Upload
others
View
6
Download
0
Embed Size (px)
Citation preview
Viruses of taro and other edible aroids in East Africa
by
Dawit Beyene KIDANEMARIAM Bachelor of Education (Biology)
Master of Science (Botany)
Centre for Tropical Crops and Biocommodities School of Earth, Environmental and Biological Sciences
Science and Engineering Faculty
A thesis submitted in fulfilment of the requirement for the degree of Doctor of Philosophy
Queensland University of Technology Brisbane, Australia
2018
“The end of a journey is the beginning of another….”
i
Abstract
Edible aroids such as taro and tannia are important root crops in most parts of East
Africa and cultivated mainly by small-holder farmers. Taro is the most preferred aroid
in the region where it plays significant nutritional, economic and social roles. Viruses
are among the most important constraints for the production of edible aroids
worldwide. To date, no comprehensive study has been carried out to determine the
status of viruses infecting taro and other edible aroids in East Africa. This PhD project,
therefore, aimed to investigate the incidence, distribution and possible origin of
viruses infecting taro and other edible aroids in the region. During 2014/15, a survey
was carried out in the major growing areas in Ethiopia, Kenya, Tanzania and Uganda.
A total of 25 districts were visited in the four countries and a total of 392 leaf samples
were collected. Based on the availability of reliable diagnostic molecular tests, the
samples were tested for the presence of badnaviruses, potyviruses and cucumber
mosaic virus. Additional screening was also carried out for the presence of
rhabdoviruses known to infect taro.
When the 392 samples were tested by PCR using degenerate badnavirus
primers, between 58-74 % of the samples from the four countries were positive.
BLAST analysis of the core RT/RNase H-coding sequences revealed the presence of
both taro bacilliform virus (TaBV) and taro bacilliform CH virus (TaBCHV) with TaBCHV
identified in all four countries and TaBV identified in all countries except Ethiopia.
Full-length genome sequences of representative TaBV and TaBCHV isolates infecting
both taro and tannia from East Africa were generated by rolling circle amplification
(RCA) and outward-facing PCR, respectively. The genome of TaBV isolates from East
Africa ranged between 7,796-7,805 nucleotides and contained four open reading
frames consistent with that of a previously reported isolate from Papua New Guinea.
The genome of TaBCHV isolates from East Africa ranged from 7,389-7,654
nucleotides. Unlike previous reports of TaBCHV isolates from China and Hawaii which
possessed six and five ORFs, respectively, the TaBCHV isolates from East Africa
contained only four ORFs. No obvious symptoms were associated with TaBV and
ii
TaBCHV infection in East Africa, with a number of asymptomatic plants also testing
positive. Phylogenetic analysis showed that all East African TaBV isolates form a single
subgroup together with a known TaBV isolate from New Caledonia. However,
TaBCHV isolates formed several distinct subgroups in the phylogenetic tree.
Due to quarantine restrictions, an Australian TaBV isolate was used as a model
to generate a TaBV infectious clone. A terminally redundant cloned copy of the TaBV
genome was generated and was shown to be infectious when inoculated into taro
plants by agrobacterium-mediated inoculation. TaBV genomic DNA was amplified
from inoculated plants using rolling circle amplification at 12 weeks post-inoculation
confirms the presence of episomal TaBV DNA. At 20 weeks post-inoculation, some
plants developed symptoms including downward-curling of the leaf margins, similar
to that observed in some TaBV-infected taro plants in the field. This was the first
report describing the development of an infectious clone of TaBV and may serve as
an important tool to facilitate further investigation into the virus host range,
symptoms and yield loss.
The incidence and distribution in East Africa of four RNA viruses known to infect
taro, namely cucumber mosaic virus (CMV), dasheen mosaic virus (DsMV), taro vein
chlorosis virus (TaVCV) and colocasia bobone disease-associated virus (CBDaV), was
also investigated by RT-PCR using degenerate and/or virus-specific primers. No
samples tested positive for TaVCV or CBDaV. Further, CMV was only detected in three
tannia plants with mosaic, mottling and vein chlorosis symptoms from Buikwe district
in Uganda. Next generation sequencing of total RNA extracted from these samples
confirmed the presence of CMV in all three plants, the nucleotide sequences of which
showed 99.5-99.8 % identity. One isolate, designated CMV-Xa, was characterised
further. Pairwise sequence comparison, BLAST search and phylogenetic analysis
based on full-length RNA 1, 2 and 3 sequences showed that CMV-Xa belonged to
subgroup-IB of CMV isolates. The genome organisation of RNA 1 and 3 of CMV-Xa
was similar to previously reported CMV isolates. However, RNA 2 contained an
additional, non-AUG initiated putative ORF, referred to as ORF 2c, in addition to ORF
2a and 2b. This was the first report of a complete genome sequence of a subgroup IB
iii
CMV isolate from sub-Saharan Africa and was also the first report of CMV infecting
Xanthosoma sp.
DsMV was detected in 40 samples, including 36 out of 171 from Ethiopia, 1 out
of 94 from Uganda and 3 out of 41 from Tanzania, while no samples from Kenya
tested positive. The complete genomes of nine DsMV isolates from East Africa were
cloned and sequenced. Phylogenetic analyses based on the amino acid sequence of
the CP-coding region revealed two distinct clades, which is consistent with previous
reports. Interestingly, samples from Ethiopia were distributed across several
subgroups in both clades, while samples from Uganda and Tanzania belonged to
different clades.
During preliminary RT-PCR assay development for potyviruses at QUT, an aroid
(Alocasia sp.) showing a mosaic and feathery-mottle symptom typical of DsMV
infection was identified growing near Brisbane. The plant tested positive for potyvirus
infection by RT-PCR using degenerate primers and subsequent cloning and sequence
analysis revealed the presence of the potyvirus, Zantedeschia mild mosaic virus
(ZaMMV). The complete genome of ZaMMV from Australia (ZaMMV-AU) was
obtained and was found to be closely related to a previously reported ZaMMV isolate
from Taiwan (ZaMMV-TW). This was the first report of ZaMMV from Australia and
from an Alocasia sp.
To our knowledge, this is the first study describing the occurrence, distribution
and genome organisation of viruses infecting aroids in East Africa and it will
contribute to ongoing surveillance and to disease management activities throughout
the region. Aroids are considered an ‘orphan-crop’ in East Africa and, as a result, are
receiving less attention from national and regional research agencies. The findings
from this study will hopefully raise awareness of the status of viral diseases of aroids
in the region and may be the catalyst for attracting much needed funding for research
and development activities in the future.
iv
Keywords
Colocasia esculenta, CMV, DsMV, East Africa, Ethiopia, Infectious clone, Kenya,
RCA, taro, tannia, TaBCHV, TaBV, Tanzania, Uganda, Xanthosoma sp., ZaMMV
v
Publications
Peer reviewed publications related to this PhD thesis
1. Kidanemariam, D.B., Abraham, A.D., Sukal, A.C., Holton, T.A., Dale, J.L., James,
A.P. and Harding, R.M. (2016). Complete genome sequence of a novel
zantedeschia mild mosaic virus isolate: the first report from Australia and from
Alocasia sp. Archives of Virology 161:1079–1082.
2. Kidanemariam, D.B., Sukal, A.C., Abraham, A.D., Stomeo, F., Dale, J.L., James,
A.P. and Harding, R.M. Identification and molecular characterisation of taro
bacilliform virus and taro bacilliform CH virus from East Africa. Submitted to
Plant Pathology https://doi.org/10.1111/ppa.12921.
3. Kidanemariam, D.B., Sukal, A.C., Crew, K., Jackson, G.V.H., Abraham, A.D.,
Stomeo, F., Dale, J.L., James, A.P. and Harding, R.M. (2018). Characterization of
an Australian isolate of Taro bacilliform virus and development of an infectious
clone. Archives of Virology 163:1677–1681.
4. Kidanemariam, D.B., Sukal, A.C., Abraham, A.D., Njuguna, J.N., Mware, B.O.,
Stomeo, F., Dale, J.L., James, A.P. and Harding, R.M. Characterisation of a
subgroup IB isolate of Cucumber mosaic virus from Xanthosoma sp. in sub-
Saharan Africa. Submitted to Virus Genes.
5. Kidanemariam, D.B., Sukal, A.C., Abraham, A.D., Njuguna, J.N., Stomeo, F.,
Dale, J.L., James, A.P. and Harding, R.M. Incidence and distribution of four RNA
viruses infecting taro and tannia in East Africa and molecular characterisation
of Dasheen mosaic virus isolates. Formatted for submission to Annals of
Applied Biology.
vi
Table of Contents
Abstract .......................................................................................................................................... i Publications ....................................................................................................................................v Table of Contents .......................................................................................................................... vi List of Figures ............................................................................................................................... viii List of Tables ................................................................................................................................... x List of Abbreviations ...................................................................................................................... xi Statement of Original Authorship ............................................................................................... xiii Acknowledgments ....................................................................................................................... xiv Chapter 1 ....................................................................................................................................... 1 Introduction ................................................................................................................................... 1
Description of the scientific problem investigated ............................................................. 1 General objectives of the study .......................................................................................... 2 Specific aims of the study ................................................................................................... 2 Account of scientific progress linking the scientific papers ................................................ 2
Chapter 2 ....................................................................................................................................... 5 Literature Review .......................................................................................................................... 5
2.1 Taro ............................................................................................................................. 5 2.2 Taro in East Africa ........................................................................................................ 6 2.3 Factors affecting the production of taro ..................................................................... 9 2.4 Production constraints of taro in East Africa .............................................................. 9 2.5 Viral diseases of taro ................................................................................................. 10 2.6 Research problem and aim ....................................................................................... 22 2.7 Objectives .................................................................................................................. 23 2.8 References ................................................................................................................. 24
Chapter 3 ..................................................................................................................................... 35 Complete genome sequence of a novel Zantedeschia mild mosaic virus isolate: the first report from Australia and from Alocasia sp. .......................................................................................... 35
Abstract ............................................................................................................................. 37 Acknowledgments ............................................................................................................. 44 References......................................................................................................................... 45
Chapter 4 ..................................................................................................................................... 47 Identification and molecular characterisation of taro bacilliform virus and taro bacilliform CH virus from East Africa .................................................................................................................. 47
Abstract ............................................................................................................................. 49 Introduction ...................................................................................................................... 50 Materials and methods ..................................................................................................... 53 Results ............................................................................................................................... 56 Discussion .......................................................................................................................... 70 Acknowledgments ............................................................................................................. 74 References......................................................................................................................... 75
vii
Chapter 5 ...................................................................................................................................... 79 Characterisation of an Australian isolate of taro bacilliform virus and development of an infectious clone ............................................................................................................................ 79
Acknowledgments ............................................................................................................. 90 References ......................................................................................................................... 91
Chapter 6 ...................................................................................................................................... 93 Characterization of a subgroup IB isolate of Cucumber mosaic virus from Xanthosoma sp. in sub-Saharan Africa ....................................................................................................................... 93
Abstract .............................................................................................................................. 96 Acknowledgements ......................................................................................................... 109 References ....................................................................................................................... 110
Chapter 7 .................................................................................................................................... 113 Incidence and distribution of four RNA viruses infecting taro and tannia in East Africa and molecular characterisation of Dasheen mosaic virus isolates ................................................... 113
Abstract ............................................................................................................................ 116 Introduction ..................................................................................................................... 117 Materials and Methods ................................................................................................... 119 Results .............................................................................................................................. 123 Discussion ........................................................................................................................ 131 Acknowledgments ........................................................................................................... 134 References ....................................................................................................................... 135
Chapter 8 .................................................................................................................................... 139 General Discussion ..................................................................................................................... 139
References ....................................................................................................................... 143
viii
List of Figures Chapter 2 Figure 1. Taro production and use in Ethiopia and Kenya. .......................................... 8 Figure 2. The typical feathery-mottle and mosaic symptoms associated with DsMV
infection. ...................................................................................................... 11 Figure 3. Virions and genome organisation of DsMV. ............................................... 13 Figure 4. Electron micrograph showing bacilliform-shaped badnavirus particles
partially purified from taro leaves. .............................................................. 15 Figure 5. Linearised schematic representation of the genome organisation of TaBV
and TaBCHV. ................................................................................................. 16 Figure 6. Virion structure and typical genome organisation of rhabdoviruses ......... 20 Figure 7. Typical vein chlorosis symptom associated with TaVCV infection in taro. . 21
Chapter 3 Figure 1. Phylogenetic analysis of ZaMMV-AU. ......................................................... 41 Figure 2. Genome organisation of ZaMMV-AU. ......................................................... 42 Figure 3. Alignment of partial amino acid sequences of the NIb-CP junction of
ZaMMV and selected potyviruses from the BCMV subgroup. .................... 43 Chapter 4 Figure 1. Linearised schematic representation of the genome organisation of full-
length TaBV and TaBCHV isolates sequenced from East Africa. .................. 60 Figure 2. Phylogenetic analyses of the TaBV and TaBCHV sequences from East Africa
together with other representative sequences from the family Caulimoviridae. ............................................................................................ 65
Figure 3. Phylogenetic analyses of the TaBV-like sequences characterised in this study. ............................................................................................................ 66
Figure 4. Phylogenetic analyses of the TaBCHV-like sequences characterised in this study. ................................................................................................................... 68
Chapter 5 Figure 1. Schematic representation of the linearised genome of TaBV-Aus7. .......... 86 Figure 2. Phenotypic and molecular analysis of pOPT-NXT-Aus7 inoculated taro
plants. ........................................................................................................... 89
ix
Chapter 6 Figure 1. Symptoms associated with CMV-Xa. .......................................................... 98 Figure 2. Schematic representation of the genome organisation of CMV-xa. ........ 102 Figure 3. Phylogenetic analysis of CMV–Xa based on complete nucleotide
sequences. ................................................................................................. 108
Chapter 7 Figure 1. Locations of survey sites in Ethiopia, Kenya, Tanzania and Uganda......... 124 Figure 2. Photos of typical virus-like symptoms on taro and tannia plants from East
Africa. ......................................................................................................... 126 Figure 3. Phylogenetic analysis based on amino acid sequences of the core CP-
coding region of selected DsMV isolates. .................................................. 130
x
List of Tables Chapter 3 Table 1. Comparison of the nucleotide and amino acid sequences of the putative
coding and non-coding regions of ZaMMV-AU and ZaMMV-TW. ............... 40
Chapter 4 Table 1. Summary of badnavirus PCR screening and samples used for initial
sequence analysis......................................................................................... 57 Table 2. Summary of the genomic features of TaBV and TaBCHV isolates from East
Africa. ........................................................................................................... 61 Table 3. Pairwise sequence comparisons of TaBCHV isolates using core 529 nt
RT/RNase H-coding sequences. ................................................................... 69
Chapter 5 Table 1. Sampling locations and results of PCR testing for TaBV in taro leaf samples.
...................................................................................................................... 84
Chapter 6 Table 1. Next generation sequencing data from Xanthosoma sp. samples collected
from Uganda. ............................................................................................. 100 Table 2. Name, subgroup, country of origin and accession numbers of CMV
sequences from NCBI database used in the analysis. ................................ 103
Chapter 7 Table 1. Primers used for virus detection with RT-PCR. .......................................... 121 Table 2. Summary of PCR and RT-PCR screening results for viruses infecting taro and
tannia samples in this study. ...................................................................... 125
xi
List of Abbreviations
aa amino acid
AAS Australia Awards Scholarship
bp base pair/s
BecA–ILRI Hub Biosciences eastern and central Africa–International
Livestock Research Institute Hub
BLAST basic local alignment search tool
cDNA complementary DNA
CTAB cetyl trimethyl ammonium bromide
CTCB Centre for Tropical Crops and Biocommodities
DB-PCR direct-binding polymerase chain reaction
DNA deoxyribonucleic acid
ds double-stranded
EIAR Ethiopian Institute of Agricultural Research
ELISA enzyme-linked immunosorbent assay
g gravity
gfp green fluorescent protein
ha hectare
Hz hertz
IC-PCR immuno-capture polymerase chain reaction
ICTV International Committee on Taxonomy of Viruses
IR intergenic region
kbp kilobase pair/s
kDa kilodalton/s
min minute/s
ml millilitre
NARS National Agricultural Research Systems
NCBI National Centre for Biotechnology Information
ng nanogram
NGS Next Generation Sequencing
xii
nm nanometre/s
nt nucleotide/s
nptII neomycin phosphotransferase II
ORF open reading frame
PBS-T phosphate buffered saline with Tween-20
PCR polymerase chain reaction
pH -log (hydrogen ion concentration)
ρmol picomole/s
RACE rapid amplification of cDNA ends
RCA rolling circle amplification
RNA ribonucleic acid
RNase H ribonuclease H
RT reverse transcriptase
RT-PCR reverse transcription polymerase chain reaction
s second/s
SEF Science and Engineering Faculty
sp. species
t ton/s
QUT Queensland University of Technology
UTR untranslated region
V volt/s
µl microlitre/s
µg microgram
°C degrees Celsius
xiii
Statement of Original Authorship
I certify that this thesis is my own work and contains no material which has been
previously submitted to meet requirements for an award at this or any other higher
education institution. To the best of my knowledge and belief, the thesis contains no
material previously published or written by another person, except where due
reference is made.
Signature
Date
QUT Verified Signature
xiv
Acknowledgments
I am deeply thankful to my wife Abigail for her support, understanding and
patience throughout my study. I am so sorry for keeping you up late while I
stayed longer in the lab. Those extra 5 minutes in the lab are what made this
possible.
I would also like to express my deepest gratitude to my supervisors Rob Harding,
Anthony James, James Dale and Adane Abraham for their unconditional support,
guidance and encouragement. Rob and AJ, your dedication, hard-work and
meticulousness make me travel an extra mile, read more, think more, of course
pipette more and write more but, in the end, you crafted me very well. While
saying this without forgetting all the celebrations we had for every small success,
thank you very much.
Ben, ‘Science Faculty’, I don’t know how to express my deepest gratitude to you.
Your advice, support and humour made me pass all the challenges and cloudy
days I faced - you are a real friend to depend on and a real genius.
I am very thankful to my friend Amit for suggestions, sharing frustrations and
celebrating every small success along the way (Uni pub should also take some
credit for that). I am glad to have a friend whom I can call a brother.
I am also very thankful to Timothy Holton and his family, for the love they showed
me and for his support and guidance at the beginning of this project and during
the pilot study which has paved my path.
To everyone who helped me during sample collection, Mengistu, Demelw,
Stephen, Paul, Abigail, Ndungu, Margaret, Julius, Castro, and Kwame, thank you
very much for the care you showed me during my visit and sharing the hard work
of sample collection and making my life easier, especially with translations. I
could have come out empty-handed from all my surveys without your kind
xv
assistance. I am also very thankful to all the farmers in all the countries for
allowing me to inspect their farms and collect samples.
I am greatly indebted for all the support, encouragement and love I received
from all the wonderful students and staff at CTCB, with special thanks to Dani,
JY, Saga and CTCB admin. I am also thankful to all my colleagues from Holetta
National Agricultural Biotechnology Laboratory, Ethiopia, for all the support you
gave me, and especially Melaku for taking care of all my official communications.
From CSSF, Jennifer and Anne, thank you very much for the excellent job you are
doing.
To my friend Zola and Abdulwahab, thank you very much for all the advice and
the strength you built inside me, it all adds up to this.
ABCF program and fellows, capacity building team particularly Appolinaire,
Ekaya, Francesca, Val, Joyce, Dedan, Marvin, all research assistants, and all staff
at BecA–ILRI Hub, I really appreciate your kind support and encouragement.
I am very grateful to Australian Awards scholarship, Centre for Tropical Crops and
Biocommodities, Queensland University of Technology, Ethiopian Institute of
Agricultural Research and Biosciences eastern and central Africa for sponsoring
this study - without you this could not be possible. I also wish to thank
international student services at QUT for their kind support and encouragement
along the way.
To my family, words cannot express how grateful I am for all your sacrifices,
support and encouragement and, above all, for allowing me to follow my heart
and make me a confident person. Special thanks to my brothers and sister for all
your unreserved support, especially during those challenging times of our life.
This thesis is dedicated to my parents and grandparents.
xvi
1
Chapter 1
Introduction
This thesis is presented in ‘Thesis by Publication’ style containing a
comprehensive literature review section (Chapter 2) followed by five results
chapters (Chapter 3 to 7) and a general discussion chapter (Chapter 8). Of the
five results chapters, Chapter 3 and 5 have been published in the journal Archives
of Virology. Chapters 4 and 6 have been submitted for publication, while Chapter
7 has been formatted for submission to the journal Annals of Applied Biology.
Therefore, the presentation of the results chapters follows the formatting style
of the target journals.
Description of the scientific problem investigated
Taro (Colocasia esculenta (L.)) and other edible aroids, such as tannia
(Xanthosoma sp.), are among the most important crops cultivated by small-
holder farmers in East Africa. The production of taro in Ethiopia, as well as Kenya,
Uganda and Tanzania, has declined significantly in recent times due to a lack of
improved planting materials and the occurrence of weeds, pests and diseases. In
addition, aroids are receiving less attention from both national and regional
agricultural research institutes in terms of research and development activities.
A pilot study in 2013 to identify taro viruses in Ethiopia and Kenya confirmed the
presence of the potyvirus Dasheen mosaic virus (DsMV) and the badnavirus Taro
bacilliform virus (TaBV). Apart from this study, the incidence, distribution and
genome organisation of viruses infecting taro and other edible aroids in the
region was unknown at the commencement of this PhD project. As the threat of
viral diseases on this economically important crop warrants urgent attention, the
identification of viruses affecting taro production throughout the region was
considered a research priority. Therefore, to address the lack of knowledge on
the incidence and distribution of viral diseases of taro and other edible aroids in
East Africa, and to establish a capacity for virus-indexing of aroids in the region,
2
the current PhD project was initiated. This project has established a baseline for
knowledge on the occurrence and distribution of viruses infecting taro, and the
related crop tannia, in East Africa and will contribute towards taro disease
management both within the region and worldwide.
General objectives of the study
The general objective of this study was to identify, characterise and determine
the distribution of economically important viruses infecting taro and other edible
aroids in East Africa.
Specific aims of the study
The specific aims of this project were to (i) conduct extensive surveys in four East
African countries and determine the incidence and distribution of known DNA
and RNA viruses infecting taro and other edible aroids in East Africa, and (ii)
characterise, at the molecular level, the viruses detected.
Account of scientific progress linking the scientific papers
During the initial work at QUT to develop/optimise assays for the detection of
potyviruses, a leaf sample was collected from an Alocasia plant (member of the
Araceae family) growing near Brisbane which showing symptoms typical of
DsMV. The sample tested positive by PCR and further characterisation showed
that it was an isolate of Zantedeschia mild mosaic virus (ZaMMV), another
species in the genus Potyvirus. As this was the first report of ZaMMV from
Australia, as well as from an Alocasia sp., the complete genome sequence of this
novel isolate was determined and analysed. These results are presented in
Chapter 3.
3
Chapter 4 describes the occurrence, distribution and molecular
characterisation of two distinct members of the genus Badnavirus, TaBV and Taro
bacilliform CH virus (TaBCHV), in East Africa. This was the first comprehensive study
covering the four countries in the region (Ethiopia, Kenya, Tanzania and Uganda) with
392 samples collected from 25 districts. The results showed that badnaviruses are
widespread in East Africa, but no symptoms were consistently associated with
infections.
There are no reports on the host range of TaBV or yield losses due to infection.
Infectious clones of plant viruses are a convenient way to undertake such studies and,
therefore, Chapter 5 describes the development of the first infectious clone of TaBV.
Due to strict biosecurity regulations in Australia, it was not possible to develop an
infectious clone for an African TaBV isolate. Therefore, an Australian TaBV isolate was
identified for use as a model system and its complete genome sequence was
determined. Taro plants were inoculated with the TaBV infectious clone and some
leaves displayed mild downward-curling, a symptom sometimes observed on taro
plants in the field. The infectious clone will be useful in screening aroid germplasm
for resistance and also for investigations into host range and yield.
The remaining two chapters mainly involved work to characterise RNA viruses
infecting aroids in East Africa. During surveys in Uganda, three tannia samples
showing symptoms usually associated with DsMV infection were collected. The
samples tested negative for potyviruses but were subsequently found to be infected
with cucumber mosaic virus (CMV) following RNAseq Next Generation Sequencing.
Sequence analysis revealed the first subgroup-IB isolate of CMV from sub-Saharan
Africa and also that the RNA2 encoded a putative novel ORF. The results are
presented in Chapter 6.
The final results chapter (Chapter 7) summarises the findings of the field
surveys, with a particular emphasis on RNA viruses. The incidence and distribution of
DsMV, CMV and rhabdoviruses is presented in addition to any correlations observed
between virus infection and symptoms.
4
This study is the first to comprehensively assess the occurrence, incidence and
sequence diversity of taro and tannia viruses in East Africa. Sequence information has
been deposited in the National Centre for Biotechnology Information (NCBI) GenBank
database and a collection of the samples is stored at the BecA–ILRI Hub laboratory in
Nairobi, Kenya, for future analysis if needed.
5
Chapter 2
Literature Review
2.1 Taro
Taro (Colocasia esculenta (L.) Schott) belongs to the Araceae family (Vaneker &
Slaats, 2012) which comprises a diverse range of plants commonly called aroids. Taro
originated in south-east or south-central Asia and is believed to have been first
domesticated in northern India (Kantaka, 2004; Wilson & Siemonsma, 1996). Aroids
are the world’s oldest food crops, being utilised even before the domestication of
wheat and rice. They are among the six most important root and tuber crops, and
rank fourteenth among staple vegetable crops (Vaneker & Slaats, 2012; Kantaka,
2004). Archaeological evidence from the Solomon Islands suggests that taro was
being propagated around 28,700 years ago and it was introduced to Egypt and East
Africa at least 2000 years ago (Vaneker & Slaats, 2012; Kantaka, 2004). The five most
cultivated aroids, used as food are taro (Colocasia esculenta (L.) Schott), tannia
(Xanthosoma sagittifolium L.), elephant ear (Alocasia spp), elephant foot yam
(Amorphophallus paeoniifolius Dennst (Nicolson)) and swamp taro (Cyrtosperma
merkusii Hassk (Schott)).
Taro is an erect, herbaceous perennial plant but most often it is grown as an
annual crop (Kantaka, 2004; Wilson & Siemonsma, 1996). It performs best in the
tropics and tolerates a wide range of environments and agricultural practises
(Kantaka, 2004). It is tolerant to drought and low temperatures and can also be
cultivated on dry land or under flooded conditions. In addition, it is tolerant to shade
making it suitable for intercropping in agroforestry systems (Wilson & Siemonsma,
1996). In the wet tropics, aroids can be cultivated throughout the year. Rainfall,
between 200 and 300 mm/month, is ideal for optimum growth and production.
However, irrigation is necessary for taro and swamp taro in low rainfall areas, while
tannia, elephant ear and elephant foot yam are more drought tolerant. The time
needed to reach maturity varies according to species/variety, temperature, sunlight
6
and water availability (Lebot, 2009). Under ideal agronomic practises, taro can give
yields up to 60 – 110 t/ha (Lebot, 2009).
In 2012, worldwide production of taro was 9.98 million metric tons from a total
of 1.32 million hectares of land, with Africa accounting for 7.36 million metric tons
(FAOSTAT, 2014). Nigeria is the world’s largest producer of taro with a total
production of 3.45 million metric tons in 2012, followed by China, Cameroon and
Ghana (FAOSTAT, 2014).
The corms and leaves of taro are very rich sources of easily digestible starch
and dietary fibre. They also contain substantial amounts of protein, vitamin C,
thiamine, riboflavin, niacin, β-carotene, iron and folic acid (Ndabikunze et al., 2011;
Tumuhimbise et al.; 2009). The corm can be sliced and fried into chips and is used in
the preparation of soups, beverages and puddings. The starch is used in baby foods
and as a cereal substitute. In Hawaii, the corms are processed into flour and used for
biscuits and bread. The leaves are eaten as leafy vegetables and pot-herbs for soups
and sauces (Wilson & Siemonsma, 1996). Although the medicinal value of taro corm
or leaf has not been studied in detail, in different parts of the world people use taro
corm and/or leaf to treat snakebites, rheumatism, arterial hypertension, liver
infection and ulcers (Wilson & Siemonsma, 1996).
2.2 Taro in East Africa
Taro plays a significant social, cultural and economic role for most small scale farmers
in East Africa (Akwee et al., 2015; Onwueme and Charles, 1994; Talwana et al., 2009).
There are reports showing taro and other edible aroids are introduced into the
African continent at different times from different sources. The first introduction of
taro to East Africa is believed to be at least 2,000 years ago to Egypt via Arabia
(Plucknett et al., 1970; Bown, 2000; Kantaka, 2004). In addition, tannia (Xanthosoma
sp.) was introduced to Central and West Africa between the 16th and 17th centuries
by the Portuguese (Bown, 2000).
7
In the south and south-western part of Ethiopia around 20 million people
depend on root crops such as potato, sweet potato, taro and enset for their dietary
intake, during both surplus and poor harvest years (Mariame and Gelmesa, 2006;
Beyene, 2013; Harrison et al., 2014). Taro (locally called ‘godere’) (Figure 1A, B) and
enset are propagated mainly because they are known to perform well in drought-
prone areas where the annual rainfall is too low to support the production of other
crops (Harrison et al., 2014). In Sheka (a town in the southwest of Ethiopia), taro
remains important, since it is available throughout the year (Mariame and Gelmesa,
2006).
In Kenya, taro, also known locally as ‘arrowroot’, and tannia are a basic source
of starch in the diet for many communities in the Mount Kenya and Aberdares
districts of central Kenya, as well as in the Lake Victoria basin districts of Kakamega,
Kisumu and Siaya, where it is mainly cultivated adjacent to streams and rivers (Akwee
et al., 2015; Figure 1C, D, E). In Tanzania and Uganda, taro and tannia are mainly
grown along the Lake Victoria basin, including Bukoba, Musoma, Tarime, Biharamulo
and Mwanza districts in Tanzania and the Mitiyana, Masaka, Jinja, Iganga and Luuka
districts in Uganda (Talwana et al., 2009; Ndabikunze et al., 2011).
In Ethiopia in the fiscal years 2009/10, 2010/11 and 2011/12, the average taro
production was 7.77, 8.03 and 7.94 t/ha, respectively (CSA, 2010; CSA, 2011; CSA,
2012). In the years 2007, 2008 and 2009, the average taro production in Kenya was
7.70, 7.49 and 9.62 t/ha, respectively (CPPMU, 2010). In Uganda and Tanzania, the
average annual production is less than 1 t/ha (Tumuhimbise et al., 2009; Talwana et
al., 2009).
8
Figure 1. Taro production and use in Ethiopia and Kenya.
(A) Taro plantation at Areka Agricultural Research Centre, Ethiopia, (B) Local taro market in Welayita, Ethiopia, (C) Taro and tomatoes in a supermarket in Nairobi, Kenya, (D) Boiled taro, a typical breakfast in Kenya, (E) Taro leaf vegetable.
