Thesis for doctoral degree (Ph.D.)2009

Lova Perup Segerström

Thesis for doctoral degree (Ph.D.) 2009

Lova Perup SegerströmN

ovel Experimental Targeted Th

erapy in Neuroblastom

a

Novel Experimental Targeted Therapy in

Neuroblastoma

From

DEPARTMENT OF WOMEN’S AND CHILDREN’S HEALTH Karolinska Institutet, Stockholm, Sweden

NOVEL EXPERIMENTAL TARGETED THERAPY IN

NEUROBLASTOMA

Lova Perup Segerström

Stockholm 2009

‘Som cesium och syre brinner Jag alldeles klart’ (Celcius, Isola, 1997)

All previously published papers were reproduced with permission from the publisher. Published by Karolinska Institutet. Printed by Larserics Digital Print © Lova Perup Segerström, 2009 ISBN 978-91-7409-675-0

To…

…my satisfaction…

’Det är så konstigt med mig, jag kan nästan allt. Jag kan allt, utom slalom. Men det borde inte vara så svårt? Först åker man åt ena hållet, sen åker man åt andra hållet,

och så vickar man på stjärten hela tiden!’

Lotta på Bråkmakargatan / Astrid Lindgren

ABSTRACT Neuroblastoma, a malignancy of the sympathetic nervous system, is the most common solid extracranial tumor of infancy and is responsible for around 15% of the cancer-related deaths in children. For the entire group the survival has increased over the last decades, but despite today’s intense muti-modal therapy the survival of high-risk neuroblastomas lies just around 50%. Therefore, novel treatment options are urgently needed and awaited. The development of novel cancer therapies has geared up with more and more agents entering trials and become clinically available, but this has predominately been directed towards the adult oncology area. Hopefully, legal directives will act as a ‘carrot and a stick’ on companies to take more interest in the pediatric area.There are concerns, with all rights, about how much efficacy a novel drug should need to show before it can be justified to move into the clinic. Preclinical animal models of cancer have established their role in the evaluation of these agents. But there is everlasting uncertainty about how truly they represent all or parts of a particular disease, and if in vivo efficacy is predictive of clinical value. This thesis describes the investigation of six novel targeted therapies, evaluated in vitro and in vivo in neuroblastoma. Anti-angiogenic antibody-therapy with bevacizumab (Avastin®) showed efficacy in vivo in three neuroblastoma xenograft models. Primary material from neuroblastoma was shown to express activated Akt and mTOR. Inhibition of the mTOR signalling pathway with rapamycin (Rapamune®) or its novel analogue CCI-779 (Torisel®) showed promising potential in vitro and in vivo, where the most interesting finding was that MYCN-amplified or over expressing cells were more sensitive. Upon treatment in vitro and in vivo we observed a down regulation of MYCN and cyclin D1 protein. Inhibition of the upstream signalling pathway with the PDK1 inhibitor OSU03012 or the dual PI3K/mTOR inhibitor PI103 did also show promising effects in vitro and in vivo. The major finding was that inhibition upstream of mTOR seemed most effective in MYCN-amplified or over expressing cells. As observed previously, treatment was associated with a down regulation of MYCN and cyclin D1 proteins. Targeting the MYCN protein with the Myc-Max disruptor 10058-F4 had effect in vitro. There were modest effects of 10058-F4 in vivo on a MYCN-amplified xenograft model, whereas in vivo in the transgenic MYCN-driven model of neuroblastoma, 10058-F4 showed some interesting potential. In summary, this thesis suggests that targeting angiogenesis in neuroblastoma appear as an interesting strategy. Primary neuroblastoma seems to be over expressing key proteins in the PI3K/Akt/mTOR pathway and targeting these with inhibitors seems to have efficacy, especially in the context of a MYCN-amplification or over expression. Also, interfering with the MYCN protein appears as an interesting approach. Some of these compounds are currently easing their way into the pediatric oncology area and hopefully in the future they, and the results generated in this thesis, will aid in improving the survival of children with neuroblastoma.

LIST OF PUBLICATIONS

I. Segerström L*, Fuchs D*, Bäckman U, Holmquist K, Christofferson R, Azarbayjani F. (2006) The anti-VEGF Antibody bevacizumab potently reduces the growth rate of high-risk neuroblastoma xenografts. Pediatric Research;60(5).

II. Johnsen JI*, Segerström L*, Orrego A, Elfman L, Henriksson M, Kågedal B, Eksborg S, Sveinbjörnsson B, Kogner P. (2008) Inhibitors of mammalian target of rapamycin downregulate MYCN protein expression and inhibit neuroblastoma growth in vitro and in vivo. Oncogene, 27(20);2910-22.

III. Segerström L, Baryawno N, Elfman L, Sveinbjörnsson B, Kogner P, Johnsen JI. (2009) Effects of the novel PDK-1 inhibitor OSU-03012 and the dual PI3K/mTOR inhibitor PI103 on neuroblastoma in vitro and in vivo. In manuscript.

IV. Segerström L, Zirath H, Henriksson M*, Kogner P*. (2009) The Myc –Max disruptor 10058-F4 show promising efficacy in vivo on the MYCN-driven transgenic neuroblastoma model. In manuscript.

* Authors contributed equally Related publications, not included in the thesis Baryawno N, Sveinbjörnsson B, Eksborg S, Orrego A, Segerström L, Öqvist CO, Holm S, Gustavsson B, Kågedal B, Kogner P, Johnsen JI. (2008) Tumor-growth-promoting cyclooxygenase-2 prostaglandin E2 pathway provides medulloblastoma therapeutic targets. Neuro Oncology, 10(5);661-74. Wickström M, Johnsen JI, Ponthan F, Segerström L, Sveinbjörnsson B, Lindskog M, Lövborg H, Viktorsson K, Lewensohn R, Kogner P, Larsson R, Gullbo J. (2007) The novel melphalan prodrug J1 inhibits neuroblastoma growth in vitro and in vivo. Molecular Cancer Therapeutics, 6(9);2409-17. Ponthan F, Wickström M, Gleissman H, Fuskevåg OM, Segerström L, Sveinbjörnsson B, Redfern CP, Eksborg S, Kogner P, Johnsen JI. (2007) Celecoxib prevents neuroblastoma tumor development and potentiates the effect of chemotherapeutic drugs in vitro and in vivo. Clinical Cancer Research, 13(3);1036-44. Gleissman H, Segerström L, Hamberg M, Ponthan F, Lindskog M, Johnsen JI and Kogner P. (2009) Omega-3 fatty acid supplementation delays the progression of neuroblastoma in vivo. In manuscript.

‘Så nära det bränns, Jag är äntligen här’ (Kungen är död, Hagnesta Hill, 1999)

CONTENTS 1 Foreword .................................................................................................................. 1 2 Childhood cancer – why a category of its own? ..................................................... 2

2.1 Childhood cancer in numbers ....................................................................... 2 2.2 How and why different from adult cancer? ................................................... 2 2.3 Are not children just small adults? ................................................................ 3

3 Neuroblastoma – deciphering the Enigma? ........................................................... 5 3.1 Origin and localisation ................................................................................... 5 3.2 Aetiology ........................................................................................................ 5 3.3 Epidemiology ................................................................................................. 6 3.4 Clinic .............................................................................................................. 6

3.4.1 Clinical presentation and diagnosis ................................................ 6 3.4.2 Staging system ................................................................................ 6 3.4.3 Screening ......................................................................................... 7 3.4.4 Current therapy ................................................................................ 7

3.5 Biology ........................................................................................................... 7 3.5.1 Prognostic factors – clinical ............................................................. 7 3.5.2 Prognostic factors – molecular and histopathological .................... 8 3.5.3 Prognostic factors – genetical ......................................................... 8

3.6 Translational – bringing the lab to the clinic ................................................. 9 4 Animal models – being patient with our rodent patients ....................................... 10

4.1 Taking the furry history tour ........................................................................ 10 4.2 Hollow fibre assay ....................................................................................... 11 4.3 Heterotopic xenograft models ..................................................................... 11

4.3.1 Being nude ..................................................................................... 11 4.3.2 Practicalities ................................................................................... 12

