce a protein is known as A. Transcription B. Translation C. Translocation D. Intron

Question 3:The function of proteins is A. To build cellular structures B. To act as hormones C. To mediate chemical conversions D. All of the above

Question 4:The variation seen in a complex trait such asheight A. Is not due to variations in genetic make-up B. Is partly explained by DNA sequence variations in several different genes C. Can be entirely explained by variations in growth hormone genes D. Is explained by variation in amounts of structural proteins produced in different people

Question 5:Variations in the DNA sequences of intergenicregions do not affect the sequence of aminoacids in proteins. A. True B. False

Question 6:If all the exome sequence variation present inan individual were determined, most of theindividual's disease risks would be revealed. A. True B. False

Submit Reset


Part IV: Gene Regulation


Part IV: Gene RegulationLesson 8: Controlling Protein-Coding Genes


Define gene regulationRecognize that alterations in gene regulation caninfluence the development of traits and diseaseExplain that the expression of any particulargene may be influenced by other genes and bythe environmentInterpret information from genetic tests



The term gene regulation refers to the process ofincreasing or decreasing the production ofprotein products from genes. To begin geneexpression, mRNA is produced from genes (recallthat this process is called transcription). mRNA isthen translated into protein in the cytoplasm. Byincreasing the amount of mRNA that is producedfrom any particular gene, the amount of thatparticular protein product can be increased. Mostgenes are regulated by turning transcription on

or off, and by subtle increases or decreases intranscription.



The expression of many genes remains completelyinhibited in most cell types. The DNA in humancells includes over 20,000 genes, but only asubset of these genes are transcribed in anyparticular cell type. Different cell types expressdifferent sets of genes, meaning that theytranscribe some genes into mRNA, and notothers. Different cell types have very differentsets of proteins in them, causing them them tolook and function very differently. Furthermore,cells regularly turn gene expression up or down,depending on cellular needs and environmentalsignals.

Human brain Cells

Human blood cells


Part IV: Gene RegulationLesson 8: Controlling Protein-CodingGenes

Cells regulate the level of expression of eachgene so that the correct amount of protein willbe made. Defects in gene regulation cause toolittle or too much of a particular protein to bemade. Defects in gene regulation can affecttraits. For example, if you make too littlehemoglobin, you will have the trait of anemia.

Hemoglobin



The four main causes of gene regulationdefects are:

1. Mutations in the DNA sequence near thestart point of gene transcription.

2. Mutations in genes that code for proteinsthat regulate transcription.

3. Mutations that duplicate or delete genesso that the number of copies of aparticular gene changes.

4. Exposure to environmental factors thatalter normal patterns of gene expression.



Environmental factors can influence generegulation. For example, when someonebecomes infected with a wart virus, the wartvirus directs changes in gene transcription thatcause the infected cells to grow into a wart.

Another example of an environmental influenceon gene regulation is stress. Long-termstressful experiences increase the levels of ahormone called cortisol. Cortisol is a generegulator that increases the expression ofseveral genes, leading to long-term changes inphysiology.



It is important to remember that traits can beinfluenced by alterations in coding sequences andby alterations in gene regulation. In addition,some traits are influenced by a single gene andothers are polygenic.

Another complicating factor is that thepenetrance (the likelihood that a particular allelewill actually produce a particular trait) of geneticmutations is often far less than 100%.

A DNA test

mutations is often far less than 100%.

Some environmental factors affect generegulation and other environmental factorsdirectly affect the development of traits.



Gene regulation plays a role in theinterpretation of molecular genetic tests. Because several complex factors affect genesand traits, it is often difficult to predict thelikelihood of developing a genetic disease, evenwhen a complete DNA sequence is obtainedfrom all the genes known to influence thedisease. However, by taking into considerationall available genetic and environmentalinformation, a medical professional should beable to state if a person is at low risk, averagerisk, high risk, or very high risk for geneticdisease development.