A A B
C
D
E
9
2.3 Factors affecting the production of taro
Several pests and diseases are known to cause significant yield reduction in taro with
different insects, snails and nematodes among the pests (Lebot, 2009). There are also
some reports on abiotic stresses caused by nutrient deficiency, temperature and
water shortage affecting the production of taro (Carmichael et al 2008; Zettler, 1989;
Ooka, 1990). Numerous viral, bacterial and fungal pathogens are also known to infect
taro and result in significant production loss in terms of quantity and quality (Zettler,
1989; Revill et al., 2005a). Taro leaf blight caused by the Oomycete, Phytophthora
colocasiae, is a disease of major importance in many regions of the world where taro
is grown (Sharma et al., 2009; Singh et al., 2012). Bacterial soft rot and bacterial leaf
spot are among the most economically important bacterial diseases of taro
(Carmichael et al 2008; Ooka, 1990). Viruses are one of the most important
pathogens affecting taro and, since the focus of this PhD study is on viruses of taro,
they are discussed in more detail in section 2.5.
2.4 Production constraints of taro in East Africa
Although taro has significant social, cultural and economic importance for most small
scale farmers in East Africa, the average yields obtained from taro are below the
potential of the crop due to various constraints including diminishing soil fertility,
unavailability of improved varieties, competition due to weeds and the presence of
pests and diseases (Akwee et al., 2015; Talwana et al., 2009; Tumuhimbise et al.,
2009). In Africa, particularly Eastern Africa, the situation of low taro yields is
intensified by a lack of research and extension efforts to support the production,
utilisation and consumption of the crop (Akwee et al., 2015; Ndabikunze et al., 2011;
Talwana et al., 2009). Consequently, production of taro in East Africa is lagging behind
that of other root and tuber crops (Tumuhimbise et al., 2009). A pilot study on taro
viruses in Ethiopia and Kenya conducted by Kidanemariam et al. (2018), confirmed
the presence of dasheen mosaic virus (DsMV), taro bacilliform virus (TaBV) and
10
possibly two other viruses. Aside from this previous study, there is no other
information regarding taro viruses in the region.
2.5 Viral diseases of taro
Viruses are among the most economically important pathogens of taro and infection
can result in significant yield losses (Revill et al., 2005a). Moreover, the presence of
taro viruses restricts the international movement of germplasm, which has a serious
impact on its accessibility and production (Revill et al., 2005a). Until relatively
recently, studies on taro viruses have been limited to a number of Pacific Island
countries and all diagnostic tests have been developed using viruses identified from
this region (Yang et al., 2003a, b; Pearson et al., 1999; Revill et al., 2005a, b).
2.5.1 Dasheen mosaic virus (DsMV)
DsMV is one of the most important viruses known to infect both edible and
ornamental aroids worldwide (Elliott et al., 1997). The virus was first reported in 1970
from Florida, USA and subsequently assigned under the family Potyviridae, genus
Potyvirus (Zettler et al., 1970). DsMV is transmitted in a non-persistent manner by
several aphid species including Myzus persicae and Aphis gossypii and it can also be
transmitted by vegetative propagation or mechanically with infected plant sap (Babu
et al., 2011; Elliott et al., 1997; Nelson, 2008). The virus has a natural host range of at
least 16 genera from both edible and ornamental members of the Araceae family
including Cyrtosperma and Alocasia (Elliott et al., 1997). DsMV infection typically
results in a characteristic feathery-mottle and mosaic symptoms, but symptoms may
vary considerably with cultivars and seasons (Figure 2; Elliott et al., 1997). DsMV
infection is reported to affect both quality and quantity of the corm with production
loss ranging from 20 – 60 % (Rana et al., 1983; Elliott et al., 1997).
11
Figure 2. The typical feathery-mottle and mosaic symptoms associated with DsMV infection. (A) Taro (Colocasia esculenta), (B) tannia (Xanthosoma sagittifolium) (Nelson, 2008).
A B
12
DsMV consists of filamentous virions of ∼750 nm long and 11-15 nm in diameter
(Figure 3A). The genome comprises a monopartite molecule of single-stranded (ss),
positive sense RNA of ∼10 kbp, which consists of 5ˈ and 3ˈ terminal UTRs flanking a
major single ORF and the 3ˈ UTR terminating with a poly-A tail (Hull, 2014; King et al.,
2012; Cuevas et al., 2012; Adams et al., 2005; Ha et al., 2008a). The major single ORF
is translated into a large polyprotein which is subsequently processed into ten
functional proteins by the action of several viral-encoded proteinases (Hull, 2014;
King et al., 2012). The ten functional proteins in their order from 5ˈ to 3ˈ are P1 (first
protein), HC-Pro (helper component protease), P3 (third protein), 6K1, CI (cylindrical
inclusion protein), 6K2, VPg (viral protein genome-linked), NIa-Pro (major- protease
of small nuclear inclusion protein -NIa), NIb (large nuclear inclusion protein) and CP
(coat protein) (Figure 3B; Hull, 2014; Cuevas et al., 2012; Adams et al., 2005). The
currently accepted criteria for distinguishing virus species within the family
Potyviridae is based on genome sequence relatedness. Different species have an
amino acid (aa) sequence identity less than 80 % in the CP-coding region and/or
nucleotide (nt) sequence identity less than 76 % over the entire genome. In addition,
differences in host range and host reaction, antigenic properties and the morphology
of inclusion bodies can be considered as criteria for demarcation (King et al., 2012).
Symptomatology, serology and molecular approaches have been used for the
detection of DsMV (Abo El-Nil et al., 1977; Nelson, 2008; Babu and Hegde, 2014).
However, due to high sensitivity, molecular techniques are the most preferred
method. Several published degenerate and virus specific primers targeting the most
conserved regions including CP, CI and Nib of potyvirus or DsMV are available (Revill
et al., 2005a; Ha et al., 2008b; Zheng et al., 2010). Furthermore, several cultural,
agronomical and biotechnological approaches have also been used to control DsMV
infection in taro (Zettler and Hartman, 1986; Shaw et al., 1979). However, successful
elimination of DsMV from taro plants was achieved through tissue culture technique
using 0.5 mm meristem-tip culture (Zettler and Hartman, 1987; Zettler et al., 1989).
13
Figure 3. Virions and genome organisation of DsMV. (A) Negatively stained flexuous rod-shaped particles of DsMV (Zettler et al., 1970); (B) Schematic representation of Potyvirus genome (Cuevas et al., 2012). The ten functional proteins represented. P1: first protein, HC-Pro: helper component protease, P3: third protein, 6K1, CI: cylindrical inclusion protein, 6K2, VPg: viral protein genome-linked, NIa: major protease of small nuclear inclusion protein, NIb: large nuclear inclusion protein, and CP: coat protein.
A
B
14
2.5.2 Badnaviruses
Badnaviruses are plant pararetroviruses in the family Caulimoviridae, genus
Badnavirus (Geering and Hull, 2012; Geering, 2014; Bhat et al., 2016, Bömer et al.,
2017). The genus Badnavirus is the most diverse and heterogeneous member of the
family Caulimoviridae both at the genomic and antigenic level. Currently, it comprises
more than forty distinct recognised species (https://talk.ictvonline.org/taxonomy/),
the majority of which infecting a broad range of economically important tropical and
subtropical crops worldwide including banana, yam, taro, sugarcane, black pepper,
citrus, and cacao with some reports also from temperate regions in hosts such as
raspberry, gooseberry and ornamental spiraea (Bhat et al., 2016; Yang et al., 2003a;
Iskra-Caruana et al., 2014). An estimated 10-90 % economic loss is recorded in various
crops as a result of infection from different species of badnaviruses (Bhat et al., 2016).
Currently, there are two distinct species of badnavirus which have been reported to
infect taro, namely TaBV (Yang et al., 2003a, b) and Taro bacilliform CH virus (TaBCHV)
(Ming et al., 2013; Kazmi et al., 2015; Geering and Teycheney, 2016).
TaBV is a bacilliform-shaped virus, which has virions of 130 x 30 nm (Figure 4)
and a circular, double-stranded (ds) DNA genome comprising ∼7.5 kbp (James et al.,
1973; Bhat et al., 2016; King et al., 2012). The genome of TaBV possesses four ORFs,
all encoded on the plus-strand of the viral DNA, with the size and organisation of ORFs
1-3 consistent with most badnaviruses (Figure 5A; Yang et al., 2003a). ORF 1 and 2 of
TaBV encodes proteins of 16.67 and 15.78 kDa, respectively. The function of the
protein coded by ORF 1 is unknown, whereas the protein coded by ORF 2 has
nonspecific DNA and RNA binding activity and may be involved in virion assembly
(Jacquot et al., 1996). ORF 3 encodes a large polyprotein (214.34 kDa) which contains
motifs that are conserved amongst badnaviruses including movement protein (MP),
coat protein (CP), aspartic protease (AP), reverse transcriptase (RT) and ribonuclease
H (RNase H) (Yang et al., 2003 a, b; Hull, 2014). ORF 4, which overlaps with ORF 3,
encodes a small protein (∼13.1 kDa) of unknown function (Figure 5A; Yang et al.,
2003b).
15
Figure 4. Electron micrograph showing bacilliform-shaped badnavirus particles partially purified from taro leaves. (James et al., 1973).
16
Figure 5. Linearised schematic representation of the genome organisation of TaBV and TaBCHV. (A) TaBV, (B) TaBCHV. Functional proteins encoded by ORF 3 are represented. MP: movement protein, CP: coat protein, Zn: zinc finger-like domains, AP: aspartic protease, RT: reverse transcriptase, RNase H: ribonuclease H.
1000 2000 3000 4000 5000 6000 7000
tRNAmet TATA PolyA ORF 1 ORF 2
ORF 4
MP CP Zn AP RT RNase H ORF 3
1000 2000 3000 4000 5000 6000 7000
tRNAmet TATA PolyA ORF 1
ORF 2 ORF 5
MP CP Zn AP RT RNase H ORF 3
ORF 4 ORF 6
A
B
17
In contrast to TaBV, TaBCHV encodes six putative ORFs, with ORFs 1-4
analogous to TaBV and an additional two small ORFs at the 3' end of ORF 3 (Figure
5A, B; Kazmi et al., 2015). ORF 5 partially overlaps ORF 3, while ORF 6 is downstream
of, and partially overlaps, the 3' end of ORF 5 (Figure 5B; Kazmi et al., 2015).
According to the International Committee on Taxonomy of Viruses (ICTV), the
criterion for demarcation of species in the genus Badnavirus is a threshold of 20 %
nucleotide divergence in the RT/RNase H-coding region of ORF 3 (King et al., 2012).
The current genetic diversity of badnaviruses appears to be structured into three
major clades. Interestingly, however, Bougainvillea spectabilis chlorotic vein-banding
virus (BCVBV) and TaBV isolates group as an additional clade which appears as an out-
group (Iskra-Caruana et al., 2014).
TaBV appears to infect plants without causing symptoms or to cause only mild
symptoms such as vein clearing, stunting and down-curling of the leaf blades (Bhat
et al., 2016; Revill et al., 2005a, Yang et al., 2003a). A synergistic infection with
colocasia bobone disease-associated virus (CBDaV), a putative rhabdovirus, is
thought to result in the lethal disease ‘alomae’ which is the most economically
important virus disease affecting taro (Higgins et al., 2016; Revill et al., 2005a;
Macanawai et al., 2005). TaBV has a natural host range restricted to aroids. The virus
can be transmitted by the mealybugs (Sedococcus longispinus), seed or pollen but it
is not mechanically transmissible (Macanawai et al., 2005).
All members of the family Caulimoviridae are pararetroviruses. Therefore, at
least one part of the viral replication occurs in the nucleus where the viral DNA
genome is transcribed from minichromosomes formed by an association with
histones (Iskra-Caruana et al., 2014; Hull, 2014). This likely facilitates the random
integration of viral DNA into the host genome by illegitimate recombination or during
repair of DNA breaks which contributes to the diversity and evolution of badnaviruses
(Iskra-Caruana et al., 2014; Holmes, 2011). Integrated viral sequences of badnavirus
are also known as endogenous badnaviruses (Holmes, 2011).
18
Different molecular and serological diagnostic tools have been developed in the
past for the detection of different badnaviruses (Yang et al., 2003b; Harper et al.,
1999; Sukal et al., 2017; James et al., 2011a; Bomer et al., 2016; Bomer et al., 2017).
Immuno-capture-PCR (IC-PCR), direct-binding polymerase chain reaction (DB-PCR),
immuno-sorbent electron microscopy (ISEM) and ELISA techniques were limited due
to the higher serological variability of badnaviruses (Harper et al., 1999; Mulholland,
2005; Le Provost et al., 2006; Geering and Hull, 2012). In addition, due to the
illegitimate integration of viral DNA into the host genome, PCR tests can also give a
false positive amplification where such phenomenon has been observed in banana
for the detection of banana streak virus (Geering et al., 2005; James et al., 2011b).
Recently, rolling circle amplification (RCA) techniques have been optimised for the
selective detection and amplification of different episomal badnavirus DNAs using
bacteriophage Phi29 DNA polymerase (James et al., 2011a, b; Bomer et al., 2016;
Sukal et al., 2017). RCA is a non-sequence-specific method for the amplification of
circular DNA molecules and has been used successfully to amplify plant viruses in all
three families with circular DNA genomes (Caulimoviridae, Geminiviridae and
Nanoviridae). To amplify episomal virus DNA, isothermal amplification is carried out
at 30 oC for 18 hours, followed by restriction digestion of the products with
endonuclease enzyme and visualise digested fragments using agarose gel
electrophoresis. Digested reaction products can subsequently be cloned and
sequenced (Sukal et al., 2017; Johne et al., 2009; James et al., 2011a).
2.5.3 Taro vein chlorosis virus (TaVCV)
TaVCV is an enveloped, bullet-shaped virus in the family Rhabdoviridae, genus
Nucleorhabdovirus with virions ∼210 x 70 nm (Revill et al., 2005b). The genome of
TaVCV comprises a molecule of single-stranded, negative sense RNA of ∼12 kbp and
has six open reading frames (Hull, 2014; Revill et al., 2005b). Three of the six encoded
proteins, namely the nucleocapsid protein (N), phosphoprotein (P) and RNA-
dependent RNA-polymerase (L) are associated with the RNA in the virion (Hull, 2014).
The glycoprotein (G) associates with the matrix protein (M) to form the major
19
structural component of the virion outer shell, while the remaining ORF encodes the
movement protein (3) (Figure 6A, B; Hull, 2014; Revill et al., 2005b).
A distinct leaf-vein chlorosis near the leaf margin is a typical symptom caused
by TaVCV (Pearson et al., 1999; Revill et al., 2005b; Figure 7). The virus has been
reported from several South Pacific island countries as well as Hawaii (Revill et al.,
2005b; Long et al., 2014). PCR based diagnostic tools have been successfully used for
the detection of TaVCV (Revill et al., 2005b).
2.5.4 Colocasia bobone disease-associated virus (CBDaV)
CBDaV is an uncharacterised virus which has been classified as a putative member of
the family Rhabdoviridae based on sequence analysis and the presence of a
characteristic, enveloped, bullet-shaped particles of ∼300 x 50 nm observed in sap
extracts (Higgins et al., 2016; Pearson et al., 1999). Previously it was known as taro
large bacilliform virus. CBDaV is symptomatically recognised by leaf distortions,
formation of galls on petioles and plant stunting. The virus is much more devastating
when there is co-infection of TaBV. The virus has only been reported from Papua New
Guinea and Solomon Islands (Higgins et al., 2016; Pearson et al., 1999; Revill et al.,
2005b).
2.5.5 Taro reovirus (TaRV)
TaRV is among the more recently identified taro viruses (Revill et al., 2005a, b). It is a
putative member of the family Reoviridae and genus Oryzavirus based on sequence
analysis of four partial genomic segments (Revill et al., 2005a). Reoviruses have an
icosahedral double capsid viral particle with a diameter of 75 - 80 nm (Hull, 2014;
King et al., 2012). Viruses in the genus Oryzavirus have a genome comprised of 10
segments of linear, double-stranded RNA (dsRNA) with the size of segments varying
between 1.1 - 3.8 kbp (Hull, 2014). No symptoms have been associated with TaRV
infection and the virus has only been detected in symptomless taro plants and plants
infected with other viruses (Revill et al., 2005a).
20
Figure 6. Virion structure and typical genome organisation of rhabdoviruses
leader N P 3 M G L trailer 3' 5'
A
B
(A) Bullet-shaped virion strcture; (B) genome organisation of Taro vein chlorosis virus (King et al., 2012).
21
Figure 7. Typical vein chlorosis symptom associated with TaVCV infection in taro. Photo: Prof. Rob Harding.
22
2.5.6 Other viruses infecting taro and other aroids
Several other viruses have been reported to infect taro and other aroids. Konjac
mosaic virus (KoMV) from the family Potyviridae and genus Potyvirus was reported
from India infecting taro, elephant foot yam (Amorphophallus paeoniifolius),
Caladium sp. and Dieffenbachia sp. (Manikonda et al., 2011; Padmavathi et al., 2013).
Furthermore, the potyvirus Zantedeschia mild mosaic virus (ZaMMV) was reported
infecting calla lily and Alocasia sp. from Taiwan and Australia (Huang et al., 2005,
Huang et al., 2007; Kidanemariam et al., 2016). Wang et al. (2014), reported the first
incidence of Cucumber mosaic virus (CMV), family Bromoviridae genus Cucumovirus
infecting taro from China. In 2011, Groundnut bud necrosis virus (GBNV) from the
family Bunyaviridae, genus Tospovirus was reported infecting taro in India
(Sivaprasad et al., 2011). In addition, Calla lily chlorotic spot virus (CCSV), a putative
tospovirus, was reported infecting calla lily in Taiwan (Chen et al., 2012). Except
ZaMMV, which was reported from Australia infecting Alocasia sp., the other reports
of taro and other aroids infected with viruses mentioned are basically from the Asian
continent. In addition, apart from their occurrence and genome characterisation,
production loss or other agronomic traits associated with these viruses on aroids is
yet unknown. PCR based detection techniques have been used for the detection of
these viruses.
2.6 Research problem and aim
Despite the substantial contribution of taro to the food and income security for many
small scale farmers in East Africa, the crop has gained very low research priority
within the region (Akwee et al., 2015; Talwana et al., 2009; Tumuhimbise et al., 2009).
The production of taro in the region has declined significantly over time due to poor
agronomic practices and various biotic and abiotic stresses (Talwana et al., 2009).
Viruses are known to be one of the most important constraints to production, with
some infections resulting in a severe reduction in quantity and quality of production
(Talwana et al., 2009; Revill et al., 2005b; Lebot et al., 2004). The status of taro viruses
23
in East Africa has not been extensively studied. However, in a small pilot study
conducted by Kidanemariam et al. (2018) in Ethiopia and Kenya, DsMV, TaBV and
possibly two other viruses were detected. A more extensive study is now warranted
in order to identify the viruses affecting taro and possibly other aroids from the
region that may serve as virus reservoirs. Therefore, the aim of this project was to
determine the identity and incidence of economically important viruses associated
with taro, and other important aroids where possible, in East Africa.
2.7 Objectives
The specific aims of this project were to (i) conduct extensive surveys in four East
African countries and determine the incidence and distribution of known DNA and
RNA viruses infecting taro and other edible aroids in East Africa, and (ii) characterise,
at the molecular level, the viruses detected.
24
2.8 References
Abo El-Nil, M.M., Zettler, F.W., Hiebert, E. (1977). Purification, serology and some
physical properties of dasheen mosaic vims. Phytopathol. 67:1445–1450.
Akwee, P.E., Netondo, G., Kataka, J.A. and Palapala, V.A. (2015). A critical review of
the role of taro Colocasia esculenta L. (Schott) to food security: A comparative
analysis of Kenya and Pacific Island taro germplasm. Scientia Agri. 9:101–108.
Adams, M., Antoniw, J. and Fauquet, C. (2005). Molecular criteria for genus and
species discrimination within the family Potyviridae. Arch. Virol. 150:459–479.
Babu, B., Hegde, V., Makeshkumar, T. and Jeeva, M. (2011). Characterisation of the
coat protein gene of dasheen mosaic virus infecting elephant foot yam. J. Plant
Pathol. 93:199–203.
Babu, B. and Hegde, V. (2014). Molecular characterization of dasheen mosaic virus
isolates infecting edible aroids in India. Acta Virologica 58:34–42.
Beyene, T.M. (2013). Morpho-agronomical characterization of taro (Colocasia esculenta) accessions in Ethiopia. SciencePG 1:1–9.
Bhat, A.I., Hohn, T. and Selvarajan, R., (2016). Badnaviruses: the current global
scenario. Viruses 8:177.
Bomer, M., Turaki, A.A., Silva, G., Kumar, P. and Seal, S.E. (2016). A sequence-
independent strategy for amplification and characterisation of episomal
badnavirus sequences reveals three previously uncharacterised yam
badnaviruses. Viruses 8:188.
Bömer, M., Rathnayake, A. I., Visendi, P., Silva, G., & Seal, S. E. (2017). Complete
genome sequence of a new member of the genus Badnavirus, Dioscorea
bacilliform RT virus 3, reveals the first evidence of recombination in yam
badnaviruses. Arch. Virol. 163:553–538.
Bown, D. (2000). Aroids: plants of the Arum family (No. Ed. 2). Timber press.
25
Carmichael, A., Harding, R., Jackson, G., Kumar, S., Lal, S., Masamdu, R., Wright, J. and
Clarke, A. (2008). TaroPest: an illustrated guide to pests and diseases of taro in
the South Pacific. ACIAR 132:76.
Chen, T.C., Li, J.T., Lin, Y.P., Yeh, Y.C., Kang, Y.C., Huang, L.H., and Yeh, S.D. (2012).
Genomic characterization of Calla lily chlorotic spot virus and design of broad-
spectrum primers for detection of tospoviruses. Plant Pathol. 61:183–194.
CPPMU (Central Planning and Project Monitoring Unit), (2010). Republic of Kenya.
Ministry of Agriculture. Economic review of agriculture, 2010. Accessed
29/03/2014 http://www.kilimo.go.ke/kilimo_docs/pdf/ERA_2010.pdf.
CSA (Central Statistical Agency), (2010). Federal democratic republic of Ethiopia.
Central statistical agency. Agricultural sample survey 2009 / 2010, Report on
area and production of major crops. Statistical bulletin, 4. Addis Ababa,
Ethiopia. Accessed 28/03/2014
http://harvestchoice.org/sites/default/files/downloads/publications/Ethiopia
_2009-0_Vol_4.pdf.
CSA (Central Statistical Agency), (2011). Federal democratic republic of Ethiopia.
Central statistical agency. Agricultural sample survey 2010 / 2011, Report on
area and production of major crops. Statistical bulletin, 1 . Addis Ababa,
Ethiopia. Accessed 28/03/2014
http://harvestchoice.org/sites/default/files/downloads/publications/Ethiopia
_2010-1_Vol_1.pdf.
CSA (Central Statistical Agency), (2012). Federal democratic republic of Ethiopia.
Central statistical agency. Agricultural sample survey 2011 / 2012, Report on
area and production of major crops. Statistical bulletin, 1. Addis Ababa,
Ethiopia. Accessed 28/03/2014
http://www.csa.gov.et/newcsaweb/images/documents/surveys/survey0/data
/Doc/Report/Area%20and%20production%20report%202004.pdf.
26
Cuevas, J.M., Delaunay, A., Visser, J.C., Bellstedt, D.U., Jacquot, E. and Elena, S. F.
(2012). Phylogeography and molecular evolution of potato virus Y. PLoS One 7:
e37853.
Elliott, M.S., Zettler, F.W. and Brown, L.G. (1997). Dasheen mosaic potyvirus of edible
and ornamental aroids. Plant Pathol. Circular, 384.
FAOSTAT (2014). Food and Agricultural Organization of the United Nations. Crop
production. Accessed 01/04/2014 http://faostat3.fao.org/faostat-
gateway/go/to/download/Q/QC/E.
Geering, A., Olszewski, N.E., Harper, G., Lockhart, B. Hull, R. and Thomas, J. (2005).
Banana contains a diverse array of endogenous badnaviruses. J. Gen. Virol. 86:
511–520.
Geering, A. and Hull, R. (2012). Caulimoviridae. In: King, A.M.Q., Adams, M.J.,
Carstens, E.B., Lefkowitz, E.J. (Eds.), Virus Taxonomy, Ninth report of the
International Committee on Taxonomy of Viruses pp. 429–443. Amsterdam,
Elsevier.
Geering, A. (2014). Caulimoviridae (Plant Pararetroviruses). In: eLS. John Wiley &
Sons, Ltd: Chichester. DOI: 10.1002/9780470015902.a0000746.pub3
Geering, A. and Teycheney, P. (2016). Two new species in the genus Badnavirus.
https://talk.ictvonline.org/files/
Ha, C., Revill, P., Harding, R.M., Vu, M. and Dale, J.L. (2008a). Identification and
sequence analysis of potyviruses infecting crops in Vietnam. Arch. Virol.
153:45–60.
Ha, C., Coombs, S., Revill, P., Harding, R.M., Vu, M. and Dale, J.L. (2008b). Design and
application of two novel degenerate primer pairs for the detection and
complete genomic characterization of potyviruses. Arch. Virol. 153:25–36.
27
Harrison, J., Moore, K.A., Paszkiewicz, K., Jones, T., Grant, M.R., Ambacheew, D.,
Muzemil, S. and Studholme, D.J. (2014). A Draft genome sequence for Ensete
ventricosum, the drought-tolerant “Tree against hunger”. Agronomy 4:13–33.
Harper, G., Dahal, G., Thottappilly, G. and Hull, R. (1999). Detection of episomal
banana streak badnavirus by IC-PCR. J. Virol. Methods 79:1–8.
Higgins, C., Bejerman, N., Li, M., James, A., Dietzgen, R., Pearson, M., Revill, P. and
Harding, R. (2016). Complete genome sequence of Colocasia bobone disease-
associated virus, a putative cytorhabdovirus infecting taro. Arch. Virol.
161:745–748.
Holmes, E.C. (2011). The evolution of endogenous viral elements. Cell host &
microbe. 10: 368–377.
Huang, C.H. and Chang, Y.C. (2005). Identification and molecular characterization of
Zantedeschia mild mosaic virus, a new calla lily-infecting potyvirus. Arch. Virol.
150:1221–1230.
Huang, C.H., Hu, W.C., Yang, T.C. and Chang, Y.C. (2007). Zantedeschia mild mosaic
virus, a new widespread virus in calla lily, detected by ELISA, dot-blot
hybridization and IC-RT-PCR. Plant Pathol. 56:183–189.
Hull, R. (2014). Plant Virology (5th ed.). UK, Elsevier.
Iskra-Caruana, M.L., Duroy, P.O., Chabannes, M. and Muller, E. (2014). The common
evolutionary history of badnaviruses and banana. Infection, Genetics and
Evolution 21:83–89.
Jacquot, M., Hagen, L.S., Jacquemond, M. and Yot, P. (1996). The open reading frame
2 product of cacao swollen shoot badnavirus is a nucleic acid-binding protein.
Virology 225:191–195.
28
James, A., Geijskes, R.J., Dale, J.L. and Harding, R.M. (2011a). Development of a novel
rolling-circle amplification technique to detect Banana streak virus that also
discriminates between integrated and episomal virus sequences. Plant Dis.
95:57–62.
James, A., Geijskes, R.J., Dale, J.L. and Harding, R.M. (2011b). Molecular
characterisation of six badnavirus species associated with leaf streak disease of
banana in East Africa. Ann. Appl. Biol. 158:346–353.
James, M., Kenten, H.R. and Woods, D.R. (1973). Virus-like particles associated with
two diseases of Colocasia esculenta (L.) Schott in the Solomon Islands. J. Gen.
Virol. 21:145–153.
Johne, R., Müller, H., Rector, A., Van Ranst, M. and Stevens, H. (2009). Rolling-circle
amplification of viral DNA genomes using phi29 polymerase. Trends in
Microbiol. 17:205–211.
Kantaka, S. (2004). Colocasia esculenta (L.). Schott. Grubbrn, G.J.H. and Denton, O.A.
(Eds). PROTA (Plant resources of Tropical Africa / Ressources vegetales de l’
Afrique tropicale). Netherlands, Wageningen.
Kazmi, S.A., Yang, Z. and Hong, N. (2015). Characterization by small RNA sequencing
of Taro Bacilliform CH Virus (TaBCHV), a novel Badnavirus. PLoS One: 10,
e0134147.
Kidanemariam, D. B., Abraham, A. D., Sukal, A. C., Holton, T. A., Dale, J. L., James, A.
P., & Harding, R. M. (2016). Complete genome sequence of a novel
zantedeschia mild mosaic virus isolate: the first report from Australia and from
Alocasia sp. Arch. Virol. 161:1079–1082.
Kidanemariam, D. B., Macharia, M. W., Harvey, J., Holton, T., Sukal, A., James, A. P.,
Harding, R. M. & Abraham, A. D. (2018). First report of Dasheen mosaic virus
infecting taro (Colocasia esculenta) from Ethiopia. Plant Dis. PDIS-12.
29
King, A.M., Adams, M.J., Lefkowitz, E.J. and Carstens, E.B. (2012). Virus taxonomy:
classification and nomenclature of viruses: Ninth report of the International
Committee on Taxonomy of Viruses. Amsterdam, Elsevier.
Le Provost, G., Iskra-Caruana, M.L., Acina, I. and Teycheney, P.Y. (2006). Improved
detection of episomal Banana streak viruses by multiplex immunocapture
PCR. J. Virol. Methods 137:7–13.
Lebot, V., Prana, M.S., Kreike, N., van Heck, H., Pardales, J., Okpul, T., Gendua, T.,
Thongjiem, M., Hue, H., Viet, N. and Yap, T.C. (2004). Characterisation of taro
(Colocasia esculenta (L.) Schott) gentic resources in Southeast Asia and
Oceania. Genetic Resources and Crop Evol. 51:381–392.
Lebot, V. (2009). Tropical root and tuber crops: cassava, sweet potato, yams and
aroids. UK, MPG Biddles Ltd.
Long, M.H., Ayin, C., Li, R., Hu, J.S. and Melzer, M.J. (2014). First report of Taro vein
chlorosis virus Infecting taro (Colocasia esculenta) in the United States. Plant
Dis. 98:1160–1160.
Macanawai, A.R., Ebenebe, A.A., Hunter, D., Devitt, L., Hafner, G. and Harding, R.
(2005). Investigations into the seed and mealybug transmission of Taro
bacilliform virus. Aust. Plant Pathol. 34:73–76.
Manikonda, P., Srinivas, K.P., Reddy, S., Venkata, C., Ramesh, B., Navodayam, K.,
Krishnaprasadji, J., Ratan, P.B. and Sreenivasulu, P. (2011). Konjac mosaic virus
naturally infecting three aroid plant species in Andhra Pradesh, India. J.
Phytopathol. 159:133–135.
Mariame, F. and Gelmesa, D. (2006). Review of the status of vegetable crops
production and marketing in Ethiopia. Uganda J. Agri. Sci. 12:26–30.