4.4 Orthotopic and metastatic models .............................................................. 13 4.4.1 Practicalities ................................................................................... 13

4.5 Transgenic models ...................................................................................... 14 4.5.1 Genotyping –deciding if you are my type or not ........................... 15 4.5.2 Practicalities ................................................................................... 15

4.6 Screening programs.................................................................................... 15 4.7 Experimental models - where there’s light, there’s shadow ...................... 17

4.7.1 Hollow fibre assay ......................................................................... 17 4.7.2 Heterotopic xenograft models ....................................................... 17 4.7.3 Orthotopic and metastatic models ................................................ 18 4.7.4 Transgenic models ........................................................................ 18

5 Therapeutic rationales – what to do and why? ..................................................... 19 5.1 Angiogenesis inhibition – not going with the flow! ..................................... 20

5.1.1 The bloody history of it .................................................................. 20 5.1.2 Sprouting here and there, sprouting everywhere ......................... 20 5.1.3 The VEGF family ........................................................................... 20 5.1.4 ‘Why are tumor blood vessels abnormal and is it important?’ ..... 21 5.1.5 Bevacizumab ................................................................................. 22 5.1.6 Toxicity, pharmacology and resistance ........................................ 22 5.1.7 The role of angiogenesis in neuroblastoma ................................. 22

5.2 mTOR signalling – taking a tango with the target! ..................................... 24 5.2.1 PI3K in cancer – raising a red card for a frequent player? .......... 24 5.2.2 Signalling via the PI3K hub – all roads leading through Akt? ...... 24 5.2.3 From Rapa Nui to Rapa Mycin… .................................................. 26 5.2.4 …and onwards to the Olimus brotherhood of rapalogues ........... 27 5.2.5 Toxicity, pharmacology and resistance ........................................ 27 5.2.6 The role of this wicked team in the neuroblastoma playoff .......... 28

5.3 PI3K signalling – disrupt the chain of command! ....................................... 30 5.3.1 The role of the PI3K pathway in cancer ....................................... 30 5.3.2 The PI3K family – keep on adding the complexity layers ............ 30 5.3.3 Selective PI3K inhibitors – how was it with that selectivity? ........ 31 5.3.4 But in this myriad of drugs, what do one chose? ......................... 32 5.3.5 PDK1 inhibitors – emerging from the darkness ............................ 32 5.3.6 Toxicity, pharmacology and resistance ........................................ 33 5.3.7 PI3K and PDK1 in neuroblastoma ................................................ 34

5.4 Transcription signalling – messing with Myc! ............................................. 36 5.4.1 Myc signalling in cancer – the naughty, the bad and the ugly? ... 36 5.4.2 The story of an overachieving little protein ................................... 36 5.4.3 Inhibiting Myc - the emasculation of a long standing dream? ...... 37 5.4.4 Toxicity, pharmacology and resistance ........................................ 38 5.4.5 MYCN in neuroblastoma ............................................................... 39

6 Aims ....................................................................................................................... 40 7 Materials and Methods .......................................................................................... 41

7.1 In vitro .......................................................................................................... 41 7.1.1 Neuroblastoma cell lines ............................................................... 41 7.1.2 Inhibitors, drugs and agents .......................................................... 41 7.1.3 Viability assays .............................................................................. 41 7.1.4 Immunoblotting .............................................................................. 42 7.1.5 Immunohistochemistry .................................................................. 42 7.1.6 ELISA and mRNA analysis ........................................................... 43

7.2 In vivo .......................................................................................................... 43 7.2.1 Housing and husbandry ................................................................ 43 7.2.2 Xenograft models .......................................................................... 43 7.2.3 Transgenic model .......................................................................... 44

7.3 Statistical analysis ....................................................................................... 44 8 Results and discussion .......................................................................................... 46

8.1 Paper I ......................................................................................................... 46 8.1.1 Description of the study ................................................................. 46 8.1.2 Results ........................................................................................... 46 8.1.3 Discussion ..................................................................................... 47

8.2 Paper II ........................................................................................................ 50 8.2.1 Description of the study ................................................................. 50 8.2.2 Results ........................................................................................... 50 8.2.3 Discussion ..................................................................................... 51

8.3 Paper III ....................................................................................................... 56 8.3.1 Description of the study ................................................................. 56 8.3.2 Results ........................................................................................... 56 8.3.3 Discussion ..................................................................................... 57

8.4 Paper IV....................................................................................................... 60 8.4.1 Description of the study ................................................................. 60 8.4.2 Results ........................................................................................... 60 8.4.3 Discussion ...................................................................................... 61

9 Summary and conclusions .................................................................................... 64 10 Future perspectives ............................................................................................... 65 11 Acknowledgements ............................................................................................... 67 12 References ............................................................................................................. 74

‘Ni kan skratta om Ni vill, håna oss! Vi rör oss, Ni står still’ (747, Isola, 1997)

LIST OF ABBREVIATIONS (eIF)-4E Eukaryotic translation initiation factor 4E 4E-BP1 Eukaryotic translation initiation factor 4E-binding protein 1 Akt Protein kinase B ALK Anaplastic lymphoma kinase AMPK AMP-activated protein kinase ATP/ADP/AMP Adenosine tri/di/mono-phosphate BDNF Brain-derived neurotrophic factor Chk1 Checkpoint kinase 1 COX-2 Cyclooxygenase-2 DNA-PK DNA-dependent kinase EGF and EGFR Epidermal growth factor and its receptor ERK Extracellular signal-regulated kinase FDA Food and Drug Administration FKBP12 FK-506 binding protein GD2 Disialoganglioside GTP/GDP/GMP Guanine tri/di/mono-phosphate HIF1α Hypoxia-inducable factor 1α IGF and IGFR Insuline-like growth factor and its receptor IRS1 Insulin receptor substrate 1 LKB1 serine/threonine kinase 11 MAPK Mitogen-activated protein kinase MDR Multidrug resistance miRNA MicroRNA MRI Magnetic resonance imaging MRP Multidrug resistance-associated protein MTD Maximally tolerated dose mTOR Mammalian target of rapamycin mTORC1 or 2 Mammalian target of rapamycin complex 1 or 2 MYCN Myelocytomatosis virus related oncogene, neuroblastoma NCI National Cancer Institute NGF Nerve growth factor NIH National Institute of Health NPC Neuronal precursor cells NSAID Non-steroidal anti-inflammatory drug NT-3 Neurotrophin-3 ODC1 Ornithine decarboxylase 1 OIS Oncogene-induced senescence p70S6K Protein70 S6 kinase PA Phosphatidic acid PDGF and PDGFR Platelet-derived growth factor and its receptor PDK1 Phosphoinositide-dependent kinase 1 PDK2 Phosphoinositide-dependent kinase 2 (identity unclear) PET Positron-emission tomography/ PH domain Pleckstrin homology domain PI3K Phosphatidyl-inositol 3 kinase PI4K Phosphatidyl-inositol 4 kinase PIN1 Prolyl isomerase 1 PP2A Protein phosphatase 2A

PPTP Pediatric preclinical testing program PtdIns(x)Px Phosphatidyl-inositol, mono-, di- or tri-phosphorylated PTEN Phosphatase with tensin homology RAG Recombination activating gene Raptor Regulatory associated protein of mTOR Rheb Ras homologue enriched in brain Rictor Rapamycin-insensitive companion of mTOR RNAi RNA interference RTK Receptor tyrosine kinase s.c. / i.p. / p.o. Subcutaneous / intraperitoneal / per os (orally) SCID Severe combined immunodeficiency SH2 domain Src homology domain Shh The Sonic Hegdehog signalling pathway SHIP SH2 domain-containing inositol phosphatase TGFβ Transforming growth factor β TrkA/B/C Tropomyosin-related kinase A, B or C TSC 1 or 2 Tuberous sclerosis complex TSP-1 Thrombospondin-1 TVI Tumor volume index VEGF/R Vascular endothelial growth factor and its receptor vHL Von Hippel-Lindau tumor suppressor

1

1 FOREWORD This thesis is about the childhood cancer neuroblastoma, a solid tumor of the peripheral nervous system, and the preclinical investigation of novel targeted therapies that possibly could contribute to improve the otherwise poor survival of these young patients. The thesis focuses also on the use of animal models in preclinical screening of novel targeted therapies and if they can aid in the selection of novel therapies to consider taking into the clinic. Stockholm, November 2009

’På en sekund, är jag långt härifrån, Jag mäter försprång i ljusår Jag är redan i mål’

(Elvis, Isola, 1997).

2

2 CHILDHOOD CANCER – WHY A CATEGORY OF ITS OWN?

Cancer is thought of as a disease of the adult, an inevitable fate of aging. The hallmarks of cancer include uncontrolled cell proliferation without restrictions, overriding signals to cease cycling, defy death signals and invade and spread (Hanahan et al., 2000). In many cases, the underlying mechanisms have been discovered and the disease can be explained by inherited or acquired genetic abnormalities and/or lifestyle and environmental factors. Therefore, the diagnosis of cancer in a young child seems somewhat like a contradiction and hard to grasp. 2.1 CHILDHOOD CANCER IN NUMBERS Childhood cancer comprise around 2% of all cancer cases in western countries (Scotting et al., 2005) but is the leading cause of childhood death due to disease in developed countries, and the second cause of childhood death worldwide only surpassed by infectious diseases in developing countries (Johnsen et al., 2009). There are indications that the incidence of childhood cancer is rising in Europe (a 1% average yearly increase) as reported from the ACCIS project (Automated Childhood Cancer Information System) on data collected from 1978-1997 from 62 cancer registries in 19 European countries (Pritchard-Jones et al., 2006). In response to scepticism, the authors concluded that a small increase in incidence might only be significant in larger materials, as childhood cancers are rare (Steliarova-Foucher et al., 2005). Though improved registration could not be excluded as a cofounding factor, the data did not support that explanation. Instead, decreased infant mortality (thereby increasing the pool of children surviving to later be diagnosed with cancer) and other parameters related to increased risk for childhood cancer (higher parental age, thereby greater number of children being firstborns, and an increase in birth weight) were offered as possible explanations (Steliarova-Foucher et al., 2005). 2.2 HOW AND WHY DIFFERENT FROM ADULT CANCER? There are fundamental differences between cancer in the adult and in the child. Adult cancers are mainly carcinomas (of epithelial origin) whereas children predominately get haematological or nervous system cancers (Scotting et al., 2005). Cancer in the young child can be thought of as a deregulation of normal development (Grimmer et al., 2006). During development, dividing cells give rise to more dividing cells and cellular migration is intrinsically entwined. This is in contrast to the adult, where dividing cells nearly always gives rise to daughter cells that differentiate and stay put (Scotting et al., 2005). A small subset of neuroblastomas can spontaneously regress, which indicates a developmental aspect (Scotting et al., 2005). Screening of infants has shown neuroblastomas in situ, but these rarely became tumors, and presumably these are eradicated as a part of the normal developmental program (Nakagawara et al., 2004; Scotting et al., 2005). Additionally, several signalling pathways shown

3

to be deregulated in neuroblastoma also play important roles in the normal maturation of sympathetic neurons (Nakagawara and Ohira, 2004). 2.3 ARE NOT CHILDREN JUST SMALL ADULTS? Today, about 75% of all children diagnosed with cancer in Europe survive (Pritchard-Jones et al., 2006). As these data are encouraging one has to acknowledge both those that, despite our most intense effort, succumb to the disease (Pritchard-Jones et al., 2006) and also the growing number of adolescent and/or adult survivors with adverse late effects from the treatment they have recieved (Blaauwbroek et al., 2007). Novel targeted therapies are rapidly developed for adult cancers but the pediatric area is lagging behind, in whole or in part, due to the fact that childhood cancer belongs to the rare disease group and that low prevalence makes clinical studies nearly impossible unless national or international collaboration is sought (Vassal, 2009). Targeted drugs are developed for adult cancers, and it is crucial to verify the relevance of these targets in childhood cancers prior to initiating clinical trials (Balis et al., 2009). In addition, few of the drugs used in pediatrics have been properly studied for the pediatric population, especially in the oncology area (Saint Raymond et al., 2005). In 1997, the US developed programs to regulate and support development of drugs for children. The Best Pharmaceuticals for Children Act encouraged companies to provide data in children, and this was followed by the Pediatric Rule and the Pediatric Research Equity Act, which in effect enforced studies in children (Vassal, 2009). The remaining problem was of an economical nature; as companies invest huge amount of money in development and trials the final product must be of interest to a large group of patients to bring back a considerable profit before the patent is over. Thus, developing drugs for the pediatric area with its limited number of patients is not economically attractable (Ablett et al., 2004). In the US this was solved by the Pediatric Exclusivity program, a financial carrot which promised six months extension of the patent if data in children was submitted, regardless if the drug could show activity in children or not (Vassal, 2009). In 2000, the European Parliament followed the US example and in early 2007 the European Pediatric Medicine Regulation was enforced (Vassal, 2009). Assessing the last 10 years of drug licensing by the European Medicine Agency, there had been no significant increase in the number of drugs approved for pediatric use (Ceci et al., 2006). Also, obtaining novel drugs to study has been easier in the US trough the National Cancer Institute (NCI) than in Europe (Vassal, 2009). Conducting clinical trials in children is controversial as they are unable to give proper legal consent (needs proxy-consent) and it is difficult to fully asses their assimilation and understanding about what they agree to, depending on the child’s age (Saint Raymond and Brasseur, 2005). But on the other hand, as the majority of drugs given to children are used off-label then, as accurately put by

4

the authors, ‘every child becomes the single participant of an uncontrolled trial’ (Saint Raymond and Brasseur, 2005). This is truly unethical. Animal models are becoming increasingly used in preclinical screening of potential drugs to take into the clinic, and more and more models can be genetically tailored to represent specific features of different cancers. There are valid concerns about how extensive preclinical data (in vitro and/or in vivo) that needs to be in place to initiate clinical trials in children (Houghton, 2009). This is a challenge.

5

3 NEUROBLASTOMA – DECIPHERING THE ENIGMA? Since first described in the mid 18th century and named in the early 19th century, neuroblastoma has both drawn the attention of and confused clinical practitioners and researchers. It has a very diverse range of clinical behaviour. On one end of the scale the tumor, and extensive metastases, can spontaneously regress with minimal or no treatment, whereas on the other end the patient succumb to the disease despite intensive multi-modal treatment. It might be this diametrical aspect of the disease that bewitch and fascinate so many clinicians and researchers, attempting to decipher the Enigma? 3.1 ORIGIN AND LOCALISATION Neuroblastoma is thought to originate from primitive embryonal cells of a transient structure call the neural crest (Johnsen et al., 2009). These multipotent neural crest cells give rise to the cells of the sympathetic nervous system and will differentiate into, among others, peripheral sensory neurons, the enteric innervation and supportive Schwann cells that myelinate neurons (Johnsen et al., 2009). Neuroblastoma can arise anywhere along either side of the spine in the neck, chest, abdominal or pelvic region, but most primary tumors arise in the abdomen and predominately in the medulla of the adrenal gland (Maris et al., 2007). 3.2 AETIOLOGY The aetiology of neuroblastoma is still mainly unknown, but environmental factors seems unlikely (Brodeur, 2003). There is a subset of familiar neuroblastoma, suggesting that an inheritable factor is at play. Recently, the anaplastic lymphoma (ALK) kinase was identified as a predisposing factor for familiar neuroblastoma (Mosse et al., 2008) and also found to be mutated in sporadic neuroblastomas (Caren et al., 2008). Both activating germline and somatic mutation in ALK was found as well as amplification and in-gene rearrangements, all which correlated to more advanced disease (Caren et al., 2008; Mosse et al., 2008). The heritable disease neurofibromatosis (von Recklinghausen disease), where neurofibromatous tumors develop, and Hirschsprung disease, with loss of ganglia in the colon, is associated with neuroblastoma (Brodeur, 2003). As both these diseases also result from defects in the neural crest, a relation is plausible (Brodeur, 2003). In addition, a germline mutation in the PHOX2B gene has been shown to correlate with hereditary or multifocal neuroblastoma (Bourdeaut et al., 2005). This gene is also involved in congenital central hypoventilation (Ondine’s Curse, a lack of autonomic respiratory control) which shows a hereditary co-occurrence with both neuroblastoma and Hirschsprung disease (Bourdeaut et al., 2005). Interestingly, there seems to be an under representation of neuroblastoma among patient with Downs Syndrome (Brodeur, 2003).

6

3.3 EPIDEMIOLOGY Neuroblastoma accounts for about 7-10% of all childhood cancers, it is the most common cancer diagnosis in infancy and accounts for 15% of all childhood cancer related deaths (Brodeur, 2003; Maris et al., 2007). When divided by risk group, the low and intermediate risk group have a good 10 year event-free survival, but the survival in the high-risk group is low, only around 40% (Maris et al., 2007). In the Nordic countries (Sweden, Norway, Finland, Denmark and Iceland) 30-40 cases are diagnosed with neuroblastoma each year and the overall survival for the entire diagnose group were just over 60% during the period from 1988-2007 (Gustafsson, 2008). In Sweden, about 10 children are diagnosed with neuroblastoma per year, making the incidence 1 in 100000 per year (Träger C, 2009). In this material, more boys were diagnosed with metastatic neuroblastoma than girls, and this contributed to boys having a lower overall survival (Träger C, 2009). Only speculations have hereto been put forward on the reasons for this difference. The overall survival for the entire group, all stages, was just about 60% 5 or 10 years from diagnosis and the survival increased during the investigated period, especially for the high-risk patients (Träger C, 2009). 3.4 CLINIC

3.4.1 Clinical presentation and diagnosis The clinical presentation of neuroblastoma is as heterogeneous as the tumor, and the symptoms depend largely on the localisation of the tumor, whether there are metastatic spread or paraneoplastic syndromes (Maris et al., 2007). The diagnosis is based on histopathological presence of tumor cells in biopsy or aspirate material, assessment of catecholamine metabolites in urine, and possible metastatic spread is monitored by computer tomography, magnetic resonance imaging and/or scintigraphy (Maris et al., 2007). 3.4.2 Staging system The first attempt to divide the disease into stages was the Evans staging system, which is a post-surgical system that differentiated patients based on the localisation and spread of the tumor (Evans, 1980). In 1988, efforts was made to put forth a staging system, the International Neuroblastoma Staging System (INSS), that unify international criteria’s for confirmation of the diagnosis and the response to treatment, the International Neuroblastoma Response Criteria (INRC) (Brodeur et al., 1988). Both the INSS and INRC was revised in 1993 (Brodeur et al., 1993). The INSS is also based on post-surgical localisation and spread of the tumor, but here the resectability of the tumor is also weighed in. As this system is dependent on the skill and courage of the surgeon, that decides how extensive the excision can be, the risk for staging patients more towards high-risk treatment is increased and thereby the risk of over treating patients is also increased. In 2009, the International Neuroblastoma Risk Group (INRG) addressed this problem and the new system is based on Image Defined Risk Factors (IDRF) that strictly evaluates the resectability. In this system the patients are divided into three stages, localized L1 or L2 depending on if the tumors have IDRF or not, metastatic

7

stage M and the special metastatic stage MS (Monclair et al., 2009). The INRG stage is then further weighed into the INRG classification system together with other prognostic factors to achieve a pre-treatment risk stratification system (Cohn et al., 2009).In the MS stage, previously called 4S, infant patients presents with small localised tumors and metastases to the liver, skin and/or bone marrow. It is in these special patients that, with no or minimal treatment and often just observation, the tumors can spontaneously regress (Maris et al., 2007). Neuroblastoma is peculiar in this manner, as it has the highest rate of spontaneously regressing tumors of any human cancer (Schwab et al., 2003). The tumor can also, spontaneously or by treatment, differentiate into ganglioneuromas, but this is rare and in the case of treatment also usually incomplete (Schwab et al., 2003). 3.4.3 Screening To improve the survival of neuroblastoma, mass screening has been performed in the hopes that diagnosing the disease in earlier stages could be beneficial to the outcome, and that the disease could be detected before presentation of symptoms. As neuroblastoma is a noradrenergic tumor, it frequently produces catecholamines, which metabolites can be traced in the urine. Pioneering screening studies in Japan did indeed detect more cases and seemed to increase the survival, but later prospective studies have shown that screening did not reduce the mortality (Brodeur, 2003; Maris et al., 2007). What was discovered was that the fraction of increased detection consisted mainly of tumors with favourable features. The conclusion was drawn that screening most likely detects tumors that without treatment would have regressed and/or matured spontaneously and not caused symptoms (Brodeur, 2003; Maris et al., 2007). 3.4.4 Current therapy The patients are divided into risk groups and given treatment accordingly. The advantage is that the deleterious side effects and possible long term late effects further on in life can, if possible, be avoided or decreased. Children with high-risk disease are treated aggressively with high dose multi-modal therapy with induction chemotherapy (vincristine, cisplatin, etoposide, doxorubicin), surgery, myoablative high-dose chemotherapy followed by stem cell rescue and irradiation. The follow-up therapy with retinoic acid can be long and might also include immune therapy. Still, the high-risk group has a poor survival and this is the group where adding novel targeted therapies to the treatment protocol might improve survival. 3.5 BIOLOGY 3.5.1 Prognostic factors – clinical The most important clinical prognostic factors are age and stage. The INRG pretreatment classification scheme is the initial separator that divides the diagnose group (Cohn et al., 2009). The second divider is the age at diagnosis, where children younger than 18 months are staged and treated as a lower risk group (Cohn et al., 2009).

8

3.5.2 Prognostic factors – molecular and histopathological For the localised L stage, the third and fourth divider is the histopathological grading or grading of the tumor differentiation. The grading is done according to the Shimada/International Neuroblastoma Pathological Classification (INPC) system (Shimada et al., 2001). The appearance of ganglioneuroma and/or ganglioneuroblastoma intermixed pathology is considered low-risk, apposed to ganglioneuroblastoma and/or neuroblastoma pathology which is associated with high-risk disease (Cohn et al., 2009). In the case of the localised nodular ganlioneuroma and/or neuroblastoma, the grade of differentiation is further weighed in (Cohn et al., 2009). At the fifth forking, the tumors are separated due to their amplification status of the MYCN oncogene (Cohn et al., 2009). The MYCN gene was discovered in the early 1980s and is a member of the Myc family of transcription factors (Schwab et al., 1983). Other family members also have a reputation in cancer, where c-Myc is the most studied (Prochownik, 2008). Follow the discovery of the gene in neuroblastoma derived cell lines, a correlation between MYCN-amplification and a poor prognosis was established (Brodeur et al., 1984). There does not seem to be mutations in MYCN, instead the amplified copies seem to be active and express MYCN mRNA (Schwab, 2004). Neuroblastoma cell lines with MYCN-amplifications generally express high levels of the protein (Brodeur, 2003; Schwab et al., 2003). MYCN is amplified in about 20% of the primary tumors and has independent value as a predictor of rapid disease progression and poor outcome (Brodeur, 2003; Maris et al., 2007; Schwab et al., 2003). Interestingly there are examples, both clinical and cell lines, that express high levels of the MYCN mRNA and protein without amplification, and the jury is out on the prognostic values of this (Brodeur, 2003). The tropomyosin-related kinase (Trk) family of neurotrophin receptors consists of TrkA, TrkB and TrkC, and their ligand, nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF) and neurotrophin-3 (NT-3) respectively (Brodeur et al., 2009). They play important roles in the peripheral nervous system during development; for sensory neurons TrkB is expressed early and TrkA later, whilst in sympathetic neurons, Trk C is important early on, TrkA is expressed later and TrkB is rarely expressed (Brodeur et al., 2009). TrkA is highly expressed in favourable neuroblastomas, inversely correlated to MYCN-amplification, and virtually absent in high-risk patients (Brodeur et al., 2009). Conversely, TrkB is highly expressed in unfavourable neuroblastomas, have a high correlation to MYCN-amplification, and is linked to drug resistance (Brodeur et al., 2009). TrkB and BDNF are thought to constitute a stimulatory growth loop that enables neuroblastoma cells to keep cycling (Brodeur et al., 2009). Trk C expressing tumors seems to be a subgroup to the favourable TrkA expressing tumors (Brodeur et al., 2009). 3.5.3 Prognostic factors – genetical In the next forking of the risk group the L2 and MS are separated by a genetic aberration, a loss of material on chromosome 11 (11q) (Cohn et al., 2009). This allelic loss is a predictor of outcome for the group of non-amplified L and MS stage tumors (Brodeur, 2003; Maris et al., 2007).

9

There are other genetic aberrations in neuroblastoma where deletion or allelic loss of material on chromosome 1p, and gain on chromosome 17q can be mentioned. The 1p deletion is more common in patients with advanced stage disease and correlate with MYCN-amplification, but its prognostic value as an independent marker is controversial and attempts to characterise the gene/s responsible has so far been futile (Maris et al., 2007). An unbalanced gain of material on chromosome 17q resulting in 1-3 additional copies, often occuring trough a translocation with chromosome 1 or 11, can correlate to aggressive disease (Maris et al., 2007). At the seventh and last crossroad, the M stage tumors are divided based on their DNA index, where near-diploid DNA content assigns the patient to a higher risk group (Cohn et al., 2009). 3.6 TRANSLATIONAL – BRINGING THE LAB TO THE CLINIC In neuroblastoma, the clinical challenge is the relapsed high-risk patients and a wealth of novel therapies are being evaluated or under consideration. Hereto, few have reached the clinic. Retinoic acid, oxidized vitamin A, is currently used in the follow up maintenance phase and Fenretinide, a synthetic vitamin A derivative, have passed trough phase II trials (Maris et al., 2007). Retinoic acid makes neuroblastoma cells differentiate and cease cycling whilst Fenretinide induce apoptosis, and both agents have acceptable toxicity (Brodeur, 2003). Issues to be solved are how to administer enough to get sufficient levels of circulating drug (Wagner et al., 2009). There are continuous efforts to improve the conventional cytostatic used, for example by identifying drugs that gives good combinatory effects, co-administration of chemosensitising agents or metronomic scheduling (Wagner and Danks, 2009). As neuroblastomas generally respond well to radiotherapy efforts have been made to specifically deliver it to the tumor cells by radio-labelling of MIBG, which is selectively taken up by neuroblastoma cells (Wagner and Danks, 2009). Immunotherapy with antibodies targeting the disialoganglioside (GD2) glycolipid expressed on the surface of most neuroblastomas, thereby killing through both the complement system and direct cell mediated lysis, has shown best effects in patients with minimal residual disease (Wagner and Danks, 2009). There are several ongoing studies on novel agents, both at the preclinical stage and clinical trials, and several molecular targets and strategies are actively pursued (Wagner and Danks, 2009). This thesis will discuss some of them.

10

4 ANIMAL MODELS – BEING PATIENT WITH OUR RODENT PATIENTS

The limited number of patients, which currently often is enrolled simultaneously in both national and international studies, proposes a challenge as how to use these as wisely as possible (Ablett et al., 2004). In addition, as the cure rates in childhood cancer increase the number of available patients shrink, and the population at disposal are often heavily pretreated and the majority are not chemotherapy responsive (Balis et al., 2009). The bulk of novel therapies currently in development aims at targets present and validated in adult cancers. Iit remains to be thoroughly investigated if these targets play an equally important part in the pathogenesis of childhood cancer, to consider these agents for clinical trials (Balis et al., 2009). Moreover, the targets in questions might play totally different roles in the normal development of the child versus that in the fully developed adult. Therefore, inhibiting it could possibly result in different acute and long-term toxicities in the child that might not be anticipated or can be extrapolated from clinical trials in adults (Balis et al., 2009). Therefore, taking all these facts into consideration, it is of major importance to select the correct agents to advance into clinical trials for pediatric cancer. Modelling human cancer in animals is a field under constant development, and as much as these models can aid us both in unreaveling the pathogenesis of the disease and aid in selection of therapies, there are drawbacks and considerations to be minded. These models may not be perfect, in every aspect mimicking the sick child, but it is the best replacement available. 4.1 TAKING THE FURRY HISTORY TOUR In the mid 1950s, evidence was presented that efficacy of an agent in vivo on were more predictive of clinical response than in vitro cultures, and the NCI initiated a drug screening program in vivo (Suggitt et al., 2005). Murine-derived cancer cells were implanted in the abdominal cavity of mice (ascites model), but apart from a predictive value for fast growing hematological cancers there was little progress for solid tumors (Talmadge et al., 2007). In the mid 1970s, after discovering the nude athymic mice and the subsequent pioneering growth of a human tumor in vivo in 1969, the panel was extended to include representative types of the major human cancers (Suggitt and Bibby, 2005). Both syngenic murine, injected subcutaneously (s.c.), intraperitoneally ( i.p.), or intravenously (i.v.), and transplantable human tumors, implanted under the renal capsule, was used (Suggitt and Bibby, 2005). In the early 1980s, NCI switched to sequential screening with increasing demands for an agent to show efficacy in both syn- and xenogenic tumors, but all efforts seemed to result in a low success rate of identifying compounds with clinical efficacy (Suggitt and Bibby, 2005). To save time and money, the hollow fibre model was added for preliminary screening (Suggitt and Bibby, 2005).

11

4.2 HOLLOW FIBRE ASSAY In the hollow fibre assay, tumor cells (from cell lines or primary material) are placed into a hollow tube of semi-permeable membrane (allows large molecules to move in and out, but stop cell migration and direct tumor-host cell contact) which are implanted s.c. or i.p. in immunodeficient mice. The mice are treated with the drug of interest and after 24-48 hours the tube is excised, the cells recovered and viability, target inhibition and treatment effects can be assessed in vitro (Suggitt and Bibby, 2005). 4.3 HETEROTOPIC XENOGRAFT MODELS Heterotopic (in an abnormal anatomical location) xenografts (from Greek xenos: stranger) have for the last 40 years cemented its place in preclinical drug development. Any type of tumor tissue (primary or cell lines) of any origin is implanted, usually s.c., in immunodeficient mice or rats, and after some time a growing tumor is established and the animal can be randomized to treatment (Morton et al., 2007). The cells can be chosen to mimic a specific feature of the disease or a subgroup of the patients. The s.c. neuroblastoma xenografts have been the base for a wealth of publications and testing of conventional and novel therapies, and it is beyond the scope of this text to make a summary of all. 4.3.1 Being nude There are several immunodeficient strains of mice and also rats that can be used. The ‘nude’ mice was discovered by chance in 1966 (Flanagan, 1966) and in 1968 it was found to be athymic, rendering them susceptible to infections and an early death (Pantelouris, 1968). In 1994 it was discovered that they carry a mutation in the formerly named WHN gene, a member of the forkhead family of transcription factors, which is now called FOXN1 (Nehls et al., 1994). This mutation, that renders the mice athymic and thus T-cell deficient and also hairless, perfectly mimics the resulting effects of mutations in the orthologous human WHN gene (Frank et al., 1999). The nude mutation is a pleitropic mutation where disruption of a gene leads to two independent phenotypes, i.e. the lack of hair is separate from the dysgenesis of the thymus (Mecklenburg et al., 2001), as it was early on found that thymic restoration by grafting did not rescue the hairless phenotype (Eaton, 1976). In 1996, generating transgenic animals to try rescuing the phenotype by restoring FOXN1 was party successful (i.e. they got mice with hair but still lacking a thymus) (Kurooka et al., 1996), but in 2002 a complete rescue could be achieved (Cunliffe et al., 2002). The SCID (severe combined immunodeficient) spontaneous mutant mice, also discovered by chance in 1983 (Bosma et al., 1983), are a murine representation of the human form of SCID. In humans, SCID comprises a group of several different genetic events that all lead to similar clinical

12

presentation, but with different degrees of dysfunctional or absence of T-, B- and NK-cells (Cavazzana-Calvo et al., 2007). In the mice, a mutated enzyme involved in the genetic recombination of the T- and B-cell receptors results in defect T- and B-cell development plus defects in the innate immune system (Hunter, 1995; Kirchgessner et al., 1995). As the enzyme is involved in the rejoining of double-strand DNA-breaks, the SCID mice are also very sensitive to radiation (Kirchgessner et al., 1995). A proportion of all SCID mice are ‘leaky’ (peripheral receptor positive T- and B-cells can be found together with a few clones of antibodies) and this phenomena increase with age, but they are incapable or mounting a proper antibody response (Bosma et al., 1991). The ‘leakiness’ can somewhat be reduced by maintaining them in a strict pathogen-free environment (Bosma and Carroll, 1991) thus avoiding to challenge the immune system. If a nuder mouse is necessary, SCID mice can be ‘topped up’ with the beige mutation. It was discovered in 1966-67 (Kaplan et al., 2008). The animals, named after their coat colour, showed enlarged lysosomes (Lutzner et al., 1967). In 1979 they were shown to be deficient in NK-cells (Roder et al., 1979) and crossed to the SCID mice in 1990 (Croy et al., 1990). The gene responsible for the beige phenotype was cloned in 1996 and was found to be the murine ortholog to the LYST/CHS1 gene in humans, the gene causing Chediak-Higashi syndrome (Barbosa et al., 1996). The function of the LYST gene is still unclear (Kaplan et al., 2008), but both the animals and patients lack proper lysosomal trafficking. As NK-cells exert their cytotoxicity by releasing granules, a link to the dysfunctional NK-cells can be depicted. The SCID mice can also be deprived of NK-cell activity by crossing them with mice lacking the major histocompatibility complex (MHC) class I (Christianson et al., 1997) or the γc chain of the interleukin-2 receptor (Ito et al., 2002). In 1992, another immunodeficient strain was developed by targeted deletion in the recombination activating gene 2 (RAG2) (Shinkai et al., 1992). This model represents the murine ortholog to Omenn syndrome in humans, a disease of immunodeficiency and autoimmune reactions (Marrella et al., 2008). The immunological portrait of patients show oligoclonal T cells, that can only display a limited array of rearranged T-cell receptors, and reduced levels or absence of circulating B-cells (Marrella et al., 2008). The disease could be traced to the RAG1 or 2 (recombination activating gene), where mutations in the protein leads to reduced catalytic activity and thus impaired V(D)J recombination of the T- and B-cell receptors (hence, only a limited repertoire of receptors ca be observed on circulating cells) (Marrella et al., 2008). In the RAG2 mice the disruption of V(D)J recombination is fully impaired and only immature T- and B-cells can be observed (Shinkai et al., 1992). 4.3.2 Practicalities Tumors s.c. can easily be measured daily with a calliper, and the tumor volume and growth can be closely followed. This is extremely easy in the nude mice but other models require repeated shaving. There are differences in pricing, nude are cheap whilst RAG are expensive (>$100/animal) (www.taconic.com, accessed October 2009). There are also differences in the temperament (nude are calm and easy to handle) and in body weight (SCID generally weighs less).

13

Also differences in the breeding must be considered as some of these models are kept as an outbreed stocks, resulting in differences in pharmacokinetic response for example. All immunodeficient animals require strict pathogen-free housing, husbandry and handling to be able to thrive and survive. 4.4 ORTHOTOPIC AND METASTATIC MODELS Orthotopic growth, meaning in its right place, has been described for several cancer types, and can provide additional valuable data in parallel or on top of s.c. xenografts. Metastatic models have their use in the fact that they represent the principal clinical challenge, eradicating disseminated disease. In the case of neuroblastoma the orthotopic sites used are in and around the adrenal gland, whilst metastatic models are done by i.v. injection (peripheral or into the aorta). In addition, orthotopic models can also metastasise (something s.c. xenografts very rarely do) especially in an NK-cell deficient model. The orthotopic neuroblastoma model was first described in 1994/95 (Flickinger et al., 1994; Judware et al., 1995). In 2000 it was further developed by GFP-expressing cells (implanted near the adrenal gland), enabling the metastases to be detected by RT-PCR and the visualisation and measuring of the tumor by magnetic resonance imaging (MRI) (Moats et al., 2000). In 2001, a metastatic neuroblastoma model was described, where cells injected i.v. resulted in the development of both a primary adrenal mass and distant metastases to bone and liver (Engler et al., 2001). Addressing the differences between heterotopic s.c. tumors and orthotopic tumors, a study in 2002 found that the orthotopic tumors showed more relevant biology (Khanna et al., 2002). In 2005, orthotopic growth of neuroblastoma cells in the adrenal gland pointed out the importance of a correct microenvironment, as these tumors reproduced the abnormal vascularisation and metastatic growth of patients (Joseph et al., 2005). The orthotopic model has also been used to evaluate a handful of novel compounds. The angiogenesis inhibitor bevacizumab (Dickson et al., 2007) gave rise to a reduction in the microvessel density together with an improved perfusion leading to better exposure of cytostatic; and the mammalian target of rapamycin (mTOR) inhibitor rapamycin (Marimpietri et al., 2007) showed inhibition of tumor growth and a reduction in vascularisation, especially in combination with vinblastine. Other therapeutical strategies that have been evaluated in the orthotopic neuroblastoma model include liposomal doxorubicin (Pastorino et al., 2008), bortezomib and fenretinide (Pagnan et al., 2009), sunitinib (Fuchs et al., 2009), and dasatinib (Vitali et al., 2009). 4.4.1 Practicalities The orthotopic and metastatic model have the same practical requirements as the heterotopic model as they also use immunodeficient mice, except in syngenic models. The use of non-invasive techniques to follow and measure tumor growth and disease dissemination is a requirement. Palpation and sensitive hands can work fine, but it takes some learning and can only give estimates of tumor size. Advances in molecular tagging of cells (for example

14

stably fluorescent), ultrasound, and small-animal positron-emission tomography (PET) or MRI can aid in the detection, tumor measurement and assessment of the spread of grafted cells. Also, the possibly disseminated disease makes it necessary to closely follow and asses the general health status of these animals, which can change quickly. 4.5 TRANSGENIC MODELS The first reports of a transgenic model of neuroblastoma was in the early 90s in an effort to study a polyoma virus antigen under the thymidine kinase promotor, these mice developed neuroblastoma-like tumors and preneoplastic leasions in the adrenal medulla (Aguzzi et al., 1990). This discovery was followed by others making transgenic mice with different constructs and seemingly by chance ending up with neuroblastoma-like tumors (Iwamoto et al., 1993; Pecori Giraldi et al., 1994; Servenius et al., 1994; Skalnik et al., 1991). It was not until 1997 that a transgenic model of neuroblastoma with a true purpose and a hypothesis was created. The targeted expression of the MYCN protein to the neural crest using the tyrosine hydroxylase promotor gave rise to tumors with features very similar to clinical neuroblastoma (Weiss et al., 1997). The model showed that MYCN by itself could drive the tumorigenesis of neuroblastoma and that the gene dosage of MYCN directly contributed, as homozygous mice showed increased incidence and shorter latency of tumor formation (Weiss et al., 1997). Further, the model was shown to be metastatic and that the tumors displayed syntenic gains and losses of genetic material that can be observed in patients (Weiss et al., 1997). The transgenic mice were then shown to further have amplified the transgene in the tumors and, interestingly, no correlation between N-myc expression and transgene dosage or tumor latency was observed (Norris et al., 2000). It has also been shown that whilst normal litter mates develop hyperplasia in the ganglia that spontaneously regress this was delayed and incomplete in the transgenic mice, and the conclusion was put forward that the improper expression of MYCN drives tumorigenesis by disturbing the normal process when these cells should be eradicated (Hansford et al., 2004). The histology of tumors from these animals (Moore et al., 2008) and characteristics of cell lines established from the tumors (Cheng et al., 2007) showed high similarity to human neuroblastoma. Several studies have further confirmed that genomic events in these mice are syntenic to those observed in patients (Hackett et al., 2003; Lastowska et al., 2004; Weiss et al., 2000). There has been a number of treatment studies performed on these animals, including MYCN antisense oligonucleotide (Burkhart et al., 2003), anti-angiogenic TNP-470 (Chesler et al., 2007), methionine aminopeptidase inhibitor (Morowitz et al., 2005), retinoids (Liu et al., 2005), phosphatidyl-inositol 3 kinase (PI3K) inhibitor (Chesler et al., 2006), the histone deacetylase inhibitor Trichostatin A (Kuljaca et al., 2007; Liu et al., 2007), and cyclophosphamide (Chesler et al., 2008). Several genetic targets have been shown to be deregulated in the model, including the multidrug resistance-associated protein (MRP) where treatment sensitivity can be restored by the novel MRP1 inhibitor

15

Reversan (Burkhart et al., 2009). The ornithine decarboxylase 1 (ODC1) can be targeted using the suicide inhibitor DFMO (Hogarty et al., 2008; Rounbehler et al., 2009). Haploinsufficiency of the putative tumor suppressor Clustrin (Chayka et al., 2009) and transcription factor and potential oncogene HMGA1 (high mobility group A1 protein) (Giannini et al., 2005) has also been reported Most recently, it has also been presented indicating a role for Phox2B in the pathogenesis of neuroblastoma in these mice (Alam et al., 2009). 4.5.1 Genotyping –deciding if you are my type or not In the original publication the hemizygous mice were separated from the homozygous by Southern blotting (Weiss et al., 1997) but as this method is time and money consuming, a real-time PCR was developed (Norris et al., 2000). This method has not been without obstacles, as it has not always been possible to give a straight answer on the genotype. An improved protocol was proposed, but this neither made the answer clear cut (Burkhart et al., 2002). Finally, by cloning the transgenic insert and creating primers against the border, a fast and simple PCR was developed (Haraguchi et al., 2009). The authors could also confirm the integration site previously stated, but reported that 5-6 copies of the insert were integrated head-to-tail at each locus (Haraguchi and Nakagawara, 2009). This might be the reason why the real-time PCR has proven to be complicated, as the copy number of the transgene thus is not null, one or two. 4.5.2 Practicalities The transgenic mice are nice and calm to handle and the breeding capacities are satisfactory. The animal needs to be palpated several times a week to detect tumor formation and a rather large breeding has to be in place to generate enough animals for therapeutical studies. In summary, there are both financial and technical support that are needed to take the model into the lab. Likewise as for the orthotopic/metastatic models, the transgenic model can rely on palpation for tumor detection and size estimate, but this Sisyphus work can be simplified enormously by the aid of non-invasive techniques such as ultrasound, PET or MR. In addition, these techniques can also add much information about the tumor apart from just the size; ultrasound can give information about vascularisation and perfusion of the tumor and on central necrosis or cystic formations. 4.6 SCREENING PROGRAMS It has come to question, with all right, what minimal amount of preclinical data that should be requested before an agent can be advanced into the clinic (Houghton, 2009). In 2006, implemented by the NCI, the Pediatric Preclinical Testing Program (PPTP) was initiated (Houghton et al., 2007). This consortium of researchers with extensive experience in the preclinical pediatric oncology field, combine in vitro and in vivo testing of promising agents and integrate genomic expression and profiling. The program also highlights the importance of assuring that the preclinical model selected should correctly recapitulate the histological and/or molecular features of the diagnosis of interest, and that the dosing of the selected agent should be carefully selected to secure that the agents are evaluated at clinically relevant and achievable levels (Peterson et

16

al., 2004). The program have to this date evaluated both standard agents routinely used in the clinic to calibrate the panel of tumor model used and to be a reference of activity (vincristine & cyclophosphamide (Houghton et al., 2007), and cisplatin (Tajbakhsh et al., 2008)), and a number of novel agents, including: the proteasome inhibitor bortezomib (Houghton et al., 2008b); the vascular endothelial growth factor receptor (VEGFR) inhibitor AZD2171 (Maris et al., 2008a); the mTOR inhibitor rapamycin (Houghton et al., 2008a); the dual Src/Alb tyrosine kinase inhibitor dasatinib (Kolb et al., 2008b); the BH3 mimetic inhibitor ABT-236 (Lock et al., 2008); a monoclonal antibody SCH717454 against the insuline-like growth factor 1 (IGF-1) (Kolb et al., 2008a); the heat-shock protein inhibitor alvespimycin (Smith et al., 2008); the multi-target tyrosine kinase inhibitor sunitinib (Maris et al., 2008b); the histone deacetylase inhibitor vorinostat (Keshelava et al., 2009); the kinesin spindle protein inhibitor ispinesib (Carol et al., 2009); and the tyrosine kinase inhibitor of EGFR/ErbB2 lapatinib (Gorlick et al., 2009). The program comprise a panel of s.c. xenografts of solid tumors and i.v. inoculation of hematological cancers (Houghton et al., 2007). The program also put forward a novel concept of evaluate tumor response, a very useful system where the response in different tumor models with different growth rate can be compared directly (Houghton et al., 2007). The PPTP have the capacity to evaluate >10 novel compounds yearly, selected based on their or the targets relevance in childhood cancer (Houghton et al., 2007). The compounds are tested at the maximally tolerated dose (MTD) in mice, and only if an agent shows activity in the initial phase I testing can it be advanced into phase II to establish dose-response activity (Houghton et al., 2007). The only possible drawback of the program is that with doses at MTD and no proper evaluation of target inhibition, possible beneficial effects can be overseen. Testing at the MTD assume that the therapeutic and toxic effects of the drugs are correlated, whilst many novel targeted therapies does in fact have therapeutic efficacy at doses far lower than the MTD, i.e. the biological optimal dose (Gutierrez et al., 2009). In addition, this nearly industrious approach of speedy testing and publishing data on novel agents might discourage other researchers from testing them more thoroughly, and result in dismissal of possibly beneficial agents. Of all the agents tested so far, few have shown in vivo activity in the neuroblastoma models in the panel. Summarising the PPTP this far show that only one agent (cyclophosphamide) has ever achieved the grading ‘high’ response activity in neuroblastoma (Houghton et al., 2007), whereas both vincristine and cisplatin generated mainly ‘low’ response activity (Houghton et al., 2007; Tajbakhsh et al., 2008). Also, neither of these clinically used cytostatic agents gave rise to any more than progressive disease when evaluating the overall median response for the group. This bring forward questions about the relevance of the models chosen and the conclusions that can be drawn thereof. All neuroblastoma xenografts of the PPTP panel in some way represent high-risk disease, they are all either MYCN-amplified or high-risk stages (majority stage 4) and 6/8 are established from relapsed patients (Houghton et al., 2007). Maybe it should be clarified that the neuroblastoma xenografts in the PPTP does not represent the entire diagnose group, but only the high-risk disease. The novel agents that have displayed the highest efficacy in vivo in neuroblastoma in the PPTP is the IGF-1 antibody with ‘intermediate’ response activity in 4/6 models (Kolb et al., 2008a) and a VEGFR inhibitor with

17

5/6 ‘intermediate’ response activity (Maris et al., 2008a). Still, it should be noted that both agents only gave rise to progressive disease when evaluating the overall response. 4.7 EXPERIMENTAL MODELS - WHERE THERE’S LIGHT, THERE’S

SHADOW The only correct statement about how the perfect animal model should be is that no such model exists. Each model has its specific advantages and drawbacks. It is up to the investigator to choose which model he or she believes to best represent the feature that warrants investigation, and asses if the laborious, financial and/or technical demands associated with that model can be properly met. 4.7.1 Hollow fibre assay The hollow fibre model is fast and efficient, require a minimum of labour and material (several fibres containing different cell lines can be implanted simultaneously) and efficacy in this mode is often predictive of effect in the s.c. xenograft model. On the other hand, host-tumor interactions (for example angiogenesis and metastasis) can not be studied, which limits its clinical relevance. The model also makes it possible to perform efficacy studies on tumor cells in fibres s.c. in parallel with early pharmacokinetic studies, thus reducing the number of animals necessary. This pharmacokinetic data can be used as guidance for dose selection in a following s.c. xenograft study. The amount of drug that reaches the fibre can also indicate to what levels a growing tumor can be exposed to the drug before a functional vascularisation has been established. 4.7.2 Heterotopic xenograft models The s.c. xenograft model have the advantage of being fast, easy, reliable, cheap and, as opposed to the hollow fibre model, they allow tumor-host interaction, making it possible to study for example angiogenesis. In the s.c. model prolonged treatment schemes can be studied, in effect mimicking clinical trials. The s.c. tumors can be closely followed without being invasive and with minimal stress to the animal and handler, giving a day-to-day assessment of treatment efficacy. On the negative side, the lack of metastases in the s.c. model (seen only very rarely) makes this model not a true mimic of the clinical challenge of disseminated disease. But this lack can also be turned to a positive because the tumors that are visible represent the entire tumor burden. The most prominent drawback of the xenograft model is the site, valid questions are raised about how relevant a tumor growing in the s.c. compartment are with respects to environmental cues to the tumor cells. The cell lines that are used in xenografts have usually been grown in vitro for an extended period, sometimes decades, and there are concerns that they do no longer represent the features of the original disease. This can possibly be somewhat circumvented by serial transplant of a primary tumor. The tumor is engrafted directly from the patient and when it is established in vivo, it can be excised and re-transplanted over and over again onto new recipient animals, thus avoiding the tumor cells from ever seeing plastic.

18

4.7.3 Orthotopic and metastatic models The advantage in the orthotopic model are just the opposite as the s.c. xenografts, the tumor are growing in its correct place and are, hopefully, receiving proper environmental cues. There is also opportunity to study the metastatic process, as these models frequently metastasise. This is also true for the metastatic models, but there is ongoing debate on whether this model represents the ‘true’ metastatic pattern, i.e. the ‘seed and soil’ theory’ or if the tumor cells just establish at convenient locations. The drawbacks of both the orthotopic and the metastatic model are that the tumor development is more difficult to asses and to follow. Invasive techniques with laparotomy can be used, but palpation, ultrasound, PET or MR is to prefer. Also there are difficulties with assessing the animals health status, as widespread disseminated disease or a tumor growing invasively rapidly can affect the general health of small rodents. 4.7.4 Transgenic models The main advantage of the transgenic model is that it possibly reflects a true mechanism of the tumor pathogenesis and origin, and allows for studies thereof. It also represent a model of aggressively growing tumors that are driven by MYCN, making it ideal to use for studying therapies aiming at this subset of clinical tumors. The main drawback of the transgenic model, apart from it being technically demanding, expensive and time-consuming, is that hereto the genotyping has been a challenge. There are also difficulties in following and assessing the total tumor burden (primary + disseminated), problems and solutions similar to those stated for the orthotopic and metastatic models. In conclusion, the selection of animal model depends both on the scientific question and the resources at hand (technical, financial and time).

19

5 THERAPEUTIC RATIONALES – WHAT TO DO AND WHY?

Selecting the novel targeted therapies to study in neuroblastoma presents some challenge as numoues agents are currently on the market, in late phase trials or in the pipeline. Here, I will I discuss the rationales behind the selection of agents that we have studied. Research strategy Our research group is focused on preclinical and translational research of the neuroblastoma, using a step-by-step strategy (as the illustration below). Our primary goal is to bridge the gap between preclinical research and the clinic to identify novel therapies that could be beneficial for neuroblastoma. Ex vivo investigation of clinical samples to

identify the presence of the targets of interest

Validation of targets in cultured neuroblastoma cells and in vitro studies of therapeutic effects and mechanisms of action of novel therapies

In vivo studies to investigate efficacy and mechanisms of action in relevant models, the s.c. xenograft model and/or the transgenic model, to identify candidate drugs for the clinic

20

5.1 ANGIOGENESIS INHIBITION – NOT GOING WITH THE FLOW! 5.1.1 The bloody history of it The concept of angiogenesis and its role in disease was postulated in 1971 by J Folkman, stating that the growth of solid tumors are dependent on angiogenesis and that inhibiting this process could prove to be a valuable therapeutical option to explore (Folkman, 2007). Since then, accumulating data have validated a role for this principle in many fields of medicine. Since the first discovery of endogenous anti-angiogenic molecules in the early 80s and until the 2004 Food and Drug Administration (FDA) approval of the first anti-angiogenic agent, it has been a promising rationale in cancer therapy (Folkman, 2007). 5.1.2 Sprouting here and there, sprouting everywhere Angiogenesis is an ordered and tightly regulated process that is a prerequisite for growth of any tissue (Folkman, 2007), to allow nutrients and oxygen to get there and for waste products to be transported away (Nagy et al., 2008). When a tissue expands beyond the diffusible distance from a vessel hypoxia occurs and is followed by an up regulation of secreted pro-angiogenic factors, resulting in the sprouting of microvessel from nearby vessels (Folkman, 2007). The ingrowth of microvessels is achieved either by proliferation of endothelial cells, by migration of existing endothelial cells or by recruitment of circulating bone-marrow derived endothelial precursor cells (Folkman, 2007) and other cells supporting angiogenesis (Kerbel, 2008). When the tissue is properly vascularised, the pro-angiogenic signals cease and the process is terminated, also aided by the action of endogenous anti-angiogenic signals (Folkman, 2007). Apart from the arterio- and lymphangiogenesis that take place during development, angiogenesis occur in wound healing, reproduction and tissue expansion (Folkman, 2007). Today, maybe the most correct way of looking at angiogenesis might not be as a separate field, but as an organizing principle (Folkman, 2007), regarding this physiological function as a core from where connections to several phenomena’s can be drawn. For example, if two otherwise unrelated diseases both essentially are dependent on angiogenesis then both subordinate under the organizing principle of angiogenesis. Thus, both can benefit from anti-angiogenesis treatment disregarding that they in every other aspect are different. An ever growing number of targeted anti-angiogenic therapies are under development and also several conventional cytotoxic agents are evaluated for their anti-angiogenic properties under so-called metronomic dosing schedules, where the doses are lower and more frequently distributed to target the endothelial compartment (Folkman, 2007) 5.1.3 The VEGF family Since discovered in 1989 (Ferrara, 2009) the most studied pro-angiogenic factors are the VEGF family, of whom VEGF-A and its receptors VEGFR2 are

21

thought to be the most important pair for mitogenic, angiogenic and permeability effects (Ferrara et al., 2005a). VEGF-A occur in several splice forms (Kerbel, 2008) and haploinsufficiency results in an embryonal lethal phenotype in mice (Ferrara et al., 2005b). VEGF-A is up regulated in response to hypoxia. Under normal O2 tension the hypoxia-inducible factor 1α (HIF1α) α transcription factor is hydroxylated and targeted to destruction by the von Hippel-Lindau (vHL) tumor suppressor (Brahimi-Horn et al., 2009). Upon hypoxia, HIF1α is stabilized and translocated to the nucleus where it dimerise with HIF1β, bind to hypoxia-responsive elements and initiate the transcription of several genes, among them VEGF-A (Brahimi-Horn and Pouyssegur, 2009; Ferrara et al., 2005a). VEGF-A mRNA and protein expression has been found to be up regulated in many types of tumors (Ferrara et al., 2005a; Kerbel, 2008) and this is thought to be related both to hypoxia and mutations in tumor suppressors, but also to oncogenes (Ferrara et al., 2005a). 5.1.4 ‘Why are tumor blood vessels abnormal and is it important?’ It has been established that the growth of a solid tumor (or any other tissue) beyond a few cubic millimetres in size is dependent on the ingrowth of tumor blood vessels, and a failure to do so, i.e. the unability to turn on the ‘angiogenic switch’, can delay tumor progression and even result in tumor dormancy (Naumov et al., 2006). However, certain solid tumors has been shown to be able under a limited time to grow independently of angiogenesis, so called vascular cooption, where the tumor grow along pre-existing vessels (Holash et al., 1999; Holmgren et al., 1995). Tumor blood vessels have been shown to be abnormal in nearly every aspect of their biology (Fukumura et al., 2007; Nagy et al., 2009). Tumor blood vessels are often immature, leaky and with unevenly and heterogenic distributed blood flow (Fukumura and Jain, 2007). This, together with the lack of proper lymphatic ingrowth to drain excessive fluids, results in increased interstitial pressure and a negative barrier working against effective drug delivery (Fukumura and Jain, 2007). In addition, tumor vessels often grows in an un-orderly fashion, twisted and coiled, are unsuccessful in both recruiting proper supportive cells to mature and creating a proper branching, and form arterio-venous shunts (Nagy et al., 2009). The improper formation of vessels in tumors is thought to arise, at least in part, due to the improper angiogