17
Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle ytogenetic abnormalities of diagnostic and prognostic importa ave been identified in some mature B cell neoplasms n Newcastle, a targeted FISH approach has been used for detec

Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of

Embed Size (px)

Citation preview

Page 1: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of

Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms

Chris Lowe, Newcastle

Cytogenetic abnormalities of diagnostic and prognostic importance have been identified in some mature B cell neoplasms

In Newcastle, a targeted FISH approach has been used for detection

Page 2: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of

FISH/morphology/phenotype strategy for CLL/MCL

Morphology

CLL CLL/MCL

Phenotype

CD5CD19FMC7-Weak sIg

CD5CD19FMC7+Strong sIg

CLL CLL/MCL

G-banding

Likely sub-type?

FISH

Abnormal Not abnormal

More FISH?

Rare or unexpected abnormalities to which FISH has not been directed

Page 3: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of

Low success and abnormality rate in mature B cell neoplasms

In CLL, this is due to leukaemic cell arrest in G0 or early G1 of the cell cycle

B cell mitogens: EBV, Pokeweed, Lipopolysaccharide, TNF alpha,SAC, TPA and CD40L stimulation

The trouble with G-banding…..

Page 4: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of

DSP30: single stranded, CpG unmethylated, phosphorothioate oligodeoxynucleotide

5’ TCGTCGCTGTCTCCGCTTCTTCTTGCC

CLL cells arrested in G0 or early G1; unable to apoptose

G1

M

S

G2 G0G1

M

S

G2 G0

Cell activation results in entryinto the cell cycle

DSP30 also induces the IL2 alpha receptor (possibly via CD25) in CLL cells thereby allowing IL2 to generate a co-stimulatory effect

Adapted from Liang et al, 2009

B cells, plasmacytoid DC cells

In CLL

Page 5: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of

Study Neoplasm No. of cases Success

Rate

Abnormality

Rate

Dicker et al

2006

CLL 132 95% 81%

Mayr et al 2006

CLL 14 ? ~90%

Haferlach et al 2007

CLL 504 99% 83%

Put et al

2009

CLL 217 ? 51%

Wren et al

2010

CLL 24 75% 29%

Hereema et al 2010

CLL 229 ? 64%

Struski et al

2009

CLL 76 95% 98%

Other mature B

cell

neoplasms

51 79% 76%

Summary of use of DSP30 / IL2 as a B cell mitogen for cytogenetic studies

The CpG oligonucleotide DSP30 and cytokine IL2 are established as highly effective in CLL

Page 6: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of

Unseparated samples of blood (12), marrow (17)

and lymph node (3)

Stimulated with DSP10 (2uM)and IL2 (200U/ml) for 72 hrs

Consumable cost ~£6 per culture

Unstimulated for 24 hr

Mature B cell neoplasm

CLL, MCL, WM, MM, NHL, HCL, lymphocytosis

Incidence ofabnormalities compared

Page 7: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of

Results

0 5 10 15 20 25 30 35

Abnormal: FISHalone detectable

Abnormal: Gbanding alone

detectable

Abnormal

Successful

Total

No. of cases

In an initial study (n=19) the abnormality rate was significantly different between stimulated and unstimulated cultures (p=0.033 in a paired t-test)

32

27

14

12

2

Eg. add(2q) del(14q) t(13;22;19) 6 x complex

3 cases of clinical significance

SR 85%

AR 52%

Page 8: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of

Case 175 year old man referred for atypical CLL

Without G-banding

IGH-CCND1 FISH Negative FISH/MLPA for abnormalities prognostic in CLL

With G-banding

43,XY,der(6;13),-9,add(12)(q24),der(14)t(6;14)(p21;q32),der(15)t(8;15),-17,der(17)t(11;17),-20,+mar

der(14)t(6;14)

Rare abnormality in mature B cell neoplasms including mantle cell lymphoma

Page 9: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of

t(6;14)(p21;q32) results in IGH-CCND3 rearrangement

Supported by FISH using BACs flanking IGH and CCND3

Confirmed IGH-CCND3 fusion positive using a commercial dual fusion probe

der(14)

ish der(14)t(6;14)(RP11-7K24+,RP11-47P23+)

DSP30/IL2 G-banding Clinically important abnormality identified

Page 10: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of

t(2;7)(p11;q22)

Rare abnormality in matureB cell neoplasms including

splenic marginal zone lymphoma

Cases 2 and 376 year old man and 77 year old woman both referred for lymphocytosis, ?MCL