Ming, S.F.Y., Ping, G.W., Ping, L.W., Xing, W.X. and Ni, H. (2013) Molecular
identifcation and specifc detection of badnavirus from taro grown in China.
Acta Phytopathol Sinica 6:590–595
30
Mulholland, V. (2005). Immunocapture-polymerase chain reaction. Methods in
Molecular Biology, Vol. 295: Immunochemical Protocols, 3rd edition pp. 281-
290. New York, Humana Press.
Nelson, S.C. (2008). Dasheen mosaic of edible and ornamental aroids. Plant Dis. 44:1–
9.
Ndabikunze, B.K., Talwana, H.A.L., Mongi, R.J., Issa-Zacharia, A., Serem, A.K.,
Palapala, V. and Nandi, J.O.M. (2011). Proximate and mineral composition of
cocoyam (Colocasia esculenta L. and Xanthosoma sagittifolium L.) grown along
the Lake Victoria Basin in Tanzania and Uganda. Afri. J. Food Sci. 5:248–254.
Onwueme, I.C. and Charles, W.B. (1994). Cultivation of cocoyam. In: Tropical root and
tuber crops. Production, perspectives and future prospects. FAO Plant
Production and Protection Paper 126, Rome. pp. 139–161.
Ooka, J.J. (1990). Taro Diseases. Accessed 17/04/2014
http://www.ctahr.hawaii.edu/oc/freepubs/pdf/RES-114-11.pdf.
Padmavathi, M., Srinivas, K., Hema, M. and Sreenivasulu, P. (2013). First report of
Konjac mosaic virus in elephant foot yam (Amorphophallus paeoniifolius) from
India. Aust. Plant Dis. Notes, 8:27–29.
Pearson, M., Jackson, G., Saelea, J. and Morar, S. (1999). Evidence for two
rhabdoviruses in taro (Colocasia escudenta) in the Pacific region. Aust. Plant
Pathol. 28:248–253.
Plucknett, D.L., Pena, R.D. L., and Obrero, F. (1970). Taro (Colocasia escalenta).
In Field Crop Abstracts 23: 413–426.
Rana, G.L., Vovlas, C. and Zettler, F.W. (1983). Manual transmission of dasheen
mosaic virus from Richardia to nonaraceous hosts. Plant Dis. 67:1121–1122.
31
Revill, P., Jackson, G., Hafner, G., Yang, I., Maino, M., Dowling, M., Devitt, L., Dale, J.
and Harding, R. (2005a). Incidence and distribution of viruses of taro (Colocasia
esculenta) in Pacific Island countries. Aust. Plant Pathol. 35:327–331.
Revill, P., Trinh, X., Dale, J. and Harding, R. (2005b). Taro vein chlorosis virus:
characterization and variability of a new nucleorhabdovirus. J. General Virol.
86:491–499.
Sharma, K., Mishra, A.K. and Misra, R.S. (2009). Identification and characterization of
differentially expressed genes in the resistance reaction in taro infected with
Phytophthora colocasiae. Mol. Biol. Reports 36:1291–1297.
Shaw, E.D., Plumb, R.T. and Jackson, G.V.H. (1979). Virus diseases of taro (Colocasia
esculenta) and Xanthosoma spp. in Papua New Guinea. Papua New Guinea Agri.
J. 30:71–97.
Singh, D., jackson, G., Hunter, D., Fullerton, R., Lebot, V., Taylor, M., Iosefa, T., Okpul,
T. and Tyson, J. (2012). Taro leaf blight—A threat to food security. Agriculture
2:182–203.
Sivaprasad, Y., Reddy, B.B., Kumar, C.N., Reddy, K.R. and Gopal, D.S. (2011). First
report of groundnut bud necrosis virus infecting taro (Colocasia esculenta).
Aust. Plant Dis. Notes 6:30–32.
Sukal, A., Kidanemariam, D., Dale, J., James, A. and Harding, R. (2017).
Characterization of badnaviruses infecting Dioscorea spp. in the Pacific reveals
two putative novel species and the first report of dioscorea bacilliform RT virus
2. Virus Research 238:29–34.
Talwana, H.A.L., Serem, A.K., Ndabikunze, B.K., Nandi, J.O.M., Tumuhimbise, R.,
Kaweesi, T., Chumo, E.C. and Palapala, V. (2009). Production status and
prospects of cocoyam (Colocasia esculenta (L.) Schott.) in East Africa. J. Root
Crops 35:98–107.
32
Tumuhimbise, R., Talwana, H.L., Osiru, D.S.O., Serem, A.K., Ndabikunze, B.K., Nandi,
J.O.M. and Palapala, V. (2009). Growth and development of wetland-grown
taro under different plant populations and seedbed types in Uganda. Afri. Crop
Sci. J. 17:49–60.
Vaneker, K. and Slaats, E. (2012). AROIDS: The world’s oldest food crop. Accessed
09/03/2012
http://www.b4fn.org/fileadmin/B4FN_Docs/documents/Case_study_docume
nts/Aroids_factsheet.pdf.
Wang, Y.F., Wang, G.P., Wang, L.P. and Hong, N. (2014). First report of Cucumber
mosaic virus in taro plants in China. American Phytopathol. Society J. 98:574.
Wilson, J.E. and Siemonsma, J.S. (1996). Colocasia esculenta (L.) Schott, Record from
proseabase. Flach, M. & Rumawas, F. (Editors). PROSEA (Plant resources of
South-East Asia) Foundation, Bogor, Indonesia. Accessed 01/03/2014
http://www.prota4u.org/search.asp.
Yang, I.C., Hafner, G.J., Revill, P., Dale, J. and Harding, R. (2003a). Sequence diversity
of South Pacific isolates of Taro bacilliform virus and the development of a PCR-
based diagnostics test. Arch. Virol. 148:1957–1968.
Yang, I., Hafner, G., Dale, J. and Harding, R. (2003b). Genomic characterisation of Taro
bacilliform virus. Arch. Virol. 148:937–949.
Zettler, F.W., Foxe, M.J., Hartman, R.D., Edwardson, J.R. and Christie, R.G. (1970).
Filamentous viruses infecting taro and other araceous plants. Phytopathol. 60:
983–987.
Zettler, F.W. and Hartman, R.D. (1986). Dasheen mosaic virus and its control in
cultivated aroids. Extension Bulletin 233, ASPAC Food fertilizer technology
center, Taiwan (233).
33
Zettler, F.W. and Hartman, R.D. (1987). Dasheen mosaic virus as a pathogen of
cultivated aroids and control of the virus by tissue culture. Plant Dis. 71: 958–
963.
Zettler, F.W., Jackson, G.V.H. and Frison, E.A (eds.) (1989). FAO/IBPGR Technical
guidelines for the safe movement of edible aroid germplasm. Food and
Agriculture Organization of the United Nations, Rome / International board for
plant genetic resources, Rome. Accessed 15/03/2014
http://www.bioversityinternational.org/uploads/tx_news/Edible_aroid_400.p
df.
Zheng, L., Rodoni, B., Gibbs, M. and Gibbs, A. (2010). A novel pair of universal primers
for the detection of potyviruses. Plant Pathol. 59:211–220.
34
35
Chapter 3
Complete genome sequence of a novel Zantedeschia mild mosaic virus isolate: the first report from Australia and from
Alocasia sp.
Dawit B. Kidanemariam1,2, Adane D. Abraham2*, Amit C. Sukal1, Timothy A. Holton3,
James L. Dale1, Anthony P. James1, Robert M. Harding1
1Centre for Tropical Crops and Biocommodities, Queensland University of Technology, Brisbane, 4001, Australia
2National Agricultural Biotechnology Research Center, Ethiopian Institute of Agricultural Research, P.O. Box 2003, Addis Ababa, Ethiopia
3Biosciences eastern and central Africa–International Livestock Research Institute (BecA–ILRI) Hub, P.O. Box 30709, Nairobi, Kenya
*Current address: Department of Biotechnology, Addis Ababa Science and
Technology University. P.O. Box 16417, Addis Ababa, Ethiopia
Archives of Virology 161:1079-1082
36
Statement of Contribution of Co-Authors of Thesis by Publication Paper
The authors listed below have certified that: 1. They meet the criteria for authorship in that they have participated in the conception,
execution, or interpretation, of at least that part of the publication in their field of expertise; 2. They take public responsibility for their part of the publication, except for the responsible
author who accepts overall responsibility for the publication;3. There are no other authors of the publication according to these criteria;4. Potential conflicts of interest have been disclosed to (a) granting bodies, (b) the editor or
publisher of journals or other publications, and (c) the head of the responsible academicunit, and
5. They agree to the use of the publication in the student’s thesis and its publication on theQUT’s ePrints site consistent with any limitations set by publisher requirements.
In the case of this chapter: Complete genome sequence of a novel Zantedeschia mild mosaic virus isolate: the
first report from Australia and from Alocasia sp.
RSC, Level 4, 88 Musk Ave, Kelvin Grove Qld 4059 Page 1 of 1 Current @ 20/09/2016 CRICOS No. 00213J
QUT Verified Signature
QUT Verified
Signatures
37
Abstract
The complete genome of an Australian isolate of zantedeschia mild mosaic virus
(ZaMMV) causing mosaic symptoms on Alocasia sp. (designated ZaMMV-AU) was
cloned and sequenced. The genome comprises 9942 nucleotides (excluding the poly-
A tail) and encodes a polyprotein of 3167 amino acids. The sequence is most closely
related to a previously reported ZaMMV isolate from Taiwan (ZaMMV-TW), with 82
and 86 % identity at the nucleotide and amino acid level, respectively. Unlike the
amino acid sequence of ZaMMV-TW, however, ZaMMV-AU does not contain a
polyglutamine stretch at the N-terminus of the coat-protein-coding region upstream
of the DAG motif. This is the first report of ZaMMV from Australia and from Alocasia
sp.
Zantedeschia mild mosaic virus (ZaMMV) is a positive sense, single-stranded RNA
virus belonging to the genus Potyvirus, family Potyviridae [1]. The virus was first
reported infecting calla lily (Zantedeschia sp.) in Taiwan in 2005 [1, 2] and has
subsequently only been reported from Italy [3] and New Zealand (GenBank accession
no. DQ407934). Currently, there is only a single published full-length genome
sequence of ZaMMV available from Taiwan, designated ZaMMV-TW (GenBank
accession no. AY626825).
In 2014, an aroid (Alocasia sp.) showing feathery mosaic symptoms typical of
those caused by the potyvirus dasheen mosaic virus (DsMV) was observed at
Bellthorpe, Queensland, Australia. To determine if the plant was infected with DsMV,
symptomatic leaves were collected and initially tested for the presence of
potyviruses by RT-PCR. Total RNA was extracted using a lithium-chloride based
protocol [4], and cDNA was synthesised using M-MLV reverse transcriptase
(Promega) and oligo(dT)18 primers. PCR was carried out using GoTaq-Green Master
Mix (Promega) and degenerate primers designed to amplify a fragment of the CI-
coding region of potyviruses [5, 6]. As a positive control, total RNA extracted from
DsMV-infected taro leaves was used. An amplicon of the expected size (∼700 bp) was
generated from extracts derived from both the DsMV-infected taro and Alocasia sp.
38
samples. The amplicon from the Alocasia sp. sample was subsequently cloned and
sequenced, and a BLAST search analysis of the 621-nt sequence revealed 84 % and
93 % identity to ZaMMV-TW at the nucleotide and amino acid level, respectively. As
ZaMMV has not previously been reported in Australia, or in Alocasia sp., the
complete genome sequence of this novel isolate (herein referred to as ZaMMV-AU)
was determined.
To obtain the remainder of the virus genome, RT-PCR was carried out using
degenerate primers targeting the potyviral HC-Pro-, NIb- and CP-coding regions [6,
7]. The amplicons were cloned and sequenced, and specific primers were
subsequently designed in order to amplify the intervening sequences. The 50-
terminal sequence of the genome was obtained by rapid amplification of cDNA ends
(RACE) using a 50/30 RACE Kit, 2nd Generation (Roche). In all cases, amplicons were
separated by electrophoresis through 1.5 % agarose gels, purified using the Freeze ‘N
SqueezeTM DNA Gel Extraction Spin Columns (Bio-Rad) and cloned into pGEM_-T
Easy Vector (Promega) following the manufacturer’s protocols. For each amplicon, at
least three clones were sequenced in both directions using a Big Dye_ Terminator
v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) following the manufacturer’s
protocol.Sequencing data were processed and analysed using CLC Main Workbench
v6.9.2 (QIAGEN) and Vector NTI Advance_ Suite v11 (Invitrogen). Virus sequences
were further aligned and analyzed using the ClustalW multiple alignment algorithm
in BioEdit version 7.1.9 (http://www.mbio.ncsu.edu/BioEdit/bioedit.html), and
phylogenetic trees were constructed from ClustalW-aligned sequences using MEGA
version 6.0.6 [8], using the neighbour-joining method and the Kimura 2-parameter
model with 1000 bootstrap replications.
The complete genome sequence of ZaMMV-AU was assembled from the
consensus sequences of amplicons generated using degenerate and specific primers
and 50 RACE. The genome comprised 9942 nucleotides (Gen-Bank accession no.
KT729506) including the 50 UTR (198 nt) and 3’ UTR (240 nt), but excluding the 3’
polyA-tail. Sequence analysis identified a single putative open reading frame of 9501
nt, encoding a 3167-amino-acid polyprotein with a predicted MW of 359.14 kDa.
39
Sequence comparison of the complete genome of ZaMMV-AU to ZaMMV-TW
revealed 82 % identity, while comparison of the polyprotein coding region revealed
79.5 % and 86.3 % identity at the nucleotide and amino acid level, respectively. The
nucleotide and amino acid sequences of the putative protein- coding and non-coding
region of ZaMMV-AU and ZaMMV-TW were also compared (Table 1). These analyses
revealed nucleotide sequence identities ranging from 61.3 % (5’ UTR) to 88 % (3’ UTR)
and amino acid sequence identities ranging from 58.7 % (P1) to 100 % (6K1). Further,
when the nucleotide sequence of ZaMMV-AU was compared to the partial sequences
of the Italian and New Zealand ZaMMV isolates, there was 86.6 % and 80.3 % identity,
respectively. Phylogenetic analysis of the complete genome sequence of ZaMMV-AU
and other selected Potyviridae members showed that it groups with ZaMMV-TW
within the bean common mosaic virus (BCMV) subgroup of the genus Potyvirus
(Figure 1).
Analysis of the amino acid sequence revealed the presence of putative potyviral
proteinase cleavage sites, which would result in cleavage of the polyprotein into ten
putative mature proteins [9–11] (Figure 2). A PIPO-encoding ORF (81 amino acids),
embedded within the P3 cistron, was also identified, while the presence of a DAG
motif in the CP-coding region indicates that ZaMMV-AU may be aphid-transmissible.
The amino acid sequence of ZaMMV-TW contains an unusual stretch of 39 glutamine
residues at the N-terminus of the CP-coding region, upstream of the DAG motif, for
which the function is unknown [1]. Despite analyzing this region in sequences of 10
individual clones from two different cloning experiments, such a polyglutamine
stretch is not present in the amino acid sequence of ZaMMV-AU. In ZaMMV-AU, this
region comprises a smaller number of amino acids and is lysine rich (9/36) (Figure 3).
The differences between ZaMMV-TW and –AU across this region raise questions
about their biological significance.
40
Table 1. Comparison of the nucleotide and amino acid sequences of the putative coding and non-coding regions of ZaMMV-AU and ZaMMV-TW.
5' UTR P1 HC-Pro P3 PIPO* 6K1 CI 6K2 VPg NIa NIb CP 3' UTR
% Nucleotide sequence identity 61.3 63.6 80.6 81.4 85.8 85.9 83.2 81.1 84.1 82.7 83.6 75.5 88
% Amino acid sequence identity 58.7 90 83.4 78.8 100 93.4 92.5 93.7 92.2 93.4 78.1
* Predicted from ZaMMV-TW sequence annotation
41
Figure 1. Phylogenetic analysis of ZaMMV-AU. Phylogenetic tree generated by the neighbour-joining method in MEGA 6 [8] using nucleotide sequences of the complete polyprotein ORF of selected potyviruses comprising the bean common mosaic virus (BCMV) subgroup and representative members of other genus Potyvirus subgroups. The tree was rooted using ryegrass mosaic virus (RGMV, NC_001814.1), the type member of the genus Rymovirus. Bootstrap values greater than 50 % are shown, and the scale bar indicates 0.1 substitutions per site. Subgroup A includes potyviruses from the BCMV subgroup, and subgroup B includes potyviruses from other subgroups. Abbreviations are BCMV (bean common mosaic virus, KC832501), BCMNV (bean common mosaic necrosis virus, AY864314), BYMV (bean yellow mosaic virus, AB439732), CABMV (cowpea aphid-borne mosaic virus, AF348210), DsMV (dasheen mosaic virus, KJ786965), KoMV (konjac mosaic virus, AB219545), PVY (potato virus Y, EF026076), SCMV (sugarcane mosaic virus, AY569692), SMV (soybean mosaic virus, KF135488), SPVG (sweet potato virus G, KF790759), SrMV (sorghum mosaic virus, KJ541740) WMV (watermelon mosaic virus, FJ823122),YMV (yam mosaic virus, NC004752), ZaMMV-AU (zantedeschia mild mosaic virus-Australia, KT729506), ZaMMV-TW (zantedeschia mild mosaic virus-Taiwan, AY626825), ZYMV (zucchini yellow mosaic virus, AY188994-1).
42
Figure 2. Genome organisation of ZaMMV-AU. Predicted mature proteins and their relative position on the genome, and predicted proteinase cleavage sites of ZaMMV-AU (PIPO-encoding ORF not shown).
43
Figure 3. Alignment of partial amino acid sequences of the NIb-CP junction of ZaMMV and selected potyviruses from the BCMV subgroup. The polyglutamine amino acid tract present in the ZaMMV-TW isolate is underlined, the characteristic DAG motif is boxed, and the predicted cleavage site between NIb and CP-coding regions is indicated by an arrow.
44
According to the current species demarcation criteria for viruses within the
family Potyviridae [9], members of different species are distinguished by having less
than 80 % CP amino acid sequence identity and less than 76 % nucleotide sequence
identity, either in the CP-coding region or over the whole genome. Based on
comparisons over the whole genome, the virus sequence isolated from Alocasia sp.
in this study should be considered a strain of ZaMMV. However, based on
comparisons using only the CP-coding region, the reported sequence could be
considered a new potyvirus. We have chosen the whole-genome comparison as the
criterion for classification due to the presence of the unusual stretch of amino acids
in the CP-coding region upstream of the DAG motif. When this region was excluded
from comparisons, the amino acid sequences of ZaMMV-TW and ZaMMV-AU shared
89.8 % identity.
To our knowledge, this is the first report of ZaMMV from Australia, and it is
also the first report of ZaMMV infecting an Alocasia sp. This report provides a useful
reference for further work investigating the occurrence of viruses in Alocasia sp. and
its relatives, particularly the economically important members of the family Araceae,
such as the cultivated taros (Colocasia esculenta).
Acknowledgments
DK is the recipient of an Australia Awards Scholarship.
45
References
1. Huang CH, Chang YC (2005) Identification and molecular characterization of
Zantedeschia mild mosaic virus, a new calla lily-infecting potyvirus. Arch Virol
150:1221–1230
2. Huang CH, Hu WC, Yang TC, Chang YC (2007) Zantedeschia mild mosaic virus, a
new widespread virus in calla lily, detected by ELISA, dot-blot hybridization and
IC-RT-PCR. Plant Pathol 56:183–189
3. Rizzo D, Panattoni A, Stefani L, Paoli M, Nesi B, Lazzereschi S, Vanarelli S, Farina
P, Della Bartola M, Materazzi A, Luvisi A (2015) First report of Zantedeschia mild
mosaic virus on Zantedeschia aethiopica (L) Spreng in Italy. J Plant Pathol 97:1–2
4. Valderrama-Cha´irez ML, Cruz-Herna´ndez A, Paredes-Lo´pez O (2002) Isolation
of functional RNA from cactus fruit. Plant Mol Biol Rep 20:279–286
5. Ha C, Revill P, Harding RM, Vu M, Dale JL (2008) Identification and sequence
analysis of potyviruses infecting crops in Vietnam. Arch Virol 153:45–60
6. Ha C, Coombs S, Revill P, Harding RM, Vu M, Dale JL (2008) Design and application
of two novel degenerate primer pairs for the detection and complete genomic
characterization of potyviruses. Arch Virol 153:25–36
7. Yamamoto H, Fuji S (2008) Rapid determination of the nucleotide sequences of
potyviral coat protein genes using semi-nested RT-PCR with universal primers. J
Gen Plant Pathol 74:97–100
8. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular
evolutionary genetics analysis version 6.0. Mol Biol Evol 30:2725–2729
9. Adams MJ, Zerbini FM, French R, Rabenstein F, Stenger DC, Valkonen JPT (2012)
Family Potyviridae. In: King AMQ, Lefkowitz E, Adams MJ, Carstens EB (eds) Virus
taxonomy: ninth report of the International Committee on Taxonomy of Viruses,
London, pp 1069–1089
46
10. Adams MJ, Antoniw JF, Fauquet CM (2005) Molecular criteria for genus and
species discrimination within the family Potyviridae. Arch Virol 150:459–479
11. Adams MJ, Antoniw JF, Beaudoin F (2005) Overview and analysis of the
polyprotein cleavage sites in the family Potyviridae. Mol Plant Pathol 6:471–487
47
Chapter 4
Identification and molecular characterisation of taro bacilliform virus and taro bacilliform CH virus from East Africa
D. B. Kidanemariama,b, A. C. Sukala, A. D. Abrahamc, F. Stomeod, J. L. Dalea, A. P.
Jamesa, R. M. Hardinga*
a Centre for Tropical Crops and Biocommodities, Queensland University of Technology, Brisbane, 4001, Australia
b National Agricultural Biotechnology Research Center, Ethiopian Institute of Agricultural Research, P.O. Box 2003, Addis Ababa, Ethiopia
c Department of Biotechnology, Addis Ababa Science and Technology University, P.O. Box 16417, Addis Ababa, Ethiopia
d Biosciences eastern and central Africa–International Livestock Research Institute (BecA–ILRI) Hub, P.O. Box 30709, Nairobi, Kenya
Plant Pathology https://doi.org/10.1111/ppa.12921
48
Statement of Contribution of Co-Authors of Thesis by Publication Paper
The authors listed below have certified that: 1. They meet the criteria for authorship in that they have participated in the conception,
execution, or interpretation, of at least that part of the publication in their field of expertise; 2. They take public responsibility for their part of the publication, except for the responsible
author who accepts overall responsibility for the publication; 3. There are no other authors of the publication according to these criteria; 4. Potential conflicts of interest have been disclosed to (a) granting bodies, (b) the editor or
publisher of journals or other publications, and (c) the head of the responsible academic unit, and
5. They agree to the use of the publication in the student’s thesis and its publication on the QUT’s ePrints site consistent with any limitations set by publisher requirements.
In the case of this chapter: Identification and molecular characterisation of taro bacilliform virus and taro
bacilliform CH virus from East Africa
RSC, Level 4, 88 Musk Ave, Kelvin Grove Qld 4059 Page 1 of 1 Current @ 20/09/2016 CRICOS No. 00213J
QUT Verified Signatures
QUT Verified Signature
49
Abstract
Taro (Colocasia esculenta) and tannia (Xanthosoma sp.) are important root crops
cultivated mainly by small-scale farmers in sub-Saharan Africa and the South Pacific.
Viruses are known to be one of the most important constraints to production, with
infections resulting in severe yield reduction. In 2014 and 2015, surveys were
conducted in Ethiopia, Kenya, Tanzania and Uganda to determine the identity of
viruses infecting taro in East Africa. Screening of 392 samples collected from the
region using degenerate badnavirus primers revealed an incidence of 58-74% among
the four countries surveyed, with sequence analysis identifying both taro bacilliform
virus (TaBV) and taro bacilliform CH virus (TaBCHV). TaBCHV was identified from all
four countries while TaBV was identified in all except Ethiopia. Full-length sequences
from representative TaBV and TaBCHV isolates showed that the genome organisation
of TaBV isolates from East Africa was consistent with previous reports while TaBCHV
isolates from East Africa were found to encode only four ORFs, distinct from a
previous report from China. Phylogenetic analysis showed that all East African TaBV
isolates form a single subgroup within known TaBV isolates, while TaBCHV isolates
form at least two distinct subgroups. To our knowledge, this is the first report
describing the occurrence and genome organisation of TaBV and TaBCHV isolates
from East Africa and the first full-length sequence of the two viruses from tannia.
Keywords
Colocasia esculenta; Xanthosoma; Caulimoviridae; badnavirus; rolling circle
amplification; episomal DNA
50
Introduction
The aroids, taro (Colocasia esculenta (L.) Schott) and tannia (Xanthosoma sp.), are
among the most important root crops in many sub-Saharan African countries
including Burundi, Cote d’Ivoire, Ethiopia, Gabon, Ghana, Kenya, Nigeria, Tanzania
and Uganda (Ndabikunze et al., 2011; Akwee et al., 2015). The corm and leaves of
taro plants are very rich sources of easily digestible starch and dietary fibre and also
contain substantial amounts of protein, vitamins and minerals (Ndabikunze et al.,
2011). Worldwide more than half a billion people incorporate taro in their diets,
including many areas of the tropics (Lebot, 2009). In East African countries, taro is
mainly cultivated by small-holder farmers where it plays important cultural,
economic and nutritional roles (Onwueme and Charles, 1994; Talwana et al., 2009;
Tumuhimbise et al., 2009; Beyene, 2013).
In southern Ethiopia, taro (locally called ‘godere’), tannia and enset are the
preferred food security crops, as they perform well with minimal agricultural inputs
(Mariame and Gelmesa, 2006; Beyene, 2013; Harrison et al., 2014). In Kenya, taro,
also known locally as ‘arrowroot’ and tannia are a basic source of starch in the diet
for many communities in the Mount Kenya and Abedares districts of central Kenya,
as well as in the Lake Victoria basin districts of Kakamega, Kisumu and Siaya, where
it is mainly cultivated adjacent to streams and rivers (Akwee et al., 2015). In Tanzania
and Uganda, taro and tannia are mainly grown along the Lake Victoria basin, including
Bukoba, Musoma, Tarime, Biharamulo and Mwanza districts in Tanzania and the
Mitiyana, Masaka, Jinja, Iganga and Luuka districts in Uganda (Talwana et al., 2009;
Ndabikunze et al., 2011). Due to a range of biotic and abiotic factors, the yield from
taro production in East Africa is much lower than the world’s average production.
These factors include pests, weeds, soil infertility and a lack of genetically improved
cultivars, as well as a range of diseases caused by fungi, bacteria and viruses
(Tumuhimbise et al., 2009; Talwana et al., 2009; Akwee et al., 2015).
51
Badnaviruses infect a wide range of tropical and subtropical crops including
banana, yam, taro, sugarcane, black pepper, citrus, and cacao with some reports also
from temperate regions in hosts such as raspberry, gooseberry and ornamental
spiraea (Bhat et al., 2016). Badnaviruses have bacilliform-shaped particles of
approximately 30 nm by 120–150 nm with a circular, double-stranded (ds) DNA
genome of 6.9 – 9.2 kb. The genome typically contains three ORFs but there may be
one or more additional ORFs (Geering and Hull, 2012; Bhat et al., 2016). ORFs 1 and
2 encode small proteins of about 23 and 15 kDa, respectively (Geering and Hull,
2012). The function of the protein encoded by ORF 1 is unknown, while the ORF 2
protein has non-specific DNA- and RNA-binding activity and may be involved in virion
assembly (Jacquot et al., 1996). ORF 3 encodes a large polyprotein of about 200 kDa
which is post-translationally processed into several mature proteins, including
movement protein (MP), coat protein (CP), aspartic protease (AP), reverse
transcriptase (RT) and ribonuclease H (RNase H) (Geering and Hull, 2012; Bhat et al.,
2016). Several additional ORFs have been reported from a number of species,
however, these usually have no ascribed function (Kazmi et al., 2015). The RT/RNase
H-coding region of ORF 3 is the most conserved region of the genome and nucleotide
(nt) differences of greater than 20% in this part of the genome is used for the
demarcation of species in the genus (Geering and Hull, 2012).
The genus Badnavirus is the most diverse member of the family Caulimoviridae
at both the genomic and antigenic level (Geering and Hull, 2012). Currently, it
comprises forty distinct recognised species (https://talk.ictvonline.org/taxonomy/).
All members of the family Caulimoviridae are pararetroviruses, whereby at least one
part of the viral replication occurs in the nucleus where the viral DNA genome is
transcribed from mini-chromosomes formed by an association with histones (Hull
and Covey, 1983; Geering and Hull, 2012). This replication strategy can result in the
random integration of the viral DNA into the host genome by either illegitimate
recombination, or during repair of DNA breaks (Iskra-Caruana et al., 2014). The
genetic and serological diversity of badnaviruses and occurrence of viral DNA within
the genome of host plants complicates diagnosis (Kenyon et al., 2008; Muller et al.,
2011; Seal et al., 2014). Additionally, as many host plant species are vegetatively
52
propagated, badnaviruses can accumulate across cultivation cycles. These attributes
make badnaviruses important pathogens for many crops and presents a serious
threat to germplasm exchange in a number of important crop species (Borah et al.,
2013).
In taro, two distinct badnavirus species have been reported, namely Taro
bacilliform virus (TaBV) (Yang et al., 2003a, b) and Taro bacilliform CH virus (TaBCHV)
(Ming et al., 2013; Kazmi et al., 2015). The genome of TaBV possesses four ORFs, all
encoded on the plus-strand of the viral DNA, with the size and organisation of ORFs
1-3 consistent with most badnaviruses (Yang et al., 2003a). ORF 4 of TaBV overlaps
ORF 3 between the MP and CP domains and putatively encodes a protein of ~13 kDa,
with little homology to any published protein-coding sequences (Yang et al., 2003a).
In contrast to TaBV, TaBCHV encodes six putative ORFs, with ORFs 1-4 analogous to
TaBV and an additional two small ORFs at the 3' end of ORF 3. ORF 5 partially overlaps
ORF 3, while ORF 6 is downstream of, and partially overlaps, the 3' end of ORF 5
(Kazmi et al., 2015). Characterisation of Pacific isolates of TaBV showed that there is
up to 23% nucleotide sequence variability within the RT/RNase H-coding region (Yang
et al., 2003b). The same study also revealed the presence of TaBV-like sequences in
taro samples from Papua New Guinea (PNG), Fiji, Vanuatu, Samoa, Solomon Island
and New Caledonia with 50 to 60% nucleotide identity to TaBV, indicating the
possible presence of other badnaviruses infecting taro in the South Pacific region.
Recently, TaBCHV has been reported from Hawaii (USA), with 91-98% nucleotide
sequence identity to the published TaBCHV isolate from China (Wang et al., 2018).
