Transcripts of a gene encoding a putative cell wall-plasma membrane linker protein are specifically cold-induced in Brassica napus

Plant Molecular Biology 31: 771-781, 1996. Q 1996 Kluwer Academic Publishers. Printed in Belgium.

771

Transcripts of a gene encoding a putative cell wall-plasma membrane linker protein are specifically cold-induced in Brassica napus

Wil l i am G o o d w i n , J acque l ine A. Pal las 1 and Gare th I. Jenkins* Plant Molecular Science Group, Division of Biochemisto' and Molecular Biology, Institute of Biomedical and Life Sciences, Bower Building, UniversiO" of Glasgow, Glasgow G12 8QQ, UK (*author for correspondence); I Present address: Centre~r Plant Biochemist13, and Biotechnolog3; UniversiO, of Leeds, Leeds LS2 9JT, UK

Accepted: Received l0 January 1996; accepted in revised form 18 April 1996

Key words: Brassica napus, cell wall protein, cold-induced gene, hybrid-proline-rich protein, low temperature

Abstract

We have isolated a gene and cDNA from Brassica napus encoding a hybrid-proline-rich protein. The putative protein is modular in structure. The N-terminal domain has properties of a signal peptide which would direct the protein into the ER. Amino acids 27 to 287 comprise three domains which contain high levels of proline and several other amino acids common in proline-rich cell wall proteins. These domains are characterised by repeating amino acid motifs. The C-terminal domain (amino acids 288 to 376) contains three putative membrane-spanning regions and shows a high degree of amino acid similarity to known hybrid-proline-rich proteins from several species. It is likely that the protein is secreted from the cell, located in the cell wall and anchored in the plasma membrane via the C-terminal domain. Transcripts encoding this protein are induced in leaf tissue within 8 h of cold treatment and decrease rapidly when plants are returned to normal temperatures. The transcripts are not induced by heat shock, dehydration, exogenous ABA or wounding, whereas transcripts of a control B. napus gene are induced by dehydration and ABA. The possible function of this protein in cold tolerance is discussed.

Abbreviations: PRR proline-rich-protein; RWC, relative water content

Introduction

Sudden exposure of plants to freezing or near-freezing temperatures normally elicits a stress response and may cause severe damage to the tissues. However, if plants are first exposed to a period of low but non- freezing temperatures they undergo cold acclimation, which increases their tolerance to subsequent low- temperature treatments [14, 51]. A variety of bio- chemical and physiological changes occur during cold acclimation [ 14, 17, 51 ]. Furthermore, changes in gene expression upon cold treatment have been reported in a range of species and a considerable diversity of proteins and mRNAs has been described [ 14, 18, 51,52]. In some cases, correlations have been reported between

The nucleotide sequence data reported will appear in the EMBL, GenBank and DDBJ Nucleotide Sequence Databases under the accession number X94976.

the expression of particular cold-induced genes and cold acclimation [ 16, 33, 60], but there is little direct evidence demonstrating that any cold-induced protein has a causative effect in freezing tolerance in vivo.

DNA clones encoding a variety of cold-induced proteins have been isolated from a range of species [ 18, 52]. The isolation of cDNA clones of cold-induced genes was first reported for alfalfa [33]. Subsequently, eDNA and genomic clones for cold-induced genes have been obtained from species includingArabidopsis [e.g. 15, 20, 30, 36, 37], barley [e.g. 3, 9, 10, 19, 54, 58], wheat [13, 16], rye [60] and potato [53].

Very little is known about the mechanisms of low- temperature perception and signal transduction which lead to cold-induced gene expression, although recent evidence suggests that an elevation of cytosolic calcium is involved [28, 34]. Abscisic acid levels have been shown to rise upon cold treatment, and in dehydration-

772

stressed tissues in general, and the exogenous application of ABA has been reported to induce freezing tolerance in some species in the absence of cold treatment [14, 51]. Moreover, the expression of several, though not all [e.g. 16, 20, 57], cold-induced genes can be induced by ABA [18, 52]. There is evidence that different signal transduction pathways are involved in the cold, drought and ABA induction of gene expression in Arabidopsis [12, 36]. Thus the increase in ABA after cold treatment may contribute to the induction of certain genes, whereas others may be regulated via ABA-independent signal transduction pathways.

We are investigating the regulation of gene expression in Brassica napus by low temperature. In pre- vious studies with this species, cold-induced changes in protein synthesis in vivo and in the in vitro trans- lation products of RNA have been reported [23, 32]. Moreover, ABA can substitute for cold in inducing both the synthesis of certain proteins and the development of freezing tolerance [23, 38]. DNA clones of several B. napus cold-induced genes have been obtained [39, 45, 57, 59]. In this paper we report the isolation of a gene encoding a B. napus hybrid-proline-rich protein and show that complementary transcripts increase specifically in response to low temperature and not in response to ABA, water stress or wounding. We dis- cuss the possible role of this putative cell wall-plasma membrane linker protein in cold tolerance.

Materials and methods

Growth and treatment of plants

B. napus cv. Cobra plants were grown from seed in compost at 22 °C in continuous white light (warm white fluorescent tubes) of 150 #tool m -2 s -1 for 21 to 28 days before being subjected to further treatments. For cold treatment, plants were transferred to an identical growth room at 4 °C. Plants were heat shocked at 40 °C by being placed in an incubator with illumination from above for up to 8 h. During this treatment the plants were placed in polythene bags to minimise water loss.

The method of exogenous ABA application was similar to that of Hajela et al. [ 15]. Plants were sprayed to run-off with ABA (mixed isomers, Sigma, Poole, UK) dissolved in a small amount of methanol and diluted to 10 - 4 o r 10 -5 M with water. Control plants were sprayed with water containing the same amount of methanol.

Dehydration was induced by withholding water from day 15 after germination. Leaf tissue was har- vested 21 or 28 days after germination. The relative water content (RWC) of individual leaves was estimated using the method of Guo et aL [13]. A leaf at the same stage of development and of equivalent dehydration (assessed visually) from the same plant was used for RNA isolation.

Wounding was inflicted by cutting leaves into 25 mm 2 sections. These were placed on moist filter paper in a Petri dish and incubated at 22 °C under constant illumination as described above. As a control to show that sections remained responsive to a stimulus, sections incubated for defined periods were transferred to 4 °C for 24 h.

RNA isolation and hybridisation

Total RNA was isolated by the method of Chom- czynski and Sacchi [4] with additional sodium acet- ate washes [49]. RNA was resolved on 1.5% agarose- formaldehyde gels (normally 15 #g per lane) and blotted onto nylon membrane (Hybond-N, Amersham, Bucks, UK) using standard procedures [47]. Equal loading of RNA in the lanes of the gel was checked by staining with ethidium bromide. Filters were pre- hybridised for 6 h at42 °C in 5 x SSC, 50% formamide, 5x Denhardt's solution, 0.1% SDS, 100 mg/ml denatured salmon sperm DNA. The BnPRP and BnD22 cDNAs were excised from their plasmid vectors using appropriate restriction endonucleases and labelled to high specific activity using random hexanucleotide primers in the presence of a radiolabelled deoxynuc- leotide triphosphate. The probe was purified, denatured and added to the pre-hybridisation solution at a con- centration of ca. 2 x 10 6 cpm/ml. Hybridisation was for 16 h at 42 °C. Filters were washed for 20 min at 60 °C in each of three solutions: 2 x SSC, 0.1% SDS; 0.5 x SSC, 0.1% SDS; 0.1 x SSC, 0.1% SDS, and then rinsed in 2x SSC prior to autoradiography.

Construction and screening of the cDNA library

The cDNA library was constructed in the Uni-ZAP XR vector (Stratagene, La Jolla, CA) using the ZAP- cDNA synthesis kit (Stratagene) with oligo(dT) as a primer. Poly(A) + RNA was purified from total RNA from leaves exposed to 4 °C by passing it twice through an oligo(dT)-cellulose column [47]. The library was screened using a 174 bp MspI fragment from the cDNA pLF5 which was known to hybridise to cold-induced

transcripts [40]. Selected positive clones were plaque- purified, the inserts were sized and in vivo excised into pBluescript II S K ( - ) (Stratagene, La Jolla, USA). The longest cDNA, BnPRP, was sequenced.

Screening of a B. napus genomic librao'

A B. napus genomic library made by Clontech (Califor- nia, USA) was used to isolate BnPRP genomic clones. The library was constructed by ligating B. napus genomic DNA partially digested with Sau3AI into the AEMBL3 vector digested with BamHI. Primary screening, and secondary and tertiary screening of putative positive clones, was by hybridisation to either the above 174 bp MspI fragment or the cDNA BnPRR Seven plaque-purified clones proved to be true posit- ives. After restriction mapping and hybridisation of fragments on Southern blots to BnPRP, one clone, designated ABnPRP, was selected for further study. Restriction fragments of this clone were subcloned into pBluescript II SK(- ) .

DNA sequence analysis

The BnPRP cDNA and selected ABnPRP genomic sub-clones were sequenced in both directions using Sequenase x v2.0 (Amersham, UK) and, as necessary, a combination of ExolII nuclease deletions and intern- al oligonucleotide primers. The primers were made to known regions of the DNA that had been sequenced with other primers or deletions. Apart from a 126 bp stretch of DNA between positions 1665 and 1792 all of the 2.4 kb subclone was sequenced on both strands. Primers could not be synthesised to this region due to the repetitive nature of the DNA sequence which caused any primer to prime from multiple points and do not yield any useful sequence information. Never- theless, four separate overlapping deletions covering this region were sequenced, allowing confidence in the fidelity of sequence obtained.

The DNA sequences were converted into putative protein sequence and analysed using the UWGCG program PILEUR The hydropathy profile of putative protein sequences was analysed using a Kyte and Doolittle plot with a nine residue window [31]. The HGMP computers (Cambridge, UK) were used for searching the GenBank and EMBL databases using the BLAST algorithm.

773

Results

Isolation of a B, napus gene and cDNA encoding a hybrid-proline- rich protein

A cDNA library was prepared from poly(A) + RNA isolated from B. napus leaf tissue exposed to 4 °C for 24 h. The library was screened using a Mspl fragment derived from a partial, chimaeric cDNA, isolated previously from a B. napus shoot apex cDNA library, which was found to hybridise to cold-induced transcripts [40]. Several cDNAs were isolated and the longest, BnPRR was sequenced and found to contain a single open reading frame encoding a proline-rich amino acid sequence.

A genomic library was screened to isolate the gene corresponding to the BnPRP cDNA. One of the clones isolated (ABnPRP), with an insert size of ca. 28 kbp, was selected for further characterisation. The sequence of the BnPRP cDNA was contained within two adjacent 2.4 kb and 0.6 kb EcoRI-SalI fragments of ABnPRR Each of these fragments hybridised to cold-induced transcripts on a northern blot of leaf RNA. The 2.4 kb (2407 bp) and 0.6 kb (607 bp) subcloned genomic fragments were sequenced.

The sequence of the open reading frame and 3' non- coding region of the BnPRP gene is shown in Fig. 1. No other ATG was present between the putative TATA box of the promoter and the start of the open reading frame. The open reading frame is 1128 bp and contains no introns. The coding and 3'-untranslated sequence of the cDNA BnPRP is completely identical to the genomic sequence over its entire length, which starts at nt 492 in Fig. 1. The cDNA was therefore incomplete. Alignment of ABnPRP with the cDNA shows a 3'-untranslated region of 205 bp. A consensus polyadenylation signal (AATAAA) [26] is present 27 bp upstream of the position of the poly(A) tail.

Characterisation of the BNPRP hybrid-proline-rich protein

BnPRP encodes a putative hybrid-proline-rich protein of 376 amino acids with an estimated molecular mass of 38 673 Da. Figure 2A shows a Kyte and Doolittle hydropathy profile of the predicted protein which reveals that it has a modular structure. There are five distinct domains (Fig. 2A), each of which has a distinct amino acid composition.

The N-terminal domain has the expected properties of a signal peptide [56] which would direct the BNPRP precursor into the ER. It is 27 amino acids long, having

