Type IV Pilus Biogenesis, Twitching Motility, and DNA Uptake inThermus thermophilus: Discrete Roles of Antagonistic ATPases PilF,PilT1, and PilT2

Ralf Salzer,a Friederike Joos,b Beate Averhoffa

‹Molecular Microbiology & Bioenergetics, Institute of Molecular Biosciences, Goethe University Frankfurt, Frankfurt am Main, Germanya; Department of Structural Biology,Max Planck Institute of Biophysics, Frankfurt am Main, Germanyb

Natural transformation has a large impact on lateral gene flow and has contributed significantly to the ecological diversificationand adaptation of bacterial species. Thermus thermophilus HB27 has emerged as the leading model organism for studies of DNAtransporters in thermophilic bacteria. Recently, we identified a zinc-binding polymerization nucleoside triphosphatase(NTPase), PilF, which is essential for the transport of DNA through the outer membrane. Here, we present genetic evidence thatPilF is also essential for the biogenesis of pili. One of the most challenging questions was whether T. thermophilus has any depo-lymerization NTPase acting as a counterplayer of PilF. We identified two depolymerization NTPases, PilT1 (TTC1621) and PilT2(TTC1415), both of which are required for type IV pilus (T4P)-mediated twitching motility and adhesion but dispensable fornatural transformation. This suggests that T4P dynamics are not required for natural transformation. The latter finding is con-sistent with our suggestion that in T. thermophilus, T4P and natural transformation are linked but distinct systems.

DNA transport machineries of natural transformation systemsare related to type IV pili (T4P) and type II protein secretion

systems (T2SSs) and sometimes even share components (1–5).The components of natural transformation systems in Gram-neg-ative bacteria are hypothesized to form distinct subcomplexes: aDNA translocator rod comprising pilin-like subunits that extendsfrom the cytoplasmic membrane through the periplasm and theouter membrane; a shaft, made up of multiple copies of the secre-tin protein, that guides the rod through the outer membrane; acytoplasmic motor complex that powers assembly of the rod; anda DNA translocator subcomplex mediating the transport of theDNA through the cytoplasmic membrane (3, 6–9).

The finding that DNA translocators and T4P share compo-nents led to the following two hypotheses: one explanation for thedual function of components in both systems is that DNA isbound to the T4P and retraction of the dynamic T4P leads to thetransport of DNA across the outer membrane. However, severalfindings are not consistent with this hypothesis, such as the factthat the expression of pilus and natural transformation do notalways correlate (10–12). A second hypothesis is that the transfor-mation machinery represents an alternative system: DNA binds tothe tip of a pilus-like DNA translocator rod. Then, the transloca-tor, guided through a secretin pore through the outer membrane,retracts, thus transporting DNA into the periplasm, where it isbound by DNA binding proteins and subsequently transferred toan inner membrane DNA transporter subcomplex (3).

To elucidate structural and functional aspects of DNA trans-porters, we have chosen the natural transformation system of thethermophilic bacterium Thermus thermophilus, which exhibits thehighest natural transformation frequencies known to date (13,14). A genetic screen led to the identification of 16 competencegenes essential for natural transformation of T. thermophilus (3).Some of them, such as the secretin PilQ, the pilin PilA4, and theinner and outer membrane proteins PilM, PilN, PilO, and PilW,were found to play a dual role in piliation and transformation,whereas others, such as the traffic nucleoside triphosphatase

(NTPase) PilF and the pilins PilA1 to PilA3, were found to beessential only for natural transformation (15, 16).

Extension and retraction of pili and the pilus-like DNA trans-locator rods obviously require energy, which is supplied by ATPhydrolysis and catalyzed by traffic NTPases belonging to the PilF/PilB (pilus extension/assembly) and PilT/PilU (pilus retraction)subfamilies (17, 18). Members of these two subfamilies are knownto power T4P and/or DNA translocators in many different Gram-negative bacteria, such as Pseudomonas aeruginosa, Neisseria men-ingitidis, Neisseria gonorrhoeae, Myxococcus xanthus, Francisellatularensis, and Pseudomonas stutzeri (19–28). Despite their broaddistribution in T4P and DNA transporter systems, analysis of theirstructure and function is still in its infancy.

In T. thermophilus, so far only one traffic ATPase, PilF, wasidentified to be essential for natural transformation (29). PilF issimilar to traffic NTPases of the PilF/PilB subfamily, which cata-lyze pilus extension (17, 21, 30–33). However, PilF differs from allother members of this subfamily by its bipartite structure with anunusually long N terminus comprising three GSPII domains (Fig.1A). The N termini of traffic ATPases are suggested to mediatestable interactions with other proteins of T4P (34, 35), whereas theC termini harbor the ATP-binding sites and a conserved tetracys-teine motif (33, 36, 37). The latter was found to be essential forZn2� binding of PilF (33, 36).

Interestingly, a pilF insertion mutant was unaffected in pilia-tion but lost its transformation phenotype (29). This finding waspuzzling, since members of the PilF/PilB subfamily often exhibit adual function in both natural transformation and piliation (2) and

Received 26 September 2013 Accepted 6 November 2013

Published ahead of print 8 November 2013

Address correspondence to Beate Averhoff, averhoff@bio.uni-frankfurt.de.

Copyright © 2014, American Society for Microbiology. All Rights Reserved.

doi:10.1128/AEM.03218-13

644 aem.asm.org Applied and Environmental Microbiology p. 644 – 652 January 2014 Volume 80 Number 2

on October 28, 2020 by guest

http://aem.asm

.org/D

ownloaded from

are thought to power T4P rod extension and polymerization of theDNA translocator shaft.

The objective of this study was to investigate the role of thecompetence protein PilF in T4P biogenesis and function and tosearch for potential depolymerization NTPases acting as counter-players of the polymerization ATPase PilF. We discovered thatfull-length PilF is essential for T4P biogenesis. Two depolymeriza-tion ATPases, PilT1 (TTC1621) and PilT2 (TTC1415), were iden-tified to be essential for T4P-mediated twitching motility and ad-hesion. Together with the hyperpiliation phenotype of pilT1 andpilT2 mutants, this provides evidence that PilT1 and PilT2, essen-tial for T4P dynamics, are the counterplayers of PilF. Interestingly,the pilT mutants and the pilT double mutants had no defect intransformation, indicating that T4P depolymerization is not re-quired for natural transformation.

MATERIALS AND METHODSOrganisms and cultivation. Escherichia coli cells were grown under stan-dard conditions at 37°C in LB complex medium. Antibiotics were addedwhen appropriate (100 �g/ml hygromycin B and/or 100 �g/ml ampicil-lin). T. thermophilus HB27 was grown at 68°C on TM� complex medium(containing 8 g/liter tryptone, 4 g/liter yeast extract, 3 g/liter NaCl, 0.6mM MgCl2, and 0.17 mM CaCl2) or at 60°C when hygromycin was added.Antibiotics were added when appropriate (bleomycin at 5 �g/ml or 15�g/ml, hygromycin at 100 �g/ml, or kanamycin at 20 �g/ml or 40 �g/ml)in liquid and solid medium.