To date, TaBV and TaBCHV appear to be restricted to host plants in the family
Araceae. TaBV is transmitted mainly by vegetative propagation, by mealybugs in a
semi-persistent manner and in some cases through seed or pollen, but it is not
mechanically transmissible (Gollifer et al., 1977; Macanawai et al., 2005). Although
no consistent symptoms have been associated with TaBV infection, there have been
some reports of mild symptoms such as vein clearing, stunting and downward-curling
of the leaf blades in some cultivars (Yang et al., 2003a; Revill et al., 2005;
Kidanemariam et al., 2018).
53
Despite the importance of aroids in sub-Saharan Africa, there is no information
on the incidence, distribution and diversity of TaBV or TaBCHV in the region. In 2014
and 2015, surveys were conducted to identify viruses infecting taro and other edible
aroids in Ethiopia, Kenya, Tanzania and Uganda. In this paper, we report the
identification and genomic characterisation of both TaBV and TaBCHV from East
African countries and discuss their incidence and sequence diversity. Further, the
current nomenclature of TaBV isolates is discussed and a modification to TaBV
nomenclature is proposed.
Materials and methods
Sample collection and DNA extraction
Between November 2014 and August 2015, leaf samples were collected from 333
taro plants and 59 tannia plants from 25 major growing areas in Ethiopia, Kenya,
Tanzania and Uganda. Of these, 171 (160 taro and 11 tannia) were collected from
Ethiopia, 86 (83 taro and three tannia) from Kenya, 41 (29 taro and 12 tannia) from
Tanzania and 94 (61 taro and 33 tannia) from Uganda. Samples were taken from
plants showing virus-like symptoms as well as from asymptomatic plants. The leaf
samples were desiccated over silica-gel and transported to the BecA–ILRI Hub
laboratory in Nairobi, Kenya for in-vitro laboratory analysis. Total nucleic acid (TNA)
was extracted using 2% CTAB (0.1 M Tris-HCl pH 8, 1.4 M NaCl, 20 mM EDTA, 2%
CTAB, 2% PVP and 1 M DTT) as described by Kleinow et al. (2009). Selected samples
were later transported to Queensland University of Technology (QUT), Brisbane,
Australia for cloning and sequence analysis.
PCR, cloning and sequencing
PCR was carried out using OneTaq® 2x Master Mix (NEB, UK) and degenerate
badnavirus primers BadnaFP/RP (Yang et al., 2003a) which amplify an approximately
580 nt region of the RT/RNase H-coding region of ORF 3. As a positive control, total
DNA extracted from yam leaf tissue infected with dioscorea bacilliform alata virus
was used. Briefly, 1 μl of TNA (30 ng/μl) was mixed with 10 μl of OneTaq® 2x Master
Mix and 5 ρmol of each primer in a total of 20 μl. PCR cycling conditions were as
54
follows: initial denaturation at 94 °C for 3 min followed by 40 cycles of 94 °C for 30 s,
50 °C for 30 s, and 72 °C for 1 min, with a final extension at 72 °C for 5 min. Amplicons
were separated by electrophoresis through 1.5 % agarose gels.
Ten PCR positive samples from each country, representing different districts
where possible, were randomly selected and amplicons of the expected size (∼580
bp) were gel-excised and purified using the Freeze ‘N’ Squeeze™ DNA Gel Extraction
Spin Columns (Bio-Rad, Australia) and subsequently cloned into pGEM®-T Easy
(Promega, Australia). Putative recombinant plasmid DNA containing the PCR
amplicons was sequenced using the Big Dye® Terminator v3.1 Cycle Sequencing Kit
(Thermo Fisher Scientific, Australia) at the Central Analytical Research Facility (CARF),
QUT, Brisbane, Australia. For each sample, three independent clones were
sequenced in one direction using M13F primer.
Rolling circle amplification (RCA), restriction digestion, cloning and sequencing
RCA was carried out using the Illustra™ TempliPhi 100 Amplification Kit (GE
Healthcare, UK) as described by James et al. (2011). The RCA products were digested
with StuI, SalI and XbaI restriction enzymes (NEB, UK), which were predicted, from in
silico restriction site analysis based on published full-length sequences of TaBV (Yang
et al., 2003a; GenBank accession no. AF357836) and TaBCHV (Kazmi et al., 2015;
GenBank accession no. NC026819), to cut up to three times. Digested RCA products
were separated using 0.8 % agarose gels and fragments of approximately 7-8 kb were
excised and purified using the Freeze ‘N’ Squeeze™ DNA Gel Extraction Spin Columns
(Bio-Rad, Australia) and subsequently ligated into appropriately digested and alkaline
phosphatase-treated pUC19 plasmid DNA. Recombinant DNAs were transformed
into E.coli competent cells and plasmid DNAs were purified by alkali lysis and digested
using EcoRI (NEB, UK) to identify putative recombinant plasmid DNAs containing the
RCA amplicons. Full-length genome sequences were subsequently generated from
RCA products, with sequencing carried out as described previously. For each sample,
at least three independent clones were sequenced in both directions. To confirm the
sequences spanning the putative restriction sites, PCR was carried out using
sequence-specific primers flanking the region. Briefly, PCR master mix consisted of
55
10 μl of 2x GoTaq Green Master Mix (Promega, Australia), 5 ρmol of each sequence-
specific primer and 1 μl of TNA (30 ng/μl) in a final volume of 20 μl. PCR cycling
conditions were as follows: initial denaturation at 94 °C for 3 min followed by 35
cycles of 94 °C for 30 s, 50 °C for 30 s, and 72 °C for 2 min, with a final extension at 72
°C for 10 min. The amplified products were cloned into pGEM®-T Easy vector and
sequenced as described previously.
Outward-facing PCR
To amplify the complete genome sequence of TaBCHV from East African isolates,
outward-facing, sequence-specific primers (TaBCVH-OutF:
AGGCCCATTATACTCAAAAG and TaBCHV-OutR: GAAATCAATGGTTGGTACTG) were
designed based on consensus RT/RNase H-coding sequences obtained in this study.
Long range PCRs were carried out using 1 μl of TNA (30 ng/μl) mixed with 10 μl of 2x
GoTaq Long-range PCR Master Mix (Promega, Australia) and 5 ρmol of each
sequence-specific primer in a final volume of 20 μl. PCR cycling was as follows: initial
denaturation at 94 °C for 3 min followed by 30 cycles of 94 °C for 30 s, 50 °C for 30 s,
and 72 °C for 7 min, with a final extension at 72 °C for 10 min. Amplicons were
separated by electrophoresis through 0.8 % agarose gels purified, cloned into
pGEM®-T easy vector and sequenced by primer-walking as described previously.
Sequence and phylogenetic analysis
Sequencing data were processed and analysed using CLC Main Workbench v6.9.2
(QIAGEN) and Geneious v11.0.2 (Biomatters) computer software. Sequences were
compared to all known badnaviruses on the NCBI database using BLAST algorithms
available on the NCBI website (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The presence
of putative open reading frames (ORFs) was predicted using Geneious v11.0.2
(Biomatters) and SnapGene® software (GLS Biotech). Virus sequences were further
aligned and analysed with the ClustalW multiple alignment application using BioEdit
sequence alignment editor program version 7.1.9
(http://www.mbio.ncsu.edu/BioEdit/bioedit.html). Phylogenetic trees were
constructed from ClustalW-aligned sequences on MEGA version 7.0
56
(http://www.megasoftware.net/mega.php), using the Maximum-Likelihood method
and a Kimura 2-Parameter model with 1000 bootstrap replications. Pairwise
sequence comparison (PASC) was carried out on aligned sequences using Geneious
v11.0.2 (Biomatters) computer software. For taxonomic purposes, the 1.2 kb
polymerase gene covering the RT/RNase H domains was used to compare the
different genera in the family Caulimoviridae while the core 529 bp sequence of the
RT/RNase H-coding region (excluding the BadnaFP/RP primer binding sites) was used
to compare the different TaBV and TaBCHV isolates.
Results
PCR screening and sequence analysis
Of the 392 leaf samples collected from the four countries included in this study, 333
were from taro and 59 were from tannia. Of these, 68 taro samples and 23 tannia
samples showed virus-like symptoms including mosaic, feathery mottle, vein
clearing, downward-curling of leaf blades and stunting. As an initial test for the
presence of badnaviruses, TNA was extracted from all samples and PCR carried out
using the degenerate BadnaFP/RP primers. An amplicon of the expected size was
observed in 70 of 94 samples from Uganda, 54 of 86 samples from Kenya, 25 of 41
samples from Tanzania and 100 of 171 samples from Ethiopia. Of the 392 samples
223 of 333 taro samples and 26 of 59 tannia samples tested positive, with positive
samples identified in all of the 25 districts surveyed in the four countries (Table 1).
No consistent symptoms were observed on any of the plants testing positive with
numerous asymptomatic plants also testing positive.
57
Table 1. Summary of badnavirus PCR screening and samples used for initial sequence analysis.
1The two tannia samples sequenced are shown in bold font
Country District Total number of samples
Total number of taro samples
Number of taro samples testing
positive
Total number of tannia samples
Number of tannia samples testing
positive
Total number of
positive
Percentage positive (%) Samples selected for sequencing1
Ethiopia
Welayita 87 84 75 3 1 76 87.4 Et4, Et8, Et17, Et22, Et141, Et158 Oromia 22 22 1 0 0 1 4.5 Et72 Sheka 25 22 7 3 3 10 40 Et43 Masha 14 12 3 2 1 4 28.6 Et49
Kefa 23 20 6 3 3 9 39.1 Et50 TOTAL 171 160 92 11 8 10
Kenya
Nyeri 30 29 17 1 0 17 56.7 Ke65, Ke72 Laikipia 3 2 1 1 0 1 33.3
Tharaka Nithi 14 14 10 0 0 10 71.4 Ke14, Ke16, Ke18, Kirinyaga 9 8 5 1 0 5 55.6
Embu 19 19 13 0 0 13 68.4 Ke43, Ke49, Ke51, Ke52 Kakamega 4 4 4 0 0 4 100
Kisumu 5 5 3 0 0 3 60 Ke83 Siaya 2 2 1 0 0 1 50
TOTAL 86 83 54 3 0 10
Tanzania
Musoma 9 9 3 0 0 3 33.3 Tz7 Tarime 5 2 1 3 3 4 80
Mago 2 2 2 0 0 2 100 Tz16, Tz17 Biharamulo 9 1 0 8 8 8 88.9 Tz24, Tz27
Mwanza 16 15 7 1 1 8 50 Tz36, Tz42, Tz43, Tz44, Tz47 TOTAL 41 29 21 12 4 10
Uganda
Busuju 25 16 15 9 4 19 76 Ug6, Ug10, Ug15 Lukaaya 26 17 15 9 5 20 76.9 Ug35, Ug45, Ug52 Busiro 20 11 10 9 1 11 55 Ug67
Budondo 4 4 4 0 0 4 100 Ug75 Buunya 6 5 5 1 0 5 83.3 Ug79 Kignlu 3 2 2 1 1 3 100
Luuka 10 6 5 4 3 8 80 Ug96 TOTAL 94 61 56 33 14 10
58
A total of 10 amplicons from each country, which included samples from most
districts (Table 1), were randomly selected for further analysis and were
subsequently cloned and sequenced. All the samples from Ethiopia, Kenya and
Uganda were from taro while from Tanzania, eight samples were from taro and two
samples (Tz24 and Tz27) were from tannia.
Analysis of the sequences from the three clones derived from each isolate
revealed 98-99% nucleotide identity. When the consensus sequence of each of the
40 isolates was subjected to a BLAST analysis, 14 isolates showed highest nucleotide
identity (96-97%) to a New Caledonian TaBV isolate (AY186614), while the remaining
26 isolates showed highest nucleotide identity (79.1-92.6%) to TaBCHV from China.
The Ethiopian isolates showed greatest nucleotide identity to TaBCHV only, while
isolates from Tanzania, Uganda and Kenya showed greatest nucleotide identity to
either TaBCHV or TaBV. Of the two tannia samples sequenced, Tz24 showed 97%
nucleotide identity to TaBV from New Caledonia, whereas Tz27 showed 92%
nucleotide identity to TaBCHV from China. Nucleotide sequence identity amongst the
40 East African isolates ranged from 57 to 99%. Within isolates showing greatest
nucleotide identity to TaBCHV, nucleotide sequence variability was highest in the 10
Ethiopian isolates, with variability of up to 22.6%. In the other three countries, the
nucleotide sequence identity of TaBCHV ranged from 85.2 to 99.9%. For the 14
isolates which were most similar to TaBV, nucleotide sequence identity ranged from
96.5 to 98% across all isolates. The least amount of variability in TaBV was observed
between isolates within each country, with the four isolates from Kenya showing
99.2-99.8% nucleotide sequence identity, the five samples from Tanzania showing
97.4 to 99.9% and the remaining five samples from Uganda showing 98.6 to 99.8%
nucleotide sequence identity.
RCA
Following the initial sequence analyses, six isolates showing greatest sequence
similarity to TaBV and eight isolates showing greatest sequence similarity to TaBCHV
were randomly selected and subjected to RCA in an attempt to amplify the complete
genomes. When RCA was carried out on eight isolates with high sequence similarity
59
to TaBCHV, no restriction profiles were observed in any samples following digestion
with a range of restriction enzymes which were predicted to cut the full-length
published TaBCHV and/or TaBV sequences either once or twice. In contrast, StuI
digestion of the RCA product obtained from all six isolates showing highest similarity
to TaBV resulted in a single fragment of approximately 8 kb. Further, XbaI digestion
resulted in three fragments while no restriction profiles were observed following SalI
digestion. Putative full-length StuI digest fragments from the six isolates were cloned
and the RT/RNase H-coding region sequenced using primer BadnaFP. Three cloned
DNAs for individual isolates generated from RCA were sequenced and showed 99-
100% identity. The consensus sequence derived from each RCA-amplified isolate was
compared with the consensus PCR-generated sequences described earlier and in all
cases the RCA-amplified sequences showed 99-100% nucleotide identity to the PCR-
amplified sequences.
Complete genome sequences were then obtained for three representative
isolates from taro originating from Kenya (Ke52), Tanzania (Tz17) and Uganda (Ug75),
and one isolate infecting tannia from Tanzania (Tz24). The complete genome
sequence of isolate Ke52 comprised 7,805 nt and contained four ORFs (Fig. 1a; Table
2). ORFs 1-3 were 453, 417 and 5979 nt in length, respectively, and encoded
respective putative proteins of 150, 138 and 1,992 amino acids (aa). ORF 4 was 333
nt long, encoded a putative protein of 110 aa, and was positioned entirely within ORF
3 (Fig. 1a; Table 2). The complete genome sequence of isolate Tz17 was 7,803 nt with
four ORFs similar to Ke52 (Fig. 1a; Table 2). ORFs 1-4 of Tz17 were 453, 417, 5982 and
333 nt in length, respectively, and encoded respective putative proteins of 150, 138,
1993 and 110 aa. Similarly, the complete genome of isolate Ug75 was 7,796 nt in
length and contained four ORFs with a similar arrangement to isolates Ke52 and Tz17
(Fig. 1a; Table 2). Similar to the TaBV sequences amplified from taro, the complete
genome of tannia isolate Tz24 was found to comprise 7,799 nt and contain four ORFs
(Fig. 1a; Table 2). ORFs 1-4 of Tz24 were 453, 414, 5877 and 330 nt, respectively,
which encoded predicted proteins of 150, 137, 1958 and 109 aa, respectively (Fig. 1a;
Table 2).
60
Figure 1. Linearised schematic representation of the genome organisation of full-length TaBV and TaBCHV isolates sequenced from East Africa. (a) Genome organisation of full-length TaBV isolates from East Africa representing isolates from Kenya (Ke52) Tanzania (Tz17, Tz24) and Uganda (Ug75). (b) Genome organisation of full-length TaBCHV isolates from East Africa representing isolates from Ethiopia (Et17), Kenya (Ke43), Tanzania (Tz27, Tz36) and Uganda (Ug10). The predicted putative conserved domains: movement protein (MP), coat protein (CP), zinc finger (Zn), aspartic protease (AP), reverse transcriptase (RT) and ribonuclease H (RNase H) are shown on ORF 3.
1000 2000 3000 4000 5000 6000 7000
tRNAmet TATA PolyA ORF 1 ORF 2
ORF 4
MP CP Zn AP RT RNase H ORF 3
1000 2000 3000 4000 5000 6000 7000
tRNAmet TATA PolyA ORF 1
ORF 2 ORF 4
MP CP Zn AP RT RNase H
ORF 3
(b)
(a)
61
Table 2. Summary of the genomic features of TaBV and TaBCHV isolates from East Africa.
Virus species Isolate
Genome length (nt)
ORF 1 ORF 2 ORF 3 ORF 4 Transcriptional elements
nt Start-stop aa Protein MW nt Start-stop aa Protein MW nt Start-stop aa Protein MW nt Start-stop aa Protein MW
TATA box -gap- polyA-signal
length (codon use) length (kDa) lengt
h (codon use) length (kDa) lengt
h (codon use) length (kDa) lengt
h (codon use) length (kDa)
TaBV
Ke52 7805 453 386-838 150 17.1 417 838-1254 138 15.1 5979 1257-7235 1992 227 333 2137-2469 110 12.5 7609-7615 -99- 7714-7720 (ATG-TGA) (ATG-TAA) ATG-TAA (ATG-TAA) ttcTATAAAAggc TTTTTT
Tz17 7803 453 386-838 150 17.1 417 838-1254 138 15.1 5982 1257-7238 1993 227.1 333 2137-2469 110 12.8 7612-7618 -94- 7713-7718 (ATG-TGA) (ATG-TAA) (ATG-TAA) (ATG-TAA) tccTATAAAAggc TTTATT
Ug75 7796 453 386-838 150 17.1 414 838-1251 137 15 5976 1254-7229 1991 226.8 327 2134-2460 108 12.5 7603-7609 -98- 7708-7713 (ATG-TGA) (ATG-TAA) (ATG-TAA) (ATG-TAA) ttcTATAAAAggc TTTTTT
Tz24 7799 453 (ATG-TGA)
150 17.1 414 838-1251
137 15 5877 1251-7127
1958 222.7 330 2131-2460
109 12.6 7605-7611
-97- 7709-7714
(386-838) (ATG-TAA) (ATG-TAA) (ATG-TAA) ttcTATAAAAggc TTTTTT
TaBCHV
Et17 7610 438 359-796 145 17 381 793-1173 126 14 5412 1170-6581 1803 205.9 309 6502-6810 102 12.2 7561-7467 -94- 7562-7567 (ATG-TGA) (ATG-TGA) (ATG-TGA) (ATG-TGA) aggTATATAAtaa AAAAAT
Ke43 7647 438 344-781 145 17 381 778-1158 126 13.9 5388 1163-6550 1795 200.4 309 6471-6779 102 12.4 7376-7382 -95- 7478-7483 (ATG-TGA) (ATG-TGA) (ATG-TGA) (ATG-TGA) aggTATATAAtat AAAAAT
Tz36 7654 438 521-958 145 16.7 381 955-1335 126 14 5385 1341-6725 1794 203.8 309 6646-6954 102 12.4 7425-7431 -112- 7544-7549 (ATG-TGA) (ATG-TGA) (ATG-TGA) (ATG-TGA) atcTATATAAgga TAAAAA
Ug10 7643 438 344-781 145 17 381 778-1158 126 14 5385 1163-6547 1794 206.3 309 6468-6776 102 12.4 7244-7250 -112- 7363-7368 (ATG-TGA) (ATG-TGA) (ATG-TGA) (ATG-TGA) atcTATATAAgga TAAAAA
Tz27 7389 438 344-781
145 17 381 778-1185
126 14 5130 1164-6292
1709 193.8 309 6214-6522
102 12.4 6990-6996
-112- 7109-7114
(ATG-TGA) (ATG-TGA) (ATG-TGA) (ATG-TGA) atcTATATAAgga TAAAAA nt: nucleotide; aa: amino acid; MW: molecular weight; kDa: kilodalton
62
Sequence analysis of all four genome sequences revealed the presence of a
putative tRNAmet binding site (TGGTATCAGAGCTTTGTT) with 88% nt identity to the
plant tRNAmet consensus sequence (3'-ACCAUAGUCUCGGUCCAA-5'). Further,
transcriptional promoter elements including a putative TATA box and
polyadenylation signal were identified (Table 2).
Analysis of the aa sequence of ORF 3 from all four isolates identified conserved
motifs related to the movement protein, coat protein, aspartic protease, reverse
transcriptase, RNase H and RNA-binding zinc finger-like domains typical of
Caulimoviridae (Fig. 1a). Based on these analyses, isolates Ke52, Tz17, Tz24 and Ug75
were identified as TaBV.
Outward-facing PCR
Outward-facing PCR was used in an attempt to amplify the complete TaBCHV-like
genomic sequence from representative taro samples obtained from Ethiopia (Et17),
Kenya (Ke43), Tanzania (Tz36) and Uganda (Ug10) and one tannia sample collected
from Tanzania (Tz27). Using sequence-specific primers designed from the consensus
RT/RNase H-coding sequences generated previously by PCR, a single amplicon of
approximately 7.5 kb was obtained from each isolate. These primers were designed
to overlap the BadnaFP/RP amplicons by 202 nt and 163 nt including the primer
sequences at the 5' and 3' ends respectively. The amplicons were cloned and
complete genome sequences for the five isolates were assembled using the near full-
length outward-facing PCR products and the original BadnaFP/RP PCR product
sequences. When the overlapping sequences between the two amplicons from each
isolate were compared, there was 99-100% identity. The complete genomes of the
five isolates varied in length from 7,389 to 7,654 nt and all contained four putative
ORFs (Fig. 1b; Table 2). Whereas the size and arrangement of ORFs 1-3 were similar
to that of the TaBCHV isolate from China, putative ORF 4 in all five isolates was
located at the 3' end of ORF 3 where it overlapped the 3' end of ORF 3 by 77 nt, a
position analogous with ORF 5 of the Chinese TaBCHV isolate. In all five isolates, ORFs
1, 2 and 4 comprised 438, 381 and 309, respectively, and encoded putative proteins
of 145, 126 and 102 aa, respectively. In contrast, ORF 3 of Et17, Ke43, Tz36, Ug10 and
63
Tz27 comprised 5412, 5274, 5385, 5385 and 5130 nt and encoded respective putative
proteins of 1803, 1798, 1794, 1794 and 1709 aa (Fig. 1b; Table 2). All five sequences
contained the putative tRNAmet binding site which was either
TGGTATCAGAGCTTTGTT (Et17, Ke43, Tz27 and Ug10) or TGGTATCAGAGCTTAGTT
(Tz36) and showed 84-88% nucleotide identity to the plant tRNAmet consensus
sequence. In addition, putative TATA boxes, polyadenylation signals and conserved
functional domains typical of Caulimoviridae were also identified (Fig. 1b; Table 2).
Phylogenetic analysis and pairwise sequence comparison
Phylogenetic analysis was initially carried out using the conserved 1.2 kb RT/RNase H
domain sequences of the nine full-length outward-facing PCR- and RCA-generated
episomal sequences from this study, together with previously reported TaBV and
TaBCHV isolates, additional members of the genus Badnavirus and representative
members of the other genera in the family Caulimoviridae. This analysis confirmed
that TaBV and TaBCHV isolates are members of two distinct clades within the genus
badnavirus (Fig. 2). TaBCHV isolates were found to be most closely related to citrus
yellow mosaic virus (AF347695), fig badnavirus 1 (JF411989) and several yam-
infecting badnaviruses, while TaBV isolates formed a separate clade together with
Bougainvillea spectabilis chlorotic vein-banding virus (EU034539), cacao swollen
shoot virus (L14546) and pagoda yellow mosaic-associated virus (KJ013302) (Fig. 2).
Analysis of full-length and partial TaBV sequences from the 14 isolates from
East Africa based on the core 529 bp RT/RNase H sequence showed they were
members of a single clade, but they do not form distinct groups based on their
country of origin, with isolates from the three countries interspersed across a single
terminal branch of the tree (Fig. 3). The nearest common ancestor to the East African
samples was TaBV isolate NC1 from New Caledonia (AY186614).
64
SCBGDV-FJ439817 BSMYV-AY805074
KTSV-AY180137 BSGFV-AY493509
BSIMV-HQ659760 BSVNV-AY750155
BSOLV-AJ002234 BSCAV-HQ593111
BSUAV-HQ593107 CiYMV-AF347695
FBV1-JF411989 TaBCHV-KP710178 Et17 Tz27 Tz36
Ug10 Ke43
TaBCHV
CSSV-L14546 PYMAV-KJ013302
BCVBV-EU034539 TaBV-AF357836
Tz17 Ug75 Ke52 Tz24
TaBV
DBSNV-DQ822073 DBRTV2-KX008577
DBRTV1-KX008574 ComYMV-X52938
SCBMOV-M89923 SCBIMV-AJ277091
BSUIV-HQ593108 BSULV-HQ593109
BSUMV-HQ593110
Badnavirus
Tungrovirus RTBV-NC001914 Rosadnavirus RYVV-JX028536
Soymovirus SbCMV-NC001739 Cavemovirus CsVMV-NC001648
Solendovirus TVCV-AF190123 Caulimovirus CaMV-NC001497
Petuvirus PVCV-NC001839 100
100
100
68
96
99
99
51 71
100
90 99
98 50
98
100
57 62
87
69
84
84
92
62
0.2
65
Figure 2. Phylogenetic analyses of the TaBV and TaBCHV sequences from East Africa together with other representative sequences from the family Caulimoviridae. The tree is based on 1.2 kbp pol-gene sequences of the RT/RNase H-coding region of ORF 3 (as described by Geering et al., 2010). BSUAV: banana streak UA virus; BSCAV: banana streak CA virus; BSOLV: banana streak OL virus; BSVNV: banana streak VN virus; BSIMV: banana streak IM virus; KTSV: Kalanchoe top spotting virus; BSGFV: banana streak GF virus; BSMYV: banana streak MY virus; SCBGDV: sugarcane bacilliform Guadeloupe D virus; ComYMV: Commelina yellow vein mosaic virus; DBSNV: Dioscorea bacilliform VN virus; DBRTV1: Dioscorea bacilliform RT virus 1; DBRTV2: Dioscorea bacilliform RT virus 2; FBV1: fig badnavirus 1; CiYMV: citrus yellow mosaic virus; TaBCHV: taro bacilliform CH virus; CSSV: cacao swollen shoot virus; PaYMV: pagoda yellow mosaic associated virus; BCVBV: Bougainvillea spectabilis chlorotic vein-banding virus; TaBV: taro bacilliform virus; SCBMOV: sugarcane bacilliform MO virus; SCBIMV: sugarcane bacilliform IM virus; BSUIV: banana streak UI virus; BSULV: banana streak UL virus; BSUMV: banana streak UM virus; RTBV: rice tungro bacilliform virus; CsVMV: cassava vein mosaic virus; TVCV: tobacco vein clearing virus; SbCMV: soybean chlorotic mottle virus; CaMV: cauliflower mosaic virus; PVCV: Petunia vein clearing virus; RYVV: rose yellow vein virus.
66
Figure 3. Phylogenetic analyses of the TaBV-like sequences characterised in this study. The analysis is based on the core 529 nt RT/RNase H-coding sequences delimited by the BadnaFP/RP primers. Ke, Tz and Ug indicate isolates from Kenya, Tanzania and Uganda, respectively, while TaBV isolates NC1, SI2, V1, FP1, S2, SI4 SI7, PNG and F1 are those previously described by Yang et al. (2003b). ). Bougainvillea spectabilis chlorotic vein-banding virus (BCVBV) was used as an outgroup (see Fig. 2).
Tz24
Tz47
Tz43
Ke18
Tz44
Ug79
Tz17
Ug6
Ug75
Ug67
Ke83
Ke49
Ke52
Ug45
TaBV NC1-AY186614
TaBV SI2-AY186617
TaBV V1-AY186616
TaBV FP1-AY186613
TaBV S2-AY186615
TaBV SI4-AY186618
TaBV SI7-AY186619
TaBV PNG-AF357836
TaBV F1-AY186612
BCVBV-EU034539
97
66
86
95
64
66100
57
0.05
67
When analysis was done using the two published TaBCHV sequences from
China together with full-length and partial sequences of the 26 isolates from East
Africa based on the core 529 bp RT/RNase H sequence, the TaBCHV isolates were
divided into two distinct subgroups (Fig. 4). The first subgroup, herein referred to as
‘subgroup a’, includes five isolates from Ethiopia and one isolate from Uganda,
whereas the second subgroup, herein referred as ‘subgroup b’, is more diverse and
comprises the two published TaBCHV sequences from China together with additional
isolates from all four countries in East Africa.
The distinctive clustering of the six TaBCHV isolates from East Africa (Ug96, Et4,
Et8, Et43, Et72 and Et141) within ‘subgroup a’, with high bootstrap support values, is
indicative that this subgroup may represent a distinct badnavirus species. ‘Subgroup
b’ can be further divided into four closely related sequence groups supported by
moderate to high bootstrap values, with three of the Ethiopian TaBCHV isolates in a
basal position to these and sharing a common ancestor with ‘subgroup a’.
As the initial sequence comparisons of PCR-amplified RT/RNase H-coding
sequences indicated that nucleotide sequence variability in the TaBCHV isolates was
up to 22.6 %, PASC analysis was carried out using all available TaBCHV sequences
(Table 3). This analysis revealed that the six isolates in TaBCHV ‘subgroup a’ showed
79.1 to 80.5 % nucleotide sequence identity with the published TaBCHV sequences
from China, which is on the threshold for species demarcation in the genus
Badnavirus. These six sequences also shared 78.9 to 81.4 % nucleotide sequence
identity to other East African TaBCHV isolates, with the exception of two isolates
(Et17 and Et49) from ‘subgroup b’ which are distinct from, and basal to, the Chinese
TaBCHV sequences with 84.1 to 85.8 % identity, as well as isolate Et22 from another
distinct TaBCHV subgroup (Fig. 4).
68
Figure 4. Phylogenetic analyses of the TaBCHV-like sequences characterised in this study. The analysis is based on the core 529 nt RT/RNase H-coding sequences delimited by the BadnaFP/RP primers. Et, Ke, Tz and Ug indicate isolates from Ethiopia, Kenya, Tanzania and Uganda, respectively, while TaBCHV-1 and -2 are described in Kazmi et al. (2015). Fig badnavirus 1 (FBV1) and citrus yellow mosaic virus (CiYMV) were used as outgroups (see Fig. 2).
Ug10
Tz16
Ke51
Tz36
Ug15
Ke16
Ke43
Tz42
Et22
Ke65
Ke72
Ug35
Ke14
Et158
Tz7
Tz27
Ug52
TaBCHV-1-NC026819
TaBCHV-2-KP710177
Et50
Et49
Et17
Subgroup b
Ug96
Et141
Et4
Et8
Et72
Et43
Subgroup a
FBV1-JF411989
CiYMV-AF347695Outgroup
69
99
100
100
100
100
91
93
97
93
50
58
61
88
89
99
57
69
Table 3. Pairwise sequence comparisons of TaBCHV isolates using core 529 nt RT/RNase H-coding sequences.