774

ATGGGGTCTCACACACAAAACCTCTCTTTTCTTATCCTCCTTCTCCTAGGCTTCCTTGCTGTCTCATTTGCTTGCGAATGTAGCCCTCCT 90

M G S H T Q N L S F L I L L L L G F L A V S F A C E C S P P 30

AAACCATCT••GAGA•C•CACAAACCGCCTAAACATC•CGT•AAACCGCCTAAACCACCAGCAGCCAAACCACCAAAACCAC•GGCAGTA 180

K P S P R P H K P P K H P V K P P K P P A A K P P K P P A V 60

AAACCTCCTAAACCCCCCACCAAA•CTCCCAC•CTTAAACCACA•CCCCACCCTAAACCTCCCACCGTTAGAC•ACATCCACACCCTAAG 270

K P P K P P T K P P T L K P H P H P K P P T V R P H P H P K 90

CCCC C TACCAAAC•TCATCC•AT•CCA•AA•CGCCCACAATTAAACCACCACC•TCCACACCCAAACCGCCCACAAAACCACC•ACCGTT 360

P P T K P H P I P K P P T I K P P P S T P K P P T K P P T V 120

AAACCACCTCCATCCACCC CTAAGC CGCCCACCAAACCACCCACCGTCAAACCACCACCCTCCACCCCAAAACCGCCCACCAAGCCACCC 450

K P P P S T P K P P T K P P T V K P P P S T P K P P T K P P 150

ACCGTCAAACCACCTCCGTCCACCCCTAAACCACCTACCcACAAGCCACCAACAGTGTGcCCAcCGCCAACACCAACACCAACCCCACCT 540

T V K P P P S T P K P P T H K P P T V C P P P T P T P T P P 180

GTTGTAACGCCA•CAA•ACCACCAACACCAACTCCACCAGTCGTTACGCCACCAACACCAGCC•CACCTGTTGTAACGCCACCAACACCA 630

V V T P P T P P T P T P P V V T P P T P A P P V V T P P T' P 210

ACAC CACCGGTCGTAACGCCACCGACAC CAACCCCTCCTGTCGTAACACCTCCAACACCACCGGTCGTAACGCCACCGACACCAACTCCT 720

T P P V V T P P T P T P P V V T P P T P i:' V V T P P T P T P 240

CCT GTCGTAACACCACCAACACCACCGGTCGTAACGCCACCGACAC CAACCCCTCCTGTCGTAACACCTCCAACACCACCGGTCGTAACG 810

P V V T P P T P P V V T P P T P T P P V V T P P T P P V V T 270

CCACCGACACC~CCCCTCCTGTCGT~C~CC~C~CTC~CCT~GCCAG~CGT~cc~TC~CGTT~TAG~900

P P T P T P P V V T P P T P T P P K P E T C P I D T L K L G 3 0 0

GCTTGTGTAGACGTTCTTGGAGGTTTAAT TCACATCGGGCTTGGTGGAAGTAGCGCCAAGAAAGAGTGTTGTCCGGTTTTGGGAGGCTTA 990

A C V D V L G G L I H I G L G G S S A K K E C C P V L G G L 330

GTTGACTTAGAC~A~TGTTTGT~TATGTACCA~CAT~AAAGCCAAACTTCTCATCGT~CCTTATTATCCCCATTGCTCTTGAGCTT 1080

V D L D A A V C L C T T I K A K L L I V D L I I P I A L E L 3 6 0

CTTATCGACTGT~AAAGACTCC~CACCTG~TTCAAATGTCCCTCTTGATGAATG~GTGTCTCTCTATCGTGTTTTTCTTTCTTTCT 1170

L I D C G K T P P P G F K C P S * 376

TTCA~G~TTTGTTAGTTTGAT~TCTCTTG~TGAGGTT~TTT~GTGTGTGAGACCTTT~TCACTTGTTTTGTTGTAC~TAAAAG 1260

GCTATGTTTGGGTTTTGTTGATGT~TTCT~G~G~GAAATAA/L%AATGTAAAACGGTAT~TTATCTTTC(A)n 1333

~gure 1. Nucleoti~ sequence and deduced ~ i n o acid sequence of He BnPRP gene. The sequence is shown from the first ATG o f ~ e 1128 bp open ~ i n g Lame ~ He last nucleotide be~re He poly(A) tail in the co~esponding cDNA. The first nucleofide of the cDNA (nt 492) is indicated by an mow. The stop codon is indicated by an as~fisk ~ d the putative poly~enyl~ion signal (AATAAA) is undedin~.

a positively charged amino terminal, a central hydrophobic region, and a polar C-terminal with a putative cleavage site (CEC-SP) that conforms to the rules for defining cleavage sites [56]. After removal of the signal peptide the BNPRP protein would have an estimated molecular mass of 35 762 Da. No amino acid motifs, such as the carboxyl-terminal KDEL/HDEL [5, 55], are present which would cause BNPRP to be retained in the ER, so it is likely that the protein would be secreted. As described below, features of the putative protein indicate that it would be located in the cell wall but anchored in the plasma membrane via its C- terminal domain.

The three central domains span residues 28 to 287. They are all rich in proline (50%), threonine (19.2%), valine (11.2%), and lysine (10.4%). Specific amino

acids motifs can be recognised within each domain and are repeated to varying degrees (Fig. 2B). The repeated motifs vary in sequence and in their length. Domain 3 shows the most ordered repeats.

The carboxyl domain stretches from residues 288 to 376. It contains three putative membrane-spanning segments. These segments consist of stretches of ca. 20 relatively apolar, hydrophobic residues (particularly leucine, isoleucine and glycine) which would span the membrane, followed typically by polar, charged, hydrophilic residues (particularly lysine) which would protrude into the cytoplasm or cell wall space. The carboxyl domain also has a relatively high content of cysteine and proline (both 9%).

After removal of the putative signal peptide, BNPRP contains only one aromatic amino acid,

5- L 4-

2-

I-

0

-1-

-2-

-3"

-4-

-5'

A

t 2 , 3 4 5

Hydrophobic

_ fl/l~lAAnl~lflfl fl ~ ~

Hydrophilic

. . . . ; , ; 50 100 150 200 2 0 300 3 0

B Domain 2: KPPKHPV 7

KPPKPPAA 8

KPPKPPAV 8

KPPKPPT 7

KPPTLKPHPNP 11

KPPTVRPHPHP 11

KPPTKPHPIPK 11

Domain 3: KPPTIKPPPSTPKPPT 16

KPPTVKPPPSTPKPPT 16

KPPTVKPPPSTPKPPT 16

KPPTVKPPPSTPKPPT 16

IIKPPTVCPPPT 11

Domain 4: PTPTPPVVTPPTp 13

PTPTPPVVTPPTP 13

PPVVTPPTPT 10

PPVVTPPTPT 10

PPVVTPPT 8

PPVVTPPTPT l 0

PPVVTPPT 8

PPVVTPPTPT 10

PPVVTPPT 8

PPVVTPPTPT 10

PPVVTPPTPTPP 12

Figure 2. Structure of the putative BNPRP protein. A. Hydropathy profile [31] using a nine residue window. The five numbered segments indicated by arrows above the profile correspond to domains discussed in the text. B. The amino acid sequences of domains 2, 3 and 4 arranged to reveal repeating motifs. The length of each motif is given on the right and the core sequences are underlined.

phenylalanine; there are no tryptophan or tyrosine residues. Methionine, asparagine and glutamine are also absent.

