Upload
others
View
2
Download
0
Embed Size (px)
Citation preview
For Peer Review
1
TITLE
High fructose corn syrup consumption in adolescent rats causes bipolarlike behavioural
phenotype with hyperexcitability in hippocampal CA3CA1 synapses
SHORT TITLE
High fructose led to bipolarlike phenotype in adolescent rats
AUTHORS
Baris Alten1, MD, PhD; Metin Yesiltepe1, MD; Erva Bayraktar1, MSc; Sadik Taskin Tas1,
MD, PhD; Ayse Yesim Gocmen1, PhD; Canan Kursungoz2,3, PhD; Ana Martinez4, PhD;
Yildirim Sara1*, MD, PhD.
1Medical Pharmacology Department, Hacettepe University Faculty of Medicine, 06100 Ankara Turkey
2Materials Science and Nanotechnology Department, Bilkent University, 06800 Ankara Turkey
3National Nanotechnology Research Center (UNAM), Bilkent University, 06800 Ankara Turkey
4Centro de Investigaciones BiologicasCSIC, Ramiro de Maeztu 9, 28040 Madrid Spain
*Corresponding author
Hacettepe University Tip Fakultesi Tıbbi Farmakoloji Anabilim Dali Sihhiye 06100 Ankara Turkey
Correspondance: [email protected], [email protected], +90 312 305 10 86
Word Count: 3389
Page 11 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
2
ACKNOWLEDGEMENTS
Baris Alten would like to thank Dr. Elif Haznedaroglu and Atagun Ulas Isiktas for their
neverending support. The authors would also like to thank Dr. M. Emre Gedik and Dr. A.
Lale Dogan for their valuable contributions. Ana Martinez is a member of the CIB Intramural
Program “Molecular Machines for Better Life” (MACBET). Funding from Hacettepe
University Scientific Research Project Coordination Unit (Grant no. TSA201715515 to
Yildirim Sara) and partial funding from MINECO (Grant no. SAF201237979C0301 and
SAF201676693R to Ana Martinez) are acknowledged. The authors declare no conflict of
interest.
Page 12 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
3
ABSTRACT
Background and Purpose. Children and adolescents are the top consumers of high fructose
corn syrup (HFCS) sweetened beverages. Even though the cardiometabolic consequences of
HFCS consumption in adolescents are well known, the neuropsychiatric consequences have
yet to be determined.
Experimental Approach. Adolescent rats were fed for a month with 11% weight/volume
carbohydrate containing HFCS solution, which is similar to the sugar sweetened beverages of
human consumption. The metabolic, behavioural and electrophysiologic characteristics of
HFCSfed rats were determined. Furthermore, the effects of TDZD8, a highly specific GSK
3 inhibitor, on the HFCSinduced alterations were further explored.
Key Results. HFCSfed adolescent rats displayed bipolarlike behavioural phenotype with
hyperexcitability in hippocampal CA3CA1 synapses. This hyperexcitability was associated
with increased presynaptic release probability and increased density of postsynaptic AMPA
receptors, due to decreased expression of the neuronspecific α3subunit of Na+/K+ATPase
(NKA) and an increased ser845phosphorylation of GluR1 subunits of AMPA receptors,
respectively. TDZD8 treatment was found to restore behavioural and electrophysiological
disturbances associated with HFCS consumption by inhibition of GSK3, the most probable
mechanism of action of lithium for its moodstabilizing effects.
Conclusion and Implications. This study shows that HFCS consumption in adolescent rats
led to bipolarlike behavioural phenotype with neuronal hyperexcitability, which is known to
be one of the earliest endophenotypic manifestations of bipolar disorder. Inhibition of GSK3
with TDZD8 attenuated hyperexcitability and restored HFCSinduced behavioural
alterations.
Keywords: high fructose corn syrup, bipolar disorder, hyperexcitability, GluR1, AMPA,
GSK3, TDZD8
Abrreviations
HFCS – High Fructose Corn Syrup SSB – Sugar sweetened beverage T2DM – Type 2 diabetes mellitus BD – Bipolar Disorder NKA Na+/K+ATPase OGTT – Oral glucose tolerance test
OFA – Open Field Arena EPM – Elevated Plus Maze FST – Forced Swim Test MWM – Morris Water Maze FUST – Female Urine Sniffing Test
Page 13 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
4
BULLET POINT SUMMARY
What is already known:
• High fructose corn syrup (HFCS) is one of the most important nutritional cause of
type 2 diabetes mellitus (T2DM) in children and adolescents.
• T2DM and bipolar disorder are recently recognized comorbidities.
What this study adds:
• HFCS consumption in adolescent rats causes bipolarlike behavioural phenotype with
neuronal hyperexcitability.
• Inhibition of GSK3 with TDZD8 succesfully restored HFCSinduced alterations.
Clinical Significance:
• The relationship between HFCS consumption and emergence of bipolarlike
behaviours should be investigated in clinical settings.
• Specific GSK3 inhibitors may be valuable therapeutics in bipolar patients with
comorbid T2DM.
Page 14 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
5
INTRODUCTION
The streamlining of the production process for high fructose corn syrup (HFCS) in 1970s has
led this new product to gradually replace sucrose and other commonly used sweeteners. Since
then, HFCS consumption has increased rapidly through the increased consumption of sugar
sweetened beverages (SSBs), in which HFCS is used as the major caloric sweetener (Marriott
et al., 2009). Since the top consumers of SSBs are adolescents rather than adults, adolescents
have the highest estimated mean intake of fructose among all age groups (Vos et al., 2008,
Marriott et al., 2009). When total caloric intake was accounted for, this continuous rise in the
consumption of HFCS is found to be the most important nutritional factor causing increased
prevalence of type 2 diabetes mellitus (T2DM) (Gross et al., 2004). Today, it has been very
well characterized that the fructose is the reason for the development of HFCSinduced
insulin resistance, fatty liver and hypertriglyceridemia (Lim et al., 2010, Baena et al., 2016).
Even though the cardiometabolic consequences of HFCS consumption in adolescent period
have been relatively studied (Pollock et al., 2012), the neuropsychiatric consequences have
yet to be determined.
Rapidly increasing evidence suggests that psychiatric diagnoses, especially bipolar disorder
(BD), are significantly more common in patients with T2DM (Wandell et al., 2014, Charles et
al., 2016). BD is a genetically heterogeneous, highly heritable and devastating condition with
a mean prevalence of 1.8% in children and adolescents (Van Meter et al., 2011). It is the
fourth leading cause of disability adjusted life years among the adolescents (Gore et al.,
2011). Unfortunately, the pathophysiology of BD and how T2DM is linked to BD remain
unknown.
One of the prominent hypotheses for the mechanism of BD is that a primary or secondary
dysfunction of Na+/K+ATPase (NKA) predisposes or even directly causes the clinical
manifestations (Singh, 1970, elMallakh and Wyatt, 1995). In the central nervous system
(CNS), the catalytic αsubunit of NKA exists as three isoforms: α1 and α2 are found in both
neurons and glia, whereas α3 is exclusively expressed in neurons (Dobretsov and Stimers,
2005). Several single nucleotide polymorphisms across all three α isoforms have been
associated with the BD (Goldstein et al., 2009). Furthermore, intracerebroventricular
administration of ouabain, an inhibitor of NKA, is widely recognized as a valid animal model
of mania (ElMallakh et al., 2003). Mice carrying an inactivating mutation in neuron specific
Page 15 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
6
α3subunit of NKA showed a behavioural phenotype resembling those of patients with BD
(Kirshenbaum et al., 2011). It is still not known how this decrease in NKA amount and/or
activity translates to the behavioural changes evident in patients with BD. Interestingly,
diabetes was shown to decrease the amount and/or activity of NKA in different brain regions
(Leong and Leung, 1991). The region with the greatest and most significant decrease in NKA
activity in the brain was the hippocampus (Leong and Leung, 1991), which is known to be
involved in pathophysiology of BD.
Apart from the NKA hypothesis, growing evidence suggests that neuroplasticity plays a
central role in the pathophysiology and treatment of BD (Schloesser et al., 2008, Zarate et al.,
2006). Specifically, the modulation of AMPA receptor trafficking has gained attention
because of being a target for the two most common mood stabilizing agents: lithium and
valproate (Du et al., 2004b). Chronic treatments with therapeutically relevant concentrations
of lithium or valproate were shown to decrease the synaptic expression of GluR1 subunit of
AMPA receptors in the hippocampus by attenuating ser845phosphorylation of GluR1 (Du et
al., 2003, Du et al., 2004a, Du et al., 2008). Increased AMPA receptor density in synapses is
thought to be necessary for the emergence of bipolarlike behavioural phenotype, as AMPA
antagonists attenuates amphetamineinduced hyperactivity (Du et al., 2008). In addition to
postsynaptic alterations, presynaptic changes were also linked to BD. One study reported
increased glutamate levels in postmortem human bipolar brains (Lan et al., 2009). Magnetic
resonance spectroscopy studies further supported the increased glutamate levels in brains of
bipolar patients (Yuksel and Ongur, 2010). In addition, both lithium and valproate were
shown to decrease the synaptic glutamate levels (Dixon and Hokin, 1998, Hassel et al., 2001).
Last but not least, a recent study showed that hippocampal neurons of patients with BD had
hyperexcitability, which was reversed by lithium only in neurons derived from patients who
also clinically responded to lithium (Mertens et al., 2015). This study clearly demonstrates
that hyperexcitability is not only a coincidental feature seen with bipolar disorder, but also a
feature contributing to the pathophysiology of it.
