Upload
buidan
View
213
Download
0
Embed Size (px)
Citation preview
Title: Proteorhodopsin-like genes present in thermoacidophilic high 1
mountain microbial communities 2
3
Running title: Proteorhodopsins diversity in Colombian acidic springs 4
5
Laura C. Bohorquez 1,2, Carlos A. Ruiz-Pérez 1,2 and María Mercedes 6
Zambrano# 1,2 7
8
Affiliations: 9
1 Molecular Genetics, Corporación CorpoGen, Carrera 5 No. 66A-34, 110231, 10
Bogotá DC, Colombia. 11
2 Colombian Center for Genomics and Bioinformatics of Extreme Environments – 12
GeBiX, Carrera 5 No. 66A-34, 110231, Bogotá DC, Colombia. 13
14
#Corresponding author: M.M. Zambrano, Corporación CorpoGen, Carrera 5 No. 15
66A-34, 110231, Bogotá D.C., Colombia. Phone: +571 8050122. Fax: +571 16
3484607. Email: [email protected] 17
18
19
Copyright © 2012, American Society for Microbiology. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.01683-12 AEM Accepts, published online ahead of print on 31 August 2012
on March 14, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Abstract 20
Proteorhodopsin (PR) sequences were PCR-amplified from three Andean acidic 21
hot spring samples. These sequences were similar to freshwater and marine PRs, 22
they contained residues indicative of proton-pumping activity and of proteins that 23
absorb green light, and suggest that PRs might contribute to cellular metabolism in 24
these habitats. 25
26
Keywords: diversity/ hot spring/ phototrophy/ proteorhodopsin 27
28
29
30
Proteorhodopsins (PRs) are retinal-binding bacterial transmembrane light-driven 31
proton pumps that generate energy from light and are considered to play an 32
important role in carbon cycling and energy fluxes in various aquatic ecosystems 33
(3, 4, 7, 8, 10, 16). PR proteins are widespread and abundant in marine and non-34
marine habitats (2, 6, 9, 17, 21, 23) and are tuned to absorb different spectral 35
wavelengths (4, 15, 18). PRs were recently shown to enhance survival and 36
competition of marine Vibrio cells during starvation, consistent with the suggestion 37
that they must have unique functional capabilities (10). 38
39
on March 14, 2018 by guest
http://aem.asm
.org/D
ownloaded from
The central Andean mountain range in Colombia is characterized by geothermal 40
activity and the presence of many fumaroles and hot springs located at high 41
altitude (> 3,400 m). A recent analysis of the microbial community in one of these 42
springs, El Coquito, showed the presence of chemolithoautotrophic acidophiles 43
and few phototrophic bacteria, both photoautotrophs and photoheterotrophs, 44
suggesting that primary production can be driven by chemical energy in the water 45
and by solar energy at the surface (5). Given the high exposure to solar light at the 46
surface (approximately 9 -11 mW/cm2 nm UV-B) (12), and the relatively low 47
abundance of phototrophic bacteria identified, we hypothesized that productivity in 48
these ecosystems could also be driven by energy-harvesting bacterial PRs. To 49
explore this possibility, we analyzed the diversity of PRs in several high mountain 50
acidic hot springs by PCR amplification using PR-specific primers. 51
52
Surface water samples were collected at four hot springs (A1, A2, A4 and A5) 53
located in the Nevados National Natural Park and processed as described (5). 54
These springs are all located at high altitudes and are acidic, but they differ in 55
terms of temperature and water characteristics (Table 1). PCR-amplification was 56
carried out using actinorhodopsin primers and six freshwater PR-specific primer 57
combinations (Table 2), as reported (2, 20), using both control plasmid DNA 58
(pCD1,pST84 for actinorhodopsins and pBAD.TA for freshwater primer 59
combinations) (3), and hot spring metagenomic DNAs in 50 µl reaction volumes 60