The rod of Asclepius, a symbol for medicine


Part IV: Gene RegulationLesson 8: Controlling Protein-Coding Genes Practice Test Question 1:An increase in gene expression means A. There will be more DNA in the gene. B. The trait associated with the gene will be increasingly obvious. C. There will be more of the protein that is encoded by the gene. D. The likelihood of inheriting the trait will be increased. Question 2:The human body has many different types ofcells A. And many types of genomes. B. And each cell type has different genes turned off or on. C. And each cell type is the result of environmental gene regulation. D. All of the above are correct.Question 3:In what way(s) can gene expression bealtered? A. A mutation prevents the transcription of a gene.

transcription of a gene. B. Factors in the environment influence gene expression. C. A chromosomal duplication increases gene copy number. D. All of these are ways that gene expression can be altered.Question 4:After complete exome sequencing andanalysis, an individual was found to haveseven recessive mutations known to causeseven different diseases. The individual washeterozygous for all seven genes; the otheralleles were normal. This means that A. The individual has the seven genetic diseases. B. Because the mutations are recessive, none of the diseases is likely to develop. C. There is a high likelihood that at least some of the diseases will develop. D. The diseases can be avoided only if a healthy lifestyle is adopted.Question 5:Several different mutations in the LDL receptorgene are dominant-acting and known to beassociated with development of high bloodcholesterol and heart disease. If a person hasone of these disease-associated mutations A. They will not be at risk for the disease if they have a healthy diet. B. They are at increased risk for the disease but can reduce their risk if they have a healthy diet. C. Regardless of their diet, they will get the disease. D. They are not at risk for the disease unless they do not also have a normal allele.

Submit Reset


Part V: Genetics and Society


Part V: Genetics and SocietyLesson 9: The Benefits of Applying Genetic Technology toHealth Care


List the benefits of genetic testingDifferentiate benefits that are available now from onesthat are still predicted for the futureDistinguish media hype from the truth about genetictechnology


Part V: Genetics and Society Lesson 9: The Benefits of Applying Genetic Technologyto Health Care

As things stand now, the benefits of genetic testing arelimited. However, a genetic test may provide people withinformation that can help them with both their reproductivedecisions and health behaviors. Because environmentaffects genetic expression, a genetic test may also alertindividuals to a need to change diet, lifestyle, or physicalsurroundings. Genetic testing can identify individuals orgroups who are at increased risk of disease.

Genetic testing can discover whether people have anincreased risk of having a child with some types of geneticdisorders. There is also genetic testing for the developingfetus to find out if the fetus has such a disorder. Pre-implantation diagnostic testing of fertilized embryos is usedto ascertain which ones are free of a particular geneticdisorder that runs in the family (e.g., cystic fibrosis), andthus suitable for transfer to the mother’s womb.


Part V: Genetics and SocietyLesson 9: The Benefits of Applying Genetic Technologyto Health Care

Many genes and gene markers have been identified forboth rare and common diseases, including ovarian andbreast cancer and Huntington’s disease. Few of thesediseases are treatable or curable, although some may bepreventable, such as by a mastectomy when the BRCA-1 orBRCA-2 gene for breast cancer is present. Screening ofchildren who are born with birth defects or havedevelopmental delays indicating a possible genetic conditionmay lead to appropriate treatment that may enable anormal life for the child. For example, if a child is born withPKU, a metabolic disorder caused by an enzyme deficiency,severe mental retardation can be avoided if the child’sintake of phenylalanine is limited.

Even when a genetic disorder is not treatable or curable, agenetic test can be beneficial. For genetic disorders such asHuntington’s disease (HD), whose symptoms emerge late inlife, the results of genetic testing can provide anopportunity to make important decisions for the future orlead to a sense of relief at not having the gene. Manypeople elect not to take the HD test because they wouldrather not know the result. If a parent gets a diagnosis ofHD, the parent needs to consider whether to have his orher children (who each have a 50% chance of inheriting thedisease) genetically tested.

Even though there may not be treatment available for agenetic disorder, genetic testing can lead to increasedsurveillance and, in one instance, the symptoms may betreatable. One form of cancer, familial polyposis (whichinvolves initially benign polyps in the large bowel), can betreated by removing polyps as they emerge. Some testingalso is being done to discover small changes in a person’sDNA that might indicate a slightly increased risk for suchcommon disorders as heart disease, diabetes, andParkinson’s disease.