In this study, we hypothesized that the consumption of HFCS causes bipolarlike behavioural
phenotype in adolescent rats. In addition, we have investigated the electrophysiological and
molecular effects of HFCS consumption on hippocampal synaptic function as both neuronal
hyperexcitability and decreased NKA levels might explain the association between HFCS
consumption and bipolarlike behavioural phenotype. As previous studies suggested that the
Page 16 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
7
HFCSinduced inflammation might cause the associated neuropsychiatric disturbances (Hsu
et al., 2015), we have also investigated the changes in proinflammatory cytokines in serum
and hippocampi of HFCSfed adolescent rats. Previous literature also demonstrated that
hippocampal insulin receptors respond to insulin similar to insulinresponsive peripheral
tissues (Grillo et al., 2009) and become resistant to insulin in response high fructose
consumption (Mielke et al., 2005). Moreover, hippocampal functions were found to be
impaired when the expression of insulin receptors and insulin receptor substrate (IRS) in
hippocampal neurons were decreased (Grillo et al., 2015, Costello et al., 2012). We
investigated whether HFCSinduced alterations are due to impaired insulin pathway in
hippocampi of HFCS fed rats.
Inhibition of GSK3 has been shown to be the mechanism of action for lithium and other
commonly used moodstabilizers for their moodstabilizing effect. (Klein and Melton, 1996,
Gould et al., 2004a, Ryves and Harwood, 2001, De Sarno et al., 2002, ChaleckaFranaszek
and Chuang, 1999, Li et al., 2004, Gould and Manji, 2005). Recently developed highly
specific GSK3 inhibitors were proven to have moodstabilizing effects on animal models of
BD, suggesting that the primary mechanism of action of lithium is, indeed, inhibition of GSK
3 (Kalinichev and Dawson, 2011, Gould et al., 2004b, KaidanovichBeilin et al., 2004,
Valvassori et al., 2017). In addition to pharmacological interventions, genetic manipulations
of GSK3 activity further support this hypothesis (O'Brien et al., 2004, Polter et al., 2010,
Prickaerts et al., 2006). Because of these indisputable evidences suggesting the critical role of
the inhibition of GSK3 in the treatment of BD, we decided to investigate the effects of
TDZD8, a highly specific inhibitor of GSK3 (Martinez et al., 2002), on HFCSinduced
alterations.
Page 17 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
8
METHODS
Animals. Male Wistar Albino rats (Kobay, Turkey) of 21 days of age, weighing 4555 g at
the time of arrival, were housed as triplets in polycarbonate cages with wood shaving
beddings on a 12/12 h light/dark schedule (lights on at 7:00 am) in a temperature (2022°C)
and humidity (4050%) controlled room. No enrichment in the cages was provided other than
what was mentioned above. Rats were given 4 weeks for acclimation prior to any procedure
and handled in order to familiarize rats with the experimenter. All experiments and tissue
harvesting were done in the light cycle. All procedures were approved by the Hacettepe
University Animal Experimentations Ethics Board, necessitating the standards of ARRIVE
and NIH (No: 2016/1208).
Determination of Sample Size. The number of animals for each group in behavioural,
electrophysiological, qRTPCR and ELISA experiments is calculated using two separate
methods (Charan and Kantharia, 2013). (I) First, G*Power program (Duesseldorf University,
Germany) was used to calculate number of subjects using power analysis. The desired α error
(type I error) probability was set as 0.05, and power was set as 0.8 (1β, 1 type II error
probability). These values yielded a total sample size of 30, which equates to 10 animals per
group. (II) The second method used for the calculation of the number of animals for each
group was the resource equation. The criterion for this method is that total number of
animalstotal number of groups should be between 10 and 20. According to this method, the
maximum number of animals to be used for the experiment is 21, which equals to 7 animals
per group. Thus, it was decided to determine a number between these two values that two
different methods has given to us. Considering the possible attrition/death and also the 3R
policies, we have decided on using 9 animals per group. OGTT protocol used 10 animals per
nondrug group and 5 animals for drug group due to the shortage of TDZD8. 3 rats (1
rat/group) allocated to open field arena and female urine sniffing test on the same day were
excluded due to error in system causing loss of data. 12 rats (4 rat/group) were used for
intracerebroventricular insulin administration and immunoblotting experiments.
Diets. Control group had ad libitum access to tap water and chow, whereas HFCS group had
ad libitum access to a HFCS solution containing 11% weight/volume (w/v) carbohydrate and
chow. HFCS group was not presented with tap water in addition to HFCS solution, as SSB
consumption in humans is associated with low plain water intake (Park et al., 2012). Diets
Page 18 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
9
were started when rats were on postnatal day 21 and continued for 6 weeks (Figure 1a). Chow
and liquid consumptions were tracked twice weekly for the first 4 weeks prior to allocation of
rats to vehicle or TDZD8 treatments.
Treatments and Experimental Groups. TDZD8, synthesized by Dr. Ana Martinez in CIB
CSIC laboratories following described procedures (Martinez et al., 2002), was dissolved (0.4
mg/ml) in 1% DMSO containing normal saline. 2 mg/kg of TDZD8 was daily given to
HFCSfed rats intraperitoneally for 14 days (TDZD-8 group). The TDZD8 dose was
determined from the previous literature (Collino et al., 2008). The control group (Control
group) and a separate set of HFCSfed rats (HFCS group) were given the vehicle solution in
equivalent volume and treatment duration. The rats were allocated to experimental groups
randomly and undergone to experiments simultaneously in order to prevent the interference
from seasonal variations.
Oral Glucose Tolerance Test (OGTT). In order to assess the glucose intolerance and
confirm the development of insulin resistance, rats received an OGTT after 14 days of vehicle
or TDZD8 treatment. In order to provide an easy access to tail vein blood, tail tips were cut
(23 mm in length) using a sterile technique under local anaesthesia (lidocaine pomade 5%), a
day before the OGTT. Prior to the OGTT, rats were fasted for 6 h. Blood samples were taken
before and after the administration of 2 mg/kg glucose solution by oral gavage at 0 min. The
clots on the tail tips were gently removed to obtain each blood sample. The first drop of blood
was removed by a sterile gauze, and the second drop was used for the assessment of blood
glucose levels with a handheld glucometer (AccuChek Performa Nano, Roche, Switzerland).
Behavioural Experiments. Rats were tested in a series of behavioural experiments after a
week of treatment with either vehicle or TDZD8. The first behavioural experiment was
carried out 30 min after the vehicle or TDZD8 administration. The experiments were
conducted in an order from the least stressful to the most stressful for the rats. To avoid any
scentinduced cues, surfaces and equipments were cleaned between each experiment with
70% ethanol solution. Animal tracking and recording was performed using an inhouse
developed tracking software (Yucel et al., 2009, EvranosAksoz et al., 2017).
Page 19 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
10
Open Field Arena (OFA). OFA was used to assess the locomotion of rats. Rats were placed
in the center of a transparent glass open field (45 cm × 45 cm × 45 cm) and allowed to freely
explore for 1 h. Total distance traveled was recorded and analyzed.
Elevated Plus Maze (EPM). A plusshaped maze composed of four perpendicular arms (40
cm × 15 cm) elevated 1 m above the ground was used for the experiment. Two opposing arms
were enclosed by 45 cm high opaque walls. Rats were placed at the center of arms, facing an
open arm. This test relies on rats’ intrinsic propensity towards the dark and enclosed places
(closed arms), and fear of heights/open places (open arms). The time spent and distance
travelled in the open and closed arms were recorded and analyzed for 5 min.
Morris Water Maze (MWM). Morris water maze was performed as previously published
(Vorhees and Williams, 2006). The water maze apparatus was a black circular pool with the
diameter of 180 cm. The pool was filled approximately halfway with warm water (2223°C).
The interior of the pool was featureless as possible, except for 4 visual cues attached. A black
cylindrical platform (height of 40 cm, diameter of 12 cm) was placed in the middle of the
northwest quadrant. The platform was hidden as it was submerged 12 cm below the water
surface. Briefly, each rat received 4 acquisition trials per day, for 4 consecutive days. The
rats were placed into the pool, facing towards the pool wall. The starting position in each trial
was different in order to prevent the rat to memorize a path to platform instead of spatially
learning where the platform was. In addition, the order of this various starting positions was
also different in different acquisition days. After the rat was placed into the water, it was
given 2 min to find the platform. If the rat fails to find it within the allotted time, it was gently
guided by the experimenter towards the platform. When the rat found the platform, it was
kept there for 15 s in order to appreciate and learn where the platform was located compared
to visual cues. The latencies to find the hidden platform were recorded. 48 h after the last
acquisition trial, a probe trial was performed. In the probe trial, the hidden platform was
removed and the rat was placed into the water from a novel starting point that it had not been
used before. This ensured that rats’ quadrant preference was an indication of true spatial
memory, rather than a memorized specific swim path. Rats were allowed to swim freely for
60 s. Time spent in the target quadrant (the quadrant where the platform was located in the
acquisition trials) was recorded.
Page 20 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
11
Female Urine Sniffing Test (FUST). Female urine sniffing test was performed as previously
described (Malkesman et al., 2010). Female urine sniffing test is a nonoperant test used to
assess the sexual rewardseeking behaviour (hedonic behaviour). This test depends on the
appetitive response of male rats towards the pheromonal odors found in the urine of female
rats. In order to maximize the attractiveness of the urine, it was collected from female rats that
are in the estrus phase of their menstrual cycle, as determined by evaluating vaginal smears
obtained from several female rats daily. Male rats were presented a cotton swab dipped into
distilled water or female urine in two consecutive 3 min sessions separated by an interval of
45 min. The duration of sniffing the tip of the cotton swab was recorded and analyzed.