using 1U TucanTaq® DNA Polymerase (CorpoGen, Bogota, Colombia). 61
Amplification products were gel-purified (QIAquick® Gel Extraction Kit, Qiagen, 62
on March 14, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Germany), cloned in pCR2.1 TOPO TA kit (Invitrogen, San Diego, CA, USA), 63
transformed into Escherichia coli DH5α cells and individual clones sequenced 64
(Macrogen, Korea). Amplification products were obtained for three hot spring DNAs 65
(A5, A2 and A1) using four different primer combinations. There was no 66
amplification for actinorhodopsins in any of the samples even though 67
Actinobacteria were detected at least in site A4 by pyrosequencing (5), suggesting 68
that PR sequences were either absent or not amplifiable with the primers used. All 69
DNAs amplified using 16S rRNA gene primers 27F and 1492R (5), indicating the 70
absence of PCR inhibitors. From 433 cloned amplification products obtained with 71
four primer combinations (mixes 1, 3, 4, and 6), 91 clones (21%) corresponded to 72
PR-like partial genes after sequencing and analysis using blastn and tblastx 73
against the Genbank database (based on best hit): 84 from site A5, 5 from site A2 74
and 2 from site A1 (Table 2). These sequences showed no similarity with other 75
sequences in the databases and even though checked for chimeras manually, by 76
doing blast analysis of sequence fragments, it is possible that some of the 77
observed variability could still be due to chimeras and/or amplification errors. The 78
remaining discarded sequences had stop codons or produced hits with very low 79
scores and poor coverage using blastn and tblastx. Previous studies have also 80
shown low recovery of PR genes (5.2%) (14), which may result from the use of 81
degenerate primers. 82
83
The 91 sequences (accession numbers JN648719 to JN648809) had an average 84
length of 351 nt and similarity across the entire sequence with other putative PRs 85
on March 14, 2018 by guest
http://aem.asm
.org/D
ownloaded from
from environmental uncultured clones. These sequences corresponded to 22 86
nucleotide sequences and 15 amino acid sequences with 43% identical sites 87
across all sequences, indicating a substantial PR diversity. A phylogenetic 88
reconstruction done with the 15 protein inferred sequences and additional 89
reference sequences showed good bootstrap support, shared features with 90
previously published phylogenetic reconstructions and clustered our sequences 91
into three groups (Figure 1). Clade hp1 was formed by 11 different PR sequences 92
from hot spring A5 and clade hp2 clustered 3 PR sequences derived from clones 93
obtained from samples A1, A2 and A5 that were closely related to a coastal water 94
clone EBAC31A08 (AF279106) (3). The PRs within clades hp1 and hp2 had 91% 95
and 94% identical amino acid sites, respectively. A single PR sequence, 96
represented by 4 different nucleotide sequences from A5 hot spring, grouped close 97
to the previously identified “freshwater clade 8” (2). Thus the PRs identified in 98
these hot springs clustered in different groups and were similar to PRs from both 99
freshwater and marine environments. 100
101
To confirm the PRs detected using degenerate primers, in particular given the 102
possible errors associated with amplification, cloning and sequencing, we designed 103
primers to specifically amplify three of the newly identified sequences: JN648793 104
(clade hp1), JN648742 (clade hp2) and JN648744 (Figure 2, Table 2). PCR 105
amplification of the same metagenomic DNAs was carried out using more stringent 106
conditions: 35 cycles at 95ºC for 1 min, 58ºC for 30 sec, and 68ºC for 45 sec. 107
These PCR products were gel-purified and sequenced (Macrogen, Korea), thus 108
on March 14, 2018 by guest
http://aem.asm
.org/D
ownloaded from