An important component of genetic testing that is currentlyperformed is genetic counseling. Genetic counseling is aprocess whereby a licensed genetic counselor providesinformation about results of a genetic test, risks of agenetic disorder occurring in the family, available optionsfor decision making and treatment, and appropriatereferrals. One can contact the National Society of GeneticCounselors at http://www.nsgc.org to find a local geneticcounselor. Genetic counseling will become even moreessential as further advances are made in genetic testingand treatment

As the technology develops, future genetic testing willresult in additional benefits, including the opportunity forpeople without a known genetic history of disease to findout what diseases they are likely to get. Other futurebenefits include the individual tailoring of medications andthe development of personalized diets and new lifestyles.The discovery of possible genetic variations can lead to newprevention strategies and treatments. The genomic era maysee great progress in prevention of illness, by identifyingindividuals at high risk of developing diseases. Given apatient’s genetic test results, physicians will be able to takemeasures to prevent illness instead of waiting untilsymptoms occur. Future genetic research can enhance ourunderstanding of the interaction of genes andenvironmental factors to cause diseases. As ourunderstanding of the genetic influences on diseasesincreases, we will be able to identify individuals' risks and

http://www.nsgc.org/

develop new, more efficient drugs.



It is often difficult to distinguish accurate reports in themedia about new genetic tests from those that are false ormisleading. Factual information often is reported bygeneticists or professional organizations, such as theAmerican College of Medical Genetics(http://www.acmg.net). Popular media, on the other hand,often presents over-simplified and sensationalized storiesabout genetic research and the benefits of genetic testing.

Personalized medicine to detect people’s individual healthrisks and tailor therapies has been around for a long time.However, there are now several companies offeringpersonalized genetic testing directly to consumers, althoughthe activity is unregulated, and some companies do notoffer genetic counseling or even use certified laboratories todo the testing.

Individuals considering the new genetic testing optionsneed to be able to differentiate between fact and fictionand to weigh benefits and risks to themselves and theirfamilies.


Part V: Genetics and Society Lesson 9: The Benefits of Applying GeneticTechnology to Health Care Practice Test Question 1:Which of the following is a benefit of genetictesting? (select the best answer) A. Learning one's susceptibility to genetic disorders B. Being able to make reproductive decisions based on the results of genetic testing C. Increasing medical surveillance if one tests positive for a disorder or disease D. All of the above

Question 2:Which of the following benefits is most likelyto come from future genetic tests? (select the best answer) A. Individual tailoring of medications B. Identifying environmental hazards to human development C. Determining one’s social and behavioral attitudes

http://www.acmg.net/

D. Selecting offspring who will have high intelligence

Question 3:How does one differentiate media hype aboutnew genetic discoveries from factualinformation? (select all answers that apply) A. Consider the source of the information. B. Seek the help of a professional genetics organization such as the American College of Medical Genetics. C. Ask friends or relatives for their interpretation. D. Consider whether the information sounds over-simplified or sensationalized.

Submit Reset


Part V: Genetics and SocietyLesson 10: The Risks of Applying Genetic Technology toHealth Care


List the risks of genetic testingIdentify unintended consequences of genetic testingDescribe ethical dilemmas in deciding if and whenchildren should have genetic testing



Along with the powerful new tools of genomics, there isrenewed emphasis on ethical, legal and social implications,especially with recent developments in genetic research andtesting. Attention to ethical issues evoked by genetic testinghas not kept pace with biotechnological developments.

Benefits of genetic testing, discussed in the previous lesson,must be balanced against the risk of genetic discrimination byemployers, insurers, schools, and society. The GeneticInformation Nondiscrimination Act (GINA) that President Bushsigned on May 21, 2008 protects people from geneticdiscrimination in employment. The law has manyshortcomings, though. It does not cover life, disability, andlong-term care insurance. It covers just health insurance. Inaddition, GINA does not apply when a person at risk for agenetic disease develops symptoms of that disease (e.g.,breast cancer or Huntington’s disease).



Individuals who get genetic testing face many challenges,including the following:

Abridgement of the right not to know geneticinformation

Compromised privacy and confidentiality of geneticinformation

Confusion about what the individual may or may notlearn from genetic testing results

The possibility of close relatives having the samemutated gene, raising the issue of the obligation toinform those relatives of test results

False positive or false negative test results

Lack of scientific validity of test results

A failure to detect environmental influences on theidentified gene and other unidentified genes

Misinterpretation of test results

Discovery of misattributed paternity or adoptions

Lack of follow-up counseling

Psychological stress after receiving test results

False hopes for treatments and cures that do not exist,and unwarranted personal reactions based on thegenetic information gleaned from the test results

Exploitation by private commercial companies based onthe individual’s known genotype (e.g., nutritionalcompanies)

Not being informed about family medical history

Potential misuse of the individual’s (and familymembers’) genetic information by insurers, employers,schools, government, and society. A genetic diagnosiscan affect an entire family, not just the individual who

was tested.



There are many risks associated with genetic technology forsociety as well as for individuals. Possible risks for societywhen genetic testing becomes more common are thefollowing:

Lack of regulatory oversight

Lack of appropriate authority for genetic decisions, inparticular when decisions need to be made on behalfof children and impaired adults

Changes in the definition of what is “normal,” e.g., forthe deaf and dwarf communities and their right tochoose to have children like themselves

Potential elimination of those who are not “perfect”

Future elimination of “undesirable” traits

Limited availability and affordability of testing andtreatment for underprivileged individuals



Genetic testing of children is a major ethical issue. Minors donot have the opportunity to make decisions for themselvesabout whether or not to be tested. Sometimes adults wanttheir children tested for the wrong reasons. In 1997, anadvisory committee of the National Human GenomeResearch Institute stated that genetic testing of children foradult-onset diseases should not be undertaken unless a childwould gain a direct medical benefit that would be lost if thechild waited until adulthood to be tested.

It is important for you to weigh both potential risks andbenefits before taking a genetic test. By doing so you will beable to make an informed decision for yourself, knowingthat your family members also need to be considered.Understanding the psychosocial and ethical implications ofgenetic testing is essential.


Part V: Genetics and Society Lesson 10: The Risks of Applying GeneticTechnology to Health Care Practice Test Question 1:Which of the following is not a risk of genetictesting? A. Compromised privacy and confidentiality of individual genetic information B. Increased medical surveillance if one tests positive for a disorder or disease C. Lack of scientific validity of test results D. Misinterpretation of test results Question 2:What are some of the unintendedconsequences of genetic testing? A. Discovery of a misattributed paternity or adoption B. Unauthorized publication of results of your genetic tests C. Elimination of newborns with genetic disorders D. All of the above

Question 3:Why is genetic testing of children a majorethical dilemma? A. Children are not smart enough to decide whether or not to have genetic testing. B. Children can institute lawsuits against their parents for wrongful birth. C. Children need to assert their right for genetic testing. D. Children who wait until adulthood to be tested might lose the opportunity to gain a direct medical benefit from the testing.

Submit Reset


Part VI: Project Literacy


Part VI: Project LiteracyLesson 11: Participating in the Personal GenomeProject


List the major benefits of participating in the PGPList the major risks of participating in the PGPRecognize the policies of the PGP that apply toparticipantsExplain some of the procedures for participatingin the PGP


Part VI: Project LiteracyLesson 11: Participating in the PersonalGenome Project

Harvard Medical School takes informed consent veryseriously. As you probably know by now, fromreading the other lessons, Harvard expects you tounderstand basic genetics in order to be acceptedinto the PGP. Harvard also expects you tounderstand what it means to be a participant in theproject. What are the benefits of participating?What are the risks? What are the policies andprocedures? This lesson will focus on these areasand help you prepare to offer truly informedconsent. This lesson will also help you answerquestions in the PGP entrance exam related toinformed consent and the policies and procedures ofthe project.


Part VI: Project LiteracyLesson 11: Participating in the PersonalGenome Project

There are many benefits of becoming a PGPparticipant. Participants will help advance scientificresearch, help promote the well-being of ourspecies, and learn more about themselves. Becausethe PGP plans to enroll over 100,000 participantsand tie genetic information to medical histories andphysical traits, extensive research data will becomeavailable. Scientists will be able to mine, analyze,and statistically correlate these data to answerfundamental questions about our basic biology, ourhistory as a species, and our risk of gettingdiseases.



One key benefit of participating in the PGP is theopportunity to help researchers learn more aboutdiseases that have a genetic component, includingmuscular dystrophy, sickle cell anemia, Huntington'sdisease, diabetes, addictions, obesity, mentalillnesses, Down syndrome, and many more. Thedata that the PGP will gather hold the promise forbetter diagnosis, therapy, and prevention of thesediseases. Although individual participants will notreceive clinical data or medical advice, theirparticipation in the project may mean better medicalcare in the future for thousands of people afflictedwith genetic diseases.



Participation in the PGP may help advance the fieldof personalized medicine, which in the future couldbenefit people who suffer from cancer, heart disease,diabetes, and other common diseases. Withpersonalized medicine, information about a patient'sgenotype or gene expression profile can be used to

tailor medical care to the person's needs. Doctorswill be able to provide specific therapy orpreventative measures that are particularly suited toan individual. Genetic information may also be usedto select the right medication and dosage.



Another benefit of participating in the PGP is personalknowledge. Although the PGP does not expect theresults to necessarily have any useful medicalpurpose for any particular individual, participants willnonetheless learn about their own genetic makeup.Participants may learn about their risk for gettinggenetic disorders and make lifestyle changes toreduce the risk.

PGP researchers may have access to Web-basedinterpretation tools that can identify geneticvariations and associate them with traits or diseases.These data may be made available to PGPparticipants who can discuss the results with theirpersonal doctors or genetic counselors. Results mayalso be discussed in online forums or blogs withresearchers or other participants. People with sharedgenetic variations or mutations may wish to contacteach other and discuss diseases, traits, or genealogy.



Individuals also benefit from participating in the PGPfrom an educational point of view. Some participantsplan to volunteer because of intellectual curiosityabout personal genomics, biology, computing, orbioinformatics. Professional interests might beanother driver for some participants, especially forpeople whose work may be impacted by genomics,such as health-care workers, policy-makers, and ITprofessionals.



Giving truly informed consent to participate in ahuman-subject research project such as the PGPmeans understanding the risks associated withparticipating, not just the benefits. The PGP hasevery intention of following protocols that arecarefully designed to minimize risk. However,participants should recognize that this project isexploring relatively unchartered territories and thatthere are risks, some that are not well understood.The PGP recommends that you discuss with yourfamily members the risks associated withparticipating.

Personal genomics will have an impact on yourprivacy. The technology may allow for exposure ofyour unique genetic "fingerprint." This will havemany implications. Consider the implications for thecriminal justice system, for example. On the positiveside, criminals can be more easily prosecuted andconvicted when DNA evidence is available. On thenegative side, someone could, in theory, makesynthetic DNA corresponding to your DNA and plantit at a crime scene, thus falsely incriminating you.Your DNA could also infer unexpected paternity oryour relationship to a criminal or historic figure ofdubious fame.



PGP results will be published on publicly accessiblewebsites. Although the PGP plans to implement standardsecurity measures for the websites, the PGP does notguarantee that your personal data will remainconfidential or that you can maintain your anonymity.When you consider that your PGP results will documentyour genome, hair and eye color, height, facial features,and unique medical conditions, it becomes clear that thePGP must warn participants that promises of anonymityare neither realistic nor ethical.

Even when strong security measures are in force,breaches happen. Hackers could gain access to yourpersonal data; computers could get stolen; researchersor participants could unintentionally expose data thatreveal more personal information than they intended. Inaddition, computer forensics experts can sometimesretrieve data that have been deleted from computerhard drives. So, even if you request that all your databe removed from the project databases, it is impossibleto confirm that the data were fully removed.