The DNA sequence of BnPRP and the amino acid sequence of the putative protein BNPRP were entered into data base searches. BNPRP shares a high degree of sequence similarity with several plant proteins.

775

The similarity is greatest in the C-terminal domain (Fig. 3). All are hybrid-proline-rich proteins, containing two distinct regions, one rich in proline and the other, at the carboxyl end, rich in hydrophobic residues. The proteins identified are from a number of species and their transcripts are expressed in response to diverse developmental and environmental stimuli. TPRP-F1 is expressed predominantly in young tomato fruit [46]. ADRll-1 , isolated from soybean, is down-regulated in response to auxin in seedling hypo- cotyls [7]. HyPRP transcripts accumulate in imma- ture maize zygotic embryos [25]. DC2.15 is expressed in carrot suspension cultures during the initiation of somatic embryogenesis [1]. zrp3 transcripts accumulate in developing cortical cells within maize roots [21 I. SACS1 transcripts accumulate in the dehiscence zone during pod formation in oilseed rape [6]. msaCIC is expressed in response to low temperatures and wounding in leaves, crowns and roots of alfalfa [2].

A low level of similarity is found between BNPRP and these other proteins in the proline-rich domains. These vary widely in length; BNPRP is the longest with 260 residues, ZRP3 is the shortest with only 22 residues. The similarity is due mainly to the high levels of proline. BNPRR TPRP-F1 and MSACIC share proline triplets, which are unusual in higher plants. The prolines in most proteins appear in doublets, as in cell wall proline-rich proteins (PRPs), or quadruplets as in the extensins [24, 27, 50]. The PPVV motif appears in BNPRE TPRP-FI, ADR11-1, and SAC51.

Erpression of BnPRP

The expression of BnPRP was studied in response to several abiotic stresses. The BnPRP cDNA was hybridised under stringent conditions to northern blots of B. napus total RNA to measure the abundance of the corresponding transcripts. The transcripts were ca. 1.4 kb in size, consistent with the length of the predicted transcribed region of BnPRP.

Transcripts were normally at or below the limit of detection in plants grown at 22 °C. As shown in Fig. 4A, an increase in the level of BnPRP transcripts in leaf tissue was detected when plants grown at 22 °C were transferred to 4 °C for 8 h. The transcript level continued to increase up to 24 h (Fig. 4A) and then remained roughly constant for as long as the plants were kept in the cold (at least 14 days; data not shown). After 24 h of cold treatment the plants were returned to normal temperatures (22 °) and the transcript level declined rapidly (Fig. 4A). Little change was detected

776

A

BNPRP

TPRP-FI

ADRII-I

EYPRP

De2.15

SAC51

ZRP3

MSACIC

B N P R P

TPRP-FI

ADRII-I

HYPRP

DC2.15

8AC51

Z R P 3

MSACXG

B

--. -- _ .__ ** . *** • • ,_ _ * ._ *

KPRTC2P I DTLKLGACVDVLGGL IH IGLGGS ~ C C PVLGGLVDLD

AQ~ ..... A ................. Z- --. - .QT...L ........

a~ .............. L .... V ..... ~PV.-~ ..... Q.. .zvz AVR ......... N ...... S .... ~V/. QZ- .RSK...I&n~.X,A...

BAGK..R.A .... V.A... -N.Y. NV~I.. P~TLP..SL.~.. -m.R

ATAK..R.A .... V.A~..~..L~.T.- .KP~V. p..TLIK..A..~

S H G R .... A...KV.AK.. -..]0K~..PQY---EO...L.~ ......

TS~K..T ...... V.A...-..VNVIV.-.P. SSK..TLIQ..A...

* * * * * * _ _ _ * _ _ * _ * _ _ _ * . . * _ . *

1'2~VCLCTT'rK~MqLLXVDLZIPZItT~LLZ-I~GKTPPP~'KCPft 3 7 6

• . Z . . . . . . ] ~ L . . • N ' d , ] ~ . L . . . . O V . . D . . . . Y . . l ~ . . . . . T 3 4 6

. . . . . . . . L . L . . • ~ 3 ~ . Y w - . ~ - . V - T . . . 8 . . . . I ' T . S L 151 • .L_ . . . . . . R . ~ , . . N / ~ I Z Y / ~ . . . . 14. • . - T . . . l ~ . S . . Q . . P L Y D 3 0 1

....... A... N~.GI~.I~ .... S.~N~...QV.N..E.T 137

• .A .... A~..N~.GZN.N•..S.S..~NV.~.KV .... Q . 147

• .L .... A. • .NY.G~U.~.LS.NFIL~..RIC.E~.T..N 129 ....... A...NZ.GIN.Ny..T.S..LBA.m.SZ.N..Q.S 166

Protein sequence TPRP-F1 ADR11-1 HYPRP SAC51 DC2.15 ZPR3

MSACIC

Percent identity

77.0 66.3 62.1 52.9 52.9 50.6 54.7

Percent similarity

89.7 84.9 80.5 70.6 70.1 71.8 69.8

Gaps inserted

Figure 3. Amino acid sequence alignment of the hydrophobic C-terminal domain of the putative BNPRP protein with similar sequences in the databases. A. Alignment of BNPRP with TPRP-F1 [46], ADR11-1 [7], HYPRP [25], DC2.15 [1], SAC51 [6], ZRP3 [21] and MSACIC [2] using PILEUP. Within the sequences, amino acids which are identical to BNPRP are indicated by dots; highly conserved amino acids are underlined; dashes indicate where gaps have been introduced into the sequence to facilitate alignment. Above the sequences, asterisks indicate identical amino acid residues in all sequences; a subscript dash indicates a highly conserved amino acid residue; a superscript dash indicates a weakly conserved amino acid residue. The numbers at the end of the sequences refer to the C terminal amino acids of the proteins. B. Percentage identity and similarity of the amino acid sequences of the above proteins with BNPRP as determined using the UWGCG program BESTFIT. The number of gaps inserted to achieve the BESTFIT alignment are indicated.

after 1 h, but within 2 h the transcripts were undetect-

able.

The induct ion o f the B n P R P transcripts was specific

to low temperature and not a response to temperature

change in general because no increase was observed in

leaf tissue subjected to 40 °C for up to 8 h (Fig. 4B).

The B n P R P transcript levels were measured in dif-

ferent organs o f plants cold- t reated for 24 h. The tran-

scripts were detected in all ages o f leaf tissue, to a

lesser extent in stem tissue and were undetectable in

roots (Fig. 4C).

