TITLE SHORT TITLEdigital.csic.es/bitstream/10261/170104/1/British Journal of Pharmacology_Alten_2018...Hacettepe University Tip Fakultesi Tıbbi Farmakoloji Anabilim Dali Sihhiye 06100

For Peer Review

1

TITLE

High fructose corn syrup consumption in adolescent rats causes bipolarlike behavioural

phenotype with hyperexcitability in hippocampal CA3CA1 synapses

SHORT TITLE

High fructose led to bipolarlike phenotype in adolescent rats

AUTHORS

Baris Alten1, MD, PhD; Metin Yesiltepe1, MD; Erva Bayraktar1, MSc; Sadik Taskin Tas1,

MD, PhD; Ayse Yesim Gocmen1, PhD; Canan Kursungoz2,3, PhD; Ana Martinez4, PhD;

Yildirim Sara1*, MD, PhD.

1Medical Pharmacology Department, Hacettepe University Faculty of Medicine, 06100 Ankara Turkey

2Materials Science and Nanotechnology Department, Bilkent University, 06800 Ankara Turkey

3National Nanotechnology Research Center (UNAM), Bilkent University, 06800 Ankara Turkey

4Centro de Investigaciones BiologicasCSIC, Ramiro de Maeztu 9, 28040 Madrid Spain

*Corresponding author

Hacettepe University Tip Fakultesi Tıbbi Farmakoloji Anabilim Dali Sihhiye 06100 Ankara Turkey

Correspondance: [email protected], [email protected], +90 312 305 10 86

Word Count: 3389

Page 11 of 49

British Pharmacological Society

British Journal of Pharmacology

For Peer Review

2

ACKNOWLEDGEMENTS

Baris Alten would like to thank Dr. Elif Haznedaroglu and Atagun Ulas Isiktas for their

neverending support. The authors would also like to thank Dr. M. Emre Gedik and Dr. A.

Lale Dogan for their valuable contributions. Ana Martinez is a member of the CIB Intramural

Program “Molecular Machines for Better Life” (MACBET). Funding from Hacettepe

University Scientific Research Project Coordination Unit (Grant no. TSA201715515 to

Yildirim Sara) and partial funding from MINECO (Grant no. SAF201237979C0301 and

SAF201676693R to Ana Martinez) are acknowledged. The authors declare no conflict of

interest.

Page 12 of 49



For Peer Review

3

ABSTRACT

Background and Purpose. Children and adolescents are the top consumers of high fructose

corn syrup (HFCS) sweetened beverages. Even though the cardiometabolic consequences of

HFCS consumption in adolescents are well known, the neuropsychiatric consequences have

yet to be determined.

Experimental Approach. Adolescent rats were fed for a month with 11% weight/volume

carbohydrate containing HFCS solution, which is similar to the sugar sweetened beverages of

human consumption. The metabolic, behavioural and electrophysiologic characteristics of

HFCSfed rats were determined. Furthermore, the effects of TDZD8, a highly specific GSK

3 inhibitor, on the HFCSinduced alterations were further explored.

Key Results. HFCSfed adolescent rats displayed bipolarlike behavioural phenotype with

hyperexcitability in hippocampal CA3CA1 synapses. This hyperexcitability was associated

with increased presynaptic release probability and increased density of postsynaptic AMPA

receptors, due to decreased expression of the neuronspecific α3subunit of Na+/K+ATPase

(NKA) and an increased ser845phosphorylation of GluR1 subunits of AMPA receptors,

respectively. TDZD8 treatment was found to restore behavioural and electrophysiological

disturbances associated with HFCS consumption by inhibition of GSK3, the most probable

mechanism of action of lithium for its moodstabilizing effects.

Conclusion and Implications. This study shows that HFCS consumption in adolescent rats

led to bipolarlike behavioural phenotype with neuronal hyperexcitability, which is known to

be one of the earliest endophenotypic manifestations of bipolar disorder. Inhibition of GSK3

with TDZD8 attenuated hyperexcitability and restored HFCSinduced behavioural

alterations.

Keywords: high fructose corn syrup, bipolar disorder, hyperexcitability, GluR1, AMPA,

GSK3, TDZD8

Abrreviations

HFCS – High Fructose Corn Syrup SSB – Sugar sweetened beverage T2DM – Type 2 diabetes mellitus BD – Bipolar Disorder NKA Na+/K+ATPase OGTT – Oral glucose tolerance test

OFA – Open Field Arena EPM – Elevated Plus Maze FST – Forced Swim Test MWM – Morris Water Maze FUST – Female Urine Sniffing Test

Page 13 of 49



For Peer Review

4

BULLET POINT SUMMARY

What is already known:

• High fructose corn syrup (HFCS) is one of the most important nutritional cause of

type 2 diabetes mellitus (T2DM) in children and adolescents.

• T2DM and bipolar disorder are recently recognized comorbidities.

What this study adds:

• HFCS consumption in adolescent rats causes bipolarlike behavioural phenotype with

neuronal hyperexcitability.

• Inhibition of GSK3 with TDZD8 succesfully restored HFCSinduced alterations.

Clinical Significance:

• The relationship between HFCS consumption and emergence of bipolarlike

behaviours should be investigated in clinical settings.

• Specific GSK3 inhibitors may be valuable therapeutics in bipolar patients with

comorbid T2DM.

Page 14 of 49



For Peer Review

5

INTRODUCTION

The streamlining of the production process for high fructose corn syrup (HFCS) in 1970s has

led this new product to gradually replace sucrose and other commonly used sweeteners. Since

then, HFCS consumption has increased rapidly through the increased consumption of sugar

sweetened beverages (SSBs), in which HFCS is used as the major caloric sweetener (Marriott

et al., 2009). Since the top consumers of SSBs are adolescents rather than adults, adolescents

have the highest estimated mean intake of fructose among all age groups (Vos et al., 2008,

Marriott et al., 2009). When total caloric intake was accounted for, this continuous rise in the

consumption of HFCS is found to be the most important nutritional factor causing increased

prevalence of type 2 diabetes mellitus (T2DM) (Gross et al., 2004). Today, it has been very

well characterized that the fructose is the reason for the development of HFCSinduced

insulin resistance, fatty liver and hypertriglyceridemia (Lim et al., 2010, Baena et al., 2016).

Even though the cardiometabolic consequences of HFCS consumption in adolescent period

have been relatively studied (Pollock et al., 2012), the neuropsychiatric consequences have

yet to be determined.

Rapidly increasing evidence suggests that psychiatric diagnoses, especially bipolar disorder

(BD), are significantly more common in patients with T2DM (Wandell et al., 2014, Charles et

al., 2016). BD is a genetically heterogeneous, highly heritable and devastating condition with

a mean prevalence of 1.8% in children and adolescents (Van Meter et al., 2011). It is the

fourth leading cause of disability adjusted life years among the adolescents (Gore et al.,

2011). Unfortunately, the pathophysiology of BD and how T2DM is linked to BD remain

unknown.

One of the prominent hypotheses for the mechanism of BD is that a primary or secondary

dysfunction of Na+/K+ATPase (NKA) predisposes or even directly causes the clinical

manifestations (Singh, 1970, elMallakh and Wyatt, 1995). In the central nervous system

(CNS), the catalytic αsubunit of NKA exists as three isoforms: α1 and α2 are found in both

neurons and glia, whereas α3 is exclusively expressed in neurons (Dobretsov and Stimers,

2005). Several single nucleotide polymorphisms across all three α isoforms have been

associated with the BD (Goldstein et al., 2009). Furthermore, intracerebroventricular

administration of ouabain, an inhibitor of NKA, is widely recognized as a valid animal model

of mania (ElMallakh et al., 2003). Mice carrying an inactivating mutation in neuron specific

Page 15 of 49



For Peer Review

6

α3subunit of NKA showed a behavioural phenotype resembling those of patients with BD

(Kirshenbaum et al., 2011). It is still not known how this decrease in NKA amount and/or

activity translates to the behavioural changes evident in patients with BD. Interestingly,

diabetes was shown to decrease the amount and/or activity of NKA in different brain regions

(Leong and Leung, 1991). The region with the greatest and most significant decrease in NKA

activity in the brain was the hippocampus (Leong and Leung, 1991), which is known to be

involved in pathophysiology of BD.

Apart from the NKA hypothesis, growing evidence suggests that neuroplasticity plays a

central role in the pathophysiology and treatment of BD (Schloesser et al., 2008, Zarate et al.,

2006). Specifically, the modulation of AMPA receptor trafficking has gained attention

because of being a target for the two most common mood stabilizing agents: lithium and

valproate (Du et al., 2004b). Chronic treatments with therapeutically relevant concentrations

of lithium or valproate were shown to decrease the synaptic expression of GluR1 subunit of

AMPA receptors in the hippocampus by attenuating ser845phosphorylation of GluR1 (Du et

al., 2003, Du et al., 2004a, Du et al., 2008). Increased AMPA receptor density in synapses is

thought to be necessary for the emergence of bipolarlike behavioural phenotype, as AMPA

antagonists attenuates amphetamineinduced hyperactivity (Du et al., 2008). In addition to

postsynaptic alterations, presynaptic changes were also linked to BD. One study reported

increased glutamate levels in postmortem human bipolar brains (Lan et al., 2009). Magnetic

resonance spectroscopy studies further supported the increased glutamate levels in brains of

bipolar patients (Yuksel and Ongur, 2010). In addition, both lithium and valproate were

shown to decrease the synaptic glutamate levels (Dixon and Hokin, 1998, Hassel et al., 2001).

Last but not least, a recent study showed that hippocampal neurons of patients with BD had

hyperexcitability, which was reversed by lithium only in neurons derived from patients who

also clinically responded to lithium (Mertens et al., 2015). This study clearly demonstrates

that hyperexcitability is not only a coincidental feature seen with bipolar disorder, but also a

feature contributing to the pathophysiology of it.