Generation of a �TTC1415 (pilT2)::hygro deletion mutant. For theconstruction of a �TTC1415::hygro mutant, the 723-bp upstream region andthe 806-bp downstream region of TTC1415 were amplified using the primerspanto_for1_EcoRI (GGATTAGAATTCCTTCGTGGTGGTCTCCGTCTTCGTCAAC), panto_rev1_XbaI (ATTATCTAGACTCATGGGTAGACCTCCAGGTTGTCTATAAG), fructo_for1_PstI (TAATCTGCAGCGCCCTTTCCCTTGCCCGCCTGGCCC), and fructo_rev1_HindIII (ATTGAAGCTTGGCCCGGAAGCGCTCCACGAGCTCTTG). The hygromycin cassette wasamplified from the vector pH118 (38) using the primers Hyg_XbaI (AGCCGGAGTCTAGACCCGGGAGTATAAC) and Hyg_rev2_PstI (AGGCGGCTGCAGACGTTCAAAATGGTATGCGTTTTGACAC). The DNA fragmentswere cloned into the vector pUC19, resulting in pUC19-�TTC1415_Hyg. Togenerate a �TTC1415 mutant, pUC19-�TTC1415_Hyg was linearized withPciI and transformed into T. thermophilus HB27. Transformants were se-lected at 60°C on TM� medium with 100 �g hygromycin/ml. The mu-tants were verified by PCR, using the primers U_1415_for1 (TAGCTTC

TCCTGCCGCTTCTTCTTGCCCAC) and U_1415_rev1 (ATGGCCTGGGTGAACTCCATGTTGTTGGTG).

Generation of a �pilF::bleo deletion mutant. To construct a �pilF::bleo deletion mutant, the 685-bp upstream region of pilF was amplified fromgenomic DNA using the primers Put_for1 (EcoRI) (ATACGAATTCTAGGGAGGAGCGGATCTAC) and Put_rev1 (AAGCATAAGCGGCCGCAAATTTAAACCATGGTCATCTCGTCACACCC) and the 545-bp downstreamregion was amplified using the primers PilT_for1 (PstI) (AATACTGCAGAGGAGGAAAGCGATGCCCAAAG) and PilT_rev (HindIII) (CCGTAAGCTTCTTGTGGAAGAACTCTATGGG). The bleomycin cassette was amplifiedfrom the vector pWUR112 (39) using the primers Bleo-for-EcoRV (AGATATCGGCGGCGCAGGCCTTCCTGG) and Bleo-rev-PstI (AAACTGCAGCTTCCGGCTCGTATGTTGTGTGG). The three fragments were digested withthe corresponding restriction enzymes and inserted into the vector pUC19,resulting in pUC19_putative_Bleo_pilT. The vector was linearized usingHindIII and transformed into T. thermophilus HB27. Transformants wereselected on TM� medium with 15 �g bleomycin/ml. The deletion mutantwas verified by PCR analysis with the primers DeltaF_for2 (GGGCGTGCTACCAGGTGGGCGAGGAGGTGGTG) and DeltaF_rev2 (CGGCGGCGATGGTCTCGTAGTCCCGCATCTCCC), binding 785 bp upstreamand 664 bp downstream of pilF, respectively.

Generation of a TTC1621::kat (pilT1) �TTC1415::hygro (pilT2)double mutant. To generate a pilT1 pilT2 double mutant, the pilT1 mu-tant (33) was transformed with linearized (PciI) plasmid pUC19-�TTC1415_Hyg. Transformants were selected at 60°C on TM� mediumwith 100 �g hygromycin and 40 �g kanamycin per ml. The mutants wereverified by PCR, using the primers U_1415_for1 (TAGCTTCTCCTGCCGCTTCTTCTTGCCCAC) and U_1415_rev1 (ATGGCCTGGGTGAACTCCATGTTGTTGGTG).

Complementation of the �pilF::bleo mutant with pilF. The pilF genewas amplified from the T. thermophilus HB27 genome using the primerspilF_pDM12_for1 (ATTACATATGCACCATCATCACCACCATCATAGCGTGCTCACCATAGGGGACAAAAGG) and pilF_rev (ACTTAGATGCGGCCGCTTACTCAATGGTACGCGCCAG), which contain NdeIand NotI restriction sites, respectively. The resulting 2,714-bp DNA frag-ment was restricted with NdeI and NotI and inserted into the E. coli/Thermus shuttle vector pDM12, which carried a bc1 promoter from T.thermophilus. Electroporation of the �pilF mutant led to the �pilF::bleo(pilF) mutant strain.

Electroporation. Exponentially grown Thermus cells were harvestedand washed 2 times with 10% glycerol. One hundred-microliter stockswere incubated for 5 min with DNA and then electroporated. A voltageof 12.5 V and a pulse length of 5 ms were used. The cells were regen-

FIG 1 (A) Domain organization and kanamycin cassette insertion site in PilF; (B) organization of the pilF wild-type (wt) and mutant loci.

Roles of NTPases in Piliation and Transformation

January 2014 Volume 80 Number 2 aem.asm.org 645

on October 28, 2020 by guest

http://aem.asm

.org/D

ownloaded from

erated at 68°C in prewarmed TM� medium for 2 h and then plated.Electroporation of T. thermophilus was performed as described by deGrado et al. (40).

Western blot analyses. Western blot analyses were performed as de-scribed by Rose et al. (33). Polyclonal PilF rabbit antibodies were used at adilution of 1:7,500.

Sub-agar-surface adhesion studies. Sub-agar-surface adhesion stud-ies were performed on minimal medium containing 1% bovine serumalbumin (BSA) and 0.01% yeast extract (41). Plates were incubated at64°C under humid conditions in a plastic bag for 3 days. Cells were stabinoculated through the solid medium down to the petri dish. To visualizeadhering cells, the solid medium was removed. Cells were stained withCoomassie blue. The petri dish bottom was washed 4 times for 30 mineach time with 10 ml 25 mM Tris HCl and 100 mM NaCl. Adhering cellsretained the blue color.

Twitching motility studies. Cells were grown on BSA containingminimal medium. The agar was stained with Coomassie blue (42), andafter removal of the solution, the agar was washed for 1 min with 10 mlwater. Then, the cells were detached from the agar surface by suspendingthem in 10 ml of water. After decantation of the cell suspension, a colorlessregion which corresponded to the attachment zones of the cells was visi-ble. This zone was defined as the twitching zone, which was visible as adark zone due to the inversion of the picture.

Electron microscopy. Electron microscopy was performed to analyzethe piliation phenotype of Thermus cells. The cells were transferred to acopper grid (400 mesh). The cells were shadowed with a pressure of 3 �10�5 to 4 � 10�5 Pa at 28°C and at a unidirectional angle of 25°, and a1.5-nm thickness of platinum-carbon was used, as reported recently (11).