Figure 4. Cold-induction of BnPRP transcripts. Northern blots of RNA from B. napus plants were hybfidised to the BnPRP cDNA. A. Leaf RNA from control plants kept at 22 °C, plants transferred to 4 °C for the times indicated, or plants exposed to 4 °C for 24 h and then returned to 22 °C for 1, 2 or 8 h. B. Leaf RNA from control plants kept at 22 °C or exposed to 4 °C for 24 h and plants transferred to 40 °C for the times indicated. C. RNA from (lanes 1 to 5 respectively) leaves 1-2 cm long, leaves 5-7 cm long, mature expanded leaves, stems and roots of plants either exposed to 4 °C for 24 h or kept at 22 °C.

To examine whether B n P R P gene expression was

regulated by A B A we applied exogenous A B A to

leaves o f plants at 22 °C. As a control to demonstra te

that A B A had entered the leaves and was capable o f

affect ing gene expression, transcripts were measured

for a gene known to be induced by ABA, but not low

temperature, in B. napus. The northern blot was probed

with a B. napus cDNA, BnD22, which encodes a pro-

tein related to the Kiinitz protease inhibi tor family [8].

Bnd22 transcripts increased in the leaves within 2 h o f

the applicat ion o f 10 -4 M A B A and also increased in

response to 10 -5 M A B A (Fig. 5). Elevated levels o f

Bnd22 transcripts were present 24 h after A B A applic-

ation but not in cold-treated plants. In contrast, no

increase in the level o f B n P R P transcripts could be detected after the applicat ion o f 10 -5 or 10 -4 M A B A

(Fig. 5).

777

Figure 5. BnPRP transcripts do not increase in response to ABA. Leaf RNA was isolated from B. napus plants either kept at 22 °C. transferred to 4 °C for 24 h or treated with 0. 10 -4 or 10 -5 M ABA at 22 o for the times indicated. A northern blot was hybridised to the BnPRP cDNA and rehybridised, after removal of radioactivity, to the BnD22 cDNA.

Figure 6. BnPRP transcripts do not increase in response to dehydration. Leaf RNA was isolated from B. napus plants either transferred to 4°C for 24 h or dehydrated until the RWC of the leaves reached 95%, 84% or 65% of the watered control plant. A northern blot was hybridised to the BnPRP cDNA and rehybridised, after removal of radioactivity, to the BnD22 cDNA.

Figure 7. BnPRP transcripts do not increase in response to wounding. RNA was isolated from B. napus leaves wounded by cutting into 25 mm 2 pieces and placed on damp filter paper in Petri dishes for the times indicated. Control samples of wounded tissue were transferred alter 0, 24 and 48 h to 4°C for 24 h. A northern blot was hybridised to the BnPRP cDNA.

Finally, to investigate whether BnPRP gene expression was induced by wounding, leaf tissue was cut into small pieces ca. 25 mm 2 and placed on damp filter

paper inside a Petri dish to prevent dehydration of the

tissue. The wounded tissue was incubated at the nor-

mal growth temperature. The wounded tissue showed

no significant increase in BnPRP transcripts up to 48 h

after wounding (Fig. 7). As a control to ensure that the wounded tissue was still capable of activating gene

expression, wounded tissue incubated for 0, 24 or 48 h at 22 °C was transferred to 4 °C for 24 h. As shown in

Fig. 7, tissue kept in the Petri dish for 24 h after wounding was still capable of increasing BnPRP transcripts in

response to cold, so the lack of induction in response to wounding is unlikely to be due to the experimental con-

ditions employed, The low level of BnPRP transcripts

detected 12 h after wounding was minimal compared

to the level detected after 24 h wounding followed by 24 h cold treatment and was comparable to the low levels occasionally detected in untreated plants.

We examined whether the BnPRP transcript level increased in response to dehydration, which has been observed with some cold-induced genes. The RWC

of the leaves of B. napus plants was reduced to as low as 65% by witholding water, at which point they

appeared wilted. No BnPRP transcripts were detectable in the wilted leaves. As a control to show that suf-

ficient dehydration had occurred to cause changes in gene expression, transcripts were measured for BnD22,

which is induced by dehydration in B. napus [8]. An increase in the level of BnD22 transcripts was observed

at 84% and 65% RWC (Fig. 6) indicating that conditions were appropriate to see transcripts of BnPRP if they had been induced by dehydration.

Discussion

In this paper we report the cloning and characterisa-

tion of a B. napus gene encoding a putative cell wall- plasma membrane linker protein. The gene is specific-

ally cold-induced, which suggests a possible function for BNPRP in cold tolerance.

The structure o f BNPRP

The nucleotide sequence of the B. napus gene, BnPRP,

reveals that is encodes a hybrid-proline-rich protein. It is extremely likely that the incomplete cDNA BnPRP is derived from transcripts of this gene because it

778

is identical in both its coding and 31 non-coding sequences to ABnPRP. Hybridisation analyses of genomic Southern blots suggest that B. napus may contain a small number of genes with sequence similarity to BnPRP [40], but it would be very unlikely for these to share identical non-coding sequences.

The putative BNPRP protein is modular, composed of five distinct domains. The 27 amino acid N-terminal domain has the characteristic features of a signal peptide in both its length and amino acid composition. Sig- nal peptides vary in length between 15 and 30 residues and contain three distinct regions called the n, h and c regions [56]. In BNPRP the n region covers the first 7 to 9 residues and the positive charge is provided by the histidine. The h region is characterised by eleven centrally located apolar residues. The border between the h and c regions is signalled by the serine residue six amino acids from the putative cleavage site. The residues in the - 3 and - I positions of cleavage sites are small and uncharged whereas the residue at the - 2 position is usually large, bulky and charged [56]. In BNPRP the Cys-Glu-Cys residues fit these criteria very well. These features of the N-terminal domain of BNPRP therefore provide strong evidence that it represents a signal peptide and the cleavage site can be defined with confidence. Signal peptides direct proteins into the ER from which they may enter the secretory pathway. Particular amino acid sequences at the C-terminus, KDEL/HDEL in plants [5, 55], cause proteins to be retained in the ER, but these sequences are absent in BNPRE The protein is therefore likely to be secreted.