In this study, we hypothesized that the consumption of HFCS causes bipolarlike behavioural

phenotype in adolescent rats. In addition, we have investigated the electrophysiological and

molecular effects of HFCS consumption on hippocampal synaptic function as both neuronal

hyperexcitability and decreased NKA levels might explain the association between HFCS

consumption and bipolarlike behavioural phenotype. As previous studies suggested that the

Page 16 of 49



For Peer Review

7

HFCSinduced inflammation might cause the associated neuropsychiatric disturbances (Hsu

et al., 2015), we have also investigated the changes in proinflammatory cytokines in serum

and hippocampi of HFCSfed adolescent rats. Previous literature also demonstrated that

hippocampal insulin receptors respond to insulin similar to insulinresponsive peripheral

tissues (Grillo et al., 2009) and become resistant to insulin in response high fructose

consumption (Mielke et al., 2005). Moreover, hippocampal functions were found to be

impaired when the expression of insulin receptors and insulin receptor substrate (IRS) in

hippocampal neurons were decreased (Grillo et al., 2015, Costello et al., 2012). We

investigated whether HFCSinduced alterations are due to impaired insulin pathway in

hippocampi of HFCS fed rats.

Inhibition of GSK3 has been shown to be the mechanism of action for lithium and other

commonly used moodstabilizers for their moodstabilizing effect. (Klein and Melton, 1996,

Gould et al., 2004a, Ryves and Harwood, 2001, De Sarno et al., 2002, ChaleckaFranaszek

and Chuang, 1999, Li et al., 2004, Gould and Manji, 2005). Recently developed highly

specific GSK3 inhibitors were proven to have moodstabilizing effects on animal models of

BD, suggesting that the primary mechanism of action of lithium is, indeed, inhibition of GSK

3 (Kalinichev and Dawson, 2011, Gould et al., 2004b, KaidanovichBeilin et al., 2004,

Valvassori et al., 2017). In addition to pharmacological interventions, genetic manipulations

of GSK3 activity further support this hypothesis (O'Brien et al., 2004, Polter et al., 2010,

Prickaerts et al., 2006). Because of these indisputable evidences suggesting the critical role of

the inhibition of GSK3 in the treatment of BD, we decided to investigate the effects of

TDZD8, a highly specific inhibitor of GSK3 (Martinez et al., 2002), on HFCSinduced

alterations.

Page 17 of 49



For Peer Review

8

METHODS

Animals. Male Wistar Albino rats (Kobay, Turkey) of 21 days of age, weighing 4555 g at

the time of arrival, were housed as triplets in polycarbonate cages with wood shaving

beddings on a 12/12 h light/dark schedule (lights on at 7:00 am) in a temperature (2022°C)

and humidity (4050%) controlled room. No enrichment in the cages was provided other than

what was mentioned above. Rats were given 4 weeks for acclimation prior to any procedure

and handled in order to familiarize rats with the experimenter. All experiments and tissue

harvesting were done in the light cycle. All procedures were approved by the Hacettepe

University Animal Experimentations Ethics Board, necessitating the standards of ARRIVE

and NIH (No: 2016/1208).

Determination of Sample Size. The number of animals for each group in behavioural,

electrophysiological, qRTPCR and ELISA experiments is calculated using two separate

methods (Charan and Kantharia, 2013). (I) First, G*Power program (Duesseldorf University,

Germany) was used to calculate number of subjects using power analysis. The desired α error

(type I error) probability was set as 0.05, and power was set as 0.8 (1β, 1 type II error

probability). These values yielded a total sample size of 30, which equates to 10 animals per

group. (II) The second method used for the calculation of the number of animals for each

group was the resource equation. The criterion for this method is that total number of

animalstotal number of groups should be between 10 and 20. According to this method, the

maximum number of animals to be used for the experiment is 21, which equals to 7 animals

per group. Thus, it was decided to determine a number between these two values that two

different methods has given to us. Considering the possible attrition/death and also the 3R

policies, we have decided on using 9 animals per group. OGTT protocol used 10 animals per

nondrug group and 5 animals for drug group due to the shortage of TDZD8. 3 rats (1

rat/group) allocated to open field arena and female urine sniffing test on the same day were

excluded due to error in system causing loss of data. 12 rats (4 rat/group) were used for

intracerebroventricular insulin administration and immunoblotting experiments.

Diets. Control group had ad libitum access to tap water and chow, whereas HFCS group had

ad libitum access to a HFCS solution containing 11% weight/volume (w/v) carbohydrate and

chow. HFCS group was not presented with tap water in addition to HFCS solution, as SSB

consumption in humans is associated with low plain water intake (Park et al., 2012). Diets

Page 18 of 49



For Peer Review

9

were started when rats were on postnatal day 21 and continued for 6 weeks (Figure 1a). Chow

and liquid consumptions were tracked twice weekly for the first 4 weeks prior to allocation of

rats to vehicle or TDZD8 treatments.

Treatments and Experimental Groups. TDZD8, synthesized by Dr. Ana Martinez in CIB

CSIC laboratories following described procedures (Martinez et al., 2002), was dissolved (0.4

mg/ml) in 1% DMSO containing normal saline. 2 mg/kg of TDZD8 was daily given to

HFCSfed rats intraperitoneally for 14 days (TDZD-8 group). The TDZD8 dose was

determined from the previous literature (Collino et al., 2008). The control group (Control

group) and a separate set of HFCSfed rats (HFCS group) were given the vehicle solution in

equivalent volume and treatment duration. The rats were allocated to experimental groups

randomly and undergone to experiments simultaneously in order to prevent the interference

from seasonal variations.

Oral Glucose Tolerance Test (OGTT). In order to assess the glucose intolerance and

confirm the development of insulin resistance, rats received an OGTT after 14 days of vehicle

or TDZD8 treatment. In order to provide an easy access to tail vein blood, tail tips were cut

(23 mm in length) using a sterile technique under local anaesthesia (lidocaine pomade 5%), a

day before the OGTT. Prior to the OGTT, rats were fasted for 6 h. Blood samples were taken

before and after the administration of 2 mg/kg glucose solution by oral gavage at 0 min. The

clots on the tail tips were gently removed to obtain each blood sample. The first drop of blood

was removed by a sterile gauze, and the second drop was used for the assessment of blood

glucose levels with a handheld glucometer (AccuChek Performa Nano, Roche, Switzerland).

Behavioural Experiments. Rats were tested in a series of behavioural experiments after a

week of treatment with either vehicle or TDZD8. The first behavioural experiment was

carried out 30 min after the vehicle or TDZD8 administration. The experiments were

conducted in an order from the least stressful to the most stressful for the rats. To avoid any

scentinduced cues, surfaces and equipments were cleaned between each experiment with

70% ethanol solution. Animal tracking and recording was performed using an inhouse

developed tracking software (Yucel et al., 2009, EvranosAksoz et al., 2017).

Page 19 of 49



For Peer Review

10

Open Field Arena (OFA). OFA was used to assess the locomotion of rats. Rats were placed

in the center of a transparent glass open field (45 cm × 45 cm × 45 cm) and allowed to freely

explore for 1 h. Total distance traveled was recorded and analyzed.

Elevated Plus Maze (EPM). A plusshaped maze composed of four perpendicular arms (40

cm × 15 cm) elevated 1 m above the ground was used for the experiment. Two opposing arms

were enclosed by 45 cm high opaque walls. Rats were placed at the center of arms, facing an

open arm. This test relies on rats’ intrinsic propensity towards the dark and enclosed places

(closed arms), and fear of heights/open places (open arms). The time spent and distance

travelled in the open and closed arms were recorded and analyzed for 5 min.

Morris Water Maze (MWM). Morris water maze was performed as previously published

(Vorhees and Williams, 2006). The water maze apparatus was a black circular pool with the

diameter of 180 cm. The pool was filled approximately halfway with warm water (2223°C).

The interior of the pool was featureless as possible, except for 4 visual cues attached. A black

cylindrical platform (height of 40 cm, diameter of 12 cm) was placed in the middle of the

northwest quadrant. The platform was hidden as it was submerged 12 cm below the water

surface. Briefly, each rat received 4 acquisition trials per day, for 4 consecutive days. The

rats were placed into the pool, facing towards the pool wall. The starting position in each trial

was different in order to prevent the rat to memorize a path to platform instead of spatially

learning where the platform was. In addition, the order of this various starting positions was

also different in different acquisition days. After the rat was placed into the water, it was

given 2 min to find the platform. If the rat fails to find it within the allotted time, it was gently

guided by the experimenter towards the platform. When the rat found the platform, it was

kept there for 15 s in order to appreciate and learn where the platform was located compared

to visual cues. The latencies to find the hidden platform were recorded. 48 h after the last

acquisition trial, a probe trial was performed. In the probe trial, the hidden platform was

removed and the rat was placed into the water from a novel starting point that it had not been

used before. This ensured that rats’ quadrant preference was an indication of true spatial

memory, rather than a memorized specific swim path. Rats were allowed to swim freely for

60 s. Time spent in the target quadrant (the quadrant where the platform was located in the

acquisition trials) was recorded.

Page 20 of 49



For Peer Review

11

Female Urine Sniffing Test (FUST). Female urine sniffing test was performed as previously

described (Malkesman et al., 2010). Female urine sniffing test is a nonoperant test used to

assess the sexual rewardseeking behaviour (hedonic behaviour). This test depends on the

appetitive response of male rats towards the pheromonal odors found in the urine of female

rats. In order to maximize the attractiveness of the urine, it was collected from female rats that

are in the estrus phase of their menstrual cycle, as determined by evaluating vaginal smears

obtained from several female rats daily. Male rats were presented a cotton swab dipped into

distilled water or female urine in two consecutive 3 min sessions separated by an interval of

45 min. The duration of sniffing the tip of the cotton swab was recorded and analyzed.