Because of these issues, the PGP cannot promisepermanent confidentiality or anonymity. To participate,you should be comfortable with this fact.

See this website from Harvard Medical School forinformation about scenarios where anonymity canbe compromised:http://arep.med.harvard.edu/PGP/Anon.htm

http://arep.med.harvard.edu/PGP/Anon.htm



Another risk associated with personal genomics is thatan insurance company could refuse to cover you if yourDNA shows that you have a genetic propensity for adisease, or an employer could refuse to hire youbecause providing health benefits could be tooexpensive. Genetic discrimination is against the law inthe United States since President George W. Bush signedinto law the Genetics Information Nondiscrimination Act(GINA) in May 2008. The law doesn't cover life,disability, or long-term care insurance, however, and hasother shortcomings according to some bioethics experts.Plus, it's unrealistic to think that genetic discriminationwon't occur, simply because it's against the law.

See the article by Mark A. Rothstein called"Keeping Your Genes Private" in the September2008 issue of Scientific American for moreinformation regarding laws related to geneticprivacy.



When considering whether to participate in the PGP, youshould keep in mind that mistakes happen. Thesequencing results, or the data that are posted onwebsites, could contain errors. The psychological impactof errors could be significant. If the project or somethird party (possibly erroneously) claims that you have apredisposition to a debilitating disease, you shouldn'toverreact. You should consult a physician or a licensedgenetic counselor.

As a participant in the PGP, you could learn that you areat risk for getting a disease that has no cure ortreatment options. How will this affect youpsychologically? How will it affect your relatives? Shouldyou tell your children, your siblings, your parents? Doyou by any chance have an identical twin? What will youtell him or her? (If you have a living identical twin, bythe way, the PGP requires that the twin provide consentfor your participation in the project.)



In addition to understanding the benefits and risksassociated with participating in the PGP, in order to passthe entrance exam you will need to answer a few

questions related to policies and procedures for theproject. The best place to learn up-to-date informationon these topics is the PGP site itself(http://www.personalgenomes.org), but this lessondiscusses a few important points here.

The current plan is that PGP participants will need tofollow these steps to participate:

1. Agree online to a "mini consent" form in order to getstarted on the PGP entrance exam. This form will ask foryour name, year of birth, and email address. It will alsoexplain that your participation is voluntary and you mayrefuse to participate or discontinue participation at anytime.

2. Pass the PGP entrance exam. (This study guide willhelp you with that!)

3. Agree online to the actual consent form forparticipation in the research study. This is a relativelylong form where you will confirm that you understandthe purpose of the research and the possible risks andbenefits of participating. You will also agree that a PGPresearcher may decide to end your participation in thestudy at any time.



To participate in the PGP, you will be asked toelectronically complete a traits questionnaire concerningsuch topics as your current medications, medical history,allergies, and vital signs. The full list of personalinformation required for enrollment will be available atthe project website.

In addition to the traits questionnaire, you will be askedto specify the amount you would like to pledge to theproject. Donations are encouraged but not required. Ifyou are selected to continue to the next stage, you willbe asked to submit a tissue sample such as hair and/orsaliva.

Scientists will perform DNA sequencing on the tissuesamples and use them to study biological characteristics,DNA, RNA (gene expression), physical traits, and thepresence and characteristics of micro-organisms in thespecimen sample. Scientists may also attempt to createa living tissue sample known as a cell line. Cell linesprovide a renewable supply of your cells and DNA.


Part VI: Project Literacy Lesson 11: Participating in the Personal GenomeProject Practice Test


Question 1:The PGP will give you medical advice. A. True B. False

Question 2:A benefit of participating in the PGP is theopportunity to help advance research ondiseases that have a genetic component. A. True B. False

Question 3:You should discuss your project participationwith your immediate family. A. True B. False

Question 4:Unlike many commercial personal genomicsventures, the PGP will not require a tissuesample. A. True B. False

Question 5:To participate in the PGP, you will be asked toelectronically complete a traits questionnaire. A. True B. False

Question 6:The PGP guarantees that your private data willnot be exposed to anyone who is notassociated with the project. A. True B. False