avoiding the bias associated with sequencing single cloned sequences that might 109
harbor amplification errors. Amplification was successful with primers for 110
JN648793, using A1 and A2 DNAs, and JN648744, using A5 metagenomic DNA, 111
and the sequences obtained were identical to the original detected sequences, 112
lending support to the idea that these PR sequences are in fact present in these 113
samples and are not simply an artifact of amplification. Primers for JN648742 114
yielded only very faint amplification bands in all samples (A1, A2 and A5) and 115
insufficient amounts that could not be further sequenced. Efforts to obtain full-116
length genes from metagenomic DNAs using reported primers (13) or the genome 117
walking technique to amplify flanking regions (1) using a specific primer designed 118
within the sequences reported here, were unsuccessful. The lack of amplification of 119
full-length genes could be due to differences in the sequences themselves, 120
preventing correct primer annealing, or to problems stemming from low quantity of 121
the metagenomic DNA and its integrity after prolonged storage, since re-122
amplification with the 16S rRNA gene primers used initially was no longer efficient. 123
124
It was interesting that most of the sequences were obtained from site A5. This 125
could be due to inefficient recovery of PR genes from the other samples due to 126
problems inherent to the DNA preparation and/or amplification with the primers 127
used. However, given the fact that with the specific primers designed here we were 128
able to amplify sequences from both A1 and A2 that were identical to those 129
originally detected in sample A5 using degenerate primers (JN648793 and 130
JN648744), it seems likely that by changing PCR conditions and primers more PR 131
on March 14, 2018 by guest
http://aem.asm
.org/D
ownloaded from
genes can be recovered from sites A1 and A2 than originally detected. It is also 132
possible, however, that these springs harbor different microbial communities, as a 133
result of environmental variables, such as pH and temperature, and therefore vary 134
in terms of microorganisms harboring PR genes. 135
136
The hot spring PR sequences were examined for conservation of amino acid 137
residues in helix C, Asp at position 97 and Glu at 108, that are key for proton 138
pumping activity (22). The majority (90 sequences) conserved Glu108, and only 139
one sequence had a Gly at this position (Figure 2), consistent with the vast majority 140
of PRs observed to date (3, 11, 19) and suggestive of PRs that function as light-141
activated ion pumps involved in phototrophy, and not as sensory receptors. 142
However, analysis of full-length genes would be required since the conservation of 143
Asp97 could not be assessed given that the forward primer used for PCR-144
amplification included this residue close to the 3' end (20). All the PR sequences 145
also contained a non-polar Leu residue at position 105 (Figure 2), indicative of 146
green-absorbing proteins with absorption maxima (λmax) of 525 nm (15). 147
148
In this work we identified diverse and low abundance PR-like genes in 149
microorganisms from high-mountain, shallow and oligotrophic hot spring waters 150
with high exposure to UV light (12) that are predicted to encode green-absorbing 151
proteins that may harvest the available energy. Energy derived from rhodopsin 152
photosystems, which is very low compared with photosynthesis, could be 153
on March 14, 2018 by guest
http://aem.asm
.org/D
ownloaded from
advantageous in these acidic hot springs by contributing to survival in ecosystems 154
that receive abundant sunlight and where alternative energy sources may vary or 155
be scarce (10, 11). Future work aimed at amplification and cloning of a full-length 156