Tz16 Ke51 Ug10 Tz36 Ug15 Ke16 Ke43 Tz42 Et22 Ug35 Ke72 Ke65 Ke14 TaBCHV-1 TaBCHV-2 Ug52 Tz27 Tz7 Et158 Et49 Et17 Et50 Et8 Et4 Et43 Et72 Et141
Tz16 Ke51 99.9 Ug10 99.9 99.9 Tz36 99.6 99.6 99.6 Ug15 99.6 99.6 99.6 99.2 Ke16 99.8 99.8 99.8 99.4 99.4 Ke43 99.6 99.6 99.6 99.2 99.2 99.8 Tz42 96.0 96.0 96.0 95.6 95.6 96.2 96.4 Et22 96.4 96.4 96.4 96.0 96.0 96.2 96.0 96.0 Ug35 91.3 91.3 91.3 90.9 91.3 91.1 90.9 93.4 94.1 Ke72 91.8 91.8 91.8 91.5 91.8 92.0 91.8 93.9 94.7 98.7 Ke65 92.6 92.6 92.6 92.2 92.6 92.8 92.6 94.7 95.4 97.9 98.9 Ke14 89.2 89.2 89.2 88.8 89.2 89.4 89.2 89.9 91.3 92.6 93.4 93.7 TaBCHV-1 87.3 87.3 87.3 86.9 87.7 87.1 86.9 86.1 88.0 89.0 88.8 89.2 90.3 TaBCHV-2 86.9 86.9 86.9 86.5 87.3 86.7 86.5 85.8 87.7 88.6 88.4 88.8 89.9 99.2 Ug52 87.9 87.9 87.9 87.5 88.2 87.7 87.5 86.7 88.4 88.6 89.0 89.0 90.5 92.6 92.2 Tz27 91.8 91.8 91.8 91.5 91.8 91.7 91.5 90.3 92.0 91.7 92.0 92.4 93.2 91.5 91.1 93.0 Tz7 91.8 91.8 91.8 91.5 91.8 91.7 91.5 90.3 92.0 91.7 92.0 92.4 93.2 91.5 91.1 93.0 99.9 Et158 92.4 92.4 92.4 92.0 92.0 92.2 92.0 90.5 92.6 92.0 92.4 92.8 91.8 92.0 91.7 92.6 96.0 96.0 Et49 89.4 89.4 89.4 89.0 89.4 89.6 89.4 89.4 91.5 89.8 90.5 90.7 89.8 88.8 88.4 88.8 90.9 90.9 92.2 Et17 90.5 90.5 90.5 90.1 90.5 90.3 90.1 90.9 93.7 91.8 92.2 92.4 90.3 88.6 88.2 88.4 91.7 91.7 93.4 96.0 Et50 86.3 86.3 86.3 86.0 86.3 86.1 86.0 85.2 86.9 87.3 87.1 87.1 86.3 89.0 88.6 86.7 89.2 89.2 91.5 91.1 91.1 Et8 81.0 81.0 81.0 80.6 80.8 80.8 80.6 81.2 84.1 79.5 79.9 80.6 80.8 79.7 79.1 78.9 80.1 80.1 80.5 84.1 85.8 77.6 Et4 81.0 81.0 81.0 80.6 80.8 80.8 80.6 81.2 84.1 79.5 79.9 80.6 80.8 79.7 79.1 78.9 80.1 80.1 80.5 84.1 85.8 77.6 99.9 Et43 81.0 81.0 81.0 80.6 80.8 80.8 80.6 81.2 84.1 79.5 79.9 80.6 80.8 79.7 79.1 78.9 80.1 80.1 80.5 84.1 85.8 77.6 99.9 99.9 Et72 81.0 81.0 81.0 80.6 80.8 80.8 80.6 81.2 84.1 79.5 79.9 80.6 80.8 79.7 79.1 78.9 80.1 80.1 80.5 84.1 85.8 77.6 99.9 99.9 99.9 Et141 81.2 81.2 81.2 80.8 81.0 81.0 80.8 81.4 84.3 79.7 80.1 80.8 81.0 79.9 79.3 79.1 80.3 80.3 80.6 84.3 85.6 77.4 99.8 99.8 99.8 99.8 Ug96 81.2 81.2 81.2 80.8 81.0 81.0 80.8 81.0 84.3 79.5 79.9 80.6 81.6 80.5 79.9 79.7 80.5 80.5 80.8 84.3 85.2 77.6 96.6 96.6 96.6 96.6 96.8
TaBCHV-1 is GenBank Accession No. NC026819; TaBCHV-2 is GenBank Accession No. KP710177
70
Five clear sequence groups having very high (>96 %) nucleotide sequence
identity were identified, including the six isolates from ‘subgroup a’ (96.6 to 99.9 %
identity), the two published TaBCHV sequences from China (99.2 % identity), isolates
Tz7, Tz27 and Et158 (96 to 100 % identity), isolates Ug36, Ke72 and Ke65 (97.9 to
98.9% identity) and the nine isolates forming the terminal TaBCHV subgroup (96 to
99.9 % identity). Between the various groups of TaBCHV isolates determined in the
phylogenetic analysis, nucleotide sequence identity generally ranged from 85 to 94%,
which may explain the low bootstrap support for some branches in the phylogenetic
analysis (Fig. 4; Table 3).
Discussion
Several surveys were carried out in 2014 and 2015 to identify viruses infecting taro
and other edible aroids in East Africa. Using a PCR-based strategy with the degenerate
badnavirus primers, BadnaFP/RP, a high incidence of badnavirus-like sequences was
found in taro growing in Ethiopia, Kenya, Tanzania and Uganda. This ranged from
58.4% to 74.4% of samples from each country, with at least one PCR-positive sample
detected in every district surveyed. Similar to previous studies (Yang et al 2003b;
Revill et al., 2005), no correlation was observed between the presence of the
badnavirus-like sequences and symptoms in either taro or tannia plants. However,
since mixed infections are common in taro (Revill et al., 2005), testing the samples
for other viruses is necessary to shed further light on any symptoms associated with
badnavirus infection. Sequence analysis of the RT/RNase H-coding region of 40
isolates amplified using PCR revealed greatest nucleotide sequence identities to
either TaBV or TaBCHV, with 14 samples showing highest (96-97%) nucleotide
sequence identity to TaBV from New Caledonia, while the remaining 26 samples
showed highest (79-92%) nucleotide sequence identity to TaBCHV from China. In
Ethiopia, sequences similar to only TaBCHV were detected, while both TaBV- and
TaBCHV-like sequences were detected from Uganda, Kenya and Tanzania. Of the two
tannia samples selected for sequencing, TaBV was detected from one sample (Tz24),
while TaBCHV was detected from a second sample (Tz27).
71
Since the BadnaFP/RP-generated amplicons could have been derived from
either integrated sequences or episomal virus, RCA was used in an attempt to
specifically amplify episomal viral genomic DNA. Whereas RCA amplified the
complete genome of TaBV isolates, no amplification products were obtained using
samples containing the TaBCHV-like sequences. Therefore, the latter samples were
analysed using an outward-facing PCR strategy which resulted in the amplification of
full-length East African TaBCHV genomes. Interestingly, analysis of the cloned
TaBCHV sequences revealed the presence of the restriction sites StuI and XbaI, which
were predicted from the published TaBCHV sequence from China and which were
used to digest the RCA-amplified DNA from these samples. Despite the presence of
high molecular weight amplification products in RCA reactions using samples shown
to contain TaBCHV, the RCA-amplified products did not digest with StuI and XbaI as
expected. The reason for this is unknown but could be due to very low levels of target
episomal DNA in taro plants, as has been reported with badnaviruses from sweet
potato (Kreuze et al., 2017).
The genome organisation of the TaBV isolates infecting taro from East Africa is
consistent with the previously published South Pacific TaBV isolates with four ORFs
(Yang et al., 2003a). The genome organisation of the TaBV isolate infecting tannia is
also consistent with the taro-infecting TaBV isolates identified from East Africa and
the South Pacific. In contrast, whereas the genome organisation of the four TaBCHV
isolates from East Africa were similar to each other and also contained four ORFs, this
differs from the previously published Chinese TaBCHV isolate which was reported to
encode six ORFs (Kazmi et al., 2015). Recently, Wang et al. (2018) reported a full-
length sequence of TaBCHV infecting taro from Hawaii, USA. The genome of this
Hawaiian TaBCHV isolate contained five ORFs. The sizes and locations of ORF 1, 2, 3
and 5 are consistent with ORFs 1-4 of TaBCHV isolates from East Africa. However,
unlike TaBCHV isolates from East Africa, TaBCHV-Hawaii possesses an overlapping
ORF within ORF 3 (Wang et al., 2018). Of the five East African TaBCHV isolates
sequenced in the current study, three (Ke43, Ug10 and Tz36) are representative of a
small subset in the terminal branch of ‘subgroup b’ in the phylogenetic analysis, while
Et17 is a basal member of this subgroup (Fig. 4). The sole TaBCHV isolate from tannia
72
(Tz27) formed another small subset within ‘subgroup b’ together with previously
published TaBCHV isolates from China and other isolates from Ethiopia and Uganda
(Fig. 4). Based on the genome organisation and phylogenetic analysis, it could be
inferred that all members of ‘subgroup b’ would have four ORFs, but interestingly the
Chinese TaBCHV sequence, which falls into a distinct group of isolates within
‘subgroup b’, has two additional ORFs. One of these ORFs is analogous to the TaBV
ORF4, while the other, ORF 6, is located at a position downstream of the ORF4
described herein from TaBCHV isolates from East Africa. Additional sequencing of
isolates from the various TaBCHV groups within ‘subgroup b’ of the phylogenetic tree
is needed to clarify these differences in genome organisation.
Phylogenetic analysis showed that all East African TaBV isolates form a single
subgroup within known TaBV isolates and are most similar to a published isolate from
New Caledonia (Fig. 3). This may indicate that a single isolate of TaBV was initially
introduced to East Africa and has since been disseminated throughout three of the
countries in the region. Phylogenetic analysis of TaBCHV isolates from East Africa
showed that they form two distinct subgroups (Fig. 4). PASC of the isolates within
these two subgroups suggests that ‘subgroup a’ may be distinct enough from some
members of ‘subgroup b’ to be considered a distinct species. However, when all
sequences in this group are considered there is no clear delineation of species based
on the current criteria for species demarcation in the genus badnavirus of 20%
nucleotide sequence variability in the core RT/RNase H-coding region of ORF3 (Table
3). Whether the members of ‘subgroup a’ represent a novel badnavirus species
requires further sequencing of TaBCHV isolates from East Africa and other regions.
Initial characterisation of badnaviruses infecting taro from the South Pacific in
2003 by Yang et al. (2003a) reported a single virus species represented by a single
full-length genome sequence of a PNG isolate (GenBank accession no. NC004450) and
partial genome sequences of isolates from Fiji, Solomon Islands, Vanuatu, New
Caledonia, French Polynesia and Samoa (Yang et al., 2003a, b). The name taro
bacilliform virus (TaBV) was subsequently accepted for this viral species (Fauquet et
al., 2005). More recently, Ming et al. (2013) reported a new species of badnavirus
73
infecting taro from China (GenBank accession no. NC026819) and Kazmi et al. (2015)
determined the complete genome sequence of two isolates using sequence-specific
PCR amplification and small RNA (sRNA) sequencing. The name taro bacilliform CH
virus (TaBCHV) was accepted for this new viral species within the genus Badnavirus
(Geering and Teycheney, 2016). This current study is the first to identify and
characterise TaBV and TaBCHV isolates infecting taro and tannia in East Africa and
the possible presence of a new badnavirus species in Ethiopia and Uganda. To have a
consistent naming of badnaviruses infecting taro and other aroids, we propose that
Taro bacilliform virus (TaBV) be renamed taro bacilliform PNG virus (TaBPNGV) to
include the name of the country from which the virus was first reported (Papua New
Guinea).
Virus infection in taro has been reported to affect both the quality and quantity
of the harvested corms, with production losses ranging from 20 to 60% and, in some
cases, plant death. These losses often result from the synergistic interactions of
multiple virus infections (Revill et al., 2005; Rana et al., 1983; Elliott et al., 1997),
however, the role of badnaviruses in these interactions remains poorly understood.
This study confirmed the widespread occurrence of two known badnavirus species,
TaBV and TaBCHV, in East Africa. Further, in the case of TaBCHV, at least two
genetically distinct subgroups were identified. To our knowledge, this is the first
report of TaBV and TaBCHV in these countries and the first sequence record from
tannia.
74
Data Availability Statement Sequences described in this paper are available in GenBank as accession numbers
MG017321 - MG017360 and MG833013 - MG833014.
Acknowledgments
This project was funded by Biosciences eastern and central Africa (BecA–ILRI) Hub
through the African Biosciences Challenge Fund (ABCF). ABCF program is supported
by the Australian Department of Foreign Affairs and Trade (DFAT) through BecA-
CSIRO partnership; the Syngenta Foundation for Sustainable Agriculture (SFSA); the
Bill and Melinda Gates Foundation (BMGF); the UK Department for International
Development (DFID) and the Swedish International Development Agency (SIDA). DK
is the recipient of an Australia Awards Scholarship.
Conflict of interest
The authors declare no conflict of interest.
75
References
Akwee PE, Netondo G, Kataka, JA, 2015. A critical review of the role of taro Colocasia esculenta L. (Schott) to food security: A comparative analysis of Kenya and Pacific Island taro germplasm. Scientia Agriculturae 9, 101–08.
Beyene TM, 2013. Morpho-agronomical characterization of taro (Colocasia esculenta) accessions in Ethiopia. SciencePG 1, 1–9.
Bhat AI, Hohn T, Selvarajan R, 2016. Badnaviruses: the current global scenario. Viruses 8, 177.
Borah BK, Sharma S, Kant R, 2013. Bacilliform DNA-containing plant viruses in the tropics: commonalities within a genetically diverse group. Molecular Plant Pathology 14, 759–71.
Elliott MS, Zettler FW, Brown LG, 1997. Dasheen mosaic potyvirus of edible and ornamental aroids. University of Florida, Plant Pathology Circular, 384.
Fauquet C, Mayo MA, Maniloff J, 2005. Virus Taxonomy: Eighth report of the International Committee on Taxonomy of Viruses. New York, NY, USA: Elsevier Academic Press.
Geering A, Hull R, 2012. Caulimoviridae. In: King AMQ, Adams MJ, Carstens EB, eds. Virus Taxonomy, Ninth report of the International Committee on Taxonomy of Viruses. New York, NY, USA: Elsevier, 429–43.
Geering A, Teycheney P, 2016. Two new species in the genus Badnavirus. https://talk.ictvonline.org/files/ Accessed 27 October 2017.
Gollifer DE, Jackson GVH, Dabek AJ, 1977. The occurrence and transmission of viruses of edible aroids in the Solomon Islands and the Southwest Pacific. International Journal of Pest Management 23, 171–77.
Harrison J, Moore KA, Paszkiewicz K et al., 2014. A draft genome sequence for Ensete ventricosum, the Drought-Tolerant “Tree against hunger”. Agronomy 4, 13–33.
Hull R, Covey SN, 1983. Does cauliflower mosaic virus replicate by reverse transcription? Trends in Biochemical Sciences 8, 119–21.
Iskra-Caruana ML, Duroy PO, Chabannes M, 2014. The common evolutionary history of badnaviruses and banana. Infection, Genetics and Evolution 21, 83–89.
Jacquot M, Hagen LS, Jacquemond M, 1996. The open reading frame 2 product of Cacao Swollen Shoot Badnavirus is a nucleic acid-binding protein. Virology 225, 191–95.
James AP, Geijskes RJ, Dale JL, 2011. Development of a novel rolling-circle amplification technique to detect Banana streak virus that also discriminates between integrated and episomal virus sequences. Plant Disease 95, 57–62.
76
Kazmi SA, Yang Z, Hong N, 2015. Characterization by small RNA sequencing of Taro Bacilliform CH Virus (TaBCHV), a novel Badnavirus. PLoS One 10, e0134147.
Kenyon L, Lebas BSM, Seal SE, 2008. Yams (Dioscorea spp.) from the South Pacific Islands contain many novel badnaviruses: implications for international movement of yam germplasm. Archives of Virology 153, 877–89.
Kidanemariam D, Sukal A, Crew K et al., 2018. Characterization of an Australian isolate of taro bacilliform virus and development of an infectious clone. Archives of Virology doi: 10.1007/s00705-018-3783-0
Kleinow T, Nischang M, Beck A et al., 2009. Three C-terminal phosphorylation sites in the Abutilon mosaic virus movement protein affect symptom development and viral DNA accumulation. Virology 390, 89–101.
Kreuze J, Perez A, Galvez M, 2017. Badnaviruses of Sweetpotato: symptomless co-inhabitants on a global scale. bioRxiv, 140517.
Lebot V, 2009. Tropical root and tuber crops: cassava, sweet potato, yams and aroids. Crop Production Science in Horticulture, 17. CABI, Wallingford, UK.
Macanawai AR, Ebenebe AA, Hunter D, 2005. Investigations into the seed and mealybug transmission of Taro bacilliform virus. Australasian Plant Pathology 34, 73–76.
Mariame F, Gelmesa D, 2006. Review of the status of vegetable crops production and marketing in Ethiopia. Uganda Journal of Agricultural Science 12, 26–30.
Ming SFY, Ping GW, Ping LW, 2013. Molecular identification and specific detection of Badnavirus from taro grown in China. Acta Phytopathologica Sinica 6, 590–95.
Muller E, Dupuy V, Blondin L et al., 2011. High molecular variability of sugarcane bacilliform viruses in Guadeloupe implying the existence of at least three new species. Virus Research 160, 414–19.
Ndabikunze BK, Talwana HAL, Mongi RJ et al., 2011. Proximate and mineral composition of cocoyam (Colocasia esculenta L. and Xanthosoma sagittifolium L.) grown along the Lake Victoria Basin in Tanzania and Uganda. African Journal of Food Science 5, 248–54.
Onwueme IC, Charles WB, 1994. Cultivation of cocoyam. In: Tropical root and tuber crops. Production, perspectives and future prospects. FAO Plant Production and Protection Paper 126, Rome 139-61.
Rana GL, Vovlas C, Zettler FW, 1983. Manual transmission of dasheen mosaic virus from Richardia to nonaraceous hosts. Plant Disease 67, 1121–22.
Revill P, Jackson G, Hafner G et al., 2005. Incidence and distribution of viruses of taro (Colocasia esculenta) in Pacific Island countries. Australian Plant Pathology 35, 327–31.
77
Seal S, Turaki A, Muller E et al., 2014. The prevalence of badnaviruses in West African yams (Dioscorea cayenensis-rotundata) and evidence of endogenous pararetrovirus sequences in their genomes. Virus Research 186, 144–54.
Talwana HAL, Serem AK, Ndabikunze BK et al., 2009. Production status and prospects of Cocoyam (Colocasia esculenta (L.) Schott.) in East Africa. Journal of Root Crops 35, 98–07.
Tumuhimbise R, Talwana HL, Osiru DSO et al., 2009. Growth and development of wetland-grown taro under different plant populations and seedbed types in Uganda. African Crop Science Journal 17, 49–60.
Wang Y, Borth WB, Green JC et al., 2018. Genome characterization and distribution of Taro bacilliform CH virus on taro in Hawaii, USA. European Journal of Plant Pathology 150, 1107–11.
Yang IC, Hafner GJ, Dale JL et al., 2003a. Genomic characterization of taro bacilliform virus. Archives of Virology 148, 937–49.
Yang IC, Hafner GJ, Revill PA et al., 2003b. Sequence diversity of South Pacific isolates of Taro bacilliform virus and the development of a PCR-based diagnostic test. Archives of Virology 148, 1957–68.
78
79
Chapter 5
Characterisation of an Australian isolate of taro bacilliform virus and development of an infectious clone
Dawit B. Kidanemariam1, 2, Amit C. Sukal1, Kathy Crew3, Grahame V. H. Jackson4, Adane D. Abraham5, James L. Dale1, Robert M. Harding1, Anthony P. James1*
1Centre for Tropical Crops and Biocommodities, Queensland University of Technology, Brisbane, 4001, Australia
2National Agricultural Biotechnology Research Center, Ethiopian Institute of Agricultural Research, P.O. Box 2003, Addis Ababa, Ethiopia
3Department of Agriculture and Fisheries, Eco-sciences Precinct, Dutton Park, Brisbane, 4102, Australia
424 Alt St, Queens Park, NSW 2022, Australia
5Department of Biotechnology, Addis Ababa Science and Technology University, P.O. Box 16417, Addis Ababa, Ethiopia
Archives of Virology 163:1677–1681
80
Statement of Contribution of Co-Authors of Thesis by Publication Paper
The authors listed below have certified that: 1. They meet the criteria for authorship in that they have participated in the conception,
execution, or interpretation, of at least that part of the publication in their field of expertise; 2. They take public responsibility for their part of the publication, except for the responsible
author who accepts overall responsibility for the publication; 3. There are no other authors of the publication according to these criteria; 4. Potential conflicts of interest have been disclosed to (a) granting bodies, (b) the editor or
publisher of journals or other publications, and (c) the head of the responsible academic unit, and
5. They agree to the use of the publication in the student’s thesis and its publication on the QUT’s ePrints site consistent with any limitations set by publisher requirements.
In the case of this chapter: Characterisation of an Australian isolate of taro bacilliform virus and development
of an infectious clone
RSC, Level 4, 88 Musk Ave, Kelvin Grove Qld 4059 Page 1 of 1 Current @ 20/09/2016 CRICOS No. 00213J
QUT Verified Signature
QUT Verified Signatures
81
Abstract The badnavirus, taro bacilliform virus (TaBV), has been reported to infect taro
(Colocasia esculenta L.) and other edible aroids in several South Pacific island
countries but there are no published reports from Australia. Using PCR and RCA, we
identified and characterized an Australian TaBV isolate. A terminally redundant
cloned copy of the TaBV genome was generated and shown to be infectious in taro
following agro-inoculation. This is the first report of TaBV from Australia and also the
first report of an infectious clone for this virus.
Keywords
Colocasia esculenta, Badnavirus, Caulimoviridae, rolling circle amplification,
episomal DNA
Taro bacilliform virus (TaBV) is a member of the genus Badnavirus, family
Caulimoviridae [4]. TaBV has a natural host range restricted to aroids and is
transmitted by vegetative propagation, mealybugs in a semi-persistent manner and
in some cases through seed or pollen, but is not mechanically transmissible [5, 14].
To date, TaBV isolates have only been characterized from several South Pacific Island
countries, including Fiji, Solomon Islands, Vanuatu, New Caledonia, French Polynesia
and Samoa [17, 23]. A second badnavirus, Taro bacilliform CH virus (TaBCHV), has
been reported from China and the USA [13, 16, 20].
Badnaviruses are characterized by non-enveloped, bacilliform-shaped
particles of 30 nm by 120-150 nm and circular, double-stranded DNA genomes of 7.2
to 9.2 kb, typically encoding three open reading frames (ORFs) [4]. The function of
the protein encoded by ORF 1 is unknown, while the ORF 2 protein has non-specific
DNA- and RNA-binding activity and may be involved in virion assembly [9]. ORF 3
encodes a large polyprotein (∼200 kDa) which is processed into several mature
functional proteins including a movement protein (MP), coat protein (CP), aspartic
protease (AP), reverse transcriptase (RT) and ribonuclease H (RNase H) [4]. The
82
RT/RNase H-coding sequence of ORF 3 is the most conserved region of the genome
and a nucleotide difference of more than 20 % in this region is used for demarcation
of species in the genus [4]. The genus Badnavirus contains the most diverse and
heterogeneous viruses within the family Caulimoviridae, both at the genomic and
antigenic level, and is currently grouped into forty distinct species. The majority of
known badnaviruses infect tropical crops including banana, yam, taro, sugar cane,
pepper, citrus and cacao (https://talk.ictvonline.org/taxonomy/). The genome of
TaBV possesses four ORFs, with the size and organization of ORFs 1-3 consistent with
most badnaviruses [22]. ORF 4 of TaBV overlaps ORF 3 between the MP and CP
domains and putatively encodes a protein of ∼13 kDa, with little homology to any
published protein-coding sequences.
TaBV-infected taro plants are typically symptomless although, in some cases,
vein-clearing, stunting and downward-curling of the leaf blades have been reported
[17, 22-23]. However, dual infection of taro with TaBV and colocasia bobone disease-
associated virus (CBDaV), a putative rhabdovirus [7], is believed to cause the lethal
disease called Alomae in Papua New Guinea (PNG) and Solomon Islands [5, 12, 17].
The inability to mechanically transmit TaBV has not only hindered investigations into
symptoms and yield losses associated with virus infection, but also the contribution
of TaBV to the Alomae disease complex.
Plant virus infectious clones are being increasingly used as a simple and
efficient means to study plant-virus interactions. Infectious clones of several
badnaviruses have been reported, including commelina yellow mottle virus, citrus
yellow mosaic virus, cacao swollen shoot virus and sugarcane bacilliform virus [3, 8,
10, 15]. The recent development of rolling circle amplification (RCA) has not only
facilitated the amplification and detection of the complete genome sequence of
circular DNA viruses, including badnaviruses [1, 11, 19], but has also greatly simplified
the development of infectious clones of viruses with circular DNA genomes such as
geminiviruses [6, 21]. In this study, we used RCA to amplify the full-length genome of
an Australian TaBV isolate and describe the development of a greater-than-genome-
length cloned copy of the virus DNA which is infectious in taro.
83
In 2013, 24 taro leaf samples were collected from several field sites in north
and south-east Queensland and northern New South Wales, Australia (Table 1).
Samples were desiccated over silica-gel and total nucleic acids (TNA) were extracted
using a CTAB-based protocol [11]. Samples were initially tested for TaBV by PCR using
the primers 12F and CP-R to amplify a 560 bp fragment of the CP-coding region [23].
Briefly, 1 μL of TNA was mixed with 10 μL of 2x GoTaq Green Master Mix (Promega,
Australia) and 5 ρmol of each primer in a 20 μL reaction volume. PCR cycling
conditions included an initial denaturation step at 94 °C for 3 min followed by 35
cycles of 94 °C for 30 s, 50 °C for 30 s, and 72 °C for 1 min and a final extension step
at 72 °C for 5 min. PCR amplicons were separated by electrophoresis through 1.5 %
agarose gels. Nine samples tested positive for TaBV (Table 1), three of which (7, 12
and 24) were randomly selected for further analysis by PCR using the degenerate
primers BadnaFP/RP [22]. Amplicons of the expected size (589 bp) were obtained
from all three samples, and these were gel-excised, cloned into pGEM-T® Easy
(Promega, Australia) and sequenced using the Big Dye® Terminator v3.1 Cycle
Sequencing Kit (Thermo Fisher Scientific, Australia). For each sample, three
independent clones were sequenced. Sequences were processed using the CLC Main
Workbench v6.9.2 (QIAGEN) and Geneious v10.2.2 (Biomatters, New Zealand)
computer software programs. In each case, the three independent sequence reads
showed 98-99 % nucleotide identity and the consensus sequence for each could be
translated to give a predicted functional protein sequence. The three consensus
sequences showed 82.1 to 86.5 % identity to each other at the nucleotide level.
Subsequent BLAST analysis, using the 529 nt sequences excluding the BadnaFP/RP
priming sites, showed that sample 7 had 92.8 % identity to a PNG TaBV isolate, while
sample 12 was identical to a New Caledonian TaBV isolate and sample 24 had 97.9 %
identity to a Fijian TaBV isolate.
84
Table 1. Sampling locations and results of PCR testing for TaBV in taro leaf samples.
Sample Location1 PCR result2 1 Cairns - 2 . - 3 . - 4 . - 5 El Arish - 6 . - 7 . + 8 . + 9 Innisfail +
10 . + 11 . - 12 Tully + 13 . + 14 Ingham - 15 Mackay - 16 . - 17 Brisbane (north) - 18 . - 19 . - 20 Cudgen - 21 . - 22 Brisbane (south) + 23 . + 24 . +
1 All locations in Queensland except Cudgen in New South Wales 2 Result of PCR screening using primers 12F/CP-R as described by Yang et al. [20]
85
To generate the complete genome sequence of a representative Australian
TaBV isolate, TNA from sample 7 (hereafter referred to as TaBV-Aus7) was subjected
to RCA using the IllustraTM TempliPhi 100 Amplification Kit (GE Healthcare, UK) as
previously described [11]. Based on in silico restriction site analysis of a published
full-length TaBV sequence (GenBanK ID NC004450), the restriction enzymes SalI and
StuI were selected for digesting the RCA product as they were predicted to have one
and two recognition sites, respectively. When the digested RCA products were
separated by electrophoresis, no RFLP profile was observed using SalI, whereas a
single, putative full-length fragment of ∼7.5 kb was obtained using StuI. The StuI
fragment was excised, cloned into SmaI-digested and dephosphorylated pUC19
vector and the complete genome was sequenced as described previously using a
primer-walking approach. The nucleotide sequence flanking the StuI site was
confirmed by PCR using sequence-specific primers and subsequent cloning and
sequencing of the amplicons. Analysis of the complete sequence confirmed the
presence of a single StuI site, with no SalI sites present in the full-length sequence.
The complete genome sequence of TaBV-Aus7 was determined to be 7,494
nt. Sequence analysis identified three putative ORFs consistent with the typical
genome organization of badnaviruses. ORF 1 comprised 441 nt and encoded a
putative protein of 146 aa (Mr 16.6 kDa), while ORF 2 was 435 nt encoding a putative
protein of 144 aa (Mr 15.7 kDa). ORF 3 was 5,664 nt in length encoding a putative
protein of 1,887 aa (Mr = 215.2 kDa) with conserved motifs identified for the MP, CP,
AP, RT, RNase H and RNA-binding zinc finger-like domains of badnaviruses (Figure 1).
There was a single nucleotide overlap between the ORF 1 and 2 stop/start codons
(TGATG) which is consistent with the previously published TaBV sequence from PNG.
Whereas the published TaBV-PNG sequence has a two nucleotide gap between ORF
2 and 3, a three nucleotide gap was present between ORF 2 and 3 in TaBV-Aus7.
86
Figure 1. Schematic representation of the linearised genome of TaBV-Aus7. It is showing the three ORFs and conserved motifs in the ORF 3 polyprotein. Single-cutting restriction sites used for the preparation of the infectious clone are also shown.
MluI (832) XhoI (3469) XbaI (6916)
ORF 3 ORF 2 ORF 1 MP CP Zn AP RT RNase H
87
The intergenic (IR) region was 952 nt in length and included a putative tRNAmet
binding site with 78% nucleotide identity to the plant tRNAmet consensus sequence
and this was designated as the origin of the circular genome, consistent with the
convention currently used for badnaviruses. Interestingly, unlike the published TaBV
sequence from PNG, TaBV-Aus7 does not possess an ORF 4.