Question 7:The medical ramifications of your geneticvariations could be discussed in online forumsrelated to the PGP. A. True B. False

Question 8:Participation in the PGP is entirely voluntaryand you can discontinue participation at anytime. A. True B. False

Question 9:A PGP researcher could terminate yourparticipation in the study. A. True B. False

Question 10:If you discontinue your participation in thePGP, your data will be securely erased andguaranteed to be unavailable in the future. A. True B. False

Question 11:To participate in the PGP, you should acceptthat your genome and trait data will bepublished on a publicly accessible website thatdoes not guarantee your anonymity. A. True B. False

Question 12:If your PGP results indicate that you have apredisposition for a life-threatening disease,you should immediately schedule surgeryand/or start a course of medication. A. True B. False

Question 13:Why do you want to participate in the PGP?For you personally, what are the benefits ofparticipating that interest you most? Whichrisks concern you the most? (This questionwon't be graded.)

Submit Reset


Part VI: Project LiteracyLesson 12: Human Subjects Research


Define "informed consent"Explain the importance of the Belmont ReportList the three ethical principles espoused in theBelmont ReportDescribe what the Belmont Report says aboutthe application of the three ethical principles toconducting research with human subjectsExplain the protections provided by a Certificateof Confidentiality



Informed consent is a process whereby individuals assess their willingness to voluntarily participate in aresearch project, based on their understanding of the purpose of the project. Participants analyze the risksand benefits of participation, and the policies and procedures of the project that will affect participants, andthen sign an informed consent form. The informed consent process shouldn't be just a one-time event,however. It should be an ongoing discourse that lets an individual assess whether to participate, before theresearch begins, and whether to continue to participate, as the research progresses.

For the PGP, the informed consent process involves these activities:

1. Education (that's why you're going through this study guide!)2. Assessment (that's why you'll take the PGP entrance exam)3. Consent (the signing of the actual PGP consent form)4. Continued reassessment of willingness to participate



Scientific research generates many social benefits.As already discussed in this study guide, PGPresearch could help alleviate human suffering fromgenetic diseases, increase our knowledge of humanbiology and history, and enable medical practicesthat are personalized to a person's genetic profile.Scientific research also poses many troubling ethicalquestions, however. Abuses of human subjects inbiomedical experiments, especially during WorldWar II, drew public attention to the question of howscientific and medical research can be conducted inan ethical fashion.

In 1947, 22 Nazi doctors and SS officers wereconvicted of war crimes, including participating in andconsenting to using concentration camp inmates asguinea pigs in medical experiments.



In the 1970s, a renewed focus was put on ethics inscientific and medical research when the publicbecame aware of the deterioration of ethics thatoccurred during the Tuskegee Study of UntreatedSyphilis in the Black Man, conducted between 1932and 1972. As part of this study, 399 poor and

Some of the Tuskegee Study clinicians

and 1972. As part of this study, 399 poor and(mostly) illiterate African American sharecropperswere studied to observe the natural progression ofsyphilis when left untreated. Enrollees in the studyweren't informed of their diagnosis, nor told thatthey could get treatment, even though by 1947penicillin had become a standard treatment forsyphilis.



In reaction to the Tuskegee Study and otherconcerns, the National Research Act was signed intoU.S. law on July 12, 1974. This law created theNational Commission for the Protection of HumanSubjects of Biomedical and Behavioral Research. Oneof the commission's goals was to identify the basicethical principles that should form the foundation ofbiomedical and behavioral research involving humansubjects. After nearly five years of discussion andcollaboration, the commission published a report inthe Federal Register. This report became known asthe Belmont Report. The report espoused thefollowing three principles:

1. Respect for persons: protecting the autonomyof all people and treating them with courtesyand respect, and allowing for informed consent

2. Beneficence: maximizing benefits for theresearch project while minimizing risks to theresearch subjects

3. Justice: ensuring that reasonable, non-exploitative, and well-considered proceduresare administered fairly



One important application of the three ethicalprinciples in the Belmont Report is making sure thathuman subjects give informed consent. According tothe report, respect for people requires that subjects,to the degree that they are capable, must be giventhe opportunity to choose what shall or shall nothappen to them. The research project should establishspecified items for disclosure to assure that subjectsare given sufficient information to make this choice.