Forced Swim Test (FST). Forced swim test is the experimental paradigm of learned

helplessness. The apparatus was a 50 cm tall glass cylinder (diameter of 20 cm) which was

filled to a depth of 30 cm with warm water (2325 oC). Forced swim test was performed in 2

sessions separated by 24 h, as described previously (Castagne et al., 2010). The first 15 min

session was to teach the rats that there were no possible ways to escape from the apparatus. In

the second session, which lasted 5 min, the duration of immobility was analyzed from the

recordings. The immobile behaviour in the swim test is thought to reflect the failure to keep

performing escapedirected behaviour due to the behavioural despair learned in the first

session.

In vivo Electrophysiology. TDZD8 or vehicle was administered 30 min before the

electrophysiology experiments. Rats were anesthetized with intraperitoneal administration of

1.4 g/kg urethane (SigmaAldrich, Germany). The depth of anaesthesia was confirmed and

tracked by the absence of toe withdrawal reflex, regularity and depth of respirations (gross

observation) and heart rate (ECG) throughout the electrophysiology experiment. Afterwards,

they were placed into a stereotaxic frame (Stoelting Co., IL, USA) and their body

temperatures were kept constant by using a blanket control unit (Harvard Apparatus, MA,

USA). A midline incision exposing both lambda and bregma was performed. Burr holes

providing access to ventral hippocampal commissure (VHC) (AP 1.2mm, ML 0.1 mm, D

4.5mm) and CA1 (AP 3.9mm, ML 2.2mm, D 2.5mm) areas of the hippocampus were

opened. A stimulating bipolar stainlesssteel electrode was placed into VHC. A recording

borosilicate electrode filled with calciumfree artificial cerebrospinal fluid was placed into

CA1. A goldplated ground electrode was placed through a hole opened on the occipital bone.

The Schaffer collaterals passing through the VHC were stimulated every 20 s with 0.1 ms

Page 21 of 49



For Peer Review

12

pulses using a stimulator (S44, Grass Instruments, RI, USA) isolated from the recording

system with a stimulus isolation unit (SIU5, Grass Instruments) to evoke CA1 field excitatory

postsynaptic potentials (fEPSPs) and field population spikes (pSpikes). The locations of both

electrodes were optimized in order to obtain the maximal response possible. The evoked

fEPSPs and pSpikes from stratum radiatum and stratum pyramidale were recorded and

amplified with a headstage (Batiray, YSED, Turkey) and an amplifier (Kaldiray EX2C,

YSED) and digitized by a data acquisition system (PowerLab 8/SP, ADInstruments,

Australia). Data recordings and analysis were done by using LabChart software (AD

Instruments, Australia) and MiniAnalysis (Synaptosoft Inc., GA, USA), respectively. Input

output curves were constructed by applying stimuli with increasing intensities, ranging from 1

V to 15 V. The slopes of fEPSPs and the amplitudes of pSpikes were normalized according to

the maximal response obtained from that particular recording. Rats with poor quality

recordings indicating the poor location of either of the electrodes, severe bleeding or death

during experiment (maximum of 1 rat/group) were excluded from the experiment/analysis.

Pairedpulse facilitation and inhibition phenomena were assessed by applying pairedpulses

with varying interpulse intervals at a stimulus intensity evoking 50% of maximum response.

The rats were sacrificed afterwards and hippocampi were extracted as described below for

qRTPCR and ELISA experiments.

Intracerebroventricular Insulin Injection. A different set of 6 h fasted rats were

anesthetized with urethane and placed into the stereotaxic frame after the confirmation of the

depth of the anaesthesia as described previously. A burr hole was opened to provide access to

the third ventricle from the midline using the following coordinates: AP 4.4mm, D 4.3mm. A

total volume of 6 µl of 6 mU human recombinant insulin (SigmaAldrich, Germany) was

infused using a 10 µl Hamilton syringe driven by an inhouse developed motorized injector in

10 min. The needle was left in place for additional 20 min, until the rats were decapitated

while still under anaesthesia. The dose of insulin and the time between the initiation of insulin

infusion and decapitation (30 min) were determined based on previous literature (Grillo et al.,

2009). The rats were sacrificed afterwards while they were still under anasthesia and

hippocampi were extracted as described below for immunoblot experiments.

Decapitation and Tissue Collection. Rats were killed by decapitation under urethane

anaesthesia after the completion of electrophysiology experiments or intracerebroventricular

insulin administration, and brains were extracted and immediately put into icecold PBS

Page 22 of 49



For Peer Review

13

solution. Isolation of both hippocampi was performed on an icecold plate in less than a

minute. Hippocampi were put into either RNAlater (Qiagen, Germany), homogenization

buffer supplied by the Plasma Membrane Protein Isolation Kit (ab65400, Abcam, United

Kingdom) or frozen immediately for further qRTPCR, western blot and ELISA studies,

respectively. Total trunk blood was collected and centrifuged at 7000×g for 10 min to

separate the serum, which was stored at 80°C. Inguinal, epididymal, mesenteric, perirenal,

retroperitoneal, and subscapular fat pads were dissected and weighted immediately.

Protein Isolation, Determination of Protein Levels of Lysates and Immunoblotting. A

commercially available Plasma Membrane Protein Isolation Kit (ab65400, Abcam) was used

and the isolation was performed according to the manufacturer’s protocol. Tablets containing

phosphatase inhibitors (ROCHE PhosSTOP, Roche Diagnostics, Germany) were dissolved in

the homogenization buffer provided by the protein isolation kit, which already included a

cocktail of protease inhibitors. Protein concentrations were determined using commercially

available RC DC Protein Assay (BioRad, CA, USA). Extracted protein samples (10 g) from

rat hippocampus were loaded and ran on a 10% acrylamide gel (TGX StainFree FastCast

Acrylamide Solution, BioRad) at 90 V for 90 min. Proteins were transferred to PVDF

membranes using TransBlot Turbo Transfer System (BioRad) at 25 V for 7 min. Blots were

blocked for 1 h at room temperature with 5% nonfat dry milk in TBST BlottingGrade

Blocker (BioRad), and subsequently probed with their relevant antibodies at 1:1000 dilution

overnight at 4°C. The following primary antibodies were used in immunoblot experiments:

Akt (#4691, CST, MA, USA), pAktThr308 (#13038, CST), pAktSer473 (#4060, CST),

GSK3 (#9336, CST), pGSK3Ser9 (#9322, CST), GluR1 (#13185, CST), pGluR1Ser845

(#8084, CST), NMDAR2A (#M264, SigmaAldrich), NMDAR2B (#14544, CST), βactin

(#3700, CST). AntiRabbitECL secondary (ab97051, Abcam) at a concentration of 1:100000

was applied for 1 h at room temperature, blots were briefly washed in TBST and then TBS,

then incubated with Immobilon ECL substrate (Merck Millipore, Germany) for 5 min in the

dark. Blot images were obtained using Kodak GEL Logic 1500 Transilluminator Integrated

Imaging System (Kodak, NY, USA). PageRuler Prestained Protein Ladder 10180 kDa

(Thermo Fisher Scientific) was used as size standards. The intensities of the target bands were

normalized according to the intensities of the corresponding betaactin bands. Relative change

of protein levels was reported as fold changes of the control group.

Page 23 of 49



For Peer Review

14

RNA Isolation, cDNA Synthesis and qRTPCR. Gene specific primers (Sentegen, Turkey)

were designed to bypass at least one intronic sequence to reduce the possibility of binding to

contaminating DNA (Table 1). Total RNA isolation was performed by Trizolchloroform

extraction method (Rio et al., 2010). Total RNA concentration and RNA purity were

determined by µDrop plate (Thermo Fisher Scientific, MA, USA). Afterwards, total RNA

was reverse transcribed into cDNA using gene specific primers by RevertAid First Strand

cDNA Synthesis Kit (Thermo Fisher Scientific). qRTPCR was performed using SYBR

Green JumpStart Taq ReadyMix (SigmaAldrich). GAPDH was used as housekeeping control

for all samples. Relative expression of the target genes was reported as fold changes of the

control group, according to the efficiency corrected Ct method (Pfaffl, 2001).

ELISA. Commercially available ELISA kits (Elabscience, MD, USA) for rat TNFα (EEL

R0019), IL1β (EELR0012), and IL6 (EELR0015) were performed according to the

manufacturer’s instructions. The total protein levels of hippocampal lysates were determined

by using RC DC Protein Assay (BioRad, CA, USA). Absorbance measurements were carried

out by Multiskan GO spectrophotometer (Thermo Fisher Scientific).

Statistical Analysis. Data was presented as mean±standart error. Statistical analyses were

performed by GraphPad Prism (GraphPad Software Inc., CA, USA). Student’s ttest or

analysis of variance (ANOVA, oneway or twoway) followed by Tukey’s post-hoc test was

used when there were 2 or 3 groups to compare, respectively. Post-hoc tests were not

performed when F values of ANOVA are not significant. p<0.05 was considered as

statistically significant. *, †, and ‡ were used to demonstrate statistical significance between

control vs. HFCS, HFCS vs. TDZD8, and control vs. TDZD8, respectively.

Materials. Suppliers of all commercial kits, drugs and chemicals used in this study were

mentioned in their corresponding subsections in the “Methods” section.

Page 24 of 49



For Peer Review

15

RESULTS

HFCS consumption caused a reduction in chow consumption and increased body fat

percentage with a slight decrease in total body mass.

After the first week, HFCS group consumed significantly more liquid when compared to the

water consumption of control group (Figure 1b). Even though both groups had free access to

chow, HFCS intake caused a significant reduction in weekly chow consumption (Figure 1c).