Transformation studies. Transformation studies were performed onTM� agar medium using 5 �g of genomic DNA of a spontaneously strep-tomycin-resistant HB27 mutant (15). The transformation frequencieswere calculated as the number of transformants per the number of livecells (i.e., the living count). All transformation assays were performed intriplicate.

RT-PCR. Briefly, for reverse transcription-PCR (RT-PCR), total Ther-mus RNA was isolated from cells harvested in the exponential growthphase by use of a NucleoSpin RNA cleanup kit and treated with RQ1RNase-free DNase (Promega, Mannheim, Germany) to remove genomicDNA. The final RNA preparation was used to generate cDNA. This cDNAwas used as the template in a PCR using primers (listed in Table 1) thatbridge the intergenic regions. DNA and RNA were used as controls.

RESULTSGeneration of a pilF deletion mutant. In a previously character-ized pilF insertion mutant, a kanamycin cassette was inserted closeto the HincII restriction site near the 5=end encoding the thirdGSPII domain of pilF (29). This mutant lost its transformationphenotype but was unaffected in piliation. Since the possibility ofthe production of a C-terminal domain of PilF in this mutant thatwas still able to function in piliation could not be excluded, a �pilFdeletion mutant was generated by marker exchange mutagenesis

using a bleomycin cassette. Transformants which had acquiredthe bleomycin cassette by allelic replacement of the pilF gene(Fig. 1B) were selected on TM� medium containing bleomycin.The genotype of the �pilF mutant was analyzed by PCR. Wild-type cells and the pilF::kat insertion mutant carrying a kanamycincassette in the HincII site (Fig. 1A) were used as controls. A �4-kbfragment was obtained with wild-type DNA, a �5-kb fragmentwas obtained with the DNA from the pilF::kat insertion mutant,and a �2.3-kb fragment was obtained with DNA from the �pilFmutant; these correspond to the calculated sizes of 4.0 kb for thewild type, 5.3 kb for the pilF::kat mutant, and 2.2 kb for the �pilFmutant. These data demonstrate a single insertion of the bleomy-cin cassette into the target locus by a double recombination event,thereby leading to a deletion of the pilF gene.

pilF is essential for both natural transformation and pilia-tion. The �pilF mutant was found to be completely impaired innatural transformation (�108 transformants per living count).This corresponds to our former results that showed that the pilF::kat insertion mutant was completely defective in natural transfor-mation and confirms that PilF is essential (29, 41). Next, we ana-lyzed the piliation phenotype of the �pilF mutant by electronmicroscopy. T. thermophilus wild-type cells and the pilF::kat mu-tant were used as controls. The piliation phenotypes of both con-trol strains were comparable. Sixty-eight percent of the pilF::katmutant cells (Fig. 2C) and 78% of the wild-type cells exhibited6.5 � 5.5 pili at one of the cell poles (Fig. 2A). In contrast, the�pilF deletion mutant did not exhibit any pilus structures at all(Fig. 2B).

To exclude the polar effects of the bleomycin marker in the�pilF mutant, complementation studies were performed withpDM12-pilF. Electroporation of the �pilF deletion mutant withthis plasmid gave rise to mutants which had transformation fre-quencies indistinguishable from those of the wild-type strain(2.8 � 10�3) (Fig. 3).

PilF is essential for T4P-mediated twitching motility and ad-hesion. Recently, we showed that T. thermophilus pili are essentialfor twitching motility and adhesion (11). The finding that thepilF::kat mutant still exhibited wild-type piliation led to the ques-tion of whether the pili of the pilF::kat mutant are still functionalwith respect to twitching motility and adhesion. Therefore, thetwitching phenotype of the pilF::kat mutant was analyzed using anassay in which we inoculated cells on an agar surface. The HB27wild type and the nonpiliated �pilF mutant were used as controls.Cells exhibiting twitching motility moved away from the inocula-tion point, forming a spreading zone. To document the spreadingzones, plates were flushed with Coomassie blue, which led tostaining of the agar but not the spreading zone. Cells were then

TABLE 1 Primers used in this study

Primer Sequence Usea

Hypo_1 GCTGAAGGAAGAGCCTGGCCTCCTCGG TTC1624 and TTC1623PGP_1 GGAGCTTCCAGCATGCGTATGAAACGGGTGPGP_3 CCGAGCGCTTCGCCCGCGTGCAGCGCCTCC TTC1623 and pilF (TTC1622)PilF_5=_rev2 CGGGAAGGCCGAGCTCCGGGTAGTGTTTGGPilF_3=_for1 GGGACTCCGAGACGGCCAAGATCGCCACC pilF (TTC1622) and pilT1 (TTC1621)PilT_1 GGTCCTCAATGGTGACGATGTGGCAGGCCTTGCGTTCPilT_2 CCATAGACCGCATCGTGGACGTCTTCCC pilT1 (TTC1621) and TTC1620Gluta_1 GCTGAAGGAAGAGCCTGGCCTCCTCGGa Use as a bridge between the indicated two genes.

Salzer et al.

646 aem.asm.org Applied and Environmental Microbiology

on October 28, 2020 by guest

http://aem.asm

.org/D

ownloaded from

removed, resulting in a clear zone that was documented by pho-tography, and then the pictures were inverted. Wild-type cellsformed large, uniform motility zones of 1 to 2 cm in diameter after3 days at 64°C (Fig. 4A). In contrast, the nonpiliated �pilF deletionmutant (Fig. 4C) was completely defective in twitching motility.Interestingly, the same was observed for the pilF::kat insertionmutant (Fig. 4B). This led to the conclusion that PilF is essentialfor pilus-mediated twitching motility and that T4P dynamics areimpaired in the pilF::kat mutant. This suggests that the truncatedPilF protein in the pilF::kat mutant is still sufficient for piliationbut not for the pilus dynamics essential for twitching motility.

Next, we examined the role of PilF in adhesion by a sub-agar-adhesion assay, based on growth of the cells at the interphasebetween the solid medium and the bottom of the petri dish. Wild-type cells adhered to the petri dish (Fig. 5A). In contrast, both thenonpiliated �pilF mutant and the piliated pilF::kat mutant werecompletely defective in adhesion (Fig. 5B and C). This corrobo-rates our previous finding that full-length PilF is essential for pilusfunction.

pilF and TTC1621 form a transcriptional unit. So far, a roddepolymerization traffic NTPase, a counterplayer of PilF, has not

been identified in T. thermophilus. Inspection of the genome led tothe identification of two PilT-like traffic NTPase genes, TTC1415and TTC1621, but neither of them was found to be essential forpilus biogenesis and natural transformation (29, 33). However,one of the two genes, TTC1621, flanked pilF downstream, whichindicated a functional relationship of the two genes. The openreading frame upstream of pilF, TTC1623, encodes a protein with62% similarity to a haloacid dehalogenase, whereas the open read-ing frame downstream of TTC1621, TTC1620, encodes a proteinwith 72% similarity to an aspartyl/glutamyl-tRNA amidotrans-ferase (Fig. 6A). Therefore, the open reading frames upstream ofpilF and downstream of TTC1621 are apparently not in a func-tional relationship with pilF and TTC1621. To analyze the tran-scriptional organization of the pilF locus, mRNA was isolatedfrom T. thermophilus cells and transcribed into cDNA. This cDNAwas then used as a template in a PCR using primers that bridge theintergenic regions between TTC1623 and pilF, pilF and TTC1621,and TTC1621 and TTC1620. No PCR product was obtained withprimers for TTC1623 and pilF and primers for TTC1621 andTTC1620, indicating that these genes are not cotranscribed. Incontrast, a 611-bp DNA fragment was generated when primers forpilF and TTC1621 were used, indicating that pilF and TTC1621form a transcriptional unit (Fig. 6B).