Forced Swim Test (FST). Forced swim test is the experimental paradigm of learned
helplessness. The apparatus was a 50 cm tall glass cylinder (diameter of 20 cm) which was
filled to a depth of 30 cm with warm water (2325 oC). Forced swim test was performed in 2
sessions separated by 24 h, as described previously (Castagne et al., 2010). The first 15 min
session was to teach the rats that there were no possible ways to escape from the apparatus. In
the second session, which lasted 5 min, the duration of immobility was analyzed from the
recordings. The immobile behaviour in the swim test is thought to reflect the failure to keep
performing escapedirected behaviour due to the behavioural despair learned in the first
session.
In vivo Electrophysiology. TDZD8 or vehicle was administered 30 min before the
electrophysiology experiments. Rats were anesthetized with intraperitoneal administration of
1.4 g/kg urethane (SigmaAldrich, Germany). The depth of anaesthesia was confirmed and
tracked by the absence of toe withdrawal reflex, regularity and depth of respirations (gross
observation) and heart rate (ECG) throughout the electrophysiology experiment. Afterwards,
they were placed into a stereotaxic frame (Stoelting Co., IL, USA) and their body
temperatures were kept constant by using a blanket control unit (Harvard Apparatus, MA,
USA). A midline incision exposing both lambda and bregma was performed. Burr holes
providing access to ventral hippocampal commissure (VHC) (AP 1.2mm, ML 0.1 mm, D
4.5mm) and CA1 (AP 3.9mm, ML 2.2mm, D 2.5mm) areas of the hippocampus were
opened. A stimulating bipolar stainlesssteel electrode was placed into VHC. A recording
borosilicate electrode filled with calciumfree artificial cerebrospinal fluid was placed into
CA1. A goldplated ground electrode was placed through a hole opened on the occipital bone.
The Schaffer collaterals passing through the VHC were stimulated every 20 s with 0.1 ms
Page 21 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
12
pulses using a stimulator (S44, Grass Instruments, RI, USA) isolated from the recording
system with a stimulus isolation unit (SIU5, Grass Instruments) to evoke CA1 field excitatory
postsynaptic potentials (fEPSPs) and field population spikes (pSpikes). The locations of both
electrodes were optimized in order to obtain the maximal response possible. The evoked
fEPSPs and pSpikes from stratum radiatum and stratum pyramidale were recorded and
amplified with a headstage (Batiray, YSED, Turkey) and an amplifier (Kaldiray EX2C,
YSED) and digitized by a data acquisition system (PowerLab 8/SP, ADInstruments,
Australia). Data recordings and analysis were done by using LabChart software (AD
Instruments, Australia) and MiniAnalysis (Synaptosoft Inc., GA, USA), respectively. Input
output curves were constructed by applying stimuli with increasing intensities, ranging from 1
V to 15 V. The slopes of fEPSPs and the amplitudes of pSpikes were normalized according to
the maximal response obtained from that particular recording. Rats with poor quality
recordings indicating the poor location of either of the electrodes, severe bleeding or death
during experiment (maximum of 1 rat/group) were excluded from the experiment/analysis.
Pairedpulse facilitation and inhibition phenomena were assessed by applying pairedpulses
with varying interpulse intervals at a stimulus intensity evoking 50% of maximum response.
The rats were sacrificed afterwards and hippocampi were extracted as described below for
qRTPCR and ELISA experiments.
Intracerebroventricular Insulin Injection. A different set of 6 h fasted rats were
anesthetized with urethane and placed into the stereotaxic frame after the confirmation of the
depth of the anaesthesia as described previously. A burr hole was opened to provide access to
the third ventricle from the midline using the following coordinates: AP 4.4mm, D 4.3mm. A
total volume of 6 µl of 6 mU human recombinant insulin (SigmaAldrich, Germany) was
infused using a 10 µl Hamilton syringe driven by an inhouse developed motorized injector in
10 min. The needle was left in place for additional 20 min, until the rats were decapitated
while still under anaesthesia. The dose of insulin and the time between the initiation of insulin
infusion and decapitation (30 min) were determined based on previous literature (Grillo et al.,
2009). The rats were sacrificed afterwards while they were still under anasthesia and
hippocampi were extracted as described below for immunoblot experiments.
Decapitation and Tissue Collection. Rats were killed by decapitation under urethane
anaesthesia after the completion of electrophysiology experiments or intracerebroventricular
insulin administration, and brains were extracted and immediately put into icecold PBS
Page 22 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
13
solution. Isolation of both hippocampi was performed on an icecold plate in less than a
minute. Hippocampi were put into either RNAlater (Qiagen, Germany), homogenization
buffer supplied by the Plasma Membrane Protein Isolation Kit (ab65400, Abcam, United
Kingdom) or frozen immediately for further qRTPCR, western blot and ELISA studies,
respectively. Total trunk blood was collected and centrifuged at 7000×g for 10 min to
separate the serum, which was stored at 80°C. Inguinal, epididymal, mesenteric, perirenal,
retroperitoneal, and subscapular fat pads were dissected and weighted immediately.
Protein Isolation, Determination of Protein Levels of Lysates and Immunoblotting. A
commercially available Plasma Membrane Protein Isolation Kit (ab65400, Abcam) was used
and the isolation was performed according to the manufacturer’s protocol. Tablets containing
phosphatase inhibitors (ROCHE PhosSTOP, Roche Diagnostics, Germany) were dissolved in
the homogenization buffer provided by the protein isolation kit, which already included a
cocktail of protease inhibitors. Protein concentrations were determined using commercially
available RC DC Protein Assay (BioRad, CA, USA). Extracted protein samples (10 g) from
rat hippocampus were loaded and ran on a 10% acrylamide gel (TGX StainFree FastCast
Acrylamide Solution, BioRad) at 90 V for 90 min. Proteins were transferred to PVDF
membranes using TransBlot Turbo Transfer System (BioRad) at 25 V for 7 min. Blots were
blocked for 1 h at room temperature with 5% nonfat dry milk in TBST BlottingGrade
Blocker (BioRad), and subsequently probed with their relevant antibodies at 1:1000 dilution
overnight at 4°C. The following primary antibodies were used in immunoblot experiments:
Akt (#4691, CST, MA, USA), pAktThr308 (#13038, CST), pAktSer473 (#4060, CST),
GSK3 (#9336, CST), pGSK3Ser9 (#9322, CST), GluR1 (#13185, CST), pGluR1Ser845
(#8084, CST), NMDAR2A (#M264, SigmaAldrich), NMDAR2B (#14544, CST), βactin
(#3700, CST). AntiRabbitECL secondary (ab97051, Abcam) at a concentration of 1:100000
was applied for 1 h at room temperature, blots were briefly washed in TBST and then TBS,
then incubated with Immobilon ECL substrate (Merck Millipore, Germany) for 5 min in the
dark. Blot images were obtained using Kodak GEL Logic 1500 Transilluminator Integrated
Imaging System (Kodak, NY, USA). PageRuler Prestained Protein Ladder 10180 kDa
(Thermo Fisher Scientific) was used as size standards. The intensities of the target bands were
normalized according to the intensities of the corresponding betaactin bands. Relative change
of protein levels was reported as fold changes of the control group.
Page 23 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
14
RNA Isolation, cDNA Synthesis and qRTPCR. Gene specific primers (Sentegen, Turkey)
were designed to bypass at least one intronic sequence to reduce the possibility of binding to
contaminating DNA (Table 1). Total RNA isolation was performed by Trizolchloroform
extraction method (Rio et al., 2010). Total RNA concentration and RNA purity were
determined by µDrop plate (Thermo Fisher Scientific, MA, USA). Afterwards, total RNA
was reverse transcribed into cDNA using gene specific primers by RevertAid First Strand
cDNA Synthesis Kit (Thermo Fisher Scientific). qRTPCR was performed using SYBR
Green JumpStart Taq ReadyMix (SigmaAldrich). GAPDH was used as housekeeping control
for all samples. Relative expression of the target genes was reported as fold changes of the
control group, according to the efficiency corrected Ct method (Pfaffl, 2001).
ELISA. Commercially available ELISA kits (Elabscience, MD, USA) for rat TNFα (EEL
R0019), IL1β (EELR0012), and IL6 (EELR0015) were performed according to the
manufacturer’s instructions. The total protein levels of hippocampal lysates were determined
by using RC DC Protein Assay (BioRad, CA, USA). Absorbance measurements were carried
out by Multiskan GO spectrophotometer (Thermo Fisher Scientific).
Statistical Analysis. Data was presented as mean±standart error. Statistical analyses were
performed by GraphPad Prism (GraphPad Software Inc., CA, USA). Student’s ttest or
analysis of variance (ANOVA, oneway or twoway) followed by Tukey’s post-hoc test was
used when there were 2 or 3 groups to compare, respectively. Post-hoc tests were not
performed when F values of ANOVA are not significant. p<0.05 was considered as
statistically significant. *, †, and ‡ were used to demonstrate statistical significance between
control vs. HFCS, HFCS vs. TDZD8, and control vs. TDZD8, respectively.
Materials. Suppliers of all commercial kits, drugs and chemicals used in this study were
mentioned in their corresponding subsections in the “Methods” section.
Page 24 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
15
RESULTS
HFCS consumption caused a reduction in chow consumption and increased body fat
percentage with a slight decrease in total body mass.
After the first week, HFCS group consumed significantly more liquid when compared to the
water consumption of control group (Figure 1b). Even though both groups had free access to
chow, HFCS intake caused a significant reduction in weekly chow consumption (Figure 1c).
After the first 2 weeks, the mean body weight of HFCSfed rats was less than that of the
control group significantly (Figure 1d). However, HFCS rats had a significant increase in the
weight ratio of their fat pads, suggesting an increase in fatty body mass and a reduction in
lean body mass (Figure 1h).
HFCS consumption increased fasting blood glucose levels and caused glucose
intolerance as evident in OGTT.