After the first 2 weeks, the mean body weight of HFCSfed rats was less than that of the

control group significantly (Figure 1d). However, HFCS rats had a significant increase in the

weight ratio of their fat pads, suggesting an increase in fatty body mass and a reduction in

lean body mass (Figure 1h).

HFCS consumption increased fasting blood glucose levels and caused glucose

intolerance as evident in OGTT.

HFCS consumption caused elevated blood glucose levels after 6 h of fasting as well as at the

end of the OGTT (Figure 1e and 1f). Area under the OGTT curve was higher in HFCS group

compared to the control group (Figure 1g). High fructose feeding was already shown to

induce insulin resistance and T2DM in rodents and nonhuman primates (Panchal and Brown,

2011, Bremer et al., 2011). Therefore, we have only performed OGTT and did not proceed

with further tests.

HFCS consumption caused spontaneous hyperlocomotion, decreased anxiety, increased

risktaking behaviour, hyperhedonia and susceptibility to behavioural despair.

Inhibition of GSK3 with TDZD8 was able to reverse HFCSinduced behavioural

disturbances.

In order to assess spontaneous locomotion, individual rats were placed in the OFA. Rats

consuming HFCS travelled more compared to the rats of the control group (Figure 2a and 2b).

To measure anxiety and risktaking behaviour, EPM was conducted. HFCS group had an

increased time spent in open arms compared to the control group, which suggests decreased

anxiety and increased risktaking behaviour (Figure 2c and 2d). Moreover, HFCSfed rats

were actively exploring the open arms, as evident in increased distance travelled in the open

arms (Figure 2e). In order to assess the changes in both social and sexual rewardseeking

behaviours, the FUST was carried out. Both control and HFCS groups had significantly

increased sniffing durations when presented with female urine after distilled water. When

Page 25 of 49



For Peer Review

16

groups were compared to each other, HFCS group had significantly higher sniffing duration

of female urine compared to the control group (Figure 2f). In FST, HFCS group had

significantly higher duration of immobility compared to the control group (Figure 2g). To

sum up, HFCS consumption caused a spontaneous hyperlocomotion, decreased anxiety,

increased risktaking behaviour, hyperhedonia and susceptibility to behavioural despair.

As expected, treatment with TDZD8, a GSK3 inhibitor, reversed the HFCSinduced

hyperlocomotion, decreased anxiety, hyperhedonia and susceptibility to behavioural despair

back to control levels (Figure 2ag).

HFCS consumption impaired hippocampal spatial learning.

In this study, hippocampus dependent spatial learning and memory was assessed by Morris

water maze. The swim speeds of groups were not significantly different from each other

(Figure 2h, inlet), suggesting the rats did not suffer from any motor disability. HFCSfed rats

were significantly worse in finding the hidden platform on the first acquisition day, which

was not reversed by TDZD8 treatment (Figure 2h). Even though it is not statistically

significant, HFCS group performed worse compared to control and TDZD8 groups until the

last acquisition day. However, the time spent in target quadrant in the probe trial assessing

longterm spatial memory was not significantly different between groups (Figure 2i).

HFCS consumption caused hyperexcitability without altering GABAergic inhibitory

activity in rat CA3CA1 synapses, which was restored by TDZD8.

In order to assess the changes in the synaptic strength of HFCSfed rats, Schaffer collaterals

were stimulated and field potentials from the stratum radiatum (synaptic layer) of CA1 region

were recorded. The inputoutput curve of fEPSP slopes shifted significantly towards left in

the HFCS group, whereas TDZD8 caused a rightwardshift, turning HFCSinduced

hyperexcitability back to normal (Figure 3a). In paired pulse paradigm, HFCS consumption

impaired normal paired pulse facilitation when the interpulse interval was 20 ms. In addition,

TDZD8 treatment was unable to restore this impairment in stratum radiatum pairedpulse

facilitation. With greater interpulse intervals, no significant differences were found between

groups (Figure 3b).

In addition, we aimed to assess the activity of GABAergic interneurons finetuning the

cumulative response of the pyramidal neurons. Here, we placed the recording electrode into

Page 26 of 49



For Peer Review

17

the stratum pyramidale (soma layer) to record field pSpikes. The inputoutput curves yielded

a similar trend to that observed in stratum radiatum (Figure 3c), but there were no significant

differences between groups in any of the interpulse intervals applied in pairedpulse

paradigm. (Figure 3d).

Neuronal hyperexcitability was accompanied with increased ser845phosphorylation of

GluR1 subunit of AMPA receptors, maintaining an increased available pool of AMPA

receptors to be readily incorporated into the postsynaptic membrane.

Ser845phosphorylation of GluR1 subunits of AMPA receptors maintains a readily available

pool of AMPA receptors to be incorporated to the postsynaptic density. In hippocampi of

HFCS fed adolescent rats, the ratio of ser845phosphorylated GluR1 to total GluR1 was

higher compared to control group, which was reversed by TDZD8 treatment (Figure 4d and

4e). In contrast, NMDAR2A and NMDAR2B subunits of NMDA receptors were found to be

unchanged (Figure 4f and 4g).

HFCS consumption in adolescent rats did not cause local insulin resistance in

hippocampus.

After intracerebroventricular administration of insulin, the ratios of ser473 and thr308

phosphorylated Akt to total Akt protein levels were found to be similar between groups

(Figure 4a and 4b). Thr308phosphorylated Akt cannot be detected by immunoblot unless

hippocampi are stimulated by insulin, which confirms the appropriateness of

intracerebroventricular insulin administration. In addition, no significant difference was

observed for the ratio of ser9phosphorylated GSK3 to total GSK3 protein levels (Figure

4c).

HFCS consumption in adolescent rats caused decreased transcription of neuron specific

α3subunit of NKA in hippocampus.

We tested whether there is a decrease in the levels of αsubunits of NKA in the hippocampi of

HFCSfed adolescent rats. While no significant differences in the mRNA levels of α1 and

α2subunits were observed, a significant reduction in the transcription of the neuronspecific

α3subunit was detected in the hippocampi of HFCSfed rats (Figure 4hj). However, TDZD

8 was unable to restore HFCSassociated reduced expression of α3subunit of NKA.

Page 27 of 49



For Peer Review

18

A systemic inflammatory response was evoked by HFCS consumption, but not locally in

the hippocampus.

Here, whether HFCS consumption has caused an increase in serum and hippocampus levels

of proinflammatory markers, namely IL1β, IL6 and TNF α, was tested, indicating systemic

inflammation and local neuroinflammation, respectively. As expected, the levels of all three

proinflammatory markers were found to be increased in serum of HFCSfed rats, and returned

back to normal in TDZD8treated rats (Figure 5ac). However, the differences of

hippocampal levels of proinflammatory markers were statistically insignificant with ANOVA,

thus no posthoc tests were performed (Figure 5df).

Page 28 of 49



For Peer Review

19

DISCUSSION

HFCS group consumed more liquid when compared to tap water consumption of control

group, as HFCS is highly palatable (Ackroff and Sclafani, 2011). In this study, we did not

present tap water to HFCS group to mimic the low plain intake of adolescents with SSB

consumption (Park et al., 2012). Interestingly, HFCSfed rats decreased their chow intake

significantly, which was also previously observed in a similar study done with mice (Jurgens

et al., 2005). Increased HFCS solution with a reduction in chow intake may be the underlying

reason of why HFCSfed rats gained relatively less weight after the second week of tracking

period. This is not compatible with human consumption, because humans tend to consume

SSBs without reducing their solid food intake, causing calories from SSBs to be “addon”

(Bray, 2013). As a limitation of our design, both lack of tap water intake with forced HFCS

consumption and decreased chow intake of HFCS group may be confounding factors

effecting the observed behavioural alterations. As the majority of fat pads dissected were

visceral, this difference in fatty body mass was due to increased visceral adiposity in HFCS

fed rats. This finding is in parallel with previous studies showing that the increased visceral

adiposity mediates the poor cardiometabolic consequences of high fructose feeding in

adolescents (Pollock et al., 2012). Interestingly, TDZD8 treatment failed to restore HFCS

induced visceral adiposity, but recovered HFCSinduced glucose intolerance.

The metabolic consequences of HFCS consumption during childhood and adolescence are

relatively well characterized, however the neuropsychiatric consequences are still not

recognized enough. We showed for the first time by this study that HFCS consumption in

adolescent rats led to spontaneous hyperlocomotion, decreased anxiety, increased risktaking

behaviour, increased social/sexual rewardseeking behaviour and increased sensitivity to

behavioural despair paradigm with learning deficits; all of which are characteristically seen in

patients with BD. In addition, these behavioural changes associated with HFCS consumption

were readily reversible with the inhibition of GSK3, which is known as the most probable

mechanism of action of lithium for its moodstabilizing effects. Even though there are many

limitations to define a rat as being bipolar (Gould and Einat, 2007), spontaneous manialike

behaviour with susceptibility to behavioural despair, combined with rats being responsive to

the inhibition of GSK3 are remarkably suggestive of BD.

Page 29 of 49



For Peer Review

20

The changes in neurotransmission observed in patients with BD are not fully understood

(Newberg et al., 2008). In addition, the lack of appropriate animal models of BD to study

neurotransmission further limits our understanding in this regard. However, neuronal

hyperexcitability is one of the most commonly reported alteration associated with BD. In our

study, HFCS consumption resulted in hyperexcitability of CA3CA1 synapses as evident by a

leftward shift of the inputoutput curve. This can be explained by both presynaptic and

postsynaptic mechanisms:

(I) When two stimuli with 20ms of interpulse interval were applied to the control rats

in pairedpulse paradigm, the second fEPSP slope was higher than the first,

demonstrating the presynaptic Ca2+ accumulation caused by two sequential

stimuli, causing increased glutamate release after the second stimulus. However,

HFCS group showed significantly less facilitation after the second stimulus than

the control group, suggesting an increased presynaptic release probability causing

depletion of glutamate containing vesicles when no time was given to replenish

the stores. This can be explained by the decreased expression of α3subunit of

NKA in HFCSfed rats, resulting in reduced Ca2+ clearance in presynaptic

terminals, thus increasing the release probability. TDZD8 treatment failed to

restore both impaired HFCSinduced pairedpulse facilitation and reduced

expression of α3subunit of NKA. Similar to TDZD8, previous literature showed

that lithium did not alter the presynaptic glutamate release probability as suggested

by previous pairedpulse facilitation experiments (Du et al., 2008).

(II) HFCS consumption increased ser845phosphorylation of GluR1 subunit of AMPA

receptors, which is required for a readily available pool of AMPA receptors to be

incorporated to the postsynaptic density. TDZD8 restored HFCSinduced

excessive phosphorylation of GluR1. This is in concordance with previous studies

showing the critical role of AMPA receptors in the pathophysiology of BD (Du et

al., 2008, Du et al., 2003, Du et al., 2004a).

In this study, HFCSinduced CA3CA1 hyperexcitability can be explained by both increased

presynaptic release probability and increased pool of AMPA receptors ready to be

incorporated to the postsynaptic membrane. However, TDZD8 treatment only restored the

postsynaptic impairment with the attenuation of overall hyperexcitability. In this study, no

alterations in GABAergic system, the main inhibitory system of central nervous system, were

found.

Page 30 of 49



For Peer Review

21

Evidence supporting NKA hypothesis of BD has been accumulating since early 1950s,

including that with Myshkin mice carrying an inactivating mutation in the neuronspecific α3

subunit of NKA, showing bipolarlike behavioural phenotype (Kirshenbaum et al., 2011). It is

still not known how this decrease in NKA levels/activity translates to bipolarlike behavioural

phenotype. In our study, the α3subunit is the only subunit whose expression was found to be

decreased. Further studies are required to determine whether this alteration in NKA is the

primary reason of observed behavioural phenotype or not.

Insulin resistance was reported in whole brain tissue as well as in the hippocampus in high

fructose and high fat fed rats (Mielke et al., 2005, Liu et al., 2015). Insulin receptors are

coupled to PI3KAktGSK3 pathway, which is known to be a crucial secondary signaling

pathway related to synaptic plasticity, synaptic structure, learningmemory and mood

processes. In our study, there were no alterations in phosphorylation levels of Akt and GSK3

after stimulated with intracerebroventricular insulin, eliminating the presence of insulin

resistance locally in the hippocampi of HFCSfed rats. Even though HFCSinduced

hyperexcitability and associated presynaptic and postsynaptic changes were not due to

hippocampal insulin resistance, the PI3KAktGSK3 pathway may still be involved in the

process. As NKA was also shown to be linked to PI3KAktGSK3 pathway (Wu et al.,

2013), decreased expression of the α3subunit of NKA may cause alterations in this pathway

leading to observed changes. However, the underlying signaling mechanism couldn’t be

unrevealed in this study and requires further focus in the future.

It is known that both western diet consumption and BD are associated with inflammation.

Here, we showed that HFCS consumption caused a systemic inflammatory response, which

was readily reversible with TDZD8 treatment. Even though the results of this study showed

many functional changes related to the hippocampus, we did not observe a statistically

significant local neuroinflammation in the hippocampi of rats fed with HFCS for 6 weeks.

This finding does not exclude the existence of inflammation in other brain regions, which

might be involved in the pathogenesis of BD, it simply showed that the electrophysiological

and molecular changes in the hippocampus cannot be explained by the local inflammation by

itself.

Page 31 of 49



For Peer Review

22

In summary, we report for the first time that HFCS fed adolescent rats displayed a bipolar

like behavioural phenotype with associated hyperexcitability of CA3CA1 synapses. In

addition, we demonstrated that both presynaptic and postsynaptic alterations might underlie

the HFCSinduced hyperexcitability with little, if any, contribution of inflammation. A

decreased expression of neuronspecific α3subunit of NKA was also evident in hippocampi

of HFCSfed rats, however it should be further studied whether this change causes bipolar

like behavioural phenotype by inducing neuronal hyperexcitability or operates through a

different mechanism.

Page 32 of 49



For Peer Review

23

AUTHOR CONTRIBUTIONS

This study is a part of the PhD dissertation of B.A. Conceptualization, B.A. and Y.S.;

Designed by B.A., S.T.T., C.K. and Y.S.; Experiments performed by B.A., M.Y., A.B., and

A.Y.G.; Writing – Original Draft, B.A.; Writing – Review & Editing, B.A., S.T.T. and Y.S.;

Resources, A.M.; Supervision Y.S.

Page 33 of 49



For Peer Review

24

REFERENCES

ACKROFF, K. & SCLAFANI, A. 2011. Rats' preferences for high fructose corn syrup vs. sucrose and sugar mixtures. Physiol Behav, 102, 548-52.

BAENA, M., SANGUESA, G., DAVALOS, A., LATASA, M. J., SALA-VILA, A., SANCHEZ, R. M., ROGLANS, N., LAGUNA, J. C. & ALEGRET, M. 2016. Fructose, but not glucose, impairs insulin signaling in the three major insulin-sensitive tissues. Sci Rep, 6, 26149.

BRAY, G. A. 2013. Energy and fructose from beverages sweetened with sugar or high-fructose corn syrup pose a health risk for some people. Adv Nutr, 4, 220-5.

BREMER, A. A., STANHOPE, K. L., GRAHAM, J. L., CUMMINGS, B. P., WANG, W., SAVILLE, B. R. & HAVEL, P. J. 2011. Fructose-fed rhesus monkeys: a nonhuman primate model of insulin resistance, metabolic syndrome, and type 2 diabetes. Clin Transl Sci, 4, 243-52.

CASTAGNE, V., MOSER, P., ROUX, S. & PORSOLT, R. D. 2010. Rodent models of depression: forced swim and tail suspension behavioural despair tests in rats and mice. Curr Protoc Pharmacol, Chapter 5, Unit 5 8.

CHALECKA-FRANASZEK, E. & CHUANG, D. M. 1999. Lithium activates the serine/threonine kinase Akt-1 and suppresses glutamate-induced inhibition of Akt-1 activity in neurons. Proc Natl Acad Sci U S A, 96, 8745-50.

CHARAN, J. & KANTHARIA, N. D. 2013. How to calculate sample size in animal studies? J Pharmacol Pharmacother, 4, 303-6.

CHARLES, E. F., LAMBERT, C. G. & KERNER, B. 2016. Bipolar disorder and diabetes mellitus: evidence for disease-modifying effects and treatment implications. Int J Bipolar Disord, 4, 13.

COLLINO, M., THIEMERMANN, C., MASTROCOLA, R., GALLICCHIO, M., BENETTI, E., MIGLIO, G., CASTIGLIA, S., DANNI, O., MURCH, O., DIANZANI, C., ARAGNO, M. & FANTOZZI, R. 2008. Treatment with the glycogen synthase kinase-3beta inhibitor, TDZD-8, affects transient cerebral ischemia/reperfusion injury in the rat hippocampus. Shock, 30,299-307.

COSTELLO, D. A., CLARET, M., AL-QASSAB, H., PLATTNER, F., IRVINE, E. E., CHOUDHURY, A. I., GIESE, K. P., WITHERS, D. J. & PEDARZANI, P. 2012. Brain deletion of insulin receptor substrate 2 disrupts hippocampal synaptic plasticity and metaplasticity. PLoS One, 7,e31124.

DE SARNO, P., LI, X. & JOPE, R. S. 2002. Regulation of Akt and glycogen synthase kinase-3 beta phosphorylation by sodium valproate and lithium. Neuropharmacology, 43,1158-64.

DIXON, J. F. & HOKIN, L. E. 1998. Lithium acutely inhibits and chronically up-regulates and stabilizes glutamate uptake by presynaptic nerve endings in mouse cerebral cortex. Proc Natl Acad Sci U S A, 95, 8363-8.

DOBRETSOV, M. & STIMERS, J. R. 2005. Neuronal function and alpha3 isoform of the Na/K-ATPase. Front Biosci, 10, 2373-96.

DU, J., CRESON, T. K., WU, L. J., REN, M., GRAY, N. A., FALKE, C., WEI, Y., WANG, Y., BLUMENTHAL, R., MACHADO-VIEIRA, R., YUAN, P., CHEN, G., ZHUO, M. & MANJI, H. K. 2008. The role of hippocampal GluR1 and GluR2 receptors in manic-like behaviour. J Neurosci, 28, 68-79.

Page 34 of 49



For Peer Review

25

DU, J., GRAY, N. A., FALKE, C., YUAN, P., SZABO, S. & MANJI, H. K. 2003. Structurally dissimilar antimanic agents modulate synaptic plasticity by regulating AMPA glutamate receptor subunit GluR1 synaptic expression. Ann N Y Acad Sci, 1003, 378-80.

DU, J., GRAY, N. A., FALKE, C. A., CHEN, W., YUAN, P., SZABO, S. T., EINAT, H. & MANJI, H. K. 2004a. Modulation of synaptic plasticity by antimanic agents: the role of AMPA glutamate receptor subunit 1 synaptic expression. J Neurosci, 24, 6578-89.

DU, J., QUIROZ, J., YUAN, P., ZARATE, C. & MANJI, H. K. 2004b. Bipolar disorder: involvement of signaling cascades and AMPA receptor trafficking at synapses. Neuron Glia Biol, 1,231-43.

EL-MALLAKH, R. S., EL-MASRI, M. A., HUFF, M. O., LI, X. P., DECKER, S. & LEVY, R. S. 2003. Intracerebroventricular administration of ouabain as a model of mania in rats. Bipolar Disord, 5, 362-5.