TTC1621 encodes a motor ATPase essential for twitchingmotility and adhesion but dispensable for natural transforma-tion. TTC1621 encodes a 39.9-kDa protein which is closely relatedto members of the T4P retraction ATPase, PilT/PilU. TTC1621 is54, 53, and 50% identical to PilT proteins from P. aeruginosa, P.stutzeri, and gonococci, respectively. Therefore, TTC1621 wasdesignated PilT1. PilT proteins from P. stutzeri and gonococci areessential for both twitching motility and natural transformation,whereas PilT from P. aeruginosa is implicated only in twitchingmotility, since P. aeruginosa is not able to take up free DNA (43–45). Unlike P. stutzeri and gonococcal mutants, the piliated T.thermophilus pilT1 mutants were unaffected in natural transfor-mation (2 � 10�3; see Fig. 8) (33). To address the challengingquestion of whether PilT1 plays a role in pilus retraction, 250 pilT1mutant cells were analyzed by electron microscopy. A total of99.7% of the mutant cells were piliated, whereas only 78% of thewild-type cells were piliated. A total of 22.5 � 12.5 pili were de-tected on the surface of the pilT1 mutant and were assembled in aunipolar pattern (Fig. 7B), whereas the wild-type strain maximally

FIG 2 Electron micrographs of a representative sample of the T. thermophilus HB27 wild type (A), the �pilF deletion mutant (B), and the pilF::kat insertionmutant (C). Electron microscopic investigations were conducted by shadowing the cells with platinum-carbon. A total of 250 to 300 cells of each strain wereanalyzed. Bars 500 nm.

FIG 3 Natural competence of T. thermophilus HB27 and the complemented�pilF::bleo (pilF) mutant.

Roles of NTPases in Piliation and Transformation

January 2014 Volume 80 Number 2 aem.asm.org 647

on October 28, 2020 by guest

http://aem.asm

.org/D

ownloaded from

exhibited 13 pilus structures (Fig. 7A). Seventeen percent of thepilT1 mutant cells exhibited less than 10 pili. This finding indicatesa hyperpiliation phenotype of the pilT1 mutant and suggests thatPilT1 is essential for T4P depolymerization.

To elucidate the role of PilT1 in pilus functions, the twitchingmotility and adhesion phenotype of pilT1 mutants were analyzedas described above. These experiments revealed that the pilT1 mu-tant was defective in both twitching motility and adhesion to petridishes (data not shown). The finding that the cells were defectivein adhesion, despite their hyperpiliation, might be due to thetwitching defect, leading to rigid pilus structures and, therefore,reduced interactions of the cells with the petri dish. Taken to-gether, these data suggest that PilT1 is required for T4P-mediatedtwitching motility and adhesion and is indeed the counterplayerof the T4P extension NTPase PilF. Moreover, the wild-type trans-formation phenotype of the twitching-defective pilT1 mutant sug-gests that pilus dynamics are not required for natural transformation.

TTC1415 is also required for pilus functions but dispensablefor natural transformation. A second PilT-like traffic NTPasegene, TTC1415, not associated with the pilF locus, is present in theT. thermophilus genome (29). The deduced protein is 46% iden-tical to PilT2 from N. gonorrhoeae (46). Therefore, TTC1415 wasdesignated PilT2. To analyze the role of pilT2 in piliation, a�TTC1415::hygro deletion mutant was generated by marker ex-change mutagenesis. Mutant studies revealed that the pilT2 dele-tion mutant was unaffected in natural transformation (2.5 � 10�3

transformants per living count; Fig. 8). Electron microscopicstudies of the pilT2 mutant revealed that the mutant exhibited ahyperpiliated phenotype (Fig. 7C). A total of 99.2% of the cellswere piliated, whereas only 78% of the wild-type cells were pili-ated. A total of 28.5 � 18.5 pili were detected on the surface of thepilT1 mutant and were assembled in a unipolar pattern (Fig. 7C).These experiments demonstrate that PilT2 is essential for T4Pdepolymerization.

To elucidate the role of PilT2 in pilus functions, the twitchingmotility and adhesion phenotype of the pilT2 mutant were ana-lyzed. These studies revealed that the mutant was defective in bothtwitching motility and adhesion to petri dishes (data not shown).These data demonstrate that PilT2 is required for T4P-mediatedtwitching motility and adhesion and that PilT2 is indeed a coun-terplayer of the T4P extension NTPase PilF. Moreover, the wild-type transformation phenotype of the twitching-defective pilT2mutant (Fig. 8) is consistent with our conclusion that pilus dy-namics are not required for natural transformation.

To provide clear evidence that both PilT1 and PilT2 are notessential for natural competence, complementation of the pilT1 orthe pilT2 defect by the wild-type pilT2 gene and pilT1 gene, respec-tively, had to be excluded. Therefore, a pilT1 pilT2 double mutantwas generated and analyzed with respect to natural transforma-tion. The pilT1 pilT2 double mutant exhibited a wild-type trans-formation frequency of 2.2 � 10�3 (Fig. 8). This provides clear

FIG 4 Twitching motility of cells of the T. thermophilus HB27 wild type (A), the pilF::kat insertion mutant (B), and the �pilF deletion mutant (C). The cells wereinoculated on minimal medium containing 1% BSA and cultivated for 72 h at 64°C under a water-saturated atmosphere. Agar and cells were stained withCoomassie blue. The cells and the Coomassie dye were removed, and the twitching zone corresponding to the noncolored agar region was determined. Thepictures were inverted. Experiments were done in triplicate and gave identical results. Bars 0.5 cm.

FIG 5 Adhesion of cells of the T. thermophilus wild type (A), the pilF::kat insertion mutant (B), and the �pilF deletion mutant (C). Cells were stab inoculatedthrough the solid medium down to the petri dish and cultivated on minimal medium containing 1% BSA for 72 h at 64°C. After removal of the agar, the petri dishwas washed four times and adhering cells were stained with Coomassie blue. Experiments were done in triplicate and gave identical results. Bars 0.5 cm.

Salzer et al.

648 aem.asm.org Applied and Environmental Microbiology

on October 28, 2020 by guest

http://aem.asm

.org/D

ownloaded from

evidence that neither PilT1 nor PilT2 is essential for natural com-petence in T. thermophilus.