gene will be required, however, to fully assess the functionality of these proteins. 157
This work extends previous inventories of PR genes and shows that they are 158
present in isolated, acidic hot spring communities where energy derived from 159
rhodopsin photosystems may complement a chemotrophic lifestyle and provide an 160
advantage to bacterial cells, helping to compensate for changing environmental 161
conditions. 162
163
Acknowledgments 164
We would like to thank Jose Salvador Montaña and Gina López for sampling and 165
processing DNA, Luisa Delgado for help with bioinformatics, Nof Atamna-Ismaeel 166
and Howard Junca for help and opinions, Sandra Baena for statistical analysis, 167
Julie Anne Maresca and Asunción Martínez from E. DeLong´s Lab for providing us 168
with the positive controls for PR genes, and A. Martínez for critical comments on 169
the manuscript. This work was financed by Colciencias – SENA (project No.6570-170
392-19990) and was done under MAVDT contract No. 15, 2008 for access to 171
genetic resources and UAESPNN Research Permit No. DTNO-N-20/2007. 172
173
References 174
on March 14, 2018 by guest
http://aem.asm
.org/D
ownloaded from
1. Acevedo, J. P., F. Reyes, L. P. Parra, O. Salazar, B. A. Andrews, and J. A. 175
Asenjo. 2008. Cloning of complete genes for novel hydrolytic enzymes from 176
Antarctic sea water bacteria by use of an improved genome walking technique. 177
Journal of biotechnology 133:277-286. 178
2. Atamna-Ismaeel, N., G. Sabehi, I. Sharon, K. P. Witzel, M. Labrenz, K. 179
Jurgens, T. Barkay, M. Stomp, J. Huisman, and O. Beja. 2008. Widespread 180
distribution of proteorhodopsins in freshwater and brackish ecosystems. Isme J 181
2:656-662. 182
3. Beja, O., L. Aravind, E. V. Koonin, M. T. Suzuki, A. Hadd, L. P. Nguyen, S. B. 183
Jovanovich, C. M. Gates, R. A. Feldman, J. L. Spudich, E. N. Spudich, and E. 184
F. DeLong. 2000. Bacterial rhodopsin: evidence for a new type of phototrophy in 185
the sea. Science 289:1902-1906. 186
4. Beja, O., E. N. Spudich, J. L. Spudich, M. Leclerc, and E. F. DeLong. 2001. 187
Proteorhodopsin phototrophy in the ocean. Nature 411:786-789. 188
5. Bohorquez, L. C., L. Delgado-Serrano, G. Lopez, C. Osorio-Forero, V. Klepac-189
Ceraj, R. Kolter, H. Junca, S. Baena, and M. M. Zambrano. 2012. In-depth 190
Characterization via Complementing Culture-Independent Approaches of the 191
Microbial Community in an Acidic Hot Spring of the Colombian Andes. Microb Ecol 192
63:103-115. 193
6. Campbell, B. J., L. A. Waidner, M. T. Cottrell, and D. L. Kirchman. 2008. 194
Abundant proteorhodopsin genes in the North Atlantic Ocean. Environ Microbiol 195
10:99-109. 196
7. de la Torre, J. R., L. M. Christianson, O. Beja, M. T. Suzuki, D. M. Karl, J. 197
Heidelberg, and E. F. DeLong. 2003. Proteorhodopsin genes are distributed 198
among divergent marine bacterial taxa. Proc Natl Acad Sci U S A 100:12830-199
12835. 200
on March 14, 2018 by guest
http://aem.asm
.org/D
ownloaded from
8. Fuhrman, J. A., M. S. Schwalbach, and U. Stingl. 2008. Proteorhodopsins: an 201
array of physiological roles? Nat Rev Microbiol 6:488-494. 202
9. Giovannoni, S. J., L. Bibbs, J. C. Cho, M. D. Stapels, R. Desiderio, K. L. 203
Vergin, M. S. Rappe, S. Laney, L. J. Wilhelm, H. J. Tripp, E. J. Mathur, and D. 204
F. Barofsky. 2005. Proteorhodopsin in the ubiquitous marine bacterium SAR11. 205
Nature 438:82-85. 206
10. Gomez-Consarnau, L., N. Akram, K. Lindell, A. Pedersen, R. Neutze, D. L. 207
Milton, J. M. Gonzalez, and J. Pinhassi. 2010. Proteorhodopsin phototrophy 208
promotes survival of marine bacteria during starvation. PLoS Biol 8:e1000358. 209
11. Gomez-Consarnau, L., J. M. Gonzalez, M. Coll-Llado, P. Gourdon, T. Pascher, 210
R. Neutze, C. Pedros-Alio, and J. Pinhassi. 2007. Light stimulates growth of 211
proteorhodopsin-containing marine Flavobacteria. Nature 445:210-213. 212
12. IDEAM, and UPME. 2005. Mapas de índice UV para Colombia, p. 97-111, Atlás de 213
radiación solar de Colombia. Ministerio de Ambiente, Vivienda y Desarrollo 214
Territorial, Bogotá, D.C. 215
13. Jung, J. Y., A. R. Choi, Y. K. Lee, H. K. Lee, and K. H. Jung. 2008. 216
Spectroscopic and photochemical analysis of proteorhodopsin variants from the 217
surface of the Arctic Ocean. FEBS Lett 582:1679-1684. 218
14. Koh, E. Y., N. Atamna-Ismaeel, A. Martin, R. O. Cowie, O. Beja, S. K. Davy, E. 219
W. Maas, and K. G. Ryan. 2010. Proteorhodopsin-bearing bacteria in Antarctic 220
sea ice. Appl Environ Microbiol 76:5918-5925. 221
15. Man, D., W. Wang, G. Sabehi, L. Aravind, A. F. Post, R. Massana, E. N. 222
Spudich, J. L. Spudich, and O. Beja. 2003. Diversification and spectral tuning in 223
marine proteorhodopsins. Embo J 22:1725-1731. 224
16. Martinez, A., A. S. Bradley, J. R. Waldbauer, R. E. Summons, and E. F. 225
DeLong. 2007. Proteorhodopsin photosystem gene expression enables 226
on March 14, 2018 by guest
http://aem.asm
.org/D
ownloaded from
photophosphorylation in a heterologous host. Proc Natl Acad Sci U S A 104:5590-227
5595. 228
17. Rusch, D. B., A. L. Halpern, G. Sutton, K. B. Heidelberg, S. Williamson, S. 229
Yooseph, D. Wu, J. A. Eisen, J. M. Hoffman, K. Remington, K. Beeson, B. 230
Tran, H. Smith, H. Baden-Tillson, C. Stewart, J. Thorpe, J. Freeman, C. 231
Andrews-Pfannkoch, J. E. Venter, K. Li, S. Kravitz, J. F. Heidelberg, T. 232
Utterback, Y. H. Rogers, L. I. Falcon, V. Souza, G. Bonilla-Rosso, L. E. 233
Eguiarte, D. M. Karl, S. Sathyendranath, T. Platt, E. Bermingham, V. Gallardo, 234
G. Tamayo-Castillo, M. R. Ferrari, R. L. Strausberg, K. Nealson, R. Friedman, 235
M. Frazier, and J. C. Venter. 2007. The Sorcerer II Global Ocean Sampling 236
expedition: northwest Atlantic through eastern tropical Pacific. PLoS Biol 5:e77. 237
18. Sabehi, G., B. C. Kirkup, M. Rozenberg, N. Stambler, M. F. Polz, and O. Beja. 238
2007. Adaptation and spectral tuning in divergent marine proteorhodopsins from 239
the eastern Mediterranean and the Sargasso Seas. Isme J 1:48-55. 240
19. Sabehi, G., A. Loy, K. H. Jung, R. Partha, J. L. Spudich, T. Isaacson, J. 241
Hirschberg, M. Wagner, and O. Beja. 2005. New insights into metabolic 242
properties of marine bacteria encoding proteorhodopsins. PLoS Biol 3:e273. 243
20. Sharma, A. K., K. Sommerfeld, G. S. Bullerjahn, A. R. Matteson, S. W. 244
Wilhelm, J. Jezbera, U. Brandt, W. F. Doolittle, and M. W. Hahn. 2009. 245
Actinorhodopsin genes discovered in diverse freshwater habitats and among 246
cultivated freshwater Actinobacteria. Isme J 3:726-737. 247
21. Sharma, A. K., O. Zhaxybayeva, R. T. Papke, and W. F. Doolittle. 2008. 248
Actinorhodopsins: proteorhodopsin-like gene sequences found predominantly in 249
non-marine environments. Environ Microbiol 10:1039-1056. 250
on March 14, 2018 by guest
http://aem.asm
.org/D
ownloaded from
22. Spudich, J. L., and K.-H. Jung. 2005. Microbial Rhodopsins: Phylogenetic and 251
Functional Diversity, p. 1-24. In W. R. Briggs and J. L. Spudich (ed.), Handbook of 252
photosensory receptors. Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim. 253
23. Stingl, U., R. A. Desiderio, J. C. Cho, K. L. Vergin, and S. J. Giovannoni. 2007. 254
The SAR92 clade: an abundant coastal clade of culturable marine bacteria 255
possessing proteorhodopsin. Appl Environ Microbiol 73:2290-2296. 256
24. Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei, and S. Kumar. 2011. 257
MEGA5: molecular evolutionary genetics analysis using maximum likelihood, 258
evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28:2731-259
2739. 260
261
Figure Legends 262