EL-MALLAKH, R. S. & WYATT, R. J. 1995. The Na,K-ATPase hypothesis for bipolar illness. Biol Psychiatry, 37, 235-44.

EVRANOS-AKSOZ, B., UCAR, G., TAS, S. T., AKSOZ, E., YELEKCI, K., ERIKCI, A., SARA, Y. & ISKIT, A. B. 2017. New Human Monoamine Oxidase A Inhibitors with Potential Anti- Depressant Activity: Design, Synthesis, Biological Screening and Evaluation of Pharmacological Activity. Comb Chem High Throughput Screen, 20, 461-473.

GOLDSTEIN, I., LERER, E., LAIBA, E., MALLET, J., MUJAHEED, M., LAURENT, C., ROSEN, H., EBSTEIN, R. P. & LICHTSTEIN, D. 2009. Association between sodium- and potassium-activated adenosine triphosphatase alpha isoforms and bipolar disorders. Biol Psychiatry, 65, 985-91.

GORE, F. M., BLOEM, P. J., PATTON, G. C., FERGUSON, J., JOSEPH, V., COFFEY, C., SAWYER, S. M. & MATHERS, C. D. 2011. Global burden of disease in young people aged 10-24 years: a systematic analysis. Lancet, 377, 2093-102.

GOULD, T. D., CHEN, G. & MANJI, H. K. 2004a. In vivo evidence in the brain for lithium inhibition of glycogen synthase kinase-3. Neuropsychopharmacology, 29, 32-8.

GOULD, T. D. & EINAT, H. 2007. Animal models of bipolar disorder and mood stabilizer efficacy: a critical need for improvement. Neurosci Biobehav Rev, 31, 825-31.

GOULD, T. D., EINAT, H., BHAT, R. & MANJI, H. K. 2004b. AR-A014418, a selective GSK-3 inhibitor, produces antidepressant-like effects in the forced swim test. Int J Neuropsychopharmacol, 7, 387-90.

GOULD, T. D. & MANJI, H. K. 2005. Glycogen synthase kinase-3: a putative molecular target for lithium mimetic drugs. Neuropsychopharmacology, 30, 1223-37.

GRILLO, C. A., PIROLI, G. G., HENDRY, R. M. & REAGAN, L. P. 2009. Insulin-stimulated translocation of GLUT4 to the plasma membrane in rat hippocampus is PI3-kinase dependent. Brain Res, 1296, 35-45.

GRILLO, C. A., PIROLI, G. G., LAWRENCE, R. C., WRIGHTEN, S. A., GREEN, A. J., WILSON, S. P., SAKAI, R. R., KELLY, S. J., WILSON, M. A., MOTT, D. D. & REAGAN, L. P. 2015. Hippocampal Insulin Resistance Impairs Spatial Learning and Synaptic Plasticity. Diabetes, 64, 3927-36.

GROSS, L. S., LI, L., FORD, E. S. & LIU, S. 2004. Increased consumption of refined carbohydrates and the epidemic of type 2 diabetes in the United States: an ecologic assessment. Am J Clin Nutr, 79, 774-9.

HASSEL, B., IVERSEN, E. G., GJERSTAD, L. & TAUBOLL, E. 2001. Up-regulation of hippocampal glutamate transport during chronic treatment with sodium valproate. J Neurochem,77, 1285-92.

Page 35 of 49



For Peer Review

26

HSU, T. M., KONANUR, V. R., TAING, L., USUI, R., KAYSER, B. D., GORAN, M. I. & KANOSKI, S. E. 2015. Effects of sucrose and high fructose corn syrup consumption on spatial memory function and hippocampal neuroinflammation in adolescent rats. Hippocampus, 25, 227-39.

JURGENS, H., HAASS, W., CASTANEDA, T. R., SCHURMANN, A., KOEBNICK, C., DOMBROWSKI, F., OTTO, B., NAWROCKI, A. R., SCHERER, P. E., SPRANGER, J., RISTOW, M., JOOST, H. G., HAVEL, P. J. & TSCHOP, M. H. 2005. Consuming fructose-sweetened beverages increases body adiposity in mice. Obes Res, 13, 1146-56.

KAIDANOVICH-BEILIN, O., MILMAN, A., WEIZMAN, A., PICK, C. G. & ELDAR-FINKELMAN, H. 2004. Rapid antidepressive-like activity of specific glycogen synthase kinase-3 inhibitor and its effect on beta-catenin in mouse hippocampus. Biol Psychiatry, 55,781-4.

KALINICHEV, M. & DAWSON, L. A. 2011. Evidence for antimanic efficacy of glycogen synthase kinase-3 (GSK3) inhibitors in a strain-specific model of acute mania. Int J Neuropsychopharmacol, 14, 1051-67.

KIRSHENBAUM, G. S., CLAPCOTE, S. J., DUFFY, S., BURGESS, C. R., PETERSEN, J., JAROWEK, K. J., YUCEL, Y. H., CORTEZ, M. A., SNEAD, O. C., 3RD, VILSEN, B., PEEVER, J. H., RALPH, M. R. & RODER, J. C. 2011. Mania-like behaviour induced by genetic dysfunction of the neuron-specific Na+,K+-ATPase alpha3 sodium pump. Proc Natl Acad Sci U S A,108, 18144-9.

KLEIN, P. S. & MELTON, D. A. 1996. A molecular mechanism for the effect of lithium on development. Proc Natl Acad Sci U S A, 93, 8455-9.

LAN, M. J., MCLOUGHLIN, G. A., GRIFFIN, J. L., TSANG, T. M., HUANG, J. T., YUAN, P., MANJI, H., HOLMES, E. & BAHN, S. 2009. Metabonomic analysis identifies molecular changes associated with the pathophysiology and drug treatment of bipolar disorder. Mol Psychiatry, 14, 269-79.

LEONG, S. F. & LEUNG, T. K. 1991. Diabetes induced by streptozotocin causes reduced Na-K ATPase in the brain. Neurochem Res, 16, 1161-5.

LI, X., ZHU, W., ROH, M. S., FRIEDMAN, A. B., ROSBOROUGH, K. & JOPE, R. S. 2004. In vivo regulation of glycogen synthase kinase-3beta (GSK3beta) by serotonergic activity in mouse brain. Neuropsychopharmacology, 29, 1426-31.

LIM, J. S., MIETUS-SNYDER, M., VALENTE, A., SCHWARZ, J. M. & LUSTIG, R. H. 2010. The role of fructose in the pathogenesis of NAFLD and the metabolic syndrome. Nat Rev Gastroenterol Hepatol, 7, 251-64.

LIU, Z., PATIL, I. Y., JIANG, T., SANCHETI, H., WALSH, J. P., STILES, B. L., YIN, F. & CADENAS, E. 2015. High-fat diet induces hepatic insulin resistance and impairment of synaptic plasticity. PLoS One, 10, e0128274.

MALKESMAN, O., SCATTONI, M. L., PAREDES, D., TRAGON, T., PEARSON, B., SHALTIEL, G., CHEN, G., CRAWLEY, J. N. & MANJI, H. K. 2010. The female urine sniffing test: a novel approach for assessing reward-seeking behaviour in rodents. Biol Psychiatry, 67, 864-71.

MARRIOTT, B. P., COLE, N. & LEE, E. 2009. National estimates of dietary fructose intake increased from 1977 to 2004 in the United States. J Nutr, 139, 1228S-1235S.

MARTINEZ, A., ALONSO, M., CASTRO, A., PEREZ, C. & MORENO, F. J. 2002. First non-ATP competitive glycogen synthase kinase 3 beta (GSK-3beta) inhibitors: thiadiazolidinones (TDZD) as potential drugs for the treatment of Alzheimer's disease. J Med Chem, 45, 1292-9.

Page 36 of 49



For Peer Review

27

MERTENS, J., WANG, Q. W., KIM, Y., YU, D. X., PHAM, S., YANG, B., ZHENG, Y., DIFFENDERFER, K. E., ZHANG, J., SOLTANI, S., EAMES, T., SCHAFER, S. T., BOYER, L., MARCHETTO, M. C., NURNBERGER, J. I., CALABRESE, J. R., ODEGAARD, K. J., MCCARTHY, M. J., ZANDI, P. P., ALDA, M., NIEVERGELT, C. M., PHARMACOGENOMICS OF BIPOLAR DISORDER, S., MI, S., BRENNAND, K. J., KELSOE, J. R., GAGE, F. H. & YAO, J. 2015. Differential responses to lithium in hyperexcitable neurons from patients with bipolar disorder. Nature, 527, 95-9.

MIELKE, J. G., TAGHIBIGLOU, C., LIU, L., ZHANG, Y., JIA, Z., ADELI, K. & WANG, Y. T. 2005. A biochemical and functional characterization of diet-induced brain insulin resistance. J Neurochem, 93, 1568-78.

NEWBERG, A. R., CATAPANO, L. A., ZARATE, C. A. & MANJI, H. K. 2008. Neurobiology of bipolar disorder. Expert Rev Neurother, 8, 93-110.

O'BRIEN, W. T., HARPER, A. D., JOVE, F., WOODGETT, J. R., MARETTO, S., PICCOLO, S. & KLEIN, P. S. 2004. Glycogen synthase kinase-3beta haploinsufficiency mimics the behavioural and molecular effects of lithium. J Neurosci, 24, 6791-8.

PANCHAL, S. K. & BROWN, L. 2011. Rodent models for metabolic syndrome research. J Biomed Biotechnol, 2011, 351982.

PARK, S., BLANCK, H. M., SHERRY, B., BRENER, N. & O'TOOLE, T. 2012. Factors associated with low water intake among US high school students - National Youth Physical Activity and Nutrition Study, 2010. J Acad Nutr Diet, 112, 1421-7.

PFAFFL, M. W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res, 29, e45.