DISCUSSION

The pilF deletion mutant generated in this study has a pheno-type that is quite different from the phenotype of the insertionmutant described before (29). The difference in phenotype be-tween the �pilF deletion mutant and the pilF::kat insertionmutant may be caused by the presence of the N-terminal trun-cated PilF in the insertion mutant, which is supported by thedetection of a truncated PilF protein by Western blotting anal-yses (data not shown). This, together with the finding that theinsertion mutant is active in piliation but defective in twitchingmotility and adhesion, argues for a domain structure of PilF

with different domains having different functions. Recently,Collins et al. (47) determined the structure of PilF by cryoelec-tron microscopy. It consists of two distinct N-terminal andC-terminal domains forming a disk and a ring structure. Thetwo domains are connected by a short stem-like structure.Upon binding of the ATP analogue adenosine 5=-(,�-imido)triphosphate (AMP-PNP), the C-terminal ring domain under-goes structural changes which are transmitted to the N-termi-nal disk-like structure via the connecting stem (47). It wassuggested that this structural change confers a piston-likemechanism, which would trigger assembly of pilus structures.

The pilF insertion mutant was completely impaired in twitch-ing motility, despite the presence of pilus structures. How can thisbe explained? The ATP binding site and the Asp and His boxes of

FIG 6 Transcriptional organization of the pilF locus. To examine the transcriptional organization, RNA was isolated and subjected to RT-PCR analyses. (A) Theprimers and expected fragments are indicated and labeled 1 to 4. RNA was used as a negative control; chromosomal DNA was used as a positive control. (B) Theresulting DNA fragments were separated on a 0.8% agarose gel. Lanes 1, chromosomal DNA from T. thermophilus; lanes 2, cDNA from T. thermophilus HB27;lanes 3, cDNA from T. thermophilus pilF::kat; lanes 4, RNA control.

FIG 7 Piliation of T. thermophilus and hyperpiliation of the pilT1 and pilT2 mutants. Electron microscopic investigations were conducted by shadowing the cellswith platinum-carbon. A total of 250 to 300 cells were analyzed, and the results for one representative sample of cells of the wild type (A), the pilT1 mutant (B),and the pilT2 mutant (C) are shown. Bars 500 nm.

Roles of NTPases in Piliation and Transformation

January 2014 Volume 80 Number 2 aem.asm.org 649

on October 28, 2020 by guest

http://aem.asm

.org/D

ownloaded from

motor ATPases, which are absolutely essential for T4P biogenesisand function (21, 32, 48), are still present in the C-terminal do-main of PilF. However, it is known that despite energization byATP hydrolysis, energy is transmitted via the N-terminal domainto N-terminal cytoplasmic domains of cytoplasmic membraneproteins. For example, the N terminus of XpsE of Xanthomonascampestris is essential for interaction with the cytoplasmic domainof XpsL (34). Analogously, a direct interaction between the Nterminus of the secretion ATPase OutE from Erwinia chrysan-themi with the cytoplasmic domain of OutL (49) and the N termi-nus of EpsE with the cytoplasmic domain of EpsL was found (35).Analyses of the functional role of the proteins interacting with theN termini of secretion ATPases suggest that these interactionsstimulate the ATPase activity of the secretion ATPases (50–53)and target the ATPases to the membrane. The absence of twitchingmotility of the PilF insertion mutants is consistent with these find-ings, since the absence of the N terminus in the truncated PilFprotein might result in the loss of PilF-mediated pilus dynamicsdue to abrogation of membrane targeting. This might lead to anuncoupling of the PilF ATPase activity from pilus dynamics. Thisis supported by the finding that an XpsE (R286A) mutant exhibitsincreased ATPase activities but is nonfunctional in protein secre-tion via the T2SS (50).

One of the most challenging questions was whether T. thermo-philus HB27 T4P dynamics and DNA translocation require depo-lymerization ATPases. Here we demonstrate that the two trafficNTPases, PilT1 and PilT2, are essential for T4P-mediated twitch-ing motility and adhesion but dispensable for natural transforma-tion. The finding that pilT1 and pilT2 mutants are hyperpiliated isconsistent with the hyperpiliation phenotype of Synechocystis sp.strain PCC 6803 pilT mutants (54, 55), P. stutzeri pilT mutants(43), and P. aeruginosa pilT and pilU mutants (26, 45). Therefore,we conclude that the two traffic NTPases, PilT1 and PilT2, areT4P depolymerization ATPases acting as counterplayers of theT4P polymerization ATPase PilF, thereby mediating retractionof T4P.

The finding that PilT1 and PilT2 both display a crucial role inT4P dynamics but are not essential for the T4P-linked naturaltransformation system is rather unique. In contrast, pilT mutantsof N. gonorrhoeae and P. stutzeri were defective in both twitchingmotility and natural transformation (43, 44). However, it must benoted that expression of a pilin where the C-terminal amino acids

were replaced by a His tag in a P. stutzeri pilT mutant restorednatural transformation (43). This led to the hypothesis that pilinsubunits or rudimentary pilus-like complexes might mimic depo-lymerized pilus structures. These complexes were suggested tointeract with the outer membrane pores, leading to their confor-mational change and subsequent DNA uptake (43). This sugges-tion is also supported by the finding that a low level of expressionof pilus structures in N. gonorrhoeae still leads to high naturaltransformation frequencies (10, 56).

A linkage of natural transformation systems and T4P has beenobserved in many Gram-negative bacteria (2, 3, 57, 58). It hasbeen shown that the dynamics of T4P structures and DNA trans-location require two types of traffic NTPases, polymerization anddepolymerization ATPases. Our findings that PilT1 and PilT2 areboth T4P depolymerization ATPases and that they are the onlyATPases of the PilT subfamily present in T. thermophilus but dis-pensable for natural transformation lead to the conclusion thatretraction of T4P is not required for DNA uptake. This suggeststhat the T. thermophilus DNA translocator is linked to T4P but is adistinct system. This is also supported by our recent finding that apilQ mutant had a defect in piliation and pilus functions but hadonly a minor change in natural transformation (11). Moreover,the transformability of the pilT1 and pilT2 mutants indicates thateither depolymerization of the DNA translocator is not requiredfor DNA uptake or PilF can display both activities, polymerizationand depolymerization of the DNA translocator. These importantquestions will be the subject of further investigations.

In summary, the results of the present study provide compel-ling evidence that PilF plays an essential dual role in T4P poly-merization and natural transformation. T4P dynamics are not re-quired for DNA translocation in T. thermophilus, supporting oursuggestion that T4P and the DNA translocator are distinct sys-tems. The DNA translocator rod is suggested to extend fromthe inner membrane into the staggered ring structures of the se-cretin complex, where it might serve as a placeholder for the in-coming DNA. This DNA translocator rod comprises the pilin-likesubunits PilA1, PilA2, PilA3, and PilA4. The pilin-like proteinsPilA1, PilA2, and PilA3 are highly specific for the DNA transloca-tor and are not involved in T4P (59). This also supports the con-clusion that T4P and the DNA translocator are distinct systemssharing components such as PilM, PilN, PilO, PilW, PilC, the pilinPilA4, the prepilin peptidase PilD, the motor ATPase PilF, and thesecretin PilQ (3). As shown recently, the pilus structures are notessential for natural transformation (11). This, together with theabsence of alternate secretins in T. thermophilus, suggests thatsome of the PilQ complexes guide the pili, whereas others guidethe pilus-independent DNA transporter rods through the outermembrane and the periplasmic space.

Recently, it was found in Vibrio cholerae that the cells mostlycontain a single pilus which colocalizes with the secretin PilQ butthat PilQ forms several foci occasionally colocalized with the dy-namic motor ATPase PilB (60). Analogously to the dynamic mo-tor ATPase PilB in V. cholerae, PilF in T. thermophilus might bedynamic, thereby occasionally interacting with the PilQ com-plexes of T4P or the PilQ complexes guiding the DNA translocatorrod. The interaction of the pilus-like rod with one of the ringstructures of the PilQ complex might affect its conformation,thereby triggering the opening of the central channel of the com-plex. This would allow the binding of DNA at the cavity of thesecretin pore. Then, the DNA might be pulled in a single step

FIG 8 Transformation frequencies of T. thermophilus HB27, the pilT1::kat(TTC1621) and �pilT2::hygro (TTC1415) mutants, and the pilT1 pilT2 doublemutant.

Salzer et al.

650 aem.asm.org Applied and Environmental Microbiology

on October 28, 2020 by guest

http://aem.asm

.org/D

ownloaded from

across the outer membrane and the periplasmic space through thesecretin channel by the action of ComEA (15). ComEA mightexert force on the bound DNA, thereby pulling the DNA throughthe secretin channel spanning the outer membrane and theperiplasmic space (7). This is also supported by the finding that aT. thermophilus ComEA mutant exhibits a more than 50-fold in-crease in DNase-sensitive DNA bound to the cell surface (41).Taken together, the absence of a retraction ATPase in the naturaltransformation system and the dramatic effect of a comEA muta-tion on DNA import argue against pilus detraction/retractionpulling the DNA through to the outer membrane. Certainly, morestudies are required to elucidate the mechanisms of DNA trans-port through the distinct barriers of the T. thermophilus cell pe-riphery and to clarify the role of the motor ATPase PilF in DNAuptake.

ACKNOWLEDGMENTS

This study was supported by a grant from the Deutsche Forschungsge-meinschaft (AV 9/6-1).

Furthermore, we thank Bernd Ludwig for providing plasmid pDM12.

REFERENCES1. Chen I, Dubnau D. 2003. DNA transport during transformation. Front.

Biosci. 8:S544 –S556. http://dx.doi.org/10.2741/1047.2. Hobbs M, Mattick JS. 1993. Common components in the assembly of

type 4 fimbriae, DNA transfer systems, filamentous phage and protein-secretion apparatus: a general system for the formation of surface-associated protein complexes. Mol. Microbiol. 10:233–243. http://dx.doi.org/10.1111/j.1365-2958.1993.tb01949.x.

3. Averhoff B. 2009. Shuffling genes around in hot environments: theunique DNA transporter of Thermus thermophilus. FEMS Microbiol. Rev.33:611– 626. http://dx.doi.org/10.1111/j.1574-6976.2008.00160.x.

4. Nunn D. 1999. Bacterial type II protein export and pilus biogenesis: morethan just homologies? Trends Cell Biol. 9:402– 408. http://dx.doi.org/10.1016/S0962-8924(99)01634-7.

5. Peabody CR, Chung YJ, Yen MR, Vidal-Ingigliardi D, Pugsley AP, SaierMH, Jr. 2003. Type II protein secretion and its relationship to bacterialtype IV pili and archaeal flagella. Microbiology 149:3051–3072. http://dx.doi.org/10.1099/mic.0.26364-0.

6. Chen I, Dubnau D. 2004. DNA uptake during bacterial transformation.Nat. Rev. Microbiol. 2:241–249. http://dx.doi.org/10.1038/nrmicro844.

7. Krüger N-J, Stingl K. 2011. Two steps away from novelty—principles ofbacterial DNA uptake. Mol. Microbiol. 80:860 – 867. http://dx.doi.org/10.1111/j.1365-2958.2011.07647.x.

8. Hamilton HL, Dillard JP. 2006. Natural transformation of Neisseria gonor-rhoeae: from DNA donation to homologous recombination. Mol. Micro-biol. 59:376 –385. http://dx.doi.org/10.1111/j.1365-2958.2005.04964.x.

9. Fussenegger M, Rudel T, Barten R, Ryll R, Meyer TF. 1997. Transfor-mation competence and type-IV pilus biogenesis in Neisseria gonorrhoeae.Gene 192:125–134. http://dx.doi.org/10.1016/S0378-1119(97)00038-3.

10. Long CD, Tobiason DM, Lazio MP, Kline KA, Seifert HS. 2003. Low-level pilin expression allows for substantial DNA transformation compe-tence in Neisseria gonorrhoeae. Infect. Immun. 71:6279 – 6291. http://dx.doi.org/10.1128/IAI.71.11.6279-6291.2003.

11. Burkhardt J, Vonck J, Langer JD, Salzer R, Averhoff B. 2012. UnusualN-terminal ���� fold of PilQ from Thermus thermophilus mediatesring formation and is essential for piliation. J. Biol. Chem. 287:8484 –8494. http://dx.doi.org/10.1074/jbc.M111.334912.

12. Aas FE, Wolfgang M, Frye S, Dunham S, Lovold C, Koomey M.2002. Competence for natural transformation in Neisseria gonorrhoeae:components of DNA binding and uptake linked to type IV pilus expres-sion. Mol. Microbiol. 46:749 –760. http://dx.doi.org/10.1046/j.1365-2958.2002.03193.x.

13. Koyama Y, Hoshino T, Tomizuka N, Furukawa K. 1986. Genetic trans-formation of the extreme thermophile Thermus thermophilus and of otherThermus spp. J. Bacteriol. 166:338 –340.

14. Oshima T, Imahori K. 1971. Isolation of an extreme thermophile andthermostability of its transfer ribonucleic acid and ribosomes. J. Gen.Appl. Microbiol. 17:513–517. http://dx.doi.org/10.2323/jgam.17.513.

15. Friedrich A, Hartsch T, Averhoff B. 2001. Natural transformation inmesophilic and thermophilic bacteria: identification and characterizationof novel, closely related competence genes in Acinetobacter sp. strainBD413 and Thermus thermophilus HB27. Appl. Environ. Microbiol. 67:3140 –3148. http://dx.doi.org/10.1128/AEM.67.7.3140-3148.2001.

16. Rumszauer J, Schwarzenlander C, Averhoff B. 2006. Identification,subcellular localization, and functional interactions of PilMNOWQ andPilA4 involved in transformation competency and pilus biogenesis in thethermophilic bacterium Thermus thermophilus HB27. FEBS J. 273:3261–3272. http://dx.doi.org/10.1111/j.1742-4658.2006.05335.x.

17. Robien MA, Krumm BE, Sandkvist M, Hol WG. 2003. Crystal structureof the extracellular protein secretion NTPase EpsE of Vibrio cholerae. J.Mol. Biol. 333:657– 674. http://dx.doi.org/10.1016/j.jmb.2003.07.015.

18. Planet PJ, Kachlany SC, DeSalle R, Figurski DH. 2001. Phylogeny ofgenes for secretion NTPases: identification of the widespread tadA sub-family and development of a diagnostic key for gene classification. Proc.Natl. Acad. Sci. U. S. A. 98:2503–2508. http://dx.doi.org/10.1073/pnas.051436598.

19. Freitag NE, Seifert HS, Koomey M. 1995. Characterization of the pilF-pilD pilus-assembly locus of Neisseria gonorrhoeae. Mol. Microbiol. 16:575–586. http://dx.doi.org/10.1111/j.1365-2958.1995.tb02420.x.

20. Wolfgang M, Park HS, Hayes SF, van Putten JP, Koomey M. 1998.Suppression of an absolute defect in type IV pilus biogenesis by loss-of-function mutations in pilT, a twitching motility gene in Neisseria gonor-rhoeae. Proc. Natl. Acad. Sci. U. S. A. 95:14973–14978. http://dx.doi.org/10.1073/pnas.95.25.14973.

21. Jakovljevic V, Leonardy S, Hoppert M, Sogaard-Andersen L. 2008. PilB andPilT are ATPases acting antagonistically in type IV pilus function in Myxococ-cus xanthus. J. Bacteriol. 190:2411–2421. http://dx.doi.org/10.1128/JB.01793-07.

22. Mattick JS. 2002. Type IV pili and twitching motility. Annu. Rev. Micro-biol. 56:289 –314. http://dx.doi.org/10.1146/annurev.micro.56.012302.160938.

23. Kaiser D. 2000. Bacterial motility: how do pili pull? Curr. Biol. 10:777–780. http://dx.doi.org/10.1016/S0960-9822(00)00568-6.

24. Chakraborty S, Monfett M, Maier TM, Benach JL, Frank DW, ThanassiDG. 2008. Type IV pili in Francisella tularensis: roles of pilF and pilT infiber assembly, host cell adherence, and virulence. Infect. Immun. 76:2852–2861. http://dx.doi.org/10.1128/IAI.01726-07.

25. Maier B, Potter L, So M, Long CD, Seifert HS, Sheetz MP. 2002. Singlepilus motor forces exceed 100 pN. Proc. Natl. Acad. Sci. U. S. A. 99:16012–16017. http://dx.doi.org/10.1073/pnas.242523299.

26. Whitchurch CB, Mattick JS. 1994. Characterization of a gene, pilU, re-quired for twitching motility but not phage sensitivity in Pseudomonasaeruginosa. Mol. Microbiol. 13:1079 –1091. http://dx.doi.org/10.1111/j.1365-2958.1994.tb00499.x.

27. Burrows LL. 2005. Weapons of mass retraction. Mol. Microbiol. 57:878 –888. http://dx.doi.org/10.1111/j.1365-2958.2005.04703.x.

28. Clausen M, Jakovljevic V, Sogaard-Andersen L, Maier B. 2009. High-force generation is a conserved property of type IV pilus systems. J. Bac-teriol. 191:4633– 4638. http://dx.doi.org/10.1128/JB.00396-09.

29. Friedrich A, Prust C, Hartsch T, Henne A, Averhoff B. 2002. Molecularanalyses of the natural transformation machinery and identification ofpilus structures in the extremely thermophilic bacterium Thermus ther-mophilus strain HB27. Appl. Environ. Microbiol. 68:745–755. http://dx.doi.org/10.1128/AEM.68.2.745-755.2002.

30. Possot OM, Pugsley AP. 1997. The conserved tetracysteine motif in the generalsecretory pathway component PulE is required for efficient pullulanase secretion.Gene 192:45–50. http://dx.doi.org/10.1016/S0378-1119(97)00009-7.

31. Chiang P, Habash M, Burrows LL. 2005. Disparate subcellular localiza-tion patterns of Pseudomonas aeruginosa type IV pilus ATPases involved intwitching motility. J. Bacteriol. 187:829 – 839. http://dx.doi.org/10.1128/JB.187.3.829-839.2005.

32. Sakai D, Horiuchi T, Komano T. 2001. ATPase activity and multimerformation of PilQ protein are required for thin pilus biogenesis in plasmidR64. J. Biol. Chem. 276:17968 –17975. http://dx.doi.org/10.1074/jbc.M010652200.

33. Rose I, Biukovic G, Aderhold P, Müller V, Grüber G, Averhoff B. 2011.Identification and characterization of a unique, zinc-containing transportATPase essential for natural transformation in Thermus thermophilusHB27. Extremophiles 15:191–202. http://dx.doi.org/10.1007/s00792-010-0343-2.

34. Chen Y, Shiue SJ, Huang CW, Chang JL, Chien YL, Hu NT, Chan NL.

Roles of NTPases in Piliation and Transformation

January 2014 Volume 80 Number 2 aem.asm.org 651

on October 28, 2020 by guest

http://aem.asm

.org/D

ownloaded from

2005. Structure and function of the XpsE N-terminal domain, an essentialcomponent of the Xanthomonas campestris type II secretion system. J. Biol.Chem. 280:42356 – 42363. http://dx.doi.org/10.1074/jbc.M506843200.

35. Abendroth J, Murphy P, Sandkvist M, Bagdasarian M, Hol WG. 2005.The X-ray structure of the type II secretion system complex formed by theN-terminal domain of EpsE and the cytoplasmic domain of EpsL of Vibriocholerae. J. Mol. Biol. 348:845– 855. http://dx.doi.org/10.1016/j.jmb.2005.02.061.

36. Salzer R, Herzberg M, Nies DH, Biukovic G, Gruber G, Muller V,Averhoff B. 2013. The DNA uptake ATPase PilF of Thermus thermophilus:a reexamination of the zinc content. Extremophiles 17:697– 698. http://dx.doi.org/10.1007/s00792-013-0544-6.

37. Camberg JL, Sandkvist M. 2005. Molecular analysis of the Vibrio choleraetype II secretion ATPase EpsE. J. Bacteriol. 187:249 –256. http://dx.doi.org/10.1128/JB.187.1.249-256.2005.

38. Cava F, Zafra O, Magalon A, Blasco F, Berenguer J. 2004. A new type ofNADH dehydrogenase specific for nitrate respiration in the extreme ther-mophile Thermus thermophilus. J. Biol. Chem. 279:45369 – 45378. http://dx.doi.org/10.1074/jbc.M404785200.