Figure 1. Neighbor-Joining phylogenetic tree constructed using 15 inferred PR 263
protein hot spring sequences and 70 reported sequences. Sequences were aligned 264
using ClustalW and the phylogeny was constructed using the Neighbor-Joining 265
algorithm with 1000 bootstrap replicates with the program MEGA (24). Sequences 266
from hot spring samples are shown in grey boxes, indicating site (A1, A2 or A5), 267
followed by accession number and number of represented different nucleotide 268
sequences (in parenthesis). The number in parenthesis for clade hp1 indicates the 269
unique PR amino acid sequences. Hot spring clades (hp) and previously reported 270
clades (hatched boxes) are indicated (2). Bootstrap values greater than 50% are 271
shown. Known phylogenetic affiliations are indicated, G-Prot, 272
Gammaproteobacteria; A-Prot, Alphaproteobacteria. 273
on March 14, 2018 by guest
http://aem.asm
.org/D
ownloaded from
274
Figure 2. Multiple alignment of PR amino acid sequences of eBAC31A08 and 275
representative hot springs sequences from each hp clade. Positions are based on 276
the eBAC31A08 protein numbering (3). Residues 97 and 108 are marked with an 277
arrow, and position 105 is boxed. Transmembrane helices (3) are indicated, as well 278
as the position of the degenerate primers (grey boxes) and the specific primers 279
designed in this study (underlined sequences). 280
281
282
on March 14, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Table 1. Characteristics of the sites sampled 283
Sample A1 A2 A5 A4
Date of sampling 07/04/2008 07/04/2008 08/04/2008 09/04/2008 Ecosystem* HAF HAF-SP SP SP Location 4°58'13.2'' N
75°22'42'' W 4°58'10.3'' N 75°22'38.6'' W
4°54'32.8'' N 75°18'19'' W
04°52'27''N 75°15'51.4''W
Altitude (m) 3464 3876 4363 3973 DAPI counts (cells ml-1) 2.09 × 105 9.16 × 104 2.42 × 104 2.35 ×105
Temperature (°C) 56.9 56.8 35 28.9 pH 2.03 2.04 3.12 2.7 Acidity (CaCO3) (mg L-1) 3633 4525 500 500 Chloride (Cl-) (mg L-1) 653 841 139 56.6 Sulfates (SO4
2-) (mg L-1) 2681 3239 1052 1003 Calcium (Ca2+) (mg L-1) 195 247 256 320 Sodium (Na+) (mg L-1) 413 531 122 45.2 Magnesium (Mg2+) (mg L-1) 282 247 134 55.3 Potassium (K+) (mg L-1) 60.8 74.3 13.5 9.25 Nitrates (NO3
-) (mg L-1) 2.44 0.51 ≤ 0.19 0.89 Total hardness (CaCO3) (mg L-1) 1192 1461 1285 1224 Total Phosphate (PO4) (mg L-1) 1.89 2.76 0.25 0.1 Total Iron (mg L-1) 56 69.4 25.8 8.27 Total suspended solids (mg L-1) 13.6 138 28.4 ≤ 8.01 Total solids (mg L-1) 7039 8854 3124 2620 Total dissolved solids (mg L-1) 6032 7049 2561 2280
284
* Ecosystems: HAF, High Andean Forest; SP, Superpáramo; 285 286
on March 14, 2018 by guest
http://aem.asm
.org/D
ownloaded from
287 Table 2. Primers used in this study 288 289 Degenerate Primers used for initial amplifications*
Mix Forward primer (5' - 3') Reverse primer (5' - 3') Recovered with PCR ** Positive PRs**
1 RYIDW MGNTAYATHGAYTGG GWAIYP GGRTADATNGCCCANCC A1(95), A2(54), A5(104) A2(5), A5(84)
2 RYIDW GWSIYP GGRTADATNSWCCANCC none
3 RYIDW GWAVYP GGRTANACNGCCCANCC A1 (120) A1 (2)
4 RYVDW MGNTAYGTNGAYTGG GWSIYP A1 (21) No
5 RYVDW GWVIYP GGRTADATNACCCANCC none
6 RYVDW GWAVYP A1 (39) No
7 YRYVDW TAYMGNTAYGTNGAYTGG WGVYPI ATNGGRTANACNCCCCA none
8 YRYADW TAYMGNTAYGCNGAYTGG WGVYPI none
Specific Primers designed to amplify PR sequences from metagenomic DNA PR
sequence Primers Sequence (5' - 3')
Recovered with PCR
JN648742 JN648742-F TTCTACTTAATTCTTGCTGCT A1, A2, A5 JN648742-R GCCCAGCCAAAGATGATAATA
JN648793 JN648793-F CTATCTGATCCTTTCCGCCAT A1, A2 JN648793-R ATATAGCCCAGCCGAAGGTGA
JN648744 JN648744-F CTGATTACCGTTCCGCTCCTG A5 JN648744-R ATCCGATTGTGACGATCCAGC
*Primers were taken from Atamna-Ismaeel et al, 2008 (2) and Sharma et al, 2009 (20)
**Numbers in parenthesis indicate the number obtained at each site 290
on March 14, 2018 by guest
http://aem.asm
.org/D
ownloaded from