HFCS consumption caused elevated blood glucose levels after 6 h of fasting as well as at the
end of the OGTT (Figure 1e and 1f). Area under the OGTT curve was higher in HFCS group
compared to the control group (Figure 1g). High fructose feeding was already shown to
induce insulin resistance and T2DM in rodents and nonhuman primates (Panchal and Brown,
2011, Bremer et al., 2011). Therefore, we have only performed OGTT and did not proceed
with further tests.
HFCS consumption caused spontaneous hyperlocomotion, decreased anxiety, increased
risktaking behaviour, hyperhedonia and susceptibility to behavioural despair.
Inhibition of GSK3 with TDZD8 was able to reverse HFCSinduced behavioural
disturbances.
In order to assess spontaneous locomotion, individual rats were placed in the OFA. Rats
consuming HFCS travelled more compared to the rats of the control group (Figure 2a and 2b).
To measure anxiety and risktaking behaviour, EPM was conducted. HFCS group had an
increased time spent in open arms compared to the control group, which suggests decreased
anxiety and increased risktaking behaviour (Figure 2c and 2d). Moreover, HFCSfed rats
were actively exploring the open arms, as evident in increased distance travelled in the open
arms (Figure 2e). In order to assess the changes in both social and sexual rewardseeking
behaviours, the FUST was carried out. Both control and HFCS groups had significantly
increased sniffing durations when presented with female urine after distilled water. When
Page 25 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
16
groups were compared to each other, HFCS group had significantly higher sniffing duration
of female urine compared to the control group (Figure 2f). In FST, HFCS group had
significantly higher duration of immobility compared to the control group (Figure 2g). To
sum up, HFCS consumption caused a spontaneous hyperlocomotion, decreased anxiety,
increased risktaking behaviour, hyperhedonia and susceptibility to behavioural despair.
As expected, treatment with TDZD8, a GSK3 inhibitor, reversed the HFCSinduced
hyperlocomotion, decreased anxiety, hyperhedonia and susceptibility to behavioural despair
back to control levels (Figure 2ag).
HFCS consumption impaired hippocampal spatial learning.
In this study, hippocampus dependent spatial learning and memory was assessed by Morris
water maze. The swim speeds of groups were not significantly different from each other
(Figure 2h, inlet), suggesting the rats did not suffer from any motor disability. HFCSfed rats
were significantly worse in finding the hidden platform on the first acquisition day, which
was not reversed by TDZD8 treatment (Figure 2h). Even though it is not statistically
significant, HFCS group performed worse compared to control and TDZD8 groups until the
last acquisition day. However, the time spent in target quadrant in the probe trial assessing
longterm spatial memory was not significantly different between groups (Figure 2i).
HFCS consumption caused hyperexcitability without altering GABAergic inhibitory
activity in rat CA3CA1 synapses, which was restored by TDZD8.
In order to assess the changes in the synaptic strength of HFCSfed rats, Schaffer collaterals
were stimulated and field potentials from the stratum radiatum (synaptic layer) of CA1 region
were recorded. The inputoutput curve of fEPSP slopes shifted significantly towards left in
the HFCS group, whereas TDZD8 caused a rightwardshift, turning HFCSinduced
hyperexcitability back to normal (Figure 3a). In paired pulse paradigm, HFCS consumption
impaired normal paired pulse facilitation when the interpulse interval was 20 ms. In addition,
TDZD8 treatment was unable to restore this impairment in stratum radiatum pairedpulse
facilitation. With greater interpulse intervals, no significant differences were found between
groups (Figure 3b).
In addition, we aimed to assess the activity of GABAergic interneurons finetuning the
cumulative response of the pyramidal neurons. Here, we placed the recording electrode into
Page 26 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
17
the stratum pyramidale (soma layer) to record field pSpikes. The inputoutput curves yielded
a similar trend to that observed in stratum radiatum (Figure 3c), but there were no significant
differences between groups in any of the interpulse intervals applied in pairedpulse
paradigm. (Figure 3d).
Neuronal hyperexcitability was accompanied with increased ser845phosphorylation of
GluR1 subunit of AMPA receptors, maintaining an increased available pool of AMPA
receptors to be readily incorporated into the postsynaptic membrane.
Ser845phosphorylation of GluR1 subunits of AMPA receptors maintains a readily available
pool of AMPA receptors to be incorporated to the postsynaptic density. In hippocampi of
HFCS fed adolescent rats, the ratio of ser845phosphorylated GluR1 to total GluR1 was
higher compared to control group, which was reversed by TDZD8 treatment (Figure 4d and
4e). In contrast, NMDAR2A and NMDAR2B subunits of NMDA receptors were found to be
unchanged (Figure 4f and 4g).
HFCS consumption in adolescent rats did not cause local insulin resistance in
hippocampus.
After intracerebroventricular administration of insulin, the ratios of ser473 and thr308
phosphorylated Akt to total Akt protein levels were found to be similar between groups
(Figure 4a and 4b). Thr308phosphorylated Akt cannot be detected by immunoblot unless
hippocampi are stimulated by insulin, which confirms the appropriateness of
intracerebroventricular insulin administration. In addition, no significant difference was
observed for the ratio of ser9phosphorylated GSK3 to total GSK3 protein levels (Figure
4c).
HFCS consumption in adolescent rats caused decreased transcription of neuron specific
α3subunit of NKA in hippocampus.
We tested whether there is a decrease in the levels of αsubunits of NKA in the hippocampi of
HFCSfed adolescent rats. While no significant differences in the mRNA levels of α1 and
α2subunits were observed, a significant reduction in the transcription of the neuronspecific
α3subunit was detected in the hippocampi of HFCSfed rats (Figure 4hj). However, TDZD
8 was unable to restore HFCSassociated reduced expression of α3subunit of NKA.
Page 27 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
18
A systemic inflammatory response was evoked by HFCS consumption, but not locally in
the hippocampus.
Here, whether HFCS consumption has caused an increase in serum and hippocampus levels
of proinflammatory markers, namely IL1β, IL6 and TNF α, was tested, indicating systemic
inflammation and local neuroinflammation, respectively. As expected, the levels of all three
proinflammatory markers were found to be increased in serum of HFCSfed rats, and returned
back to normal in TDZD8treated rats (Figure 5ac). However, the differences of
hippocampal levels of proinflammatory markers were statistically insignificant with ANOVA,
thus no posthoc tests were performed (Figure 5df).
Page 28 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
19
DISCUSSION
HFCS group consumed more liquid when compared to tap water consumption of control
group, as HFCS is highly palatable (Ackroff and Sclafani, 2011). In this study, we did not
present tap water to HFCS group to mimic the low plain intake of adolescents with SSB
consumption (Park et al., 2012). Interestingly, HFCSfed rats decreased their chow intake
significantly, which was also previously observed in a similar study done with mice (Jurgens
et al., 2005). Increased HFCS solution with a reduction in chow intake may be the underlying
reason of why HFCSfed rats gained relatively less weight after the second week of tracking
period. This is not compatible with human consumption, because humans tend to consume
SSBs without reducing their solid food intake, causing calories from SSBs to be “addon”
(Bray, 2013). As a limitation of our design, both lack of tap water intake with forced HFCS
consumption and decreased chow intake of HFCS group may be confounding factors
effecting the observed behavioural alterations. As the majority of fat pads dissected were
visceral, this difference in fatty body mass was due to increased visceral adiposity in HFCS
fed rats. This finding is in parallel with previous studies showing that the increased visceral
adiposity mediates the poor cardiometabolic consequences of high fructose feeding in
adolescents (Pollock et al., 2012). Interestingly, TDZD8 treatment failed to restore HFCS
induced visceral adiposity, but recovered HFCSinduced glucose intolerance.
The metabolic consequences of HFCS consumption during childhood and adolescence are
relatively well characterized, however the neuropsychiatric consequences are still not
recognized enough. We showed for the first time by this study that HFCS consumption in
adolescent rats led to spontaneous hyperlocomotion, decreased anxiety, increased risktaking
behaviour, increased social/sexual rewardseeking behaviour and increased sensitivity to
behavioural despair paradigm with learning deficits; all of which are characteristically seen in
patients with BD. In addition, these behavioural changes associated with HFCS consumption
were readily reversible with the inhibition of GSK3, which is known as the most probable
mechanism of action of lithium for its moodstabilizing effects. Even though there are many
limitations to define a rat as being bipolar (Gould and Einat, 2007), spontaneous manialike
behaviour with susceptibility to behavioural despair, combined with rats being responsive to
the inhibition of GSK3 are remarkably suggestive of BD.
Page 29 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
20
The changes in neurotransmission observed in patients with BD are not fully understood
(Newberg et al., 2008). In addition, the lack of appropriate animal models of BD to study
neurotransmission further limits our understanding in this regard. However, neuronal
hyperexcitability is one of the most commonly reported alteration associated with BD. In our
study, HFCS consumption resulted in hyperexcitability of CA3CA1 synapses as evident by a
leftward shift of the inputoutput curve. This can be explained by both presynaptic and
postsynaptic mechanisms:
(I) When two stimuli with 20ms of interpulse interval were applied to the control rats
in pairedpulse paradigm, the second fEPSP slope was higher than the first,
demonstrating the presynaptic Ca2+ accumulation caused by two sequential
stimuli, causing increased glutamate release after the second stimulus. However,
HFCS group showed significantly less facilitation after the second stimulus than
the control group, suggesting an increased presynaptic release probability causing
depletion of glutamate containing vesicles when no time was given to replenish
the stores. This can be explained by the decreased expression of α3subunit of
NKA in HFCSfed rats, resulting in reduced Ca2+ clearance in presynaptic
terminals, thus increasing the release probability. TDZD8 treatment failed to
restore both impaired HFCSinduced pairedpulse facilitation and reduced
expression of α3subunit of NKA. Similar to TDZD8, previous literature showed
that lithium did not alter the presynaptic glutamate release probability as suggested
by previous pairedpulse facilitation experiments (Du et al., 2008).