Both the amino acid composition and the presence of repeating motifs in domains 2 to 4 of BNPRP are characteristic of proline-rich cell wall proteins [24, 27, 50]. Each of the repeating units in these domains has a distinctive core motif, but these do not correspond to any of the common motifs previously identified in PRPs and extensins [24, 27, 50]. However, the PPP and PPVV sub-motifs are found in hybrid-proline-rich proteins. Proline accounts for 50% of the residues in domains 2 to 4 and threonine, valine and lysine are also abundant. These amino acids are common in many cell wall PRPs and extensins [24, 27, 50]. However, the proline-rich domains of BNPRP contain no tyrosine, which is commonly found in PRPs and extensins and believed to have a role in cross-linking with other cell wall components [24, 27, 50]. It is likely that BNPRP would be subject to post-translational modification, as in extensins and PRPs, and it is therefore difficult to predict the mass of the protein in vivo.

The carboxyl domain of BNPRP contains three putative membrane-spanning regions (Fig. 2A). This indicates that the protein is not fully secreted and is anchored in the plasma membrane. Membrane spanning regions are typically composed of ca. 20 apolar residues usually followed by a couple of positively charged residues on the carboxyl side. The lysine residues at positions 320 and 321 follow such a hydrophobic region and mark the carboxyl side of the first putative membrane-spanning segment. The lysine residues at positions 344 and 346 follow a second hydrophobic putative trans-membrane region. This second polar region is predicted to project into the cell wall space. Another lysine residue at position 366 marks the end of the third hydrophobic putative trans-membrane region. The last eleven amino acids at the C-terminus are predicted to be in the cytoplasm. The hypothesis that the C-terminal domain contains membrane-spanning regions is supported by amino acid sequence similarity with other membrane- spanning segments. The highest sequence similarity we have found (88% similarity, 56% identity over 18 amino acids) is between the first (amino) putative membrane-spanning region of BNPRP and the first (amino) membrane-spanning region of the human B cell integral membrane receptor protein CD20 [ 11 ].

The sequence similarity with other hybrid-proline- rich proteins over their carboxyl domains (Fig. 3) is striking. That high sequence similarities exist between both monocots and dicots suggests strong evolution- ary pressures on the carboxyl domains of the proteins, implying that the primary structure is important to their function. The high sequence similarity is primarily due to the carboxyl domain being composed largely of hydrophobic residues. However, a number of residues are conserved in all of the proteins and the cysteine residues, in particular, may play an important role. All eight cysteine residues are conserved in the carboxyl domains of the proteins shown in Fig. 3. The putative positions of these residues are both inside and out- side the membrane and they have the potential to form disulphide linkages with other cysteine residues either in the carboxyl domain or in other proteins embedded in the membrane. The length of the carboxyl domains is also highly conserved between the hybrid-proline-rich proteins.

BnPRP is specifically cold-induced

The BnPRP gene is of interest for its expression as well as its structure. Transcripts which hybridise to

BnPRP are induced by low temperature but not by the other abiotic stresses we have investigated (elevated temperature, dehydration stress and wounding). Only one size of transcript is detected on the northern blots of total RNA and also if poly(A) + RNA is used (data not shown). Transcripts are at very low levels in tissue at normal growth temperatures. If B. napus does contain a small number of genes related to BnPRP, there is no evidence that transcripts of these genes, at least as defined by the hybridisation conditions used here, increase significantly in response to stresses other than low temperature. We have not studied the developmental regulation of BnPRP in any detail and the lack of expression in roots is reported for some other cold-induced genes (e.g. blt4 [19]; BNl l5 [57]).

The relatively rapid increase in BnPRP transcripts in response to low temperature, and the rapid decline in transcript abundance upon removal of the cold stimulus, is comparable to a number of cold-induced genes, although the kinetics of increase and decrease in transcripts reported for different genes vary widely. For example, wheat cor39 and Arabidopsis kinl and ltil40 transcripts reach high levels within several hours of cold treatment [13, 30, 36] whereas the Arabidopsis RCI 1 and RC12 transcripts [20] and those that hybridise to the cDNAs p784, p2201, and p2358 from alfalfa [33] take a number of days to accumulate to maxim- al levels. We do not know whether the rapid increase in BnPRP transcripts in the cold is due to an increase in transcription and/or an increase in transcript stability. Some transcripts, for example of cor39, kinl and BnC24 [13, 30, 45], are lost rapidly after return to normal temperatures whereas others, for example of RC12 [20], are still relatively abundant several days after removal of the cold stimulus. The BnPRP transcripts appear to be very unstable at 22 °C, being undetectable within two hours of transfer from 4 ° C. We did not recognise any known elements in the gene concerned with transcript stability.

The lack of expression in response to heat shock is not unusual for cold-induced genes, since very few appear to be general temperature shock genes. Tran- scripts of the C14 thiol protease gene from tomato are cold-induced and also accumulate in the fruit after heat shock at 40 °C [148]. The only other transcripts that have been shown to accumulate in response to cold treatment and heat shock are from heat shock genes [29, 35].

The majority of cold-induced genes are induced to varying degrees by drought and the application of exogenous ABA [e.g. 15, 19, 30, 36]. However.

779

transcripts of some cold-induced genes are not elevated significantly in response to dehydration and ABA. These include the Arabidopsis RCl l and RCI2 transcripts [20], Wcsl20 from wheat [16] and transcripts hybridising to p784, p2201, p2358 from alfalfa [33]. Evidently several signal transduction pathways can potentially stimulate the promoters of cold-induced genes and the extent of induction by different signals will depend on which cis elements are present in the promoter. Our experiments show that BnPRP is not responsive to ABA concentrations that induce BnD22. The use of BnD22 as a control demonstrated that exogenous ABA had penetrated the leaf cells and was able to stimulate gene expression and, similarly, that water-stressed plants were able to increase BnD22 transcripts. These experiments provide strong evidence that BnPRP expression is not induced by drought and ABA.

The majority of cold-induced genes identified have not been studied in response to wounding. To our knowledge the only cold-induced transcript reported also to be wound-induced is msaCIC [2]. BnPRP transcripts do not increase significantly in response to wounding. The leaf tissue remained viable even though it had been cut into sections, as shown by its capacity to respond to the low-temperature stimulus. Hence an increase in BnPRP transcripts in response to wounding would have been detectable if it had occurred.

The possible.function q['BNPRP in cold tolerance

Direct demonstrations of the functions of cold-induced proteins in cold tolerance in vivo are lacking. The structure of BNPRP suggests a possible function in helping to protect the plant against the potentially damaging effects of low temperature. Freeze-induced cellular dehydration causes a reduction in cell volume, con- traction of the protoplasm and ultimately collapse of the cell [41, 42, 44]. To survive, cells must maintain a close association between the cell wall and plasma membrane under conditions of increasing cellular dehydration [22]. Our hypothesis is that BNPRP may help to maintain cellular integrity in cold-stressed tissue by forming additional strong linkages between the cell wall and plasma membrane. However, it must be emphasised that direct evidence for the location of the protein has not yet been obtained.