POLLOCK, N. K., BUNDY, V., KANTO, W., DAVIS, C. L., BERNARD, P. J., ZHU, H., GUTIN, B. & DONG, Y. 2012. Greater fructose consumption is associated with cardiometabolic risk markers and visceral adiposity in adolescents. J Nutr, 142, 251-7.

POLTER, A., BEUREL, E., YANG, S., GARNER, R., SONG, L., MILLER, C. A., SWEATT, J. D., MCMAHON, L., BARTOLUCCI, A. A., LI, X. & JOPE, R. S. 2010. Deficiency in the inhibitory serine-phosphorylation of glycogen synthase kinase-3 increases sensitivity to mood disturbances. Neuropsychopharmacology, 35, 1761-74.

PRICKAERTS, J., MOECHARS, D., CRYNS, K., LENAERTS, I., VAN CRAENENDONCK, H., GORIS, I., DANEELS, G., BOUWKNECHT, J. A. & STECKLER, T. 2006. Transgenic mice overexpressing glycogen synthase kinase 3beta: a putative model of hyperactivity and mania. J Neurosci, 26, 9022-9.

RIO, D. C., ARES, M., JR., HANNON, G. J. & NILSEN, T. W. 2010. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc, 2010, pdb prot5439.

RYVES, W. J. & HARWOOD, A. J. 2001. Lithium inhibits glycogen synthase kinase-3 by competition for magnesium. Biochem Biophys Res Commun, 280, 720-5.

SCHLOESSER, R. J., HUANG, J., KLEIN, P. S. & MANJI, H. K. 2008. Cellular plasticity cascades in the pathophysiology and treatment of bipolar disorder. Neuropsychopharmacology,33, 110-33.

SINGH, M. M. 1970. A unifying hypothesis on the biochemical basis of affective disorder. Psychiatr Q, 44, 706-24.

VALVASSORI, S. S., DAL-PONT, G. C., RESENDE, W. R., JORNADA, L. K., PETERLE, B. R., MACHADO, A. G., FARIAS, H. R., DE SOUZA, C. T., CARVALHO, A. F. & QUEVEDO, J. 2017. Lithium and valproate act on the GSK-3beta signaling pathway to reverse manic-like behaviour in an animal model of mania induced by ouabain. Neuropharmacology, 117, 447-459.

Page 37 of 49



For Peer Review

28

VAN METER, A. R., MOREIRA, A. L. & YOUNGSTROM, E. A. 2011. Meta-analysis of epidemiologic studies of pediatric bipolar disorder. J Clin Psychiatry, 72, 1250-6.

VORHEES, C. V. & WILLIAMS, M. T. 2006. Morris water maze: procedures for assessing spatial and related forms of learning and memory. Nat Protoc, 1, 848-58.

VOS, M. B., KIMMONS, J. E., GILLESPIE, C., WELSH, J. & BLANCK, H. M. 2008. Dietary fructose consumption among US children and adults: the Third National Health and Nutrition Examination Survey. Medscape J Med, 10, 160.

WANDELL, P., LJUNGGREN, G., WAHLSTROM, L. & CARLSSON, A. C. 2014. Diabetes and psychiatric illness in the total population of Stockholm. J Psychosom Res, 77, 169-73.

WU, J., AKKURATOV, E. E., BAI, Y., GASKILL, C. M., ASKARI, A. & LIU, L. 2013. Cell signaling associated with Na(+)/K(+)-ATPase: activation of phosphatidylinositide 3-kinase IA/Akt by ouabain is independent of Src. Biochemistry, 52, 9059-67.

YUCEL, Z., SARA, Y., DUYGULU, P., ONUR, R., ESEN, E. & OZGULER, A. B. 2009. Automated discrimination of psychotropic drugs in mice via computer vision-based analysis. J Neurosci Methods, 180, 234-42.

YUKSEL, C. & ONGUR, D. 2010. Magnetic resonance spectroscopy studies of glutamate-related abnormalities in mood disorders. Biol Psychiatry, 68, 785-94.

ZARATE, C. A., JR., SINGH, J. & MANJI, H. K. 2006. Cellular plasticity cascades: targets for the development of novel therapeutics for bipolar disorder. Biol Psychiatry, 59, 1006-20.

Page 38 of 49



For Peer Review

29

TABLES

Table 1. Sequences of the primers used in the qRT-PCR experiments.

Gene Forward Primer (5’-3’) Reverse Primer (5’-3’)

ATP1A1 TCCTTAAGCGTGCAGTAGCG CTCATCTCCATCACGGAGCC

ATP1A2 TAGCATACGAAGCGGCTGAG GATCATGCCGATCTGTCCGT

ATP1A3 GCCAAGATGGGGGACAAAAA TGCACGCAGTCGGTATTGTA

GAPDH TCCCATTCTTCCACCTTT TAGCCATATTCATTGTCATACC

Page 39 of 49



For Peer Review

30

FIGURES AND FIGURE LEGENDS

Figure 1. Tracking of the consumption of corresponding diets and the metabolic

characterization of the rats. (a) Rats received their corresponding diets for 6 consecutive

weeks, beginning from the postnatal day 21. After a month of feeding with their

corresponding diets, rats were randomized for either vehicle or TDZD8 treatments for

additional 2 weeks. The last week of the 2 weeks of treatment period consisted of a battery of

behavioural tests. At the end of the 6th week, rats were undergone in vivo electrophysiology

experiments and sacrificed afterward for tissue collection. OGTT was performed in a different

set of rats in order to avoid any interference due to fasting. (b) Weekly liquid consumption

was significantly greater in HFCS group compared to the control group, starting from the

second week (n=6 cage/group, each cage houses 3 rats). (c) HFCS consumption caused a

significant reduction in weekly chow consumption throughout the tracking period of a month

(n=6 cage/group, each cage houses 3 rats). (d) The mean body weight of HFCS group was

slightly less than that of control group, starting from the day 17. The means of final weights

were different significantly between control and HFCS groups (n=9/group, Control 245±6.4

g, HFCS 224±5.0 g, p<0.05). (e) HFCS consumption caused glucose intolerance as evident in

OGTT, and TDZD8 reversed HFCSinduced glucose intolerance (n=10/group for control and

HFCS, n=5/group for TDZD8). (f) HFCS group displayed elevated blood glucose levels after

6 h of fasting, and TDZD8 partially reversed this elevation (Control 81.2±3.2 mg/dL, HFCS

130±3.4 mg/dL, TDZD8 109±3.9 mg/dL, F(2,22)=56.5, p<0.05). 2 h after the oral glucose

load, the blood glucose levels of HFCS remained high compared to those of control and

TDZD8 rats (Control 101±1.4 mg/dL, HFCS 133±4.7 mg/dL, TDZD8 106±4.1 mg/dL,

F(2,22)=24.9, p<0.05). (g) Area under the OGTT curve (AUC) was higher in HFCS group

compared to control group, and TDZD8 treatment restored towards control levels (Control

16988±328 mg/dL•min1, HFCS 18500±408 mg/dL•min1, TDZD8 16199±361 mg/dL•min1,

F(2,22)=8.46, p<0.05). (h) Total weight of extracted fat pads normalized to total body weight

was higher in HFCS group, suggesting a greater fatty body percentage, which was not

reversed by TDZD8 treatment (Control 3.8±0.2%, HFCS 4.5±0.2%, TDZD8 4.8±0.2%,

F(2,26)=7.0, p<0.05).

Page 40 of 49



For Peer Review

31

Figure 2. HFCS consumption caused spontaneous hyperlocomotion, decreased anxiety,

increased risktaking behaviour, hyperhedonia, and susceptibility to behavioural

despair with significant impairments in hippocampal learning in adolescent rats. (a)

Total distance travelled in the open field arena (n=8/group, Control 18.5±4.5 m, HFCS

34.6±3.8 m, TDZD8 15.3±3.0 m, ANOVA F(2,21)=7.39, p<0.05). (b) Representative track

plots of OFA. (c) Time spent in open arms of the elevated plus maze (n=9/group, Control

6.0±2.5 s, HFCS 42.7±13.7 s, TDZD8 7.6±3.8 s, ANOVA F(2,24)=6.21, p<0.05). (d)

Averaged group heat maps of EPM. (e) Distance travelled in the open arms of the EPM

(n=9/group, Control 0.1±0.05 m, HFCS 0.8±0.2 m, TDZD8 0.2±0.08 m, ANOVA

F(2,24)=8.01, p<0.05). (f) Female Urine Sniffing Test. All three groups had significantly

increased sniffing durations when presented with female urine after distilled water

(n=8/group, repeated measures twoway ANOVA, Stage effect F(1,21)=21.8, p<0.05). When

groups were compared to each other, HFCS group had significantly higher sniffing durations

of female urine compared to the other groups (n=8/group, Control 8.1±1.1 s, HFCS 14.0±1.5

s, TDZD8 6.2±2.1 s, repeated measures twoway ANOVA, Group effect F(2,21)=6.24,

p<0.05). (g) Immobility duration in the forced swim test (n=9/group, Control 28.9±4.1 s,

HFCS 45.9±4.6 s, TDZD8 29.9±4.3 s, ANOVA F(2,24)=4.84, p<0.05). (h) Latency to find the

hidden platform in the acquisition stage of the Morris water maze and mean swim speeds

(inlet). The mean swim speeds of groups were not significantly different from each other

(n=9/group, Control 0.24±0.005 m/s, HFCS 0.24±0.005 m/s, TDZD8 0.23±0.004 m/s,

ANOVA, F(2,456)=0.474, p>0.05). Repeated measures twoway ANOVA revealed a significant

group effect in the acquisition stage of MWM (Acquisition Days × Groups F(6,420)=1.70,

p>0.05; Acquisition Days F(3,420)=118, p<0.05; Groups F(2,420)=6.90, p<0.05). In addition,

Tukey’s multiple comparisons test detected a difference between HFCS and TDZD8 groups

compared to control group on the first acquisition day. (i) Time spent in the target quadrant in

the probe trial of the MWM was not statistically different between groups (n=9/group but one

outlier data point was removed from control group as identified by ROUT test, Control

24±0.9 s, HFCS 25±2 s, TDZD8 25±2.8 s, F(2,23)=0.08, p>0.05).