39. Brouns SJ, Wu H, Akerboom J, Turnbull AP, de Vos WM, van der OostJ. 2005. Engineering a selectable marker for hyperthermophiles. J. Biol.Chem. 280:11422–11431. http://dx.doi.org/10.1074/jbc.M413623200.

40. de Grado M, Castan P, Berenguer J. 1999. A high-transformation-efficiency cloning vector for Thermus thermophilus. Plasmid 42:241–245.http://dx.doi.org/10.1006/plas.1999.1427.

41. Schwarzenlander C, Haase W, Averhoff B. 2009. The role of singlesubunits of the DNA transport machinery of Thermus thermophilus HB27in DNA binding and transport. Environ. Microbiol. 11:801– 808. http://dx.doi.org/10.1111/j.1462-2920.2008.01801.x.

42. Weber K, Osborn M. 1969. The reliability of molecular weight determi-nations by dodecyl sulfate-polyacrylamide gel electrophoresis. J. Biol.Chem. 244:4406 – 4412.

43. Graupner S, Weger N, Sohni M, Wackernagel W. 2001. Requirement ofnovel competence genes pilT and pilU of Pseudomonas stutzeri for naturaltransformation and suppression of pilT deficiency by a hexahistidine tagon the type IV pilus protein PilAI. J. Bacteriol. 183:4694 – 4701. http://dx.doi.org/10.1128/JB.183.16.4694-4701.2001.

44. Wolfgang M, Lauer P, Park HS, Brossay L, Hébert J, Koomey M. 1998.PilT mutations lead to simultaneous defects in competence for naturaltransformation and twitching motility in piliated Neisseria gonorrhoeae.Mol. Microbiol. 29:321–330. http://dx.doi.org/10.1046/j.1365-2958.1998.00935.x.

45. Chiang P, Sampaleanu LM, Ayers M, Pahuta M, Howell PL, BurrowsLL. 2008. Functional role of conserved residues in the characteristic secre-tion NTPase motifs of the Pseudomonas aeruginosa type IV pilus motorproteins PilB, PilT, and PilU. Microbiology 154:114 –126. http://dx.doi.org/10.1099/mic.0.2007/011320-0.

46. Kurre R, Hone A, Clausen M, Meel C, Maier B. 2012. PilT2 enhances thespeed of gonococcal type IV pilus retraction and of twitching motility.Mol. Microbiol. 86:857– 865. http://dx.doi.org/10.1111/mmi.12022.

47. Collins RF, Hassan D, Karuppiah V, Thistlethwaite A, Derrick JP. 2013.Structure and mechanism of the PilF DNA transformation ATPase from

Thermus thermophilus. Biochem. J. 450:417– 425. http://dx.doi.org/10.1042/BJ20121599.

48. Turner LR, Lara JC, Nunn DN, Lory S. 1993. Mutations in the consensusATP-binding sites of XcpR and PilB eliminate extracellular protein secre-tion and pilus biogenesis in Pseudomonas aeruginosa. J. Bacteriol. 175:4962– 4969.

49. Py B, Loiseau L, Barras F. 1999. Assembly of the type II secretion ma-chinery of Erwinia chrysanthemi: direct interaction and associated confor-mational change between OutE, the putative ATP-binding componentand the membrane protein OutL. J. Mol. Biol. 289:659 – 670. http://dx.doi.org/10.1006/jmbi.1999.2803.

50. Shiue SJ, Kao KM, Leu WM, Chen LY, Chan NL, Hu NT. 2006. XpsEoligomerization triggered by ATP binding, not hydrolysis, leads to its as-sociation with XpsL. EMBO J. 25:1426 –1435. http://dx.doi.org/10.1038/sj.emboj.7601036.

51. Camberg JL, Johnson TL, Patrick M, Abendroth J, Hol WG, SandkvistM. 2007. Synergistic stimulation of EpsE ATP hydrolysis by EpsL andacidic phospholipids. EMBO J. 26:19 –27. http://dx.doi.org/10.1038/sj.emboj.7601481.

52. Ball G, Chapon-Herve V, Bleves S, Michel G, Bally M. 1999. Assemblyof XcpR in the cytoplasmic membrane is required for extracellular proteinsecretion in Pseudomonas aeruginosa. J. Bacteriol. 181:382–388.

53. Possot OM, Vignon G, Bomchil N, Ebel F, Pugsley AP. 2000. Multipleinteractions between pullulanase secreton components involved in stabi-lization and cytoplasmic membrane association of PulE. J. Bacteriol. 182:2142–2152. http://dx.doi.org/10.1128/JB.182.8.2142-2152.2000.

54. Yoshihara S, Geng X, Okamoto S, Yura K, Murata T, Go M, Ohmori M,Ikeuchi M. 2001. Mutational analysis of genes involved in pilus structure,motility and transformation competency in the unicellular motile cyano-bacterium Synechocystis sp. PCC 6803. Plant Cell Physiol. 42:63–73. http://dx.doi.org/10.1093/pcp/pce007.

55. Okamoto S, Ohmori M. 2002. The cyanobacterial PilT protein responsi-ble for cell motility and transformation hydrolyzes ATP. Plant CellPhysiol. 43:1127–1136. http://dx.doi.org/10.1093/pcp/pcf128.

56. Aas FE, Winther-Larsen HC, Wolfgang M, Frye S, Lovold C, Roos N,van Putten JP, Koomey M. 2007. Substitutions in the N-terminal alphahelical spine of Neisseria gonorrhoeae pilin affect type IV pilus assembly,dynamics and associated functions. Mol. Microbiol. 63:69 – 85. http://dx.doi.org/10.1111/j.1365-2958.2006.05482.x.

57. Alm RA, Mattick JS. 1997. Genes involved in the biogenesis and functionof type-4 fimbriae in Pseudomonas aeruginosa. Gene 192:89 –98. http://dx.doi.org/10.1016/S0378-1119(96)00805-0.

58. Tønjum T, Koomey M. 1997. The pilus colonization factor of pathogenic neis-serialspecies:organellebiogenesisandstructure/functionrelationships.Gene192:155–163. http://dx.doi.org/10.1016/S0378-1119(97)00018-8.

59. Friedrich A, Rumszauer J, Henne A, Averhoff B. 2003. Pilin-like pro-teins in the extremely thermophilic bacterium Thermus thermophilusHB27: implication in competence for natural transformation and links totype IV pilus biogenesis. Appl. Environ. Microbiol. 69:3695–3700. http://dx.doi.org/10.1128/AEM.69.7.3695-3700.2003.

60. Seitz P, Blokesch M. 2013. DNA-uptake machinery of naturally compe-tent Vibrio cholerae. Proc. Natl. Acad. Sci. U. S. A. 110:17987–17992. http://dx.doi.org/10.1073/pnas.1315647110.

Salzer et al.

652 aem.asm.org Applied and Environmental Microbiology

on October 28, 2020 by guest

http://aem.asm

.org/D

ownloaded from