Apart from msaCIC, none of the other hybrid- proline-rich protein genes that display high sequence similarity to BnPRP (Fig. 3) have been reported to be cold-induced. These genes are expressed in diverse

780

conditions, including developmental situations where physical stress may be exerted, but only msaCIC and BnPRP respond to any abiotic stress. The potential importance of wall-membrane linker proteins in plant development and responses to environmental stimuli is becoming increasingly recognised. In addition to their proposed role in strengthening wall-membrane interactions, these proteins may be important in con- veying physical stress from the cell wall to the plasma membrane by stimulating stretch-activated ion chan- nels, and in directly or indirectly influencing the organ- isation of the cytoskeleton [43]. Further studies will reveal the precise role of these proteins, and BNPRP in particular, in cold tolerance.

Acknowledgements

W.G. thanks the BBSRC and Zeneca Seeds for a CASE Ph.D. Studentship and J.A.E thanks the Gatsby Charit- able Foundation for a Gatsby Ph.D. Studentship. G.I.J. is grateful for funding from these sources to support this research and thanks Professor Wolfgang Schuch for his encouragement. We thank Professor Alan Ath- erly, Iowa State University, for his interest in this research and for valuable discussions. We are grateful to Dr A. Greenland, Zeneca Seeds, for providing the genomic library, Dr J. Giraudat for the BnD22 cDNA and Norman Tait and Alastair Downie for assistance with the figures.

References

1. Aleith A, Richter G: Gene expression during induction of somatic embryogenesis in carrot cell suspensions. Planta 183: 17-24 (1990).

2. Castonguay Y, Laberge S, Nadeau P, Vrzina L-P: A cold- induced gene from Medicago sativa encodes a bimodular protein similar to developmentally regulated proteins. Plant Mol Biol 24:799-804 (1994).

3. Cattivelli L, Bartels D: Molecular cloning and characterization of cold-regulated genes in barley. Plant Phy sio193: 1504-1510 (1990).

4. Chomczynski P, Sacchi N: Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156-159 (1987).

5. Chrispeels MJ: Sorting of proteins in the secretory system. Annu Rev Plant Physiol Plant Mol Biol 42:21-53 (1991).

6. Coupe SA, Taylor JE, Isaac PG, Roberts JA: Identification and characterization of a proline-rich mRNA that accumulates during pod development in oilseed rape (Brassica napus L.). Plant Mol Biol 23:1223-1232 (1993).

7. Datta N, LaFayette PR, Kroner PA, Nagao RT, Key JL: Isol- ation and characterization of three families of auxin down- regulated cDNA clones. Plant Mol Biol 21:859-869 (1993).

8. Downing WL, Mauxion F, Fauvarque M-O, Reviron M-P, de Vienne D, Vartanian N, Giraudat J: A Brassica napus transcript encoding a protein related to the Kiinitz protease inhibitor family accumulates upon water stress in leaves, not in seeds. Plant J 2:685-693 (1992).

9. Dunn MA, Hughes MA, Pearce RS, Jack PL: Molecular characterization of a barley gene induced by cold treatment. J Exp Bot 41:1405-1413 (1990).

10. Dunn MA, Hughes MA, Zhang L, Pearce RS, Quigley AS, Jack PL: Nucleotide sequence and molecular analysis of the low temperature induced cereal gene, blt4. Mol Gen Genet 229:389-394 (1991).

11. Einfeld DA, Brown JP, Vale.ntine MA, Clark EA, Ledbetter JA: Molecular cloning of the human B cell CD20 receptor predicts a hydrophobic protein with multiple transmembrane domains. EMBO J 7:711-717 (1988).

12. Gilmour SJ, Thomashow MF: Cold acclimation and cold- regulated gene expression in ABA mutants of Arabidopsis thaliana. Plant Mol Biol 17:1233-1240 (1991).

13. Guo W, Ward RW, Thomashow MF: Characterization of a cold-regulated wheat gene related to Arabidopsis cor47. Plant Physiol 100:915-922 (1992).

14. Guy CL: Cold acclimation and freezing stress tolerance: role of protein metabolism. Annu Rev Plant Physiol Plant Mol Biol 41:187-223 (1990).

15. Hajela RK, Horvath DP, Gilmour S J, Thomashow MF: Molecu- lar cloning and expression of cor (cold-regulated) genes in Arabidopsis thaliana. Plant Physio193:1246-1252 (1990).

16. Houde M, Danyluk J, Lalibert6 J-F, Rassart E, Dhindsa RS, Sarhan F: Cloning, characterization, and expression of a cDNA encoding a 50-kilodalton protein specifically induced by cold acclimation in wheat. Plant Physiol 99:1381-1387 (1992).

17. Howarth CJ, Ougham HJ: Gene expression under temperature stress. New Phytol 125:1-26 (1993).

18. Hughes MA, Dunn MA: The molecular biology of plant acclimation to low temperature. J Exp Bot, in press (1996).

19. Hughes MA, Dunn MA, Pearce RS, White AJ, Zhang L: An abscisic-acid-responsive, low temperature barley gene has homology with a maize phospholipid transfer protein. Plant Cell Envir 15:861-865 (1992).

20. Jarillo JA, Capel J, Leyva A, Martinez-Zapter JM, Salinas J: Two related low-temperature-inducible genes of Arabidopsis encode proteins showing high homology to 14-3-3 proteins, a family of putative kinase regulators. Plant Mol Biol 25: 693- 704 (1994).

21. John I, Wang H, Held BM, Wurtele ES, Colbert JT: An mRNA that specifically accumulates in maize roots delineates a novel subset of developing cortical cells. Plant Mol Biol 20:821-831 (1992).

22. Johnson-Flanagan AM, Singh J: Membrane deletion during plasmolysis in hardened and non-hardened plant cells. Plant Cell Envir 9:299-305 (1986).

23. Johnson-Flanagan AM, Singh J: Alteration of gene expression during the induction of freezing tolerance in Brassica napus suspension cultures. Plant Physiol 85:69%705 (1987).

24. Jos6 M, Puigdomrnech P: Structure and expression of genes coding for structural proteins of the plant cell wall. New Phytol 125:259-282 (1993).

25. Josr-Estanyol M, Ruiz-Avilla L, Puigdom6nech P: A maize embryo-specific gene encodes a proline-rich and hydrophobic protein. Plant Cell 4:413-423 (1992).

26. Joshi CP: Putative polyadenylation signals in nuclear genes of higher plants: a compilation and analysis. Nucl Acids Res 15: 9627-9639 (1987).