(II) HFCS consumption increased ser845phosphorylation of GluR1 subunit of AMPA
receptors, which is required for a readily available pool of AMPA receptors to be
incorporated to the postsynaptic density. TDZD8 restored HFCSinduced
excessive phosphorylation of GluR1. This is in concordance with previous studies
showing the critical role of AMPA receptors in the pathophysiology of BD (Du et
al., 2008, Du et al., 2003, Du et al., 2004a).
In this study, HFCSinduced CA3CA1 hyperexcitability can be explained by both increased
presynaptic release probability and increased pool of AMPA receptors ready to be
incorporated to the postsynaptic membrane. However, TDZD8 treatment only restored the
postsynaptic impairment with the attenuation of overall hyperexcitability. In this study, no
alterations in GABAergic system, the main inhibitory system of central nervous system, were
found.
Page 30 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
21
Evidence supporting NKA hypothesis of BD has been accumulating since early 1950s,
including that with Myshkin mice carrying an inactivating mutation in the neuronspecific α3
subunit of NKA, showing bipolarlike behavioural phenotype (Kirshenbaum et al., 2011). It is
still not known how this decrease in NKA levels/activity translates to bipolarlike behavioural
phenotype. In our study, the α3subunit is the only subunit whose expression was found to be
decreased. Further studies are required to determine whether this alteration in NKA is the
primary reason of observed behavioural phenotype or not.
Insulin resistance was reported in whole brain tissue as well as in the hippocampus in high
fructose and high fat fed rats (Mielke et al., 2005, Liu et al., 2015). Insulin receptors are
coupled to PI3KAktGSK3 pathway, which is known to be a crucial secondary signaling
pathway related to synaptic plasticity, synaptic structure, learningmemory and mood
processes. In our study, there were no alterations in phosphorylation levels of Akt and GSK3
after stimulated with intracerebroventricular insulin, eliminating the presence of insulin
resistance locally in the hippocampi of HFCSfed rats. Even though HFCSinduced
hyperexcitability and associated presynaptic and postsynaptic changes were not due to
hippocampal insulin resistance, the PI3KAktGSK3 pathway may still be involved in the
process. As NKA was also shown to be linked to PI3KAktGSK3 pathway (Wu et al.,
2013), decreased expression of the α3subunit of NKA may cause alterations in this pathway
leading to observed changes. However, the underlying signaling mechanism couldn’t be
unrevealed in this study and requires further focus in the future.
It is known that both western diet consumption and BD are associated with inflammation.
Here, we showed that HFCS consumption caused a systemic inflammatory response, which
was readily reversible with TDZD8 treatment. Even though the results of this study showed
many functional changes related to the hippocampus, we did not observe a statistically
significant local neuroinflammation in the hippocampi of rats fed with HFCS for 6 weeks.
This finding does not exclude the existence of inflammation in other brain regions, which
might be involved in the pathogenesis of BD, it simply showed that the electrophysiological
and molecular changes in the hippocampus cannot be explained by the local inflammation by
itself.
Page 31 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
22
In summary, we report for the first time that HFCS fed adolescent rats displayed a bipolar
like behavioural phenotype with associated hyperexcitability of CA3CA1 synapses. In
addition, we demonstrated that both presynaptic and postsynaptic alterations might underlie
the HFCSinduced hyperexcitability with little, if any, contribution of inflammation. A
decreased expression of neuronspecific α3subunit of NKA was also evident in hippocampi
of HFCSfed rats, however it should be further studied whether this change causes bipolar
like behavioural phenotype by inducing neuronal hyperexcitability or operates through a
different mechanism.
Page 32 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
23
AUTHOR CONTRIBUTIONS
This study is a part of the PhD dissertation of B.A. Conceptualization, B.A. and Y.S.;
Designed by B.A., S.T.T., C.K. and Y.S.; Experiments performed by B.A., M.Y., A.B., and
A.Y.G.; Writing – Original Draft, B.A.; Writing – Review & Editing, B.A., S.T.T. and Y.S.;
Resources, A.M.; Supervision Y.S.
Page 33 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
24
REFERENCES
ACKROFF, K. & SCLAFANI, A. 2011. Rats' preferences for high fructose corn syrup vs. sucrose and sugar mixtures. Physiol Behav, 102, 548-52.
BAENA, M., SANGUESA, G., DAVALOS, A., LATASA, M. J., SALA-VILA, A., SANCHEZ, R. M., ROGLANS, N., LAGUNA, J. C. & ALEGRET, M. 2016. Fructose, but not glucose, impairs insulin signaling in the three major insulin-sensitive tissues. Sci Rep, 6, 26149.
BRAY, G. A. 2013. Energy and fructose from beverages sweetened with sugar or high-fructose corn syrup pose a health risk for some people. Adv Nutr, 4, 220-5.
BREMER, A. A., STANHOPE, K. L., GRAHAM, J. L., CUMMINGS, B. P., WANG, W., SAVILLE, B. R. & HAVEL, P. J. 2011. Fructose-fed rhesus monkeys: a nonhuman primate model of insulin resistance, metabolic syndrome, and type 2 diabetes. Clin Transl Sci, 4, 243-52.
CASTAGNE, V., MOSER, P., ROUX, S. & PORSOLT, R. D. 2010. Rodent models of depression: forced swim and tail suspension behavioural despair tests in rats and mice. Curr Protoc Pharmacol, Chapter 5, Unit 5 8.
CHALECKA-FRANASZEK, E. & CHUANG, D. M. 1999. Lithium activates the serine/threonine kinase Akt-1 and suppresses glutamate-induced inhibition of Akt-1 activity in neurons. Proc Natl Acad Sci U S A, 96, 8745-50.
CHARAN, J. & KANTHARIA, N. D. 2013. How to calculate sample size in animal studies? J Pharmacol Pharmacother, 4, 303-6.
CHARLES, E. F., LAMBERT, C. G. & KERNER, B. 2016. Bipolar disorder and diabetes mellitus: evidence for disease-modifying effects and treatment implications. Int J Bipolar Disord, 4, 13.
COLLINO, M., THIEMERMANN, C., MASTROCOLA, R., GALLICCHIO, M., BENETTI, E., MIGLIO, G., CASTIGLIA, S., DANNI, O., MURCH, O., DIANZANI, C., ARAGNO, M. & FANTOZZI, R. 2008. Treatment with the glycogen synthase kinase-3beta inhibitor, TDZD-8, affects transient cerebral ischemia/reperfusion injury in the rat hippocampus. Shock, 30,299-307.
COSTELLO, D. A., CLARET, M., AL-QASSAB, H., PLATTNER, F., IRVINE, E. E., CHOUDHURY, A. I., GIESE, K. P., WITHERS, D. J. & PEDARZANI, P. 2012. Brain deletion of insulin receptor substrate 2 disrupts hippocampal synaptic plasticity and metaplasticity. PLoS One, 7,e31124.
DE SARNO, P., LI, X. & JOPE, R. S. 2002. Regulation of Akt and glycogen synthase kinase-3 beta phosphorylation by sodium valproate and lithium. Neuropharmacology, 43,1158-64.
DIXON, J. F. & HOKIN, L. E. 1998. Lithium acutely inhibits and chronically up-regulates and stabilizes glutamate uptake by presynaptic nerve endings in mouse cerebral cortex. Proc Natl Acad Sci U S A, 95, 8363-8.
DOBRETSOV, M. & STIMERS, J. R. 2005. Neuronal function and alpha3 isoform of the Na/K-ATPase. Front Biosci, 10, 2373-96.
DU, J., CRESON, T. K., WU, L. J., REN, M., GRAY, N. A., FALKE, C., WEI, Y., WANG, Y., BLUMENTHAL, R., MACHADO-VIEIRA, R., YUAN, P., CHEN, G., ZHUO, M. & MANJI, H. K. 2008. The role of hippocampal GluR1 and GluR2 receptors in manic-like behaviour. J Neurosci, 28, 68-79.
Page 34 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
25
DU, J., GRAY, N. A., FALKE, C., YUAN, P., SZABO, S. & MANJI, H. K. 2003. Structurally dissimilar antimanic agents modulate synaptic plasticity by regulating AMPA glutamate receptor subunit GluR1 synaptic expression. Ann N Y Acad Sci, 1003, 378-80.
DU, J., GRAY, N. A., FALKE, C. A., CHEN, W., YUAN, P., SZABO, S. T., EINAT, H. & MANJI, H. K. 2004a. Modulation of synaptic plasticity by antimanic agents: the role of AMPA glutamate receptor subunit 1 synaptic expression. J Neurosci, 24, 6578-89.
DU, J., QUIROZ, J., YUAN, P., ZARATE, C. & MANJI, H. K. 2004b. Bipolar disorder: involvement of signaling cascades and AMPA receptor trafficking at synapses. Neuron Glia Biol, 1,231-43.
EL-MALLAKH, R. S., EL-MASRI, M. A., HUFF, M. O., LI, X. P., DECKER, S. & LEVY, R. S. 2003. Intracerebroventricular administration of ouabain as a model of mania in rats. Bipolar Disord, 5, 362-5.
EL-MALLAKH, R. S. & WYATT, R. J. 1995. The Na,K-ATPase hypothesis for bipolar illness. Biol Psychiatry, 37, 235-44.
EVRANOS-AKSOZ, B., UCAR, G., TAS, S. T., AKSOZ, E., YELEKCI, K., ERIKCI, A., SARA, Y. & ISKIT, A. B. 2017. New Human Monoamine Oxidase A Inhibitors with Potential Anti- Depressant Activity: Design, Synthesis, Biological Screening and Evaluation of Pharmacological Activity. Comb Chem High Throughput Screen, 20, 461-473.