Page 41 of 49



For Peer Review

32

Figure 3. HFCS consumption caused neuronal hyperexcitability without altering

GABAergic inhibitory activity that was restored by TDZD8 in rat hippocampal CA3

CA1 synapses. (n=9 rats/group, maximum of 1 rat/group was exluded because of either low

quality recording, severe bleeding or death.) (a) Inputoutput curve of stratum radiatum.

HFCS group exhibited hyperexcitability compared to control and TDZD8 groups (repeated

measures twoway ANOVA, Group F(2,23)=4.66, p<0.05). (b) Pairedpulse paradigm in

stratum radiatum. HFCS and TDZD8 groups showed significantly less facilitation compared

to control group when interpulse interval was 20ms (Tukey’s multiple comparisons test,

control vs. HFCS and control vs. TDZD8, p<0.05). (c) Representative recordings from

stratum radiatum. I/O traces were selected from the responses to stimuli of 7 V. Pairedpulse

traces were given for interpulse intervals of 20 ms and 1000 ms. Traces from control group

were yellow, whereas traces from HFCS and TDZD8 groups were red and blue respectively

in their corresponding columns. (d) Inputoutput curve of stratum pyramidale. (e) Paired

pulse paradigm of stratum pyramidale. (f) Representative recordings from stratum

pyramidale. I/O traces were selected from the responses to stimuli of 7 V. Pairedpulse traces

were given for interpulse intervals of 20 ms and 1000 ms. Traces from control group were

yellow, whereas traces from HFCS and TDZD8 groups were red and blue respectively in

their corresponding columns.

Page 42 of 49



For Peer Review

33

Figure 4. HFCS consumption in adolescent rats caused increased ser845

phosphorylation of GluR1 subunit of AMPA receptors and decreased transcription of

neuron specific α3subunit of NKA in hippocampus (n=4/group for immunoblot and

n=7/group for qRTPCR, maximum of 1/group was excluded from the qRTPCR experiments

as the isolation yielded low purity samples). (a) Relative protein levels of ser473

phosphorylated Akt to Akt normalized to βactin compared to control group. (b) Relative

protein levels of thr308phosphorylated Akt to Akt normalized to βactin compared to control

group. (c) Relative protein levels of ser9phosphorylated GSK3 to GSK3 normalized to β

actin compared to control group. (d) Relative protein levels of ser845phosphorylated GluR1

subunit of AMPA receptor to GluR1 subunit of AMPA receptor normalized to βactin

compared to control group (Statistical analysis was not performed as n<5/group). (e) Raw

immunoblot images of bands of ser845phosphorylated GluR1, GluR1 and βactin. (f)

Relative protein levels of NMDA2A normalized to βactin compared to control group. (g)

Relative protein levels of NMDA2B normalized to βactin compared to control group. (h)

Relative expression of α1subunit compared to control group. (i) Relative expression of α2

subunit compared to control group. (j) Relative expression of α3subunit compared to control

group.

Page 43 of 49



For Peer Review

34

Figure 5. A systemic inflammatory response was evoked by HFCS consumption, but not

locally in the hippocampi (n=9/group). (a) IL1β levels in serum. (b) IL6 levels in serum.

(c) TNFα levels in serum. (d) IL1β levels normalized to total protein in hippocampus. (e)

IL6 levels normalized to total protein in hippocampus. (f) TNFα levels normalized to total

protein in hippocampus.

Page 44 of 49



For Peer Review1 2 3 4

600

900

1200

1500

1800

Weeks

*

**

ControlHFCSCo

nsum

ptio

n (m

L/ca

ge)

b

1 2 3 40

200

400

600

800

Weeks

*

**

*

ControlHFCSCo

nsum

ptio

n (g

/cag

e)

c

0

75

150

225

300

Days0 3 7 10 14 17 21 24 28

ControlHFCS

Wei

ght (

g)*

**

*d

-15 0 15 30 45 60 75 90 12060

100

140

180

220

Time (min)

*†‡

*†

*‡ *‡† *† *† *†

ControlHFCSTDZD-8O

GTT

Blo

od G

luco

se(m

g/dL

)

e

Fasting 120 min0

60

120

180‡

* †

OG

TT B

lood

Glu

cose

(mg/

dL)

* †f

Cont

rol

HFC

S

TDZD

-8

Cont

rol

HFC

S

TDZD

-8

Control HFCS TDZD-815K

19K

23K * †

Are

a U

nder

the

OG

TTCu

rve

g

Control HFCS TDZD-80

2

4

6

8

Fat W

eigh

t Nor

mal

ized

to B

ody

Wei

ght (

%)

h‡

*

aDay 1 Day 15 Day 29 Day 36Day 8 Day 22 Day 42

D I E T ( W A T E R o r H F C S )

TREATMENT (VEHICLE or TDZD-8)

BEHAVIORAL TESTS

In vivo electrophysiologyOGTT

Decapitation & tissue harvesting

Page 45 of 49



For Peer ReviewControl HFCS TDZD-8

0

20

40

60 * †

OFA

Tot

al D

ista

nce

(m)

a

Cont

rol

HFC

STD

ZD-8

b

0

50

100

150

Control HFCS TDZD-8

*

EPM

Tim

e in

Ope

nA

rms (

s)

c †

Cont

rol

HFC

STD

ZD-8

d

Control HFCS TDZD-80.0

0.5

1.0

1.5

2.0 * †

EPM

Dis

tanc

e in

Ope

nA

rms (

m)

e

Water Urine0

6

12

18

24 ControlHFCSTDZD-8

* †FU

ST S

niff

ing

Dur

atio

n (s

)f


20

40

60

80* †

FST

Imm

obili

ty D

urat

ion

(s)g

1 2 3 40

25

50

75

100

Acqusition Days

*‡

Control

TDZD-8HFCS

MW

M L

aten

cy (s

)


12

24

36

48

MW

M T

ime

in T

arge

tQ

uadr

ant (

s)

ih

0

0.1

0.2

0.3

TDZD-8Control HFCS

Swim

Spe

ed (m

/s)

Page 46 of 49



For Peer Review

1 3 5 7 9 11 13 150

25

50

75

100

Stimulus Intensity (V)

†

††

†

ControlHFCSTDZD-8PS

Am

plitu

de (%

max

)

d

0

1

2

3

4

5

Interpulse Interval (ms)

ControlHFCSTDZD-8

20 40 60 80100

150200

300400

500600

700800

9001000

PS2/

PS1

e1 3 5 7 9 11 13 15

0

25

50

75

100

Stimulus Intensity (V)

fEPS

P Sl

ope

(% m

ax)

*†

*†*†

*†*†

*† †

ControlHFCSTDZD-8

a

1.00

1.25

1.50

1.75

2.00*‡

*ControlHFCSTDZD-8

Interpulse Interval (ms)20 40 60 80

100150

200300

400500

600700

800900

1000

fEPS

P2/f

EPSP

1

b

Stra

tum

Rad

iatu

m

c HFCS I/O TDZD-8 I/O

HFCS PP 20 ms TDZD-8 PP 20 ms


10m

V

10ms

Stra

tum

Pyr

amid

ale

f HFCS I/O TDZD-8 I/O



10m

V

10ms

Page 47 of 49



For Peer Review


0.5

1.0

1.5

NM

DA

2A F

old

Chan

ge(n

orm

aliz

ed to

β-a

ctin

)

f


1

2

3

4h

ATP1

A1 F

old

Chan

ge


1

3

4

ATP1

A2 F

old

Chan

ge

i

2


1

2

3*

‡

ATP1

A3 F

old

Chan

ge

j

pAKT

(ser

) / A

KT(n

orm

aliz

ed to

β-a

ctin

)


0.5

1.0

1.5a


0.5

1.0

1.5

pGSK

/ G

SK(n

orm

aliz

ed to

β-a

ctin

)

c


2

4

6

8

pAM

PA /

AM

PA(n

orm

aliz

ed to

β-a

ctin

)

d

β-actin

AMPA

pAMPA

Control TDZD-8HFCS

1 2 3 41 12 3 42 3 4

e

45 kDa

100 kDa

100 kDa


0.5

1.0

1.5g

NM

DA

2B F

old

Chan

ge(n

orm

aliz

ed to

β-a

ctin

)


0.4

1.2

1.6

pAKT

(thr

) / A

KT(n

orm

aliz

ed to

β-a

ctin

)

b

0.8

Page 48 of 49



For Peer ReviewControl HFCS TDZD-8

0

300

600

900 * †Se

rum

IL-1β

(pg/

mL)

a


25

50

75

Hip

poca

mpu

s IL-

1β(p

g/m

g To

tal P

rote

in)

dControl HFCS TDZD-8

0

600

1200

1800 * †

Seru

m IL

-6 (p

g/m

L)

b


40

80

120

160

Hip

poca

mpu

s IL-

6(p

g/m

g To

tal P

rote

in)

eControl HFCS TDZD-8

0

700

1400

2100* †

Seru

m T

NF-α

(pg/

mL)

c


50

100

150

Hip

poca

mpu

s TN

F-α

(pg/

mg

Tota

l Pro

tein

)

f

Page 49 of 49



Documents

TITLE SHORT TITLEdigital.csic.es/bitstream/10261/170104/1/British Journal of Pharmacology_Alten_2018...Hacettepe University Tip Fakultesi Tıbbi Farmakoloji Anabilim Dali Sihhiye 06100