27. Kieliszewski ML Lamport DTA: Extensin: repetitive motifs, functional sites, post-translational codes, and phylogeny. Plant J 5:157-172 (t994).

28. Knight MR, Campbell AK, Smith SM, Trewavas A J: Transgen- ic plant aequorin reports the effects of touch and cold-shock and elicitors on cytoplasmic calcium. Nature 352:524-526 (1991l.

29. Krishna P, Sacco M, Cherutti JF, Hill S: Cold-induced accu- mulation of hsp90 transcripts in Brassica napus. Plant Physiol 107:915-923 (1995).

3(1. Kurkela S, Franck M: Cloning and characterization of a cold- and ABA-inducible Arabidopsis gene. Plant Mol Biol 15:137 144 (1990).

31. Kyte J, Doolittle RF: A simple method for displaying the hydro- pathic character of a protein. J Mol Biol 157:105-132 (19821.

32. Meza-Basso L, Alberdi M, Raynal M, Ferrero-Cadinanos M-L, Delseny, M: Changes in protein synthesis in rapeseed (Brassica napusI seedlings during a low temperature treatment. Plant Physinl 82:733--738 (1986).

33. Mohapatra SS, Wolfraim L, Poole RJ, Dhindsa RS: Molecu- lar cloning and relationship to freezing tolerance of cold- acclimation-specific genes of alfalfa. Plant Physiol 89:375 380 (19891.

34. Monroy AF, Dhindsa RS: Low-temperature signal transduction: induction of cold acclimation-specific genes of alfalfa by calcium at 25 °C. Plant Cell 7:321-331 (1995).

35. Neven LG, Haskell DW, Guy CL, Denslow N, Klein PA, Green LG. Silverman A: Association of 70-kilodalton heat-shock cognate proteins with acclimation to cold. Plant Physiol 99: 1362-1369 (1992).

36. Nordin K, Heino R Palva ET: Separate signal pathways regu- late the expression of a low-temperature-induced gene in Ara- bidopsis thaliana (L.) Heynh. Plant Mol Biol 16:1061-1071 (19911.

37. Nordin K, Vahala T, Palva ET: Differential expression of two related, low-temperature-induced genes in Arabidopsis thaliana (L.) Heynh. Plant Mol Biol 21:641~553 (19931.

38. Orr W, Keller WA, Singh J: Induction of freezing tolerance in an embryogenic cell suspension culture of Brassica napus by abseisic acid at room temperature. J Plant Physiol 126:23-32 (19861.

39. Orr W, lu B, White TC, Robert LS, Singh J: Complementary DNA sequence of a low temperature-induced Brassica napus gene with homology to the Arabidopsis thaliana Kinl gene. Plant Physiol 98:1532-1534 (19921.

40. Pallas JA: Ph.D thesis, University of Glasgow (1992). 41. Pearce RS: Extracellular ice and cell shape in frost-stressed cer-

eal leaves: a low-temperature scanning-electron-microscopy study. Planta 175:3 t 3-324 (1988).

42. Pearce RS, Ashworth EN: Cell shape and localisation of ice in leaves of overwintering wheat during frost stress in the field. Planta 188:324-331 (19921.

43. Pont-Lezica RF, McNally JG, Pickard BG: Wall-to-membrane linkers in onion epidermis: some hypotheses. Plant Cell Envir 16:111-123 (19931.

781

44. Ristic Z, Ashworth EN: Response of xylem ray parenchyma cells of red osier dogwood (Cornus sericea L.) to freezing stress. Plant Physiol 104:737-746 (19941.

45. Sfiez-Vfisquez J, Raynal M, Meza-Basso L, Delseny M: Two related, low-temperature-induced genes from Brassica napus are homologous to the human turnout bbcl (breast basic conserved) gene. Plant Mol Biol 23: 12l 1-1221 (1993).

46. Salts Y, Wachs R, Gruissem W, Barg R: Sequence coding for a novel proline-rich protein preferentially expressed in young tomato fruit. Plant Mol Biol 17:t49-150 (19911.

47. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (19891.

48. Schaffer MA, Fischer RL: Transcriptional activation by heat and cold of a thiol protease gene in tomato. Plant Physiol 93: 1486-1491 (1990).

49. Shirras AD, Northcote DH: Molecular cloning and characterisation of cDNAs complementary to mRNAs from wounded potato (Solanum tuberosum) tuber tissue. Planta 162: 353-36(I (1984).

50. Showaher AM: Structure and function of plant cell wall proteins. Plant Cell 5:9-23 (19931.

51. Thomashow MF: Molecular genetics of cold acclimation m higher plants. Adv Genet 28:99-131 (1990).

52. Thomashow MF: Genes induced during cold acclimation in higher plants. In: Steponkus PL (ed) Advances in Low Temper- ature Biology, vol 2. pp. 183-210. JAI Press. London (1993),

53. van Berkel J, Salamini E Gebhardt C: Transcripts accumulating during cold storage of potato (Solanum tuberosum L.) tubers are sequence related to stress-responsive genes. Plant Physiol 104:445-452 (1994).

54. van Zee K, Chen FQ, Hayes PM, Close TJ, Chert THH: Cold- specific induction of a dehydrin gene family member in barley. Plant Physiol 1 (18:1233-1239 (1995).

55. Vitale A, Ceriotti A, Denecke J: The role of the endoplasmic reticulum in protein synthesis, modification and intmcellular transport. J Exp Bot 44:1417-1444 (19931.

56. yon Heijne G: Transcending the impenetrable: how proteins come to terms with membranes. Biochim Biophys Acta 947: 3(17-333 (1988).

57. Weretilnyk E, Orr W, White TC, Iu B, Singh J: Characteriz- ation of three low-temperature-regulated eDNAs ti"om winter Brassica napus. Plant Physiol 101 : 171-177 (1993).

58. White A J, Dunn MA, Brown K, Hughes MA: Comparative analysis of genomic sequence and expression of a lipid transfer protein gene family in winter barley. J Exp Bol 45:1885-1892 (1994).

59. White TC, Simmonds D, Donaldson P, Singh J: Regulation of BNI15, a low-temperature-responsive gene from winter Brassica napus. Plant Physiol 106:917-928 (1994).

60. Zhang L, Dunn MA, Pearce RS, Hughes MA: Analysis of organ specificity of a low temperature responsive gene family in rye (Secale cereale L.) I Exp Bot 44:1787-1793 (1993).

Documents

Transcripts of a gene encoding a putative cell wall-plasma membrane linker protein are specifically cold-induced in Brassica napus