GOLDSTEIN, I., LERER, E., LAIBA, E., MALLET, J., MUJAHEED, M., LAURENT, C., ROSEN, H., EBSTEIN, R. P. & LICHTSTEIN, D. 2009. Association between sodium- and potassium-activated adenosine triphosphatase alpha isoforms and bipolar disorders. Biol Psychiatry, 65, 985-91.
GORE, F. M., BLOEM, P. J., PATTON, G. C., FERGUSON, J., JOSEPH, V., COFFEY, C., SAWYER, S. M. & MATHERS, C. D. 2011. Global burden of disease in young people aged 10-24 years: a systematic analysis. Lancet, 377, 2093-102.
GOULD, T. D., CHEN, G. & MANJI, H. K. 2004a. In vivo evidence in the brain for lithium inhibition of glycogen synthase kinase-3. Neuropsychopharmacology, 29, 32-8.
GOULD, T. D. & EINAT, H. 2007. Animal models of bipolar disorder and mood stabilizer efficacy: a critical need for improvement. Neurosci Biobehav Rev, 31, 825-31.
GOULD, T. D., EINAT, H., BHAT, R. & MANJI, H. K. 2004b. AR-A014418, a selective GSK-3 inhibitor, produces antidepressant-like effects in the forced swim test. Int J Neuropsychopharmacol, 7, 387-90.
GOULD, T. D. & MANJI, H. K. 2005. Glycogen synthase kinase-3: a putative molecular target for lithium mimetic drugs. Neuropsychopharmacology, 30, 1223-37.
GRILLO, C. A., PIROLI, G. G., HENDRY, R. M. & REAGAN, L. P. 2009. Insulin-stimulated translocation of GLUT4 to the plasma membrane in rat hippocampus is PI3-kinase dependent. Brain Res, 1296, 35-45.
GRILLO, C. A., PIROLI, G. G., LAWRENCE, R. C., WRIGHTEN, S. A., GREEN, A. J., WILSON, S. P., SAKAI, R. R., KELLY, S. J., WILSON, M. A., MOTT, D. D. & REAGAN, L. P. 2015. Hippocampal Insulin Resistance Impairs Spatial Learning and Synaptic Plasticity. Diabetes, 64, 3927-36.
GROSS, L. S., LI, L., FORD, E. S. & LIU, S. 2004. Increased consumption of refined carbohydrates and the epidemic of type 2 diabetes in the United States: an ecologic assessment. Am J Clin Nutr, 79, 774-9.
HASSEL, B., IVERSEN, E. G., GJERSTAD, L. & TAUBOLL, E. 2001. Up-regulation of hippocampal glutamate transport during chronic treatment with sodium valproate. J Neurochem,77, 1285-92.
Page 35 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
26
HSU, T. M., KONANUR, V. R., TAING, L., USUI, R., KAYSER, B. D., GORAN, M. I. & KANOSKI, S. E. 2015. Effects of sucrose and high fructose corn syrup consumption on spatial memory function and hippocampal neuroinflammation in adolescent rats. Hippocampus, 25, 227-39.
JURGENS, H., HAASS, W., CASTANEDA, T. R., SCHURMANN, A., KOEBNICK, C., DOMBROWSKI, F., OTTO, B., NAWROCKI, A. R., SCHERER, P. E., SPRANGER, J., RISTOW, M., JOOST, H. G., HAVEL, P. J. & TSCHOP, M. H. 2005. Consuming fructose-sweetened beverages increases body adiposity in mice. Obes Res, 13, 1146-56.
KAIDANOVICH-BEILIN, O., MILMAN, A., WEIZMAN, A., PICK, C. G. & ELDAR-FINKELMAN, H. 2004. Rapid antidepressive-like activity of specific glycogen synthase kinase-3 inhibitor and its effect on beta-catenin in mouse hippocampus. Biol Psychiatry, 55,781-4.
KALINICHEV, M. & DAWSON, L. A. 2011. Evidence for antimanic efficacy of glycogen synthase kinase-3 (GSK3) inhibitors in a strain-specific model of acute mania. Int J Neuropsychopharmacol, 14, 1051-67.
KIRSHENBAUM, G. S., CLAPCOTE, S. J., DUFFY, S., BURGESS, C. R., PETERSEN, J., JAROWEK, K. J., YUCEL, Y. H., CORTEZ, M. A., SNEAD, O. C., 3RD, VILSEN, B., PEEVER, J. H., RALPH, M. R. & RODER, J. C. 2011. Mania-like behaviour induced by genetic dysfunction of the neuron-specific Na+,K+-ATPase alpha3 sodium pump. Proc Natl Acad Sci U S A,108, 18144-9.
KLEIN, P. S. & MELTON, D. A. 1996. A molecular mechanism for the effect of lithium on development. Proc Natl Acad Sci U S A, 93, 8455-9.
LAN, M. J., MCLOUGHLIN, G. A., GRIFFIN, J. L., TSANG, T. M., HUANG, J. T., YUAN, P., MANJI, H., HOLMES, E. & BAHN, S. 2009. Metabonomic analysis identifies molecular changes associated with the pathophysiology and drug treatment of bipolar disorder. Mol Psychiatry, 14, 269-79.
LEONG, S. F. & LEUNG, T. K. 1991. Diabetes induced by streptozotocin causes reduced Na-K ATPase in the brain. Neurochem Res, 16, 1161-5.
LI, X., ZHU, W., ROH, M. S., FRIEDMAN, A. B., ROSBOROUGH, K. & JOPE, R. S. 2004. In vivo regulation of glycogen synthase kinase-3beta (GSK3beta) by serotonergic activity in mouse brain. Neuropsychopharmacology, 29, 1426-31.
LIM, J. S., MIETUS-SNYDER, M., VALENTE, A., SCHWARZ, J. M. & LUSTIG, R. H. 2010. The role of fructose in the pathogenesis of NAFLD and the metabolic syndrome. Nat Rev Gastroenterol Hepatol, 7, 251-64.
LIU, Z., PATIL, I. Y., JIANG, T., SANCHETI, H., WALSH, J. P., STILES, B. L., YIN, F. & CADENAS, E. 2015. High-fat diet induces hepatic insulin resistance and impairment of synaptic plasticity. PLoS One, 10, e0128274.
MALKESMAN, O., SCATTONI, M. L., PAREDES, D., TRAGON, T., PEARSON, B., SHALTIEL, G., CHEN, G., CRAWLEY, J. N. & MANJI, H. K. 2010. The female urine sniffing test: a novel approach for assessing reward-seeking behaviour in rodents. Biol Psychiatry, 67, 864-71.
MARRIOTT, B. P., COLE, N. & LEE, E. 2009. National estimates of dietary fructose intake increased from 1977 to 2004 in the United States. J Nutr, 139, 1228S-1235S.
MARTINEZ, A., ALONSO, M., CASTRO, A., PEREZ, C. & MORENO, F. J. 2002. First non-ATP competitive glycogen synthase kinase 3 beta (GSK-3beta) inhibitors: thiadiazolidinones (TDZD) as potential drugs for the treatment of Alzheimer's disease. J Med Chem, 45, 1292-9.
Page 36 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
27
MERTENS, J., WANG, Q. W., KIM, Y., YU, D. X., PHAM, S., YANG, B., ZHENG, Y., DIFFENDERFER, K. E., ZHANG, J., SOLTANI, S., EAMES, T., SCHAFER, S. T., BOYER, L., MARCHETTO, M. C., NURNBERGER, J. I., CALABRESE, J. R., ODEGAARD, K. J., MCCARTHY, M. J., ZANDI, P. P., ALDA, M., NIEVERGELT, C. M., PHARMACOGENOMICS OF BIPOLAR DISORDER, S., MI, S., BRENNAND, K. J., KELSOE, J. R., GAGE, F. H. & YAO, J. 2015. Differential responses to lithium in hyperexcitable neurons from patients with bipolar disorder. Nature, 527, 95-9.
MIELKE, J. G., TAGHIBIGLOU, C., LIU, L., ZHANG, Y., JIA, Z., ADELI, K. & WANG, Y. T. 2005. A biochemical and functional characterization of diet-induced brain insulin resistance. J Neurochem, 93, 1568-78.
NEWBERG, A. R., CATAPANO, L. A., ZARATE, C. A. & MANJI, H. K. 2008. Neurobiology of bipolar disorder. Expert Rev Neurother, 8, 93-110.
O'BRIEN, W. T., HARPER, A. D., JOVE, F., WOODGETT, J. R., MARETTO, S., PICCOLO, S. & KLEIN, P. S. 2004. Glycogen synthase kinase-3beta haploinsufficiency mimics the behavioural and molecular effects of lithium. J Neurosci, 24, 6791-8.
PANCHAL, S. K. & BROWN, L. 2011. Rodent models for metabolic syndrome research. J Biomed Biotechnol, 2011, 351982.
PARK, S., BLANCK, H. M., SHERRY, B., BRENER, N. & O'TOOLE, T. 2012. Factors associated with low water intake among US high school students - National Youth Physical Activity and Nutrition Study, 2010. J Acad Nutr Diet, 112, 1421-7.
PFAFFL, M. W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res, 29, e45.
POLLOCK, N. K., BUNDY, V., KANTO, W., DAVIS, C. L., BERNARD, P. J., ZHU, H., GUTIN, B. & DONG, Y. 2012. Greater fructose consumption is associated with cardiometabolic risk markers and visceral adiposity in adolescents. J Nutr, 142, 251-7.