The manner and context in which information is

conveyed must foster comprehension. Informationshould be presented in an organized fashion, allowingenough time for consideration and questioning. Inaddition, subjects should understand the benefits, therange of risk, and the voluntary nature ofparticipation.



Another important aspect of human subject researchis protecting the privacy of subjects even whenthere are legal demands to do otherwise. ACertificate of Confidentiality helps researchersprotect the privacy of subjects from compulsorylegal demands (e.g., court orders and subpoenas)that seek the names or other identifyingcharacteristics of research subjects.

Certificates of Confidentiality fall under the auspicesof Section 301(d) of the U.S. Public Health ServiceAct, 42 U.S.C. 241(d), in which the Secretary ofHealth and Human Services is allowed to authorizepeople engaged in biomedical or other research toprotect the privacy of individuals who are thesubjects of that research. According to this act,people authorized to protect the privacy of researchsubjects may not be compelled in any federal, state,or local civil, criminal, administrative, legislative, orother proceedings to identify a subject by name orother identifying characteristic.



Although a Certificate of Confidentiality protectsresearchers and subjects from compelled disclosure, itdoes not prevent all disclosures. A Certificate ofConfidentiality doesn't prevent a researcher fromvoluntarily disclosing information for various reasons.It also doesn't prevent a subject from voluntarilydisclosing information.

In addition, a Certificate of Confidentiality doesn'tprevent a researcher from disclosing information if theresearcher thinks subjects are in danger of harmingthemselves or others, for example in cases of childabuse. Some states have laws that mandate thereporting of evidence of child abuse. A Certificatedoesn't prevent a researcher from complying with sucha law.


Part VI: Project Literacy Lesson 12: Participating in the Personal GenomeProject Practice Test Question 1:Informed consent is(select the best answer) A. A written agreement that permits a researcher to inform a potential participant about the goals of a research project, along with the benefits, risks, policies, and procedures of the project B. Written proof, often in the form of an entrance exam, that a participant is truly educated about a project C. A binding contract between a researcher and research subject that includes information about how to cancel the agreement should either party decide to terminate the contract D. A process whereby a human subject analyzes a research project and then provides confirmation that he or she is informed about the project's goals, benefits, risks, policies, and procedures, and consents to themQuestion 2:Which of the following is one of the threeethical principles set forth in the BelmontReport?(select the best answer) A. Beneficence, which guarantees scholarships to potential participants who can't afford the fee B. Equality, which ensures that human subjects are a mix of genders and races C. Respect for people so that their autonomy is protected D. Justice so that participants have a way to report any ethical abuses to federal authorities

Question 3:Which of the following does a Certificate ofConfidentiality prevent?(select the best answer) A. Compelled disclosure of identifying characteristics of a research subject B. Compelled disclosure of identifying characteristics of a research scientist C. Compelled disclosure of child abuse in the case where a state has a mandatory reporting law D. All of the above

Question 4:

Which of the following is an importantapplication of the three ethical principles in theBelmont Report? (select the best answer) A. Making sure that human subjects give informed consent B. Fair compensation for participating C. Providing treatment for diseases discovered as part of the human subject research D. Disclosure of any corporations that provide funding for the project

Question 5:The informed consent process for the PGPinvolves a set of activities. Which of thefollowing is not one of the activities?(select the best answer) A. Getting educated B. Passing an entrance exam C. Signing a consent form D. Going to an approved medical center to provide tissue samples

Question 6:Which of the following does the BelmontReport state are applications of the primaryethical principles?(select all answers that apply) A. Participants should not be compensated B. An agreement to participate constitutes valid consent only if it is given voluntarily C. Participants should give informed and comprehending consent to participate D. Researchers should not reveal identifying characteristics of human subjects

Submit Reset

Documents

Personal Genome Project Study Guide Personal Genome Project Study Guide Personal Genome