To generate an infectious clone of TaBV-Aus7, RCA was used on TNA to
amplify the episomal viral DNA and, based on analysis of the full-length sequence,
two separate double digestions were carried out. Initially, XbaI and XhoI were used
to cut the TaBV-Aus7 genome within ORF 3 at the 3' and 5' ends respectively, to
generate two fragments of 4047 nt and 3447 nt. The ∼4 kb fragment including the
last four nucleotides at the 3' end of ORF 3, the complete IR, ORF 1, ORF 2, and the
first 2,213 nt of ORF 3 (Figure 1) was gel-excised. XhoI and MluI were subsequently
used to generate fragments of 4,857 nt and 2637, with the ∼4.8 kb fragment including
3,451 nt of ORF 3 from the XhoI site used previously, as well as the IR, ORF 1 and the
first 14 nt of ORF 2 also gel-excised (Figure 1). The binary vector pOPT-NXT, containing
a multiple cloning site and nptII plant selection cassette, was then double-digested
using XbaI and AscI and dephosphorylated.
The ∼4 kb fragment from the XbaI/XhoI digest, together with the ∼4.8 kb
XhoI/MluI fragment and the XbaI/AscI digested pOPT-NXT were ligated, resulting in a
terminally redundant Aus7 molecule of 8,904 nt (∼1.2x the genome of Aus7) in the
binary vector. The pOPT-NXT-Aus7 DNA was transferred into Agrobacterium strain
Agl1 by electroporation and inoculum prepared as previously described [18].
Inoculum was injected [2] at the base of the pseudostem of five individual six-week-
old tissue cultured taro plants, while three plants were inoculated with the pOPT-NXT
vector alone and two additional plants were maintained as non-inoculated controls.
These plants (variety Bun Long) were obtained from a commercial tissue-culture
laboratory (Plant Biotech, Palmwoods, Australia) and all tested negative for TaBV
using RCA prior to experimentation.
88
All plants were kept in a growth room at 25 °C with a 12 hr photoperiod. At
12 weeks post-inoculation, no distinct symptoms indicative of viral infection were
observed on any of the inoculated or control plants. However, growth characteristics
such as leaf size, number of leaves and plant height appeared reduced in all five taro
plants inoculated with pOPT-NXT-Aus7 (Figure 2A). Furthermore, by 20 weeks post-
inoculation, downward-curling of the leaf blades was observed on taro plants
inoculated with pOPT-NXT-Aus7, but not on any control plants (Figure 2B).
Leaf samples were collected from all plants at 12 weeks post-inoculation, TNA
was extracted as described previously and PCR carried out to check for any residual
Agrobacterium using primers Agl1-F (ATCATTTGTAGCGACT) and Agl1-R
(AGCTCAAACCTGCTTC) targeting the virC operon. Of the five pOPT-NXT-Aus7
inoculated taro plants, one tested positive for residual agrobacterium contamination.
RCA was then carried out on plant TNA to screen for the presence of episomal TaBV
DNA. RCA products from the five pOPT-NXT-Aus7 inoculated, three pOPT-NXT
inoculated and two non-inoculated control plants were digested with StuI, which cuts
the Aus7 sequence at a single site. Fragments of the expected size were obtained
from all five taro plants inoculated with pOPT-NXT-Aus7, however no fragments were
obtained from taro plants inoculated with pOPT-NXT or the non-inoculated control
plants (Figure 2C).
The ∼7.5 kb StuI-digested fragments from one of the taro plants inoculated
with the infectious clone was excised, ligated into linearized (SmaI-digested) and de-
phosphorylated pUC19 and the RT/RNase H-coding region was sequenced as
described earlier. Pairwise sequence comparison of the RT/RNase H-coding region
showed that the sequences amplified from the inoculated taro plant was identical to
the original TaBV-Aus7 sequence. This result confirmed the infectivity of pOPT-NXT-
Aus7 in taro plants, which are the natural host of TaBV.
89
Figure 2. Phenotypic and molecular analysis of pOPT-NXT-Aus7 inoculated taro plants. (A) Taro plants at 12 weeks post-inoculation; (i) non-inoculated control plant with no symptoms and (ii) inoculated plant showing reduced growth. (B) Taro plants at 20 weeks post-inoculation, (i) non-inoculated control plant with normal leaf morphology and (ii) inoculated plant showing downward-curling of the leaf margin. (C) Agarose gel of StuI-digested RCA-amplified DNAs from inoculated or non-inoculated taro plants. M is HyperLadder 1 (Bioline, Australia); Lane 1 is the positive control (original Aus7 sample), lanes 2-6 are the five taro plants inoculated with pOPT-NXT-Aus7; lanes 7 and 8 are the two non-inoculated taro plants; lanes 9-11 are the three taro plants inoculated with pOPT-NXT (empty vector control); and lane 12 is a no template control. Arrow indicates 8 kbp marker fragment.
(A)
(B)
(C)
90
This report describes the first complete genome sequence of an Australian
TaBV isolate (TaBV-Aus7) which was obtained using RCA. The size and genome
organization of ORFs 1-3 of TaBV-Aus7 were similar to a published TaBV sequence
from PNG [22] except that, whereas the PNG TaBV isolate has four ORFs, TaBV-Aus7
has only three ORFs. Analysis of partial sequences from three TaBV isolates revealed
high nucleotide identity to TaBV isolates from PNG, New Caledonia and Fiji. Using
RCA-amplified viral DNA, a greater-than-genome-length cloned copy of TaBV-Aus7
was constructed and shown to be infectious in taro. Downward-curling of leaf blades,
a symptom sometimes associated with TaBV infection, was observed on inoculated
taro plants after 20 weeks and plants were shown to be infected with TaBV-Aus7
using RCA. This is the first report describing the development of an infectious clone
of TaBV which may serve as an important tool to facilitate further investigation into
the virus host range, symptoms and yield loss. The infectious clone may also have
utility in determining the possible role of TaBV in the etiology of the lethal Alomae
disease.
Acknowledgments
The authors are grateful to Dr. Ben Dugdale, Queensland University of Technology,
for providing the pOPT-NXT vector for cloning purposes. DK is the recipient of an
Australia Awards Scholarship.
Data Availability
Sequences described in this paper are available under GenBank accession numbers
MG017318-MG017320.
Conflict of interest
The authors declare they have no conflict of interest.
Ethical approval
This article does not contain any work conducted on animal or human participants.
91
References
1. Bomer M, Turaki A, Silva G, Kumar P, Seal S (2016) A sequence-independent strategy for amplification and characterisation of episomal badnavirus sequences reveals three previously uncharacterised yam badnaviruses. Viruses 8:188
2. Boulton M, Buchholz W, Marks M, Markham P, Davies J (1989) Specificity of Agrobacterium-mediated delivery of maize streak virus DNA to members of the Gramineae. Plant Mol Biol 12:31–40
3. Bouhida M, Lockhart B Olszewski N (1993) An analysis of the complete sequence of a sugarcane bacilliform virus genome infectious to banana and rice. J Gen Virol 74:15–22
4. Geering A, Hull R (2012) Caulimoviridae. In: King, A.M.Q., Adams, M.J., Carstens, E.B., Lefkowitz, E.J. (Eds.), Virus Taxonomy, Ninth report of the International Committee on Taxonomy of Viruses. Elsevier, Amsterdam, pp. 429–443
5. Gollifer D, Jackson G, Dabek A, Plumb R, May Y (1977) The occurrence and transmission of viruses of edible aroids in the Solomon Islands and the Southwest Pacific. Int. J. Pest Manag. 23:171–177
6. Haible D, Kober S, Jeske H (2006) Rolling circle amplification revolutionises diagnosis and genomics of geminiviruses. J Virol Meth 135:9–16
7. Higgins C, Bejerman N, Li M, James A, Dietzgen R, Pearson M, Revill P, Harding R (2016) Complete genome sequence of Colocasia bobone disease-associated virus, a putative cytorhabdovirus infecting taro. Arch Virol 161:745–748
8. Huang Q, Hartung J (2001) Cloning and sequence analysis of an infectious clone of Citrus yellow mosaic virus that can infect sweet orange via Agrobacterium-mediated inoculation. J Gen Virol 82:2549–2558
9. Jacquot E, Hagen L, Jacquemond M, Yot P (1996) The open reading frame 2 product of Cacao swollen shoot badnavirus is a nucleic acid-binding protein. Virology 225:191–195
10. Jacquot E, Hagen L, Michler P, Rohfritsch O, Stussi-Garaud C, Keller M, Jacquemond M Yot P (1999) In situ localisation of Cacao swollen shoot virus in agroinfected Theobroma cacao. Arch Virol 144:259–271
11. James M, Kenten R, Woods R (1973) Virus-like particles associated with two diseases of Colocasia esculenta (L.) Schott in the Solomon Islands. J Gen Virol 21:145–153
12. James A, Geijskes R, Dale J, Harding R (2011) Development of a novel rolling-circle amplification technique to detect Banana streak virus that also discriminates between integrated and episomal virus sequences. Plant Dis 95:57–62
92
13. Kazmi SA, Yang Z, Hong N, Wang G, Wang Y (2015) Characterization by small RNA sequencing of taro bacilliform CH virus (TaBCHV), a novel badnavirus. PLoS One 10:e0134147
14. Macanawai A, Ebenebe A, Hunter D, Devitt L, Hafner G, Harding R (2005) Investigations into the seed and mealybug transmission of Taro bacilliform virus. Aust Plant Pathol 34:73–76
15. Medberry S, Lockhart B, Olszewski N (1990) Properties of Commelina yellow mottle virus’s complete DNA sequence, genomic discontinuities and transcript suggest that it is a pararetrovirus. Nucleic Acids Res 18: 5505–5513
16. Ming SFY, Ping GW, Ping LW, Xing WX, Ni H (2013) Molecular identifcation and specifc detection of badnavirus from taro grown in China. Acta Phytopathol Sinica 6:590–595
17. Revill P, Jackson G, Hafner G, Yang I, Maino M, Dowling M, Devitt L, Dale J, Harding R (2005). Incidence and distribution of viruses of taro (Colocasia esculenta) in Pacific Island countries. Aust Plant Pathol 35:327–331
18. Sainsbury F, Thuenemann C, Lomonossoff P. (2009) pEAQ: versatile expression vectors for easy and quick transient expression of heterologous proteins in plants. Plant Biotec J 7:682–693
19. Sukal A, Kidanemariam D, Dale J, James A, Harding R. (2017) Characterisation of badnaviruses infecting Dioscorea spp. in the Pacific reveals two putative novel species and the first report of dioscorea bacilliform RT virus 2. Virus Res 238:29–34
20. Wang Y, Hu J, Borth WB, Hamim I, Green JO, Melzer M (2017) First report of taro bacilliform CH virus (TaBCHV) on taro (Colocasia esculenta) in Hawaii, USA. Plant Dis 101:1334
21. Wu C, Lai Y, Lin N, Hsu Y, Tsai H, Liao J, Hu C (2008) A simplified method of constructing infectious clones of begomovirus employing limited restriction enzyme digestion of products of rolling circle amplification. J Virol Meth 147:355–359
22. Yang I, Hafner G, Dale J, Harding R (2003a) Genomic characterisation of taro bacilliform virus. Arch Virol 148:937–949
23. Yang I, Hafner G, Revill P, Dale J, Harding R (2003b) Sequence diversity of South Pacific isolates of Taro bacilliform virus and the development of a PCR-based diagnostic test. Arch Virol 148:1957–1968
93
Chapter 6
Characterization of a subgroup IB isolate of Cucumber mosaic virus from Xanthosoma sp. in sub-Saharan Africa
Dawit B. Kidanemariam1,2, Amit C. Sukal1, Adane D. Abraham3, Joyce N. Njuguna4,
Benard O. Mware5, Francesca Stomeo4, James L. Dale1, Anthony P. James1, Robert
M. Harding1*
1 Centre for Tropical Crops and Biocommodities, Queensland University of Technology, Brisbane, 4001, Australia
2 National Agricultural Biotechnology Research Center, Ethiopian Institute of Agricultural Research, P.O. Box 2003, Addis Ababa, Ethiopia
3 Department of Biotechnology, Addis Ababa Science and Technology University, P.O. Box 16417, Addis Ababa, Ethiopia
4 Biosciences eastern and central Africa–International Livestock Research Institute (BecA–ILRI) Hub, P.O. Box 30709, Nairobi, Kenya
5 International Institute of Tropical Agriculture (IITA), Nairobi, Kenya
[Formatted for submission to Australasian Plant Disease Notes]
94
Statement of Contribution of Co-Authors of Thesis by Publication Paper
The authors listed below have certified that: 1. They meet the criteria for authorship in that they have participated in the conception,
execution, or interpretation, of at least that part of the publication in their field of expertise; 2. They take public responsibility for their part of the publication, except for the responsible
author who accepts overall responsibility for the publication; 3. There are no other authors of the publication according to these criteria; 4. Potential conflicts of interest have been disclosed to (a) granting bodies, (b) the editor or
publisher of journals or other publications, and (c) the head of the responsible academic unit, and
5. They agree to the use of the publication in the student’s thesis and its publication on the QUT’s ePrints site consistent with any limitations set by publisher requirements.
In the case of this chapter: Characterization of a subgroup IB isolate of Cucumber mosaic virus from
Xanthosoma sp. in sub-Saharan Africa
RSC, Level 4, 88 Musk Ave, Kelvin Grove Qld 4059 Page 1 of 2 Current @ 20/09/2016 CRICOS No. 00213J
QUT Verified
Signatures
95
QUT Verified Signature
96
Abstract
A cucumber mosaic virus isolate infecting Xanthosoma sp. was identified in Uganda.
The complete genome sequence of CMV-Xa was determined with the genome
organization of RNA 1 and 3 consistent with previously characterized CMV isolates.
However, in addition to ORFs 2a and 2b, RNA 2 contained a putative third, non-AUG
initiated ORF, referred to as ORF 2c. Sequence analyses based on the three genomic
RNAs showed that CMV–Xa belongs to subgroup IB. This is the first report of CMV
infecting Xanthosoma sp. and also the first CMV isolate from subgroup IB detected
from sub-Saharan Africa.
Keywords: Cucumovirus, tannia, Aracaeae
Cucumber mosaic virus (CMV) is the type species of the genus Cucumovirus (family
Bromoviridae) and has a wide host range, infecting more than 1000 crop and non-
crop plant species (Jacquemond 2012). The genome of CMV comprises three
molecules of positive-sense single-stranded RNA (Bujarski et al. 2012). RNA 1 has one
open reading frame (ORF) encoding a single protein (1a) which is crucial for
replication (Jacquemond 2012; Nouri et al. 2014). RNA 2 possesses two ORFs (2a and
2b) each encoding a single protein (Ding et al. 1994). The 2a protein is involved in
replication by interacting with the 1a protein (Jacquemond 2012), while 2b has a role
in post-transcriptional gene silencing and symptom expression (Du et al. 2007). RNA
3 encodes two proteins (3a and 3b) which encode the movement protein (MP) and
coat protein (CP), respectively (Roossinck et al. 1999).
Based on serology, nucleic acid hybridization, RFLP analyses and nucleotide
sequence comparisons, CMV isolates have been classified into two subgroups,
designated I and II (Nouri et al. 2014), with 69–77% nucleotide (nt) identity between
the two subgroups (Chen et al. 2007; Nouri et al. 2014). Subgroup I has been further
divided into subgroups IA and IB based on differences in pathogenicity and sequence
variation within the CP-coding region/3' UTR of RNA 3. Isolates within the same
subgroup have a sequence identity of greater than 90% at the nt level (Chen et al.
2007; Nouri et al. 2014; Roossinck 2002). In 2009, a third subgroup (III) was proposed
97
(Liu et al. 2009) after the discovery of a new isolate CMV-BX which was
phylogenetically distinct from subgroup I and II isolates and showed 71-89% nt
identity to previously published CMV isolates. More recently, a CMV isolate (CMV-
Rom) was reported (Tepfer et al. 2016) which showed 66-77% nt identity to
previously classified CMV isolates and was phylogenetically distinct from subgroup I,
II and III isolates. Although CMV subgroup I and II isolates generally have worldwide
distributions (Gallitelli 2000; Roossinck 2002; Eiras et al. 2004; Lin et al. 2004;
Sclavounos et al. 2006), no isolates from subgroup IB have been reported from sub-
Saharan Africa.
Taro (Colocasia esculenta L.) and tannia (Xanthosoma sp.) are both members of
the family Araceae and are among the most important root crops for many small-
scale farmers in sub-Saharan Africa. However, production is suffering from a range of
biotic and abiotic factors (Akwee et al. 2015). In 2015, we surveyed taro and other
edible aroids in east Africa (Ethiopia, Kenya, Tanzania and Uganda) in order to identify
and characterize any viruses present. During these surveys, three tannia plants
showing mosaic, mottling and vein chlorosis symptoms (Fig. 1a-c) were observed in
Buikwe district, Uganda. Leaf samples were taken from the three plants (samples
Ug90, Ug91 and Ug92), desiccated over silica and transported to the BecA–ILRI Hub
laboratory in Nairobi, Kenya. PCR testing of the samples for the presence of
potyviruses, which typically cause mosaic and mottling symptoms in aroids, using
degenerate primers targeting regions of the coat protein (CP)-coding region (∼700
bp) (Yamamoto and Fuji 2008), and cylindrical inclusion (CI)-coding region (∼700 bp)
(Ha et al. 2008) was negative.
To identify other possible virus/es infecting the samples, total RNA was
extracted (Valderrama-Cháirez et al. 2002) from the three tannia samples and was
subjected to Illumina MiSeq Next Generation Sequencing (NGS). cDNA libraries were
prepared using the Illumina® TruSeq Stranded Total RNA LT Sample Prep Kit with
Ribo-Zero™ Plant, according to the manufacturer’s instructions (Illumina). A final
concentration of 12 ρmol of pooled cDNA library was sequenced using a 600 cycles,
MiSeq v3 Reagent cartridge (Illumina) and paired-end reads were generated on the
Illumina® MiSeq platform.
98
Figure 1. Symptoms associated with CMV-Xa. The three tannia plants collected from Uganda showing mosaic, mottling and vein chlorosis symptoms. (a) Ug91, (b) Ug92, and (c) Ug93.
c) b) a)
99
The total number of raw reads generated for each sample ranged between
2,893,680 and 3,629,228 (Table 1). Adapter sequences were removed
(http://hannonlab.cshl.edu/fastx_toolkit/) and reads were further trimmed to attain
optimum quality using the DynamicTrim function of SolexaQA++ v.3.1.3 (Cox et al.
2010) De-novo assembly of reads from each sample was performed using Trinity
v.2.0.3 (Grabherr et al. 2011). Contigs from the de novo assemblies were used to
BLAST an NCBI-derived virus database (ftp://ftp.ncbi.nih.gov/genomes/Viruses/),
with CMV identified in all three samples. No other virus sequences were identified.
To validate the presence of CMV in these samples, RT-PCR was carried out using
primers CMV-CPF/CPR (Wang et al. 2014) which amplify a ∼780 bp fragment spanning
the CP-coding region and 3' UTR of CMV RNA 3. Amplicons of the expected size were
obtained from all three samples and were subsequently cloned into pGEM®-T Easy
(Promega) and sequenced using the Big Dye® Terminator v3.1 Cycle Sequencing Kit
(Thermo Fisher Scientific). The amplicons from all three samples comprised 735 nt
(not including the primer binding sites) and the sequences were identical to the
corresponding NGS-generated sequence for each sample.
The complete genome sequences of the three CMV isolates were assembled
using the NGS data based on comparisons to a CMV reference sequence from the
NCBI database (accession numbers NC_002034, NC_002035 and NC_001440 for RNA
1, 2 and 3, respectively) and ORFs were predicted and annotated using CLC Genomics
Workbench v.7.5.1 (https://www.qiagenbioinformatics.com/) with default
parameters. The total number of reads which mapped to the reference sequences
ranged between 301,926 to 1,228,667 (Table 1). Pairwise sequence comparison of
the respective NGS-generated RNA 1 to 3 genome sequences from the three tannia
samples showed nucleotide sequence identities ranging from 99.5-99.8% (sequences
were deposited in the GenBank accession numbers MG021454 - MG021462). Since
there were no significant sequence differences between the three samples, further
analyses were done using only one representative sample (Ug92).
100
Table 1. Next generation sequencing data from Xanthosoma sp. samples collected from Uganda.
Sample ID Number of raw reads obtained
Number of reads after trimming
CMV RNA
Reference sequence used for mapping
Number of reads mapped to reference sequence
Percentage of per-base coverage to the reference sequence
Length of consensus sequence
Final sequence length
NCBI accession Number
Ug90 3,452,634 3,294,042 RNA 1 NC_002034 696, 758 18.1 3357 3349 MG021454 RNA 2 NC_002035 607,477 14.1 3050 3052 MG021455 RNA 3 NC_001440 1,228,667 33.9 2216 2212 MG021456
Ug91 3,629,228 3,108,688 RNA 1 NC_002034 587, 925 17.07 3357 3349 MG021457 RNA 2 NC_002035 413,815 11.97 3050 3049 MG021458 RNA 3 NC_001440 604,810 17.85 2216 2212 MG021459
Ug92 2,893,680 2,586,760 RNA 1 NC_002034 375,107 12.65 3357 3349 MG021460 RNA 2 NC_002035 301,926 10.19 3050 3050 MG021461 RNA 3 NC_001440 638,999 23.63 2216 2212 MG021462
101
The genome organization of RNA 1 and 3 of isolate Ug92 (designated CMV–Xa)
was typical of other CMV isolates. RNA 1 comprised 3,349 nt and contained a single
ORF (1a) predicted to encode a protein of 992 amino acids with 5' and 3' UTRs of 95
and 281 nt, respectively (Fig. 2). RNA 3 comprised 2,212 nt and contained two ORFs
(3a and 3b) separated by an intergenic region of 271 nt. ORFs 3a and 3b comprised
840 nt and 687 nt, respectively, and were predicted to encode proteins of 279 and
228 amino acids, respectively. The 5' and 3' UTRs of RNA 3 were 112 and 302 nt,
respectively (Fig. 2). Similar to other CMV isolates, RNA 2 of CMV–Xa comprised 3,052
nt and contained two overlapping ORFs (2a and 2b). ORF 2a was 2,577 nt and
encoded a putative protein of 858 amino acids, while ORF 2b was 339 nt and encoded
a putative protein of 112 amino acids. The 5' and 3' UTRs of RNA 2 were 80 and 298
nt, respectively (Fig. 2). Interestingly, analysis of RNA 2 also revealed the presence of
a putative third UUG-initiated ORF (designated 2c) which was positioned within ORF
2a at the 5' end (Fig. 2). This ORF was located 58 nt downstream of, and out of frame
with, the start codon of ORF 2a, and comprised 336 nt which encoded a putative
protein of 112 amino acids. The presence of this putative ORF in the genome of CMV-
Xa was confirmed by RT-PCR and sequencing. Further, ORF2c was present in the NGS-
derived RNA2 sequences of Ug90 and Ug91.
An ORF equivalent to ORF 2c has not been previously reported in CMV.
However, analysis of 44 full-length CMV RNA 2 sequences from the NCBI database
revealed that 20 CMV isolates contained a similarly positioned ORF comprising
between 306 and 381 nt. Of these, the ORF was initiated with AUG, CUG and UUG in
nine, eight and three isolates, respectively (Table 2). Interestingly, sequence analysis
of RNA 2 of the cucumovirus, Tomato aspermy virus (TAV; NCBI Accession no.
NC003838, KT757537, D10663, KF432414, AJ320274), also revealed the presence of
a third ORF on RNA 2, similarly positioned to ORF 2c of CMV-Xa. The third ORF in all
five TAV isolates were AUG-initiated and varied between 318-321 nt long.
102
Figure 2. Schematic representation of the genome organisation of CMV-xa. ORFs predicted on RNA 1, 2 and 3 are represented with box.
500 1000 1500 2000 2500 3000
ORF 2a ORF 2b ORF 2c
500 1000 1500 2000 2500 3000
ORF 1a
500 1000 1500 2000
ORF 3a ORF 3b
RNA 1
RNA 2
RNA 3
103
Table 2. Name, subgroup, country of origin and accession numbers of CMV sequences from NCBI database used in the analysis.
1Where known, the country of origin for the isolates is indicated. Where the country of origin is not known, the country where the sequence data was uploaded to the NCBI database is indicated in brackets. *RNA 2 sequences with the putative ORF 2c.
Name Country1 RNA 1 RNA 2 RNA 3 ORF 2c start codon BX China DQ399548 DQ399549 DQ399550 Ca China AY429434 AY429433* AY429432 UUG Cah1 China FJ268744 FJ2687452 FJ268746 AUG Cb7 China EF216866 DQ785470* EF216867 AUG CM95 Japan AB188234 AB188235 AB188236 CS China AY429435 AY429436* AY429437 UUG CTL China EF213023 EF213024* EF213025 AUG D8 Japan AB179764 AB179765 AB004781 Fny USA NC002034 NC002035 NC001440 GTN South Korea KP033524 KP033525* KP033526 AUG HM3 Egypt KT921314 KT921315* KX014666 UUG IA Indonesia AB042292 AB042293 AB042294 Ixora (USA) U20220 U20218* U20219 CUG KO India KM272277 KM272278* KM272275 CUG Li South Korea AB506795 AB506796* AB506797 CUG Ls USA AF416899 AF416900 AF127976 Ly Australia AF198101 AF198102 AF198103 MB Sri Lanka AF150731* CUG Mf South Korea AJ276479 AJ276480 AJ276481 Mi Japan AB188228 AB188229 AB188230 New Delhi India GU111227 GU111228* GU111229 CUG NS Hungary AJ580953 AJ511989 AJ511990 Nt9 Taiwan D28778 D28779* D28780 CUG Pepo (Japan) AB124834 AB124835 AF103991 PF Japan AB368499 AB368500* AB368501 AUG PI1 Spain AM183114 AM183115* AM183116 CUG Phy China DQ402477 DQ412731 DQ412732 PHz China EU723568 EU723570 EU723569 PSV (USA) NC002038 NC002039 NC002040 Q Australia X02733 X00985 M21464 R France HE793685 HE793686 Y18138 Rb South Korea GU327363 GU327364 GU327365 Rom France KU558987 KU558988 KU558989 RP19 South Korea KC527793 KC527703* KC527748 AUG SD (China) AF071551 D86330 AB008777 SFQT1-2 China HQ283392 HQ283391* HQ283393 AUG SW11 Australia KM434204 KM434205 KM434206 TAV (USA) NC003837 NC003838 NC003836 Tfn Italy Y16924 Y16925* Y16926 CUG TN Japan AB176849 AB176848 AB176847 Vir Italy HE962478 HE962479* HE962480 AUG Y Japan D12537 D12538 D12499 Z1 South Korea GU327366 GU327367 GU327368 209 China KJ400002 KJ400003* KJ400004 AUG
104
Attempts to identify a possible function for the putative ORF 2c gene product
of CMV-Xa by database comparisons failed to reveal any significant homology with
known viral proteins. As such, further studies will be required to determine whether
this ORF is functional in CMV and TAV.
BLASTn analysis of CMV RNA 1 sequences revealed that CMV-Xa had highest
sequence identity (94%) to a tomato-infecting CMV isolate (HM3) from Egypt.
Similarly, RNA 2 showed highest identity (93%) to capsicum-infecting CMV isolates
from Italy and India (Vir and KO) and CMV-HM3 from Egypt, while RNA 3 showed 97%
identity to CMV-HM3. The complete nucleotide sequences of CMV-Xa RNAs 1, 2 and
3, together with published CMV sequences, were separately aligned using the
ClustalW multiple-alignment algorithm in BioEdit version 7
(http://www.mbio.ncsu.edu/BioEdit/bioedit.html). Phylogenetic trees were
subsequently constructed in MEGA version 7
(http://www.megasoftware.net/mega.php) using the maximum-likelihood method
and the Kimura 2-parameter model with 1000 bootstrap replications. For all three
genomic RNAs, clades corresponding to the previously described subgroups I
(including IA and IB), II and III were observed (Fig. 3a-c). Further, phylogenetic
analyses revealed that CMV–Xa clusters with subgroup IB CMV isolates and is most
closely related to CMV-Vir, -KO and -HM3. Interestingly, of the 20 RNA 2 sequences
which possess the putative ORF 2c, 17 clustered within subgroup IB together with
CMV–Xa (Fig. 3b). The other three isolates grouped under subgroup IA (isolates PF
and Li) or branched independently of other isolates (isolate ‘209’; Fig. 3b).
To determine whether CMV-Xa is mechanically transmissible, Nicotiana
benthamiana plants were inoculated using sap extracts prepared from sample Ug92.
Approximately 200 mg of CMV-Xa-infected leaf tissue was ground in 1 ml of 0.1 M
sodium phosphate buffer (pH 7) with 10 mg of carborundum powder and the sap was
gently rubbed onto fully-expanded leaves of eight-week old N. benthamiana plants.
Five weeks post-inoculation, newly emerging leaves developed mosaic-like
symptoms and tested positive for CMV by RT-PCR using primers CMV-CPF/CPR as
described previously.
105
0.05
Li
Fny
Pepo
Y
Mi
CM95
Mf
209
Rb
Z1
PF
NS
Ca
CS
D8
SD
SFQT1-2
Cb7
Phy
Ixora
Cah1
NewDelhi
PI1
Tfn
Nt9
GTN
RP19
CTL
IA
Xa
Vir
HM3
KO
BX
PHz
Rom
SW11
Ls
TN
Ly
Q
R
TAV
PSV
100
100
69
100
100
100
100
100
77
98
100
100
63
98
100
100
98
70
53
100
100
100
99
100
100
100
72
97
99
79
99
78
59
Xa
II
III
IB
IA
Outgroup
a)
106
0.1
Rb
Mf
Pepo
Mi
CM95
Z1
Fny
Y
PF
NS
Li
RP19
GTN
SFQT1-2
Cah1
Ixora
CTL
Cb7
NewDelhi
MB
HM3
KO
Xa
Vir
IA
Ca
CS
PI1
Nt9
Tfn
SD
D8
Phy
209
BX
PHz
Rom
Q
Ls
R
Ly
SW11
TN
TAV
PSV100
100
62
85
100
100
100
50
94
99
85
100
100
100
86
99
99
72
63
96
100
98
89
65
99
6499
*
* *
* *
* *
* *
* *
* *
* * * *
*
*
IA
IB
III
II
Xa *
Outgroup
b)
107
0.05
Pepo
Mi
Z1
Y
CM95
D8
NS
Fny
Rb
Mf
Li
Ca
CS
SD
RP19
GTN
HM3
Xa
KO
Vir
IA
CTL
Ixora
PI1
NewDelhi
Nt9
Tfn
SFQT1-2
Phy
Cah1
Cb7
209
BX
PHz
PF
SW11
Ly
Q
Ls
R
TN
Rom
TAV
PSV100
56
58
100
90
100
100
91
99
99
100
58
91
83
72
99
100
99
93
99
87
54
94
55
75
99
54
99
99
87
81
70
64
99
III
II
IB
IA
Xa
Outgroup
c)
108
Figure 3. Phylogenetic analysis of CMV–Xa based on complete nucleotide sequences. (a) RNA 1, (b) RNA 2, and (c) RNA 3. Asterisks indicate isolates having the putative
ORF 2c on RNA 2. All trees were rooted using tomato aspermy virus (TAV) and peanut
stunt virus (PSV) as outgroups. Bootstrap values greater than 50 % are shown, and
the scale bar indicates substitutions per site. Detailed information of the isolates
included in the phylogenetic analysis can be accessed from Table 2.
109
To our knowledge, this is the first report of a complete genome sequence of a
subgroup IB CMV isolate from sub-Saharan Africa and is also the first report of CMV
infecting Xanthosoma sp. The only previously published sequence record of CMV
from a member of the Araceae is a partial CP-coding sequence from a Chinese isolate
infecting taro (Wang et al. 2014). Although CMV has also been detected in Anthurium
andreanum in Brazil using ELISA and PCR, no sequence information was reported
(Miura et al. 2013).
Acknowledgements
This project was funded by the Biosciences eastern and central Africa–International
Livestock Research Institute (BecA–ILRI) Hub through the African Biosciences
Challenge Fund (ABCF). DK is the recipient of an Australia Awards Scholarship.
Data Availability
Sequences described in this paper are available under GenBank accession numbers
MG021454 - MG021462.
Compliance with ethical standards The authors declare no conflict of interest. This
article does not contain any work conducted on animal or human participants.
110
References
Akwee, P. E., Netondo, G., Kataka, J. A., & Palapala, V. A. (2015). A critical review of
the role of taro Colocasia esculenta L. (Schott) to food security: A comparative
analysis of Kenya and Pacific Island taro germplasm. Scientia Agriculturae, 9,
101–108.
Bujarski, J., Figlerowicz, M., Gallitelli, D., Roossinck, M. J., & Scott, S. W. (2012).
Bromoviridae. In: King AMQ, Adams MJ, Carstens EB, Lefkowitz EJ (eds) Virus
taxonomy: Ninth Report of the International Committee on Taxonomy of
Viruses. London: Elsevier.
Chen, Y., Chen, J., Zhang, H., Tang, X., & Du, Z. (2007). Molecular evidence and
sequence analysis of a natural reassortant between Cucumber mosaic virus
subgroup IA and II strains. Virus Genes, 35, 405–413.
Cox, M. P., Peterson, D. A., & Biggs, P. J. (2010). SolexaQA: At-a-glance quality
assessment of Illumina second-generation sequencing data. BMC
Bioinformatics, 11, 485.
Ding, S. W., Anderson, B. J., Haase, H. R., & Symons, R. H. (1994). New overlapping
gene encoded by the cucumber mosaic virus genome. Virology, 198, 593–601.
Du, Z. Y., Chen, F. F., Liao, Q. S., Zhang, H. R., Chen, Y. F., & Chen, J. S. (2007). 2b ORFs
encoded by subgroup IB strains of cucumber mosaic virus induce differential
virulence on Nicotiana species. Journal of General Virology, 88, 2596–2604.
Eiras, M., Boari, A. J., Colariccio, A., Chaves, A. L. R., Briones, M. R. S., Figueira, A. R.,
& Harakava, R. (2004). Characterization of isolates of the Cucumovirus
Cucumber mosaic virus present in Brazil. Journal of Plant Pathology, 86, 61–69.
Gallitelli, D. (2000). The ecology of Cucumber mosaic virus and sustainable
agriculture. Virus Research, 71, 9–21.
Grabherr, M. G., Haas, B. J., Yassour, M., Levin, J. Z., Thompson, D. A., Amit, I.,
Adiconis, X., Fan, L., Raychowdhury, R., Zeng, Q., Chen, Z., Mauceli, E., Hacohe,
N., Gnirke, A., Rhind, N., di Palma, F., Birren, B. W, Nusbaum, C., Lindblad-Toh,
K., Friedman, N., & Regev, A. (2011). Full-length transcriptome assembly from
RNA-seq data without a reference genome. Nature Biotechnology, 29, 644–
652.
111
Ha, C., Coombs, S., Revill, P., Harding, R. M., Vu, M., & Dale, J. L. (2008). Design and
application of two novel degenerate primer pairs for the detection and
complete genomic characterization of potyviruses. Archives of Virology, 153,
25–36.
Jacquemond, M. (2012). Cucumber mosaic virus. In: Maramorosch M, Shatkin AJ
Murphy FA (eds). Advances in Virus Research, 84, 439–504.
Lin, H. X., Rubio, L., Smythe, A. B., & Falk, B. W. (2004). Molecular population genetics
of Cucumber mosaic virus in California: evidence for founder effects and
reassortment. Journal of Virology, 78, 6666–6675.
Liu, Y. Y., Yu, S. L., Lan, Y. F., Zhang, C. L., Hou, S. S., Li, X. D., Li, X. D., Zhang, G. M., &
Shi, C. K. (2009). Molecular variability of five cucumber mosaic virus isolates
from China. Acta Virologica, 53, 89–97.
Miura, N. S., Beriam, L. O., & Rivas, E. B. (2013). Detection of cucumber mosaic virus
in commercial Anthurium crops and genotypes evaluation. Horticultura
Brasileira, 31, 322–327.
Nouri, S., Arevalo, R., Falk, W. B., & Groves, L. R. (2014). Genetic structure and
molecular variability of cucumber mosaic virus isolates in the United States.
PLoS One, 9, e96582.
Roossinck, M. J., Zhang, L., & Hellwald, K. H. (1999). Rearrangements in the 5'
nontranslated region and phylogenetic analyses of cucumber mosaic virus RNA
3 indicate radial evolution of three subgroups. Journal of Virology, 73, 6752–
6758.
Roossinck, M. J. (2002). Evolutionary history of cucumber mosaic virus deduced by
phylogenetic analyses. Journal of Virology, 76, 3382–3387.
Sclavounos, A. P., Voloudakis, A. E., Arabatzis, C., & Kyriakopoulou, P. E. (2006). A
severe hellenic CMV tomato isolate: symptom variability in tobacco,
characterization and discrimination of variants. European Journal of Plant
Pathology, 115, 163–172.
112
Tepfer, M., Girardot, G., Fénéant, L., Tamarzizt, H. B., Verdin, E., Moury, B., &
Jacquemond, M. (2016). A genetically novel, narrow-host-range isolate of
cucumber mosaic virus (CMV) from rosemary. Archives of Virology, 161, 2013–
2017.
Valderrama-Cháirez, M. L., Cruz-Hernández, A., & Paredes-López, O. (2002). Isolation
of functional RNA from cactus fruit. Plant Molecular Biology Reporter, 20, 279–
286.
Wang, Y. F., Wang, G. P., Wang, L. P., & Hong, N. (2014). First report of cucumber
mosaic virus in taro plants in China. Plant Disease, 98, 574–574.
Yamamoto, H., & Fuji, S. (2008). Rapid determination of the nucleotide sequences of
potyviral coat protein genes using semi-nested RT-PCR with universal primers.
Journal of General Plant Pathology, 74, 97–100.
113
Chapter 7
Incidence and distribution of four RNA viruses infecting taro and tannia in East Africa and molecular characterisation of
Dasheen mosaic virus isolates
D. B. Kidanemariam1,2, A. C. Sukal1, A. D. Abraham3, J. N. Njuguna4, F. Stomeo4, J. L.
Dale1, A. P. James1, R. M. Harding1*
1 Centre for Tropical Crops and Biocommodities, Queensland University of Technology, Brisbane, 4001, Australia
2 National Agricultural Biotechnology Research Centre, Ethiopian Institute of Agricultural Research, P.O. Box 2003, Addis Ababa, Ethiopia
3 Department of Biotechnology, Addis Ababa Science and Technology University. P.O. Box 16417, Addis Ababa, Ethiopia
4 Biosciences eastern and central Africa–International Livestock Research Institute (BecA–ILRI) Hub, P.O. Box 30709, Nairobi, Kenya
[Formatted for submission to Annals of Applied Biology]
114
Statement of Contribution of Co-Authors of Thesis by Publication Paper
The authors listed below have certified that: 1. They meet the criteria for authorship in that they have participated in the conception,
execution, or interpretation, of at least that part of the publication in their field of expertise; 2. They take public responsibility for their part of the publication, except for the responsible
author who accepts overall responsibility for the publication; 3. There are no other authors of the publication according to these criteria; 4. Potential conflicts of interest have been disclosed to (a) granting bodies, (b) the editor or
publisher of journals or other publications, and (c) the head of the responsible academic unit, and
5. They agree to the use of the publication in the student’s thesis and its publication on the QUT’s ePrints site consistent with any limitations set by publisher requirements.
In the case of this chapter: Incidence and distribution of four RNA viruses infecting taro and tannia in East
Africa and molecular characterisation of Dasheen mosaic virus isolates
RSC, Level 4, 88 Musk Ave, Kelvin Grove Qld 4059 Page 1 of 2 Current @ 20/09/2016 CRICOS No. 00213J
QUT Verified
Signatures
115
QUT Verified Signature
116
Abstract
Taro and tannia are important food crops in many districts of East Africa. To
investigate the incidence and distribution of four RNA viruses known to infect these
plants, 392 leaf samples were collected from taro or tannia plants growing in 25
districts in Ethiopia, Kenya, Tanzania and Uganda. The samples were tested for
Cucumber mosaic virus (CMV), Dasheen mosaic virus (DsMV), Taro vein chlorosis
virus (TaVCV) and Colocasia bobone disease-associated virus (CBDaV) by RT-PCR. No
samples tested positive for TaVCV or CBDaV, while CMV was only detected in three
tannia samples with mosaic symptoms from Uganda. DsMV was detected in 40
samples, including 36 out of 171 from Ethiopia, 1 out of 94 from Uganda and 3 out of
41 from Tanzania, while no samples from Kenya tested positive. The complete
genomes of nine DsMV isolates from East Africa were cloned and sequenced.
Phylogenetic analyses based on the amino acid sequence of the CP-coding region
revealed two distinct clades, which is consistent with previous reports. Interestingly,
samples from Ethiopia were distributed across several subgroups in both clades,
while samples from Uganda and Tanzania belong to different clades.
Keywords: Ethiopia, Kenya, Tanzania, Uganda, cucumber mosaic virus,
rhabdoviruses, aroids
117
Introduction
The aroids, taro (Colocasia esculenta) and tannia (Xanthosoma sp.), are the most
important and widely cultivated edible members of the Araceae family in sub-
Saharan Africa (Ndabikunze et al., 2011). In Ethiopia, Kenya, Tanzania and Uganda,
taro and tannia are mainly cultivated by small-holder farmers and play important
cultural, economic and nutritional roles (Onwueme and Charles, 1994; Talwana et al.,
2009; Tumuhimbise et al., 2009; Beyene, 2013). However, due to various biotic and
abiotic factors the yields from taro and tannia in East Africa are much lower than the
world’s average production (Tumuhimbise et al., 2009; Talwana et al., 2009; Akwee
et al., 2015). Viruses are among the most economically important pathogens of these
crops, resulting in significant yield losses, with a number of viruses reported from
different parts of the world (Elliott et al., 1997; Revill et al., 2005a).
The potyvirus, Dasheen mosaic virus (DsMV, family Potyviridae, genus
Potyvirus) infects taro and other edible aroids wherever they grow (Zettler et al.,
1970; Elliott et al., 1997). DsMV is transmitted in a non-persistent manner by several
aphid species and can also be transmitted by vegetative propagation or sap
inoculation (Elliott et al., 1997; Nelson, 2008). The virus has a worldwide distribution
and infects both edible and ornamental members of the Araceae family (Elliott et al.,
1997). Infection typically results in a characteristic feathery-mottle and mosaic
symptom on the leaves, but symptoms may vary considerably between cultivars and
season of the year (Alconero and Zettler, 1971; Elliott et al., 1997). DsMV infection is
reported to affect both the quality and quantity of the edible corms, with production
losses ranging from 20 to 60 % (Rana et al., 1983; Elliott et al., 1997).
Taro vein chlorosis virus (TaVCV) is a member of the family Rhabdoviridae,
genus Nucleorhabdovirus (Revill et al., 2005b). Typical symptoms associated with
TaVCV infection include a distinct vein chlorosis near the leaf margins of infected
plants (Pearson et al., 1999; Revill et al., 2005b). TaVCV has been reported from
several South Pacific island countries, as well as Hawaii and American Samoa (Long
et al., 2014; Atibalentja et al., 2017). To date, TaVCV is only known to infect taro, but
118
there is no published information on production losses resulting from infection (Revill
et al., 2005b). CBDaV is a putative member of the family Rhabdoviridae based on
sequence analysis and the presence of characteristic, enveloped, bullet-shaped
particles of ∼300 x 50 nm in infected plants (Higgins et al., 2016; Pearson et al., 1999).
CBDaV has only been reported from Papua New Guinea and the Solomon Islands,
where it has been associated with the severe diseases bobone and alomae (Gollifer
et al., 1977; Revill et al., 2005a). Bobone disease is thought to be caused by CBDaV
alone and is characterised by stunting and gall formation on the pseudostem (Gollifer
et al., 1977; Pearson et al., 1999; Revill et al., 2005a; Higgins et al., 2016), whereas
alomae is a lethal disease caused by the dual infection of taro with CBDaV and taro
bacilliform virus (TaBV).
A number of other viruses have also been reported from aroids worldwide. Taro
reovirus (TaRV), a putative member of the genus Oryzavirus in the family Reoviridae,
has been partially characterised based on sequence analysis of four incomplete
genomic segments of an isolate from PNG (Revill et al., 2005a, b). However, no
symptoms have been associated with TaRV infection and the virus has only been
detected in symptomless taro plants and plants infected with other viruses (Revill et
al., 2005a). Konjac mosaic virus (KoMV, family Potyviridae, genus Potyvirus),
Cucumber mosaic virus (CMV, family Bromoviridae, genus Cucumovirus), Groundnut
bud necrosis virus (GBNV, family Bunyaviridae, genus Tospovirus) and Tomato zonate
spot virus (TZSV, tentatively assigned in the genus Tospovirus) have also been
identified from different aroids (Manikonda et al., 2011; Wang et al., 2014;
Sivaprasad et al., 2011; Dong et al., 2008). Of the known viruses reported to infect
edible and ornamental aroids, DsMV and TaBV are the most widespread (Elliott et al.,
1997; Revill et al., 2005a).
We have recently reported the incidence, distribution and molecular
characterisation of badnaviruses infecting taro and tannia in East Africa
(Kidanemariam et al., 2018a), but there is no information on the incidence,
distribution and diversity of RNA viruses. In this paper, we report the results of
surveys carried out in 2014 and 2015 to determine the occurrence of four RNA viruses
119
infecting taro and tannia in Ethiopia, Kenya, Tanzania and Uganda. The complete
genome sequences and phylogenetic analyses of nine DsMV isolates from East Africa
is also reported
Materials and Methods
Sample collection and nucleic acid extraction
Between November 2014 and June 2015, a total of 171 (160 taro and 11 tannia), 86
(83 taro and three tannia), 41 (29 taro and 12 tannia) and 94 (61 taro and 33 tannia)
symptomatic and asymptomatic leaf samples were collected from major growing
areas in Ethiopia, Kenya, Tanzania and Uganda, respectively. Leaf samples were
desiccated over silica-gel, transported to the BecA-ILRI hub laboratory in Nairobi,
Kenya and RNA was extracted (Valderrama-Cháirez et al., 2002). Following initial
screening for viruses at BecA-ILRI hub, selected extracts were transported to
Queensland University of Technology (QUT), Brisbane, Australia for further analysis.
RT-PCR, cloning and sequencing
Complementary DNA (cDNA) was synthesised using M-MuLV reverse transcriptase
(Thermo Fisher Scientific, UK) with oligo(dT)18 and random hexamers as per the
manufacturer’s instructions. For the detection of potyviruses and rhabdoviruses, PCR
was carried out using published degenerate primers, while virus-specific primers
were used for the specific detection of DsMV, TaVCV, CBDaV and CMV (Table 1). All
PCRs were carried out using 2 μl of cDNA mixed with 10 μl of OneTaq® 2x Master Mix
and 5 ρmol of each primer in a total volume of 20 μl. PCR cycling conditions for CBDaV
was, an initial denaturation of 94 °C for 2 min, followed by 35 cycles 94 °C for 30 s, 50
°C for 30 s, and 72 °C for 30 s, with a final extension step of 72 °C for 5 min. All other
PCR assays used published cycling conditions (Table 1). A positive control samples
were included for each experiment.
PCR products were electrophoresed through 1.5 % agarose gels and were
stained using GelRed™ (Biotium, USA). Amplicons from representative samples
chosen for sequencing were gel-excised, purified using Freeze ‘N’ Squeeze™ DNA Gel
Extraction Spin Columns (Bio-Rad, Australia), cloned into pGEM-T Easy (Promega,
120
Australia) and sequenced using the Big Dye® Terminator v3.1 Cycle Sequencing Kit
(Thermo Fisher Scientific, Australia) at the Central Analytical Research Facility (CARF),
QUT, Brisbane, Australia. For each sample, three independent clones were
sequenced with M13F and/or M13R primers.
121
Table 1. Primers used for virus detection with RT-PCR.
Virus Primer name Primer sequence (5' – 3') Expected size (bp) Target region Reference
Potyvirus CI-F GGIVVIGTIGGIWSIGGIAARTCIAC
∼700 Cylindrical inclusion body Ha et al., 2008
CI-R ACICCRTTYTCDATDATRTTIGTIGC
DsMV DsMV-3F ATGACAAACCTGARCAGCGTGAYA
∼680 Coat protein Maino et al., 2003 DsMV-3R TTYGCAGTGTGCCTYTCAGGT
CMV CMV-F ATGGACAAATCTGAATCAACC
∼780 Coat protein Wang et al., 2014 CMV-R TAAGCTGGATGGACAACCCGT
Rhabdovirus RhabF GGATMTGGGGBCATCC
∼900 L-gene Dietzgen et al., 2013 RhabR GTCCABCCYTTTTGYC
TaVCV TaVCV-1 AATATGCTCTCCAGTGTTCACCC
∼1000 L-gene Revill et al., 2005b TaVCV-2 AGGTGCTCAAATGACTCAGCTTGTCC
CBDaV CBDV-3 CTCAAGACAATCAATGGGTGATG ∼300 L-gene Ralf Dietzgen. Pers comm. CBDV-4 CCACGACCGAGTAATTGAC
122
Generating complete genome sequences of DsMV
Illumina Next Generation Sequencing (NGS) was carried out to generate the complete
genome sequences of DsMV. cDNA libraries were prepared using the Illumina®
TruSeq Stranded Total RNA LT Sample Prep Kit with Ribo-Zero™ Plant, according to
the manufacturer’s instructions (Illumina, USA). A final concentration of 12 ρmol of
pooled cDNA library was sequenced using a 600 cycles, MiSeq v3 Reagent cartridge
(Illumina, USA) and paired-end reads were generated on the Illumina® MiSeq
platform at the BecA–ILRI Hub laboratory, Nairobi, Kenya. Subsequently, the NGS
data for representative samples was validated by RT-PCR and Sanger sequencing on
cloned DNA fragments and the 5'–terminal sequences were obtained by rapid
amplification of cDNA ends (RACE) using a 5'/3' RACE Kit, 2nd generation (Roche,
Australia).
Sequence and phylogenetic analysis
Sanger-derived sequences were trimmed to remove primer-binding sites and
analysed using CLC Main Workbench v6.9.2 (QIAGEN, USA) and Geneious v11.0.2
(Biomatters, New Zealand). For RNAseq data, adapter sequences were removed using
the fastx_clipper and reads were further trimmed to attain optimum quality using the
DynamicTrim function of SolexaQA++ v.3.1.3 software (Cox et al., 2010) and fastx-
trimmer module of FASTX-Toolkit (http://hannonlab.cshl.edu/fastx_toolkit/). De
novo assembly of reads from each sample was performed using Trinity v.2.0.3
(Grabherr et al., 2011) and virus contigs were identified by BLASTn analysis against
the NCBI-derived local virus database (ftp://ftp.ncbi.nih.gov/genomes/Viruses/)
using a blast command line analysis (Altschul et al., 1990). Reads were subsequently
mapped onto reference sequences using CLC Genomics Workbench v.7.5.1
(https://www.qiagenbioinformatics.com/) with default parameters. ORFs were
predicted and annotated using CLC Genomics Workbench v.7.5.1 and sequences
were designated ‘complete’ based on comparison with the reference sequence used
for mapping.
Processed Sanger and NGS data were compared to sequences on the NCBI
database using BLAST algorithms available on the NCBI website
123
(http://blast.ncbi.nlm.nih.gov/Blast.cgi). For DsMV sequences, the conserved core
CP-coding region, excluding the heterogeneous N-terminal sequences, were further
aligned and analysed using the ClustalW multiple alignment application using BioEdit
sequence alignment editor program version 7.1.9
(http://www.mbio.ncsu.edu/BioEdit/bioedit.html). Phylogenetic trees were
constructed from ClustalW-aligned sequences with MEGA version 7.0
(http://www.megasoftware.net/mega.php), using the Maximum-Likelihood method
and a Kimura 2-Parameter model with 1000 bootstrap replications. Pairwise
sequence comparison (PASC) was carried out on aligned sequences using Geneious
v11.0.2 (Biomatters, New Zealand) computer software.
Results
Sample collection and symptoms
Four surveys were conducted covering a total of 25 taro and tannia growing regions
of Ethiopia, Kenya, Tanzania and Uganda (Fig. 1, Table 2). Of the 392 samples
collected, 333 were from taro and the remaining 59 were from tannia, of which 68
taro and 23 tannia plants showed typical virus-like symptoms (Fig. 2A-K; Table 2). In
Ethiopia, taro and tannia plants showing feathery-mottle, mosaic, stunting, leaf
distortion, leaf yellowing and vein-clearing symptoms (Fig. 2C-I) were observed from
all regions except Oromia. The highest number of symptomatic samples was collected
from Welayita region with 33 out of 87 samples showing virus-like symptoms. In
Kenya, virus-like symptoms were observed on taro and tannia growing in all regions
except Siaya, whereas in Tanzania, taro and tannia plants exhibiting symptoms (Fig.
2A) were observed in all five locations surveyed. In Uganda, virus-like symptoms were
seen on taro and tannia plants (Fig. 2B, J-K) growing at five of the seven regions
visited. No plants showing typical alomae or bobone disease symptoms were
observed during the surveys.
124
Figure 1. Locations of survey sites in Ethiopia, Kenya, Tanzania and Uganda. Red stars represent sampling sites. A total of 171, 86, 41 and 94 samples were collected from Ethiopia, Kenya, Tanzania and Uganda respectively.
Ethiopia Kenya
Uganda Tanzania
125
Table 2. Summary of PCR and RT-PCR screening results for viruses infecting taro and tannia samples in this study.
Country Region Number of samples collected Symptomatic samples Number of RT-PCR positive samples
Total Taro Tannia Total Taro Tannia Poty DsMV CMV1 TaVCV CBDaV Total Taro Tannia Total Taro Tannia
Ethiopia
Welayita 87 84 3 16 13 3 17 13 4 17 13 4 0 0 0 Oromia 22 22 0 0 0 0 3 3 0 3 3 0 0 0 0 Sheka 25 22 3 6 4 2 9 5 4 9 5 4 0 0 0 Masha 14 12 2 3 1 2 4 2 2 4 2 2 0 0 0 Keffa 23 20 3 4 1 3 3 1 2 3 1 2 0 0 0
Total 171 160 11 29 19 10 36 24 12 36 24 12 0 0 0
Kenya
Nyeri 30 29 1 9 9 0 0 0 0 0 0 0 0 0 0 Laikipia 3 2 1 1 1 0 0 0 0 0 0 0 0 0 0
Tharaka Nithi 14 14 0 8 8 0 0 0 0 0 0 0 0 0 0 Kirinyaga 9 8 1 3 3 0 0 0 0 0 0 0 0 0 0
Embu 19 19 0 4 4 0 0 0 0 0 0 0 0 0 0 Kakamega 4 4 0 1 1 0 0 0 0 0 0 0 0 0 0
Kisumu 5 5 0 1 1 0 0 0 0 0 0 0 0 0 0 Siaya 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0
Total 86 83 3 27 27 0 0 0 0 0 0 0 0 0 0
Tanzania
Musoma 9 9 0 2 2 0 0 0 0 0 0 0 0 0 0 Tarime 5 2 3 1 0 1 0 0 0 0 0 0 0 0 0 Mago 2 2 0 1 1 0 0 0 0 0 0 0 0 0 0
Biharamulo 9 1 8 1 0 1 2 0 2 2 0 2 0 0 0 Mwanza 16 15 1 9 7 2 1 1 0 1 1 0 0 0 0
Total 41 29 12 14 10 4 3 1 2 3 1 2 0 0 0
Uganda
Busuju 25 16 9 9 5 4 0 0 0 0 0 0 0 0 0 Lukaaya 26 17 9 4 4 0 1 0 1 1 0 1 0 0 0 Busiro 20 11 9 3 1 2 0 0 0 0 0 0 0 0 0
Budondo 4 4 0 0 0 0 0 0 0 0 0 0 0 0 0 Buunya 6 5 1 1 1 0 0 0 0 0 0 0 0 0 0 Kignlu 3 2 1 0 0 0 0 0 0 0 0 0 0 0 0 Luuka 10 6 4 4 1 3 0 0 0 0 0 0 3 0 0
Total 94 61 33 21 12 9 1 0 1 1 0 1 3 0 0 1All the three samples tested positive to CMV from Uganda are from tannia
126
Figure 2. Photos of typical virus-like symptoms on taro and tannia plants from East Africa. A) Tz47 showing feathery-mottle symptom; B) Ug31 showing leaf yellowing and vein clearing symptoms; C) Et105 showing feathery-mottle and stunting symptoms; D) Et26 showing mosaic and feathery-mottle symptoms; E) Et36 showing yellowing and mosaic symptoms F) Et82 showing mosaic and stunting symptoms; G) and H) Et51 showing mosaic, leaf distortion, stunting and feathery-mottle symptoms; I) Et41 showing yellowing and mosaic symptoms; J) Ug93 showing mosaic symptom; and K) Ug91 showing mosaic and yellowing symptoms.
A B C
D E F
G K
I
J
H
127
RT-PCR screening
When RNA extracts were tested for the presence of potyviruses by RT-PCR using the
degenerate primers, CI-F/R, the expected ∼700 bp amplicon was only observed in 36
(24 taro and 12 tannia) samples from Ethiopia, as well as one sample from Uganda
(Ug31, Lukaaya region) and three samples from Tanzania (Tz24 and Tz34 from
Biharamulo and Tz47 from Mwanza). Samples Ug31, Tz24 and Tz34 were from tannia,
while Tz47 was from taro. When these 40 samples were subsequently tested for
DsMV by RT-PCR using specific primers DsMV-3F/3R, the expected amplicon of ∼560
bp was obtained from all 40 samples.
Testing of the extracts for the presence of CMV using the specific primers, CMV-
F/R, resulted in an amplicon of the expected size from only three tannia samples
(Ug90, 91, 92) from Buikwe district in Uganda. The amplicons from the three samples
were cloned and sequenced, with BLAST analysis of the trimmed 735 bp region of the
cloned sequences revealing highest identity (96 %) to a subgroup IB CMV isolate from
Egypt.
When extracts were tested for the presence of rhabdoviruses using the
degenerate primers Rhab-F/R, the expected ∼900 bp product was generated from 13
samples. However, these samples all tested negative for TaVCV and CBDaV using
virus-specific primers, despite amplicons of the expected size (∼220 and ∼700 bp,
respectively) being generated from the positive controls. Subsequent sequence
analysis of cloned amplicons generated using the degenerate rhabdovirus primers
revealed the sequences were of a non-viral origin.
Sequencing of DsMV isolates
Following RT-PCR using the degenerate potyvirus primers, amplicons from five
samples selected from different locations (Et9, Et41, Et56, Tz34 and Ug31) were
cloned and sequenced. BLAST analysis of the trimmed 630 bp sequences revealed 79-
89 % and 90-99 % identity at the nucleotide and amino acid levels, respectively, to
DsMV isolates infecting either taro from India (Et41, Tz34 and Ug31) or Zantedeschia
aethiopica (Arum lily) from China (Et9 and 56). Amplicons generated using the DsMV-
specific primers from 16 representative samples were subsequently cloned and
128
sequenced. These 16 samples included 13 from Ethiopia (Et5, 9, 26, 29, 36, 40, 41,
51, 56, 74, 82, 105, 106), as well as samples Tz24 and 34 from Tanzania and sample
Ug31 from Uganda. BLAST analysis of the trimmed 520 bp sequences from the 16
samples revealed a maximum of 92-96 % and 98-99 % identity at the nucleotide and
amino acid levels, respectively, to DsMV isolates infecting a range of aroids from
China, Japan, India and Nicaragua.
Following the analysis of these partial sequences, the complete genome
sequences of isolates Ug31, Tz34 and seven isolates from Ethiopia (Et5, 9, 26, 29, 36,
41 and 56) were generated using Illumina MiSeq NGS. Comparison of the consensus
nucleotide sequences of the nine isolates derived from NGS with the respective
consensus RT-PCR-generated sequences revealed 99-100 % identity. The complete
genome sequences of the nine DsMV isolates varied from 9,710 and 9,978
nucleotides in length, excluding the 3' polyA-tail. The 5' and 3' UTRs of all the isolates
varied between 138-339 nucleotides and 206-249 nucleotides, respectively. The
genome sequences also contained a single large ORF ranging from 9,339-9,576
nucleotides, encoding a predicted polyprotein of 3,113-3,192 amino acids, with
predicted molecular masses of 354.7-362.5 kDa. Further, the overlapping ORF known
as P3N-PIPO was identified in the nine sequences.
Phylogenetic analysis and PASC
Phylogenetic analysis was carried out using the amino acid sequences of the core CP-
coding region from RT-PCR amplicons from the 16 DsMV isolates sequenced from
East Africa, together with 39 published DsMV isolates and other representative
members of the family Potyviridae. DsMV isolates included in the analysis formed a
large heterogeneous group separate from other potyviridae members (Fig. 3). Within
the DsMV sequences included, 11 subgroups were identified, although many of these
have low bootstrap support values. Isolates from East Africa clustered into five of
these subgroups. However, the clustering was not representative of either host plant
species or geographic origins, with Ethiopian DsMV sequences from taro and tannia
present in four out of the five subgroups and clustering with isolates infecting taro,
129
DsMV-EF199550-Konjac-China DsMV-LC114503-Konjac-Japan DsMV-AM910400-Tannia-Nicaragua DsMV-AM910399-Tannia-Nicaragua DsMV-KJ786965-Elephant foot yam-India DsMV-AM910401-Tannia-Nicaragua DsMV-AJ298034-Arum lily-China DsMV-AM910406-Tannia-Nicaragua DsMV-AM910403-Tannia-Nicaragua DsMV-AM910398-Tannia-Nicaragua DsMV-AJ298036-Taro-Japan DsMV-JN692173-Taro-China DsMV-AM910405-Tannia-Nicaragua DsMV-AM910407-Tannia-Nicaragua Et26-Taro-MG602229 Et56-Tannia-MG602233 DsMV-DQ925465-Taro-Vietnam Et29-Taro-MG602230 Et5-Taro-MG602227 DsMV-AM910404-Tannia-Nicaragua DsMV-LC114515-Konjac-Japan Et9-Taro-MG602228 Et36-Tannia-MG602231 DsMV-AF511485-Calla lily-Taiwan DsMV-FJ160764-Elephant foot yam-India VanMV-AJ616719-Vanilla-French Polynesia DsMV-AY994104-Taro-New Zealand DsMV-AY994105-Taro-New Zealand Et40-Taro-MG602236 Et74-Tannia-MG602238 Et82-Taro-MG602239 DsMV-HQ207530-Elephant foot yam-India DsMV-U00122-Taro-USA Et41-Tannia-MG602232 Et51-Taro-MG602237 Ug31-Tannia-MG602235 DsMV-AJ298035-Taro-Japan DsMV-LC114499-Konjac-Japan DsMV-AJ298033-Arum lily-China DsMV-NC003537-Arum lily-China VanMV-AJ616720-Vanilla-Cook Islands DsMV-HQ207537-Elephant foot yam-India DsMV-HQ207538-Elephant foot yam-India DsMV-HQ207536-Elephant foot yam-India
Clade I
DsMV-LC114497-Konjac-Japan DsMV-LC114505-Konjac-Japan DsMV-LC114493-Konjac-Japan DsMV-LC114498-Konjac-Japan DsMV-LC114513-Konjac-Japan DsMV-JN692172-Taro-China Tz24-Tannia-MG602242 Tz34-Tannia-MG602234 Et105-Taro-MG602240 Et106-Taro-MG602241 DsMV-LC114506-Konjac-Japan
Clade II
ZYMV-AY188994 WMV-FJ823122 SMV-KF135488 BCMNV-AY864314 CABMV-AF348210 PStV-AY968604 BCMV-KC832501 ZaMMV-KT729506 PVY-EF026076 PeMoV-NC002600 SrMV-KJ541740 SCMV-AY569692 YMV-NC004752 BYMV-AB439732 SPVG-KF790759 KoMV-AB219545
Outgroup RGMV-NC001814
99
99
93
8998
84
83
76
75
73
67
65
5654
62
87
58
79
99
60
78
130
Figure 3. Phylogenetic analysis based on amino acid sequences of the core CP-coding region of selected DsMV isolates. Phylogenetic tree generated using the Maximum-Likelihood method and a Kimura 2-Parameter model with 1000 bootstrap replications in MEGA 7. The tree was rooted using Ryegrass mosaic virus (RGMV, NC001814), as outgroup. Bootstrap values greater than 50 % are shown. Taro (Colocasia esculenta), tannia (Xanthosoma sp.), elephant foot yam (Amorphophallus paeoniifolius), konjac (Amorphophallus konjac), arum lily (Zantedeschia aethiopica), calla lily (Zantedeschia sp.). Et: isolates sequenced from Ethiopia, Tz: isolates sequenced from Tanzania and Ug: isolates sequenced from Uganda.
131
tannia, Calla lily, Elephant foot yam, vanilla and Konjac from Vietnam, Nicaragua,
Taiwan, India, New Zealand, USA, French Polynesia and Japan (Fig. 3). PASC analysis
revealed that DsMV isolates from East Africa have an amino acid similarity ranging
from 90.5 % to 100 % with previously reported DsMV isolates.
Discussion
Of the 392 samples collected from 25 regions in the four countries, a total of 91 (68
taro and 23 tannia) samples showed virus-like symptoms. These symptoms included
mosaic, yellowing, stunting, feathery-mottle, leaf distortion, vein-clearing and/or
downward-curling of the leaf blades (Fig. 2), which have previously been associated
with virus infection in a range of aroids (Zettler et al., 1970; Elliott et al., 1997; Revill
et al., 2005a). Symptomatic samples were collected from plants growing in 21 of the
25 regions surveyed, with the exception of Oromia in Ethiopia, Siaya in Kenya or
Budondo and Kignlu in Uganda, where no virus-like symptoms were observed (Table
2). In the 25 regions from the four countries surveyed in this study, no samples
showing symptoms usually attributed to bobone or alomae diseases were observed.
Of the 91 symptomatic samples, 45 samples from Ethiopia, Tanzania and
Uganda showed symptoms such as feathery-mottle, mosaic, leaf distortion, yellowing
and/or stunting, which are often associated with DsMV infection (Fig. 2A-K) (Nelson,
2008). Of the 45 samples with DsMV-like symptoms, three tannia samples collected
from a single site in Luuka region of Uganda showing mosaic, mottling and vein-
chlorosis symptoms (Fig. 2J and K) were found to be infected with CMV, with all three
samples testing negative for DsMV. Although a range of other symptoms were
observed in the samples collected in this study, no other samples tested positive for
CMV, suggesting that asymptomatic infections of taro and tannia with CMV were not
present in any of the samples collected and that symptoms observed on other
samples were not associated with CMV infection.
Of the remaining 42 samples with typical DsMV-like symptoms (Fig. 2A-I), 36
were confirmed to be infected with DsMV, including 33 samples from Ethiopia, one
from Uganda and two from Tanzania. In addition, three asymptomatic plants from
132
Ethiopia together with an asymptomatic sample from Tanzania (Tz24) also tested
positive for DsMV. This phenomenon is consistent with previous studies and may
occur as a consequence of seasonal effects or differences in symptom expression in
different host plant species (Elliott et al., 1997; Nelson, 2008). Hence, sampling and
testing of aroids for DsMV at different seasons of the year should be considered in
future studies. The survey findings suggest that, while DsMV is widespread in
Ethiopia, being detected in ∼21 % of the 171 samples collected from the five regions
surveyed, this is not the case in Uganda, Tanzania and Kenya. Six samples (four from
Ethiopia and two from Uganda) with typical DsMV-like symptoms tested negative for
all of the viruses. The yellowing and mosaic symptoms observed on these six samples
might be caused by other factors such as aging, pest attack, pesticide use or viruses
other than DsMV, CMV or the two rhabdoviruses assayed.
Forty six samples showing symptoms such as leaf discolouration or yellowing,
vein swelling or deformation, downward-curling of the leaf blades, or stunting, tested
negative for all the assayed viruses. Of these 46 samples, 36 were from taro and 10
were from tannia collected from the four countries surveyed. The symptoms
observed on these samples may be caused by any one of a number of factors, such
as nutritional deficiencies, as yet unidentified virus/es or by other aroid-infecting
viruses for which testing was not done such as viruses from the families Reoviridae
and Tospoviridae. It is also possible that the plants were infected with sequence
variants of DsMV, CMV, CBDaV or TaVCV whose diversity precluded their detection
using the currently available primers. In work associated with the current study
(Kidanemariam et al., 2018a), samples were tested for badnaviruses using PCR and
rolling circle amplification (RCA) and full-length sequences were characterised. A high
incidence and wide distribution of both TaBV and TaBCHV was determined, with at
least one sample from every district testing positive, however there was no clear
association of either of these two viruses with symptoms. Interestingly, of the 40
samples which tested positive for DsMV, mixed infections of DsMV and TaBV were
observed in 25 of the DsMV-positive samples from Ethiopia as well as all three DsMV-
positive samples from Tanzania. This result indicates that mixed infections of TaBV
133
and DsMV are not uncommon and further work on the synergistic effects of mixed
infections, compared to infection with either TaBV or DsMV alone, on the yield of
taro plants is warranted. Interestingly there were no mixed infections between the
other badnavirus species identified, TaBCHV, and DsMV.
Although partial sequences of DsMV isolates from Ethiopia are available
(Kidanemariam et al., 2018b), the complete genomic sequences of East African DsMV
isolates have not been reported. Therefore, the complete genome sequences of nine
East African isolates were determined and analyses were carried out to determine
the evolutionary relationship of these and previously reported DsMV isolates. The
genome organisation of the nine DsMV isolates was consistent with other DsMV
isolates. Phylogenetic analysis carried out using the core CP-coding amino acid
sequences was also consistent with previous reports, with DsMV isolates grouping
into two distinct clades (Wang et al., 2017; Babu and Hegde 2014). The separation of
Ethiopian DsMV isolates into five groups across the two clades each containing
isolates from different geographic locations including, Vietnam, Nicaragua, Taiwan,
India, the USA and Japan suggests that the virus has most likely been introduced from
different sources on multiple occasions. The origins of the isolates from Uganda
(clade I) and Tanzania (clade II) are clearly different from each other, but similar to
two of the five groups of isolates present in Ethiopia. The phylogenetic analysis also
revealed that there is no relationship between either clades or groups with respect
to geographic origin or host plant among the DsMV isolates included in this study,
which is also consistent with previous work (Wang et al., 2017).
This is the first comprehensive survey carried out in East Africa to identify and
characterise viruses infecting taro and other edible aroids in the region. The findings
from this study will assist farmers and national agricultural research services in the
region to make informed decisions regarding the acquisition and dissemination of
edible aroids, and in particular highlights the high prevalence of DsMV in Ethiopia.
Further work on the yield effects of taro and tannia infected with DsMV will be crucial
in determining yield losses and identifying if resistant cultivars are available for
distribution. The establishment of virus-indexed tissue culture nurseries within East
Africa will play a key role in the production and distribution of virus-free farmer-
134
preferred taro cultivars in the region. The collection of field samples from this work
will be preserved at the BecA–ILRI Hub and will be available for further analysis, if
and when additional diagnostic assays become available. This may shed light on the
cause of the symptoms displayed on some plants which tested negative in the current
work.
Acknowledgments
This project was funded by Biosciences eastern and central Africa (BecA–ILRI) Hub
through the African Biosciences Challenge Fund (ABCF). ABCF program is supported
by the Australian Department of Foreign Affairs and Trade (DFAT) through BecA-
CSIRO partnership; the Syngenta Foundation for Sustainable Agriculture (SFSA); the
Bill and Melinda Gates Foundation (BMGF); the UK Department for International
Development (DFID) and the Swedish International Development Agency (SIDA). We
are also thankful to all the farmers for allowing us to inspect their fields and collect
samples. DK is the recipient of an Australia Awards Scholarship.
135
References
Akwee P.E., Netondo G., Kataka J.A., Palapala V.A. (2015) A critical review of the role of taro Colocasia esculenta L. (Schott) to food security: A comparative analysis of Kenya and Pacific Island taro germplasm. Scientia Agriculturae, 9, 101–108.
Alconero R., Zettler F.W. (1971) Virus infections of Colocasia and Xanthosoma in Puerto Rico. Plant Disease Reporter, 55, 506–508.
Altschul S.F., Gish W., Miller W., Myers E.W., Lipman D.J. (1990) Basic local alignment search tool. Journal of Molecular Biology, 215, 403–410.
Atibalentja N., Fiafia T.S., Gosai R., Melzer M. (2017) First Report of Taro vein chlorosis virus on Taro (Colocasia esculenta) in the U.S. Territory of American Samoa. Plant Disease, doi.org/10.1094/PDIS-09-17-1478-PDN
Babu B., Hegde V. (2014) Molecular characterization of dasheen mosaic virus isolates infecting edible aroids in India. Acta Virologica, 58, 34–42.
Beyene T.M. (2013) Morpho-agronomical characterization of taro (Colocasia esculenta) accessions in Ethiopia. SciencePG, 1, 1–9.
Cox M.P., Peterson D.A., Biggs P.J. (2010) SolexaQA: At-a-glance quality assessment of Illumina second-generation sequencing data. BMC Bioinformatics, 11, 485.
Dietzgen R.G., Tan E.R., Yong A.H.S., Feng C.W. (2013) Partial polymerase gene sequence, phylogeny and RT-PCR diagnostic assay for Datura yellow vein nucleorhabdovirus. Australasian Plant Disease Notes, 8, 21–25.
Dong J.H., Cheng X.F., Yin Y.Y., Fang Q., Ding M., Li T.T., Zhang L.Z., Su X.X., McBeath J.H., Zhang Z.K. (2008) Characterization of tomato zonate spot virus, a new tospovirus in China. Archives of Virology, 153, 855–864.
Elliott M.S., Zettler F.W., Brown L.G. (1997) Dasheen mosaic potyvirus of edible and ornamental aroids. Plant Pathology Circular, 384.
Grabherr M.G., Haas B.J., Yassour M., Levin J.Z., Thompson D.A., Amit I., Adiconis X., Fan L., Raychowdhury R., Zeng Q., Chen Z., Mauceli E., Hacohe N., Gnirke A., Rhind N., di Palma F., Birren B.W., Nusbaum C., Lindblad-Toh K., Friedman N., Regev A. (2011) Full-length transcriptome assembly from RNA-seq data without a reference genome. Nature Biotechnology, 29, 644–652.
Gollifer D., Jackson G., Dabek A., Plumb R., May Y. (1977) The occurrence and transmission of viruses of edible aroids in the Solomon Islands and the Southwest Pacific. International Journal of Pest Management, 23, 171–177.
136
Ha C., Coombs S., Revill P., Harding R.M., Vu M., Dale J.L. (2008) Design and application of two novel degenerate primer pairs for the detection and complete genomic characterization of potyviruses. Archives of Virology, 153, 25–36.
Higgins C.M., Bejerman N., Li M., James A.P., Dietzgen R.G., Pearson M.N., Revill A.P., Harding R.M. (2016) Complete genome sequence of Colocasia bobone disease-associated virus, a putative cytorhabdovirus infecting taro. Archives of Virology, 161, 745–748.
James M., Kenten R., Woods R. (1973) Virus-like particles associated with two diseases of Colocasia esculenta (L.) Schott in the Solomon Islands. Journal of General Virology, 21, 145–153.
Kazmi S.A., Yang Z., Hong N., Wang G., Wang Y. (2015) Characterization by small RNA sequencing of Taro Bacilliform CH Virus (TaBCHV), a novel Badnavirus. PloS One, 10, e0134147.
Kidanemariam D.B., Sukal A.C., Abraham A.D., Stomeo F., Dale J.L., James A.P., Harding R. (2018a) Identification and molecular characterisation of taro bacilliform virus and taro bacilliform CH virus from East Africa. Plant pathology, https://doi.org/10.1111/ppa.12921.
Kidanemariam D.B., Macharia M.W., Harvey J., Holton T., Sukal A.C., James A.P., Harding R., Abraham A.D. (2018b) First report of Dasheen mosaic virus infecting taro (Colocasia esculenta L.) from Ethiopia. Plant disease, doi.org/10.1094/PDIS-12-17-1991-PDN
Long M.H., Ayin C., Li R., Hu J.S. Melzer M.J. (2014) First Report of Taro vein chlorosis virus infecting taro (Colocasia esculenta) in the United States. Plant Disease, 98, 1160–1160.
Macanawai, A.R., Ebenebe, A.A., Hunter, D., Devitt, L., Hafner, G. and Harding, R. (2005) Investigations into the seed and mealybug transmission of Taro bacilliform virus. Australasian Plant Pathology, 34, 73–76.
Manikonda P., Srinivas K.P., Reddy S., Venkata C., Ramesh B., Navodayam K., Krishnaprasadji J., Ratan P. B., Sreenivasulu P. (2011) Konjac mosaic virus naturally infecting three aroid plant species in Andhra Pradesh. Indian Journal of Phytopathology, 159, 133–135.
Maino M.K. (2003) The development of a serological-based diagnostic test for Dasheen mosaic potyvirus (DsMV). MSc thesis, school of life sciences, Queensland University of Technology.
137
Ndabikunze B.K., Talwana H.A.L., Mongi R.J., Issa-Zacharia A., Serem A. K., Palapala V., Nandi J.O.M. (2011) Proximate and mineral composition of cocoyam (Colocasia esculenta L. and Xanthosoma sagittifolium L.) grown along the Lake Victoria basin in Tanzania and Uganda. African Journal of Food Science, 5, 248–254.
Nelson, S. C. (2008) Dasheen mosaic of edible and ornamental aroids. Plant Disease, 44, 1–9.
Onwueme I.C., Charles W.B. (1994) Cultivation of cocoyam. In: Tropical root and tuber crops. Production, perspectives and future prospects, pp. 139–161. FAO Plant Production and Protection, 126, Rome.
Pearson M., Jackson G., Saelea J., Morar S. (1999) Evidence for two rhabdoviruses in taro (Colocasia esculenta) in the Pacific region. Australasian Plant Pathology, 28, 248–253.
Rana G.L., Vovlas C., Zettler F.W. (1983) Manual transmission of dasheen mosaic virus from Richardia to nonaraceous hosts. Plant Disease, 67, 1121–1122.
Revill P., Jackson G., Hafner G., Yang I., Maino M., Dowling M., Devitt L., Dale J., Harding R. (2005a) Incidence and distribution of viruses of taro (Colocasia esculenta) in Pacific Island countries. Australian Plant Pathology, 35, 327–331.
Revill P., Trinh X., Dale J., Harding R. (2005b) Taro vein chlorosis virus: characterization and variability of a new nucleorhabdovirus. Journal of General Virology, 86, 491–499.
Sivaprasad Y., Reddy B.B., Kumar C.N., Reddy K.R., Gopal D.S. (2011) First report of groundnut bud necrosis virus infecting taro (Colocasia esculenta). Australasian Plant Disease Notes, 6, 30–32.
Talwana H.A.L., Serem A.K., Ndabikunze B.K., Nandi J.O.M., Tumuhimbise R., Kaweesi T., Chumo E.C., Palapala V. (2009) Production status and prospects of cocoyam (Colocasia esculenta (L.) Schott.) in East Africa. Journal of Root Crops, 35, 98–107.
Tumuhimbise R., Talwana H.L., Osiru D.S.O., Serem A.K., Ndabikunze B.K., Nandi J.O.M., Palapala V. (2009) Growth and development of wetland-grown taro under different plant populations and seedbed types in Uganda. African Crop Science Journal, 17, 49–60.
138
Valderrama-Cháirez M.L., Cruz-Hernández A., Paredes-López O. (2002) Isolation of functional RNA from cactus fruit. Plant Molecular Biology Reporter, 20, 279–286.
Wang Y.F., Wang G.P., Wang L.P., Hong N. (2014) First report of Cucumber mosaic virus in taro plants in China. Plant Disease, 98, 574–574.
Wang Y., Wu B., Borth W.B., Hamim I., Green J.C., Melzer M.J., Hu J.S. (2017) Molecular characterization and distribution of two strains of dasheen mosaic virus on taro in Hawaii. Plant Disease, 101, 1980–1989.
Yang I.C., Hafner G.J., Revill P.A., Dale J.L., Harding R.M. (2003) Sequence diversity of South Pacific isolates of Taro bacilliform virus and the development of a PCR-based diagnostic test. Archives of Virology, 148, 1957–1968.
Zettler F.W., Foxe M.J., Hartman R.D., Edwardson J.R., Christie R.G. (1970) Filamentous viruses infecting dasheen and other araceous plants. Phytopathology, 60, 983–987.
139
Chapter 8
General Discussion
Despite the remarkable economic growth recorded in East Africa over the past 15
years, food and nutrition insecurity are still significant problems for the region (AASR,
2016; AEO, 2017). Agricultural productivity in the region is affected by many different
factors including climate change such as El Niño, armed conflict, losses due to pests
and diseases and inefficient farming systems (AASR, 2016; FAO, 2016). Taro
(Colocasia esculenta L.) and tannia (Xanthosoma sp.) are among the most important
root crops grown for both food and economic security by many small-holder farmers
in sub-Saharan Africa. In the densely populated south and south-western part of
Ethiopia around 20 million people depend on root crops such as potato, sweet
potato, taro and enset for their dietary intake (Harrison et al., 2014). Taro is
propagated mainly because it performs well with minimal agricultural input (Harrison
et al., 2014; Wada et al., 2017) and provides a basic source of starch in the diet for
many communities. In Kenya, it is grown beside many streams and rivers in Mount
Kenya and Abedares, as well as in the Lake Victoria basin districts of Kakamega,
Kisumu and Siaya. Taro is also a very important food crop in Uganda and Tanzania. It
is mainly grown along the Lake Victoria Basin in Tanzania (Bukoba and Misenyi
districts) and Uganda (Wakiso and Mukono districts) (Talwana et al., 2009;
Ndabikunze et al., 2011; Macharia et al., 2014).
In Ethiopia, Areka Agricultural Research Centre (AARC) is one of the research
institutes mandated to carry out experiments with root and tuber crops. In early
2000, AARC released a taro variety called ‘Boloso-one’ with desirable production and
agronomic characteristics and it was accepted by most farmers (Dagne et al., 2014).
However, the production of ‘Boloso-one’ and other taro varieties in southern Ethiopia
has declined significantly in recent years. In other areas of the world, such as Asia and
the South Pacific, yield decline of taro and other edible aroids has been attributed to
virus infection and these pathogens are among the most important constraints for
the production (Yang et al., 2003; Revill et al., 2005; Babu et al., 2014). Prior to the
140
current research project, however, no comprehensive study has been carried out to
determine the incidence, distribution and the possible origin of viruses infecting taro
and other edible aroids in East Africa.
In this study, a high incidence of TaBV and TaBCHV infection was detected in
taro and tannia from East Africa. TaBCHV was detected in all four countries surveyed
(Ethiopia, Kenya, Tanzania and Uganda) while TaBV was only identified in Kenya,
Uganda and Tanzania. It is possible, however, that TaBV is present in Ethiopia but was
not represented in the samples randomly selected for sequencing from this country.
Therefore, further sampling and analysis of plants from Ethiopia is needed to verify
the absence of TaBV in this country. Both TaBV and TaBCHV are known to infect
aroids without causing obvious symptoms (Revill et al., 2005). This is also consistent
with our observations whereby no correlation was seen between symptoms and the
presence of TaBV and TaBCHV. There is currently no information available on
production losses in taro and other edible aroids due to infection by TaBV or TaBCHV
alone or in combination.
DsMV infection can reportedly cause up to 60 % production losses in aroids
(Hartman and Zettler, 1974; Elliott et al., 1997). Unless strict disease control and
eradication measures are taken, the high occurrence of DsMV in Ethiopia is a threat
to the production of taro in this country and the region. AARC is currently multiplying
and distributing corms of elite taro cultivars like ‘Boloso-one’ to farmers in southern
Ethiopia. In addition, AARC has the largest taro germplasm collection in the country.
Therefore, it is crucial for the centre to implement viral disease diagnostic procedures
in its taro production and distribution systems. Furthermore, production of disease-
free taro planting materials through tissue culture should be considered in the future.
Field observations in southern Ethiopia have revealed a high incidence of aphid
infestations, which may be facilitating the rapid spread of DsMV. Therefore,
integrated disease and pest management systems need to be established in order to
achieve effective control of DsMV in Ethiopia. Surprisingly, no samples tested positive
for DsMV from Kenya and there was a very low incidence of DsMV in Uganda and
Tanzania. Therefore, appropriate quarantine measures need to be in place in these
141
three countries in order to prevent the introduction and dissemination of the virus.
In addition, equipping researchers and farmers in Kenya, Tanzania and Uganda with
proper training on early identification and removal of DsMV-infected plants should
be considered to control the virus.
No samples collected in this study tested positive for colocasia bobone disease-
associated virus (CBDaV) or Taro vein chlorosis virus (TaVCV), two members of the
family Rhabdoviridae infecting taro in the South Pacific. However, there is currently
limited sequence information available for these two viruses and rhabdoviruses in
general. As a result, it is not known whether the virus-specific or degenerate PCR
primers used in this study will amplify the breadth of variability that may be present
within any East African rhabdovirus isolates. Therefore, the inability to detect
rhabdoviruses in this this study must be treated with caution and further research is
required. However, it is advisable that strict quarantine measures be implemented in
order to prevent the introduction of taro planting material infected with known
rhabdoviruses into the region. This is critical to avert the occurrence of alomae, a
lethal disease reported from Papua New Guinea (PNG) and the Solomon Islands
caused by the synergistic interaction between colocasia bobone disease-associated
virus (CBDaV) and TaBV (Revill et al., 2005; Higgins et al., 2016). The establishment of
disease diagnostic capacities, especially in national agricultural research systems
(NARS) and quarantine regulation bodies, is also vital.
Due to time constraints and a lack of suitable assays or known infected samples
for use as controls, testing of plant samples for members of the Tospovirus and
Oryzavirus genera was not done in this study. Groundnut bud necrosis virus (GBNV),
genus Tospovirus is only reported from India (Sivaprasad et al., 2011), while taro
reovirus (TaRV) genus Oryzavirus has only previously been identified in Papua New
Guinea (Revill et al., 2005). Currently there is no information about the effect of these
viruses on the production of taro. The testing of aroids from East Africa for these
viruses and NGS analysis for a large of number of RNA samples will be important for
future research activities.
142
Infectious virus clones are a useful means of transmitting plant viruses without
the need for insect vectors, to facilitate studies on virus resistance, viral gene
functions and to enable modification of viruses for gene expression or gene silencing
(Grimsley et al., 1986; Grimsley, 1990). Additional uses could be the assessment of
production losses in vegetatively propagated crops, such as taro, caused by viral
infection over subsequent generations and investigating the synergistic interactions
of individual viruses in mixed infections (Grimsley et al., 1986; Grimsley et al., 1987;
Dasgupta et al. 1991). In this study, a greater-than-unit-length clone of an Australian
TaBV isolate was generated and was shown to be infectious in taro. This infectious
clone can be used in future studies to assess the production losses in taro due to TaBV
infection over several generations. Furthermore, this infectious clone can be used to
screen taro cultivars for TaBV resistance, and to develop mutant TaBV infectious
clones in order to study the role of different virus gene products in the virus life-cycle.
Importantly, the TaBV infectious clone could be used to understand the possible role
of TaBV in the lethal viral disease of taro known as ‘alomae’ caused by mixed infection
of taro with TaBV and CBDaV. This would, however, first require the generation of an
infectious clone of CBDaV.
To our knowledge, this study is the first to determine the incidence and
distribution of viruses infecting taro and other edible aroids from East Africa. These
results will assist farmers, NARS and private tissue culture laboratories from the
countries surveyed, to make informed decisions on the acquisition, dissemination
and production of virus-free planting materials of taro and other edible aroids in the
region. In addition, it will lay the groundwork for future studies on aroids in the
region.
143
References
AASR (Africa Agriculture Status Report). (2016). Progress towards agricultural
transformation in Africa. Accessed 01/11/2017
https://agra.org/aasr2016/public/assr.pdf
AEO (African Economic Outlook). (2017). Entrepreneurship and industrialisation.
Accessed 01/11/2017
https://www.afdb.org/fileadmin/uploads/afdb/Documents/Publications/AEO
_2017_Report_Full_English.pdf
Babu, B. and Hegde, V. (2014). Molecular characterization of dasheen mosaic virus
isolates infecting edible aroids in India. Acta virologica 58:34–42.
Dagne, Y., Mulualem, T. and Kifle, A. (2014). Development of high yielding taro
(Colocacia esculenta L.) variety for mid altitude growing areas of Southern
Ethiopia. J. Plant Sci. 2: 50–54.
Dasgupta, I., Hull, R., Eastop, S., Poggi-Pollini, C., Blakebrough, M., Boulton, M. I. and
Davies, J. W. (1991). Rice tungro bacilliform virus DNA independently infects
rice after Agrobacterium-mediated transfer. J. Gen. Virol. 72:1215–1221.
Elliott, M.S., Zettler, F.W. and Brown, L.G. (1997). Dasheen mosaic potyvirus of
edible and ornamental aroids. Plant Pathol. Circular, 384.
FAO (2016). Africa, Regional overview of food security and nutrition. The challenhes
of building resilience to shocks and stresses. Accessed 22/09/2017
http://www.fao.org/3/a-i6813e.pdf
Grimsley, N., Hohn, B., Hohn, T. and Walden, R. (1986). “Agroinfection,” an
alternative route for viral infection of plants by using the Ti
plasmid. Proceedings of the national academy of Sci. 83: 3282–3286.
Grimsley, N., Hohn, T., Davies, J. W. and Hohn, B. (1987). Agrobacterium-mediated
delivery of infectious maize streak virus into maize plants. Nature 325:177–179.
144
Grimsley, N. (1990). Agroinfection. Physiologia Plantarum 79: 147–153.
Harrison, J., Moore, K.A., Paszkiewicz, K., Jones, T., Grant, M.R., Ambacheew, D.,
Muzemil, S. and Studholme, D.J. (2014). A draft genome sequence for ensete
ventricosum, the drought-tolerant “Tree against hunger”. Agronomy 4:13–33.
Hartman, R.D. and Zettler, F.W. (1974). Effects of dasheen mosaic virus on yields of
Caladium, Dieffenbachia, and Philodendron. Phytopathol. 64: 768.
Higgins, C., Bejerman, N., Li, M., James, A., Dietzgen, R., Pearson, M., Revill, P. and
Harding, R. (2016). Complete genome sequence of Colocasia bobone disease-
associated virus, a putative cytorhabdovirus infecting taro. Arch. Virol.
161:745–748.
Macharia, M. W., Runo, S. M., Muchugi, A. N., & Palapala, V. (2014). Genetic structure
and diversity of East African taro (Colocasia esculenta (L.) Schott). Afri. J.
Biotech. 13:2950–2955.
Ndabikunze, B.K., Talwana, H.A.L., Mongi, R.J., Issa-Zacharia, A., Serem, A.K.,
Palapala, V. and Nandi, J.O.M. (2011). Proximate and mineral composition of
cocoyam (Colocasia esculenta L. and Xanthosoma sagittifolium L.) grown along
the Lake Victoria basin in Tanzania and Uganda. Afri. J. Food Sci. 5:248–254.
Revill, P., Jackson, G., Hafner, G., Yang, I., Maino, M., Dowling, M., Devitt, L., Dale, J.
and Harding, R. (2005). Incidence and distribution of viruses of taro (Colocasia
esculenta) in Pacific Island countries. Aust. Plant Pathol. 35:327–331.
Sivaprasad, Y., Reddy, B.B., Kumar, C.N., Reddy, K.R. and Gopal, D.S. (2011). First
report of groundnut bud necrosis virus infecting taro (Colocasia esculenta).
Aust. Plant Dis. Notes 6:30–32.
Talwana, H.A.L., Serem, A.K., Ndabikunze, B.K., Nandi, J.O.M., Tumuhimbise, R.,
Kaweesi, T., Chumo, E.C. and Palapala, V. (2009). Production status and
prospects of cocoyam (Colocasia esculenta (L.) Schott.) in East Africa. J. Root
Crops 35:98–107.
145
Wada, E., Asfaw, Z., Feyissa, T. and Tesfaye, K. (2017). Farmers perception of
agromorphological traits and uses of cocoyam (Xanthosoma sagittifolium (L.)
Schott) grown in Ethiopia. African J. Agri. Res. 12: 2681–2691.
Yang, I.C., Hafner, G.J., Revill, P., Dale, J. and Harding, R. (2003a). Sequence diversity
of South Pacific isolated of Taro bacilliform virus and the development of a PCR-
based diagnostics test. Arch. Virol. 148:1957–1968.