POLTER, A., BEUREL, E., YANG, S., GARNER, R., SONG, L., MILLER, C. A., SWEATT, J. D., MCMAHON, L., BARTOLUCCI, A. A., LI, X. & JOPE, R. S. 2010. Deficiency in the inhibitory serine-phosphorylation of glycogen synthase kinase-3 increases sensitivity to mood disturbances. Neuropsychopharmacology, 35, 1761-74.
PRICKAERTS, J., MOECHARS, D., CRYNS, K., LENAERTS, I., VAN CRAENENDONCK, H., GORIS, I., DANEELS, G., BOUWKNECHT, J. A. & STECKLER, T. 2006. Transgenic mice overexpressing glycogen synthase kinase 3beta: a putative model of hyperactivity and mania. J Neurosci, 26, 9022-9.
RIO, D. C., ARES, M., JR., HANNON, G. J. & NILSEN, T. W. 2010. Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc, 2010, pdb prot5439.
RYVES, W. J. & HARWOOD, A. J. 2001. Lithium inhibits glycogen synthase kinase-3 by competition for magnesium. Biochem Biophys Res Commun, 280, 720-5.
SCHLOESSER, R. J., HUANG, J., KLEIN, P. S. & MANJI, H. K. 2008. Cellular plasticity cascades in the pathophysiology and treatment of bipolar disorder. Neuropsychopharmacology,33, 110-33.
SINGH, M. M. 1970. A unifying hypothesis on the biochemical basis of affective disorder. Psychiatr Q, 44, 706-24.
VALVASSORI, S. S., DAL-PONT, G. C., RESENDE, W. R., JORNADA, L. K., PETERLE, B. R., MACHADO, A. G., FARIAS, H. R., DE SOUZA, C. T., CARVALHO, A. F. & QUEVEDO, J. 2017. Lithium and valproate act on the GSK-3beta signaling pathway to reverse manic-like behaviour in an animal model of mania induced by ouabain. Neuropharmacology, 117, 447-459.
Page 37 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
28
VAN METER, A. R., MOREIRA, A. L. & YOUNGSTROM, E. A. 2011. Meta-analysis of epidemiologic studies of pediatric bipolar disorder. J Clin Psychiatry, 72, 1250-6.
VORHEES, C. V. & WILLIAMS, M. T. 2006. Morris water maze: procedures for assessing spatial and related forms of learning and memory. Nat Protoc, 1, 848-58.
VOS, M. B., KIMMONS, J. E., GILLESPIE, C., WELSH, J. & BLANCK, H. M. 2008. Dietary fructose consumption among US children and adults: the Third National Health and Nutrition Examination Survey. Medscape J Med, 10, 160.
WANDELL, P., LJUNGGREN, G., WAHLSTROM, L. & CARLSSON, A. C. 2014. Diabetes and psychiatric illness in the total population of Stockholm. J Psychosom Res, 77, 169-73.
WU, J., AKKURATOV, E. E., BAI, Y., GASKILL, C. M., ASKARI, A. & LIU, L. 2013. Cell signaling associated with Na(+)/K(+)-ATPase: activation of phosphatidylinositide 3-kinase IA/Akt by ouabain is independent of Src. Biochemistry, 52, 9059-67.
YUCEL, Z., SARA, Y., DUYGULU, P., ONUR, R., ESEN, E. & OZGULER, A. B. 2009. Automated discrimination of psychotropic drugs in mice via computer vision-based analysis. J Neurosci Methods, 180, 234-42.
YUKSEL, C. & ONGUR, D. 2010. Magnetic resonance spectroscopy studies of glutamate-related abnormalities in mood disorders. Biol Psychiatry, 68, 785-94.
ZARATE, C. A., JR., SINGH, J. & MANJI, H. K. 2006. Cellular plasticity cascades: targets for the development of novel therapeutics for bipolar disorder. Biol Psychiatry, 59, 1006-20.
Page 38 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
29
TABLES
Table 1. Sequences of the primers used in the qRT-PCR experiments.
Gene Forward Primer (5’-3’) Reverse Primer (5’-3’)
ATP1A1 TCCTTAAGCGTGCAGTAGCG CTCATCTCCATCACGGAGCC
ATP1A2 TAGCATACGAAGCGGCTGAG GATCATGCCGATCTGTCCGT
ATP1A3 GCCAAGATGGGGGACAAAAA TGCACGCAGTCGGTATTGTA
GAPDH TCCCATTCTTCCACCTTT TAGCCATATTCATTGTCATACC
Page 39 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
30
FIGURES AND FIGURE LEGENDS
Figure 1. Tracking of the consumption of corresponding diets and the metabolic
characterization of the rats. (a) Rats received their corresponding diets for 6 consecutive
weeks, beginning from the postnatal day 21. After a month of feeding with their
corresponding diets, rats were randomized for either vehicle or TDZD8 treatments for
additional 2 weeks. The last week of the 2 weeks of treatment period consisted of a battery of
behavioural tests. At the end of the 6th week, rats were undergone in vivo electrophysiology
experiments and sacrificed afterward for tissue collection. OGTT was performed in a different
set of rats in order to avoid any interference due to fasting. (b) Weekly liquid consumption
was significantly greater in HFCS group compared to the control group, starting from the
second week (n=6 cage/group, each cage houses 3 rats). (c) HFCS consumption caused a
significant reduction in weekly chow consumption throughout the tracking period of a month
(n=6 cage/group, each cage houses 3 rats). (d) The mean body weight of HFCS group was
slightly less than that of control group, starting from the day 17. The means of final weights
were different significantly between control and HFCS groups (n=9/group, Control 245±6.4
g, HFCS 224±5.0 g, p<0.05). (e) HFCS consumption caused glucose intolerance as evident in
OGTT, and TDZD8 reversed HFCSinduced glucose intolerance (n=10/group for control and
HFCS, n=5/group for TDZD8). (f) HFCS group displayed elevated blood glucose levels after
6 h of fasting, and TDZD8 partially reversed this elevation (Control 81.2±3.2 mg/dL, HFCS
130±3.4 mg/dL, TDZD8 109±3.9 mg/dL, F(2,22)=56.5, p<0.05). 2 h after the oral glucose
load, the blood glucose levels of HFCS remained high compared to those of control and
TDZD8 rats (Control 101±1.4 mg/dL, HFCS 133±4.7 mg/dL, TDZD8 106±4.1 mg/dL,
F(2,22)=24.9, p<0.05). (g) Area under the OGTT curve (AUC) was higher in HFCS group
compared to control group, and TDZD8 treatment restored towards control levels (Control
16988±328 mg/dL•min1, HFCS 18500±408 mg/dL•min1, TDZD8 16199±361 mg/dL•min1,
F(2,22)=8.46, p<0.05). (h) Total weight of extracted fat pads normalized to total body weight
was higher in HFCS group, suggesting a greater fatty body percentage, which was not
reversed by TDZD8 treatment (Control 3.8±0.2%, HFCS 4.5±0.2%, TDZD8 4.8±0.2%,
F(2,26)=7.0, p<0.05).
Page 40 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
31
Figure 2. HFCS consumption caused spontaneous hyperlocomotion, decreased anxiety,
increased risktaking behaviour, hyperhedonia, and susceptibility to behavioural
despair with significant impairments in hippocampal learning in adolescent rats. (a)
Total distance travelled in the open field arena (n=8/group, Control 18.5±4.5 m, HFCS
34.6±3.8 m, TDZD8 15.3±3.0 m, ANOVA F(2,21)=7.39, p<0.05). (b) Representative track
plots of OFA. (c) Time spent in open arms of the elevated plus maze (n=9/group, Control
6.0±2.5 s, HFCS 42.7±13.7 s, TDZD8 7.6±3.8 s, ANOVA F(2,24)=6.21, p<0.05). (d)
Averaged group heat maps of EPM. (e) Distance travelled in the open arms of the EPM
(n=9/group, Control 0.1±0.05 m, HFCS 0.8±0.2 m, TDZD8 0.2±0.08 m, ANOVA
F(2,24)=8.01, p<0.05). (f) Female Urine Sniffing Test. All three groups had significantly
increased sniffing durations when presented with female urine after distilled water
(n=8/group, repeated measures twoway ANOVA, Stage effect F(1,21)=21.8, p<0.05). When
groups were compared to each other, HFCS group had significantly higher sniffing durations
of female urine compared to the other groups (n=8/group, Control 8.1±1.1 s, HFCS 14.0±1.5
s, TDZD8 6.2±2.1 s, repeated measures twoway ANOVA, Group effect F(2,21)=6.24,
p<0.05). (g) Immobility duration in the forced swim test (n=9/group, Control 28.9±4.1 s,
HFCS 45.9±4.6 s, TDZD8 29.9±4.3 s, ANOVA F(2,24)=4.84, p<0.05). (h) Latency to find the
hidden platform in the acquisition stage of the Morris water maze and mean swim speeds
(inlet). The mean swim speeds of groups were not significantly different from each other
(n=9/group, Control 0.24±0.005 m/s, HFCS 0.24±0.005 m/s, TDZD8 0.23±0.004 m/s,
ANOVA, F(2,456)=0.474, p>0.05). Repeated measures twoway ANOVA revealed a significant
group effect in the acquisition stage of MWM (Acquisition Days × Groups F(6,420)=1.70,
p>0.05; Acquisition Days F(3,420)=118, p<0.05; Groups F(2,420)=6.90, p<0.05). In addition,
Tukey’s multiple comparisons test detected a difference between HFCS and TDZD8 groups
compared to control group on the first acquisition day. (i) Time spent in the target quadrant in
the probe trial of the MWM was not statistically different between groups (n=9/group but one
outlier data point was removed from control group as identified by ROUT test, Control
24±0.9 s, HFCS 25±2 s, TDZD8 25±2.8 s, F(2,23)=0.08, p>0.05).