Without G-banding

IGH-CCND1 FISH Negative Not IGH-CCND1 positive MCL

With G-banding

45~46,XY,t(2;7)(p11;q22),der(8;9)(q10;q10),del(13)(q12q14),add(17)(p13),+mar[cp11]/46,XY[1]

Page 11: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of

t(2;7) results in IGK-CDK6 rearrangement Supported by FISH using BACs flanking CDK6 and IGK

Involvement of IGK confirmed using an IGK break apart probe

der(2)

der(7)

ish t(2;7)(distal IGK+;proximal IGK+)

der(7)

der(2)

ish t(2;7)(RP11-998E13+,RP11-452G6+;RP11-344017+,RP11-160N14+)

Page 12: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of

Other advantages of G-banding

Metaphases may help in the evaluation of borderline positivity after interphase FISH

In high grade lymphoma it is important to exclude ‘dual hits’, necessitating a sequence of interphase FISH

G-banding: may be a more efficient means of establishing MYC +/- BCL2 and BCL6 rearrangements

may identify the partner chromosome

confirm the ‘hits’ are in the same cell (not possible with interphase FISH in the case of small clones)

Page 13: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of

0 5 10 15

Unstimulated only

Both stimulated andunstimulated

Stimulated only

Total abnormal cases

Abn

orm

aliti

es

in

No. of cases

14

9

3

2

Caveats

1.

Analyse stimulated and unstimulated cultures

2. Normal G banding; Abnormal FISH Still need FISH

Page 14: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of

Questions

Does DSP30/IL2 select for abnormal clones in general or for particular abnormalities?

Is DSP30 / IL2 applicable to all mature B cell neoplasms?

Is DSP30 / IL2 applicable to high grade lymphomas?

Page 15: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of

Possible strategy ?mature B cell neoplasm

Stimulated and unstimulated cell culture

Confirmed neoplastic cells in sample

Phenotype and morphology strongly suggestive of a sub-type with associated abnormality

FISH

Report / further FISH toexclude other abnormalities

G banding analysis

Yes

+ve

No

-ve

FISH with a largepanel of probes

Report +/-confirmatory FISH

abnormal normal / fail

Abnormalities sometimes restricted to unstimulated culturesMay be needed to establish unselected clone size

May be more time consuming than single G banding analysistherefore reserve this until G banding option exhausted

Page 16: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of

Conclusions

G-banding allows detection of rare abnormalities;some may be of clinical significance

The usefulness of incorporation of G-banding into a FISH/phenotype/morphology strategy is dependent upon the frequency of theseabnormalities

DSP30/IL2 is an effective, non-toxic and inexpensive adjunct to unstimulated cultures

Page 17: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of

Acknowledgements

Dicker et al, Immunostimulatory oligonucleotide induced metaphase cytogenetics detect chromosomal aberrations in 80% of CLL patients: a study of 132 CLL cases with correlation to FISH IgVH status and CD38 expression Blood (2006) 108(9) :3152-3160

Haferlach et al, Comprehensive genetic characterization of CLL: a study on 506 cases analysed with chromosome banding analysis, interphase FISH, IgVH status and immunophenotyping Leukemia (2007) 21, 2442–2451

Hereema et al, Stimulation of chronic lymphocytic leukemia cells with CpG oligodeoxynucleotide gives consistent karyotypic results among laboratories: a CLL Research Consortium (CRC) Study Cancer genetics and cytogenetics (2010) 203, 134-140

Liang et al, Toll-like receptor 9 signaling by CpG-B olidodeoxynucleotides induces an apoptotic pathway in human chronic lymphocytic leukemia B cells Blood (2010) 115(24), 5041-5052

Mayr et al, Chromosomal translocations are associated with a poor prognosis in chronic lymphocytic leukemia Blood (2006) 107:742-751

Put et al, Improved detection of chromosomal abnormalities in chronic lymphocytic leukemia by conventional cytogenetics using CpG oligonucleotide and interleukin -2 stimulation: A Belgian multicentric study Genes, Chromosomes and Cancer (2009) 48, 843-853

Struski et al, Stimulation of B-cell lymphoproliferations with CpG-oligonucleotide DSP30 plus IL-2 is more effective than with TPA to detect clonal abnormalities Leukemia (2009) 23, 617–619

The Centre for Applied Genomics, Toronto (BACs)

Charlotte Morris

Gavin Cuthbert

Nick Bown

and the Cancer Section of the Newcastle Cytogenetics Laboratory

[email protected]

References