Page 41 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
32
Figure 3. HFCS consumption caused neuronal hyperexcitability without altering
GABAergic inhibitory activity that was restored by TDZD8 in rat hippocampal CA3
CA1 synapses. (n=9 rats/group, maximum of 1 rat/group was exluded because of either low
quality recording, severe bleeding or death.) (a) Inputoutput curve of stratum radiatum.
HFCS group exhibited hyperexcitability compared to control and TDZD8 groups (repeated
measures twoway ANOVA, Group F(2,23)=4.66, p<0.05). (b) Pairedpulse paradigm in
stratum radiatum. HFCS and TDZD8 groups showed significantly less facilitation compared
to control group when interpulse interval was 20ms (Tukey’s multiple comparisons test,
control vs. HFCS and control vs. TDZD8, p<0.05). (c) Representative recordings from
stratum radiatum. I/O traces were selected from the responses to stimuli of 7 V. Pairedpulse
traces were given for interpulse intervals of 20 ms and 1000 ms. Traces from control group
were yellow, whereas traces from HFCS and TDZD8 groups were red and blue respectively
in their corresponding columns. (d) Inputoutput curve of stratum pyramidale. (e) Paired
pulse paradigm of stratum pyramidale. (f) Representative recordings from stratum
pyramidale. I/O traces were selected from the responses to stimuli of 7 V. Pairedpulse traces
were given for interpulse intervals of 20 ms and 1000 ms. Traces from control group were
yellow, whereas traces from HFCS and TDZD8 groups were red and blue respectively in
their corresponding columns.
Page 42 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
33
Figure 4. HFCS consumption in adolescent rats caused increased ser845
phosphorylation of GluR1 subunit of AMPA receptors and decreased transcription of
neuron specific α3subunit of NKA in hippocampus (n=4/group for immunoblot and
n=7/group for qRTPCR, maximum of 1/group was excluded from the qRTPCR experiments
as the isolation yielded low purity samples). (a) Relative protein levels of ser473
phosphorylated Akt to Akt normalized to βactin compared to control group. (b) Relative
protein levels of thr308phosphorylated Akt to Akt normalized to βactin compared to control
group. (c) Relative protein levels of ser9phosphorylated GSK3 to GSK3 normalized to β
actin compared to control group. (d) Relative protein levels of ser845phosphorylated GluR1
subunit of AMPA receptor to GluR1 subunit of AMPA receptor normalized to βactin
compared to control group (Statistical analysis was not performed as n<5/group). (e) Raw
immunoblot images of bands of ser845phosphorylated GluR1, GluR1 and βactin. (f)
Relative protein levels of NMDA2A normalized to βactin compared to control group. (g)
Relative protein levels of NMDA2B normalized to βactin compared to control group. (h)
Relative expression of α1subunit compared to control group. (i) Relative expression of α2
subunit compared to control group. (j) Relative expression of α3subunit compared to control
group.
Page 43 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
34
Figure 5. A systemic inflammatory response was evoked by HFCS consumption, but not
locally in the hippocampi (n=9/group). (a) IL1β levels in serum. (b) IL6 levels in serum.
(c) TNFα levels in serum. (d) IL1β levels normalized to total protein in hippocampus. (e)
IL6 levels normalized to total protein in hippocampus. (f) TNFα levels normalized to total
protein in hippocampus.
Page 44 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review1 2 3 4
600
900
1200
1500
1800
Weeks
*
**
ControlHFCSCo
nsum
ptio
n (m
L/ca
ge)
b
1 2 3 40
200
400
600
800
Weeks
*
**
*
ControlHFCSCo
nsum
ptio
n (g
/cag
e)
c
0
75
150
225
300
Days0 3 7 10 14 17 21 24 28
ControlHFCS
Wei
ght (
g)*
**
*d
-15 0 15 30 45 60 75 90 12060
100
140
180
220
Time (min)
*†‡
*†
*‡ *‡† *† *† *†
ControlHFCSTDZD-8O
GTT
Blo
od G
luco
se(m
g/dL
)
e
Fasting 120 min0
60
120
180‡
* †
OG
TT B
lood
Glu
cose
(mg/
dL)
* †f
Cont
rol
HFC
S
TDZD
-8
Cont
rol
HFC
S
TDZD
-8
Control HFCS TDZD-815K
19K
23K * †
Are
a U
nder
the
OG
TTCu
rve
g
Control HFCS TDZD-80
2
4
6
8
Fat W
eigh
t Nor
mal
ized
to B
ody
Wei
ght (
%)
h‡
*
aDay 1 Day 15 Day 29 Day 36Day 8 Day 22 Day 42
D I E T ( W A T E R o r H F C S )
TREATMENT (VEHICLE or TDZD-8)
BEHAVIORAL TESTS
In vivo electrophysiologyOGTT
Decapitation & tissue harvesting
Page 45 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer ReviewControl HFCS TDZD-8
0
20
40
60 * †
OFA
Tot
al D
ista
nce
(m)
a
Cont
rol
HFC
STD
ZD-8
b
0
50
100
150
Control HFCS TDZD-8
*
EPM
Tim
e in
Ope
nA
rms (
s)
c †
Cont
rol
HFC
STD
ZD-8
d
Control HFCS TDZD-80.0
0.5
1.0
1.5
2.0 * †
EPM
Dis
tanc
e in
Ope
nA
rms (
m)
e
Water Urine0
6
12
18
24 ControlHFCSTDZD-8
* †FU
ST S
niff
ing
Dur
atio
n (s
)f
Control HFCS TDZD-80
20
40
60
80* †
FST
Imm
obili
ty D
urat
ion
(s)g
1 2 3 40
25
50
75
100
Acqusition Days
*‡
Control
TDZD-8HFCS
MW
M L
aten
cy (s
)
Control HFCS TDZD-80
12
24
36
48
MW
M T
ime
in T
arge
tQ
uadr
ant (
s)
ih
0
0.1
0.2
0.3
TDZD-8Control HFCS
Swim
Spe
ed (m
/s)
Page 46 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
1 3 5 7 9 11 13 150
25
50
75
100
Stimulus Intensity (V)
†
††
†
ControlHFCSTDZD-8PS
Am
plitu
de (%
max
)
d
0
1
2
3
4
5
Interpulse Interval (ms)
ControlHFCSTDZD-8
20 40 60 80100
150200
300400
500600
700800
9001000
PS2/
PS1
e1 3 5 7 9 11 13 15
0
25
50
75
100
Stimulus Intensity (V)
fEPS
P Sl
ope
(% m
ax)
*†
*†*†
*†*†
*† †
ControlHFCSTDZD-8
a
1.00
1.25
1.50
1.75
2.00*‡
*ControlHFCSTDZD-8
Interpulse Interval (ms)20 40 60 80
100150
200300
400500
600700
800900
1000
fEPS
P2/f
EPSP
1
b
Stra
tum
Rad
iatu
m
c HFCS I/O TDZD-8 I/O
HFCS PP 20 ms TDZD-8 PP 20 ms
HFCS PP 1000 ms TDZD-8 PP 1000 ms
10m
V
10ms
Stra
tum
Pyr
amid
ale
f HFCS I/O TDZD-8 I/O
HFCS PP 20 ms TDZD-8 PP 20 ms
HFCS PP 1000 ms TDZD-8 PP 1000 ms
10m
V
10ms
Page 47 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer Review
Control HFCS TDZD-80
0.5
1.0
1.5
NM
DA
2A F
old
Chan
ge(n
orm
aliz
ed to
β-a
ctin
)
f
Control HFCS TDZD-80
1
2
3
4h
ATP1
A1 F
old
Chan
ge
Control HFCS TDZD-80
1
3
4
ATP1
A2 F
old
Chan
ge
i
2
Control HFCS TDZD-80
1
2
3*
‡
ATP1
A3 F
old
Chan
ge
j
pAKT
(ser
) / A
KT(n
orm
aliz
ed to
β-a
ctin
)
Control HFCS TDZD-80
0.5
1.0
1.5a
Control HFCS TDZD-80
0.5
1.0
1.5
pGSK
/ G
SK(n
orm
aliz
ed to
β-a
ctin
)
c
Control HFCS TDZD-80
2
4
6
8
pAM
PA /
AM
PA(n
orm
aliz
ed to
β-a
ctin
)
d
β-actin
AMPA
pAMPA
Control TDZD-8HFCS
1 2 3 41 12 3 42 3 4
e
45 kDa
100 kDa
100 kDa
Control HFCS TDZD-80
0.5
1.0
1.5g
NM
DA
2B F
old
Chan
ge(n
orm
aliz
ed to
β-a
ctin
)
Control HFCS TDZD-80
0.4
1.2
1.6
pAKT
(thr
) / A
KT(n
orm
aliz
ed to
β-a
ctin
)
b
0.8
Page 48 of 49
British Pharmacological Society
British Journal of Pharmacology
For Peer ReviewControl HFCS TDZD-8
0
300
600
900 * †Se
rum
IL-1β
(pg/
mL)
a
Control HFCS TDZD-80
25
50
75
Hip
poca
mpu
s IL-
1β(p
g/m
g To
tal P
rote
in)
dControl HFCS TDZD-8
0
600
1200
1800 * †
Seru
m IL
-6 (p
g/m
L)
b
Control HFCS TDZD-80
40
80
120
160
Hip
poca
mpu
s IL-
6(p
g/m
g To
tal P
rote
in)
eControl HFCS TDZD-8
0
700
1400
2100* †
Seru
m T
NF-α
(pg/
mL)
c
Control HFCS TDZD-80
50
100
150
Hip
poca
mpu
s TN
F-α
(pg/
mg
Tota
l Pro
tein
)
f
Page 49 of 49
British Pharmacological Society
British Journal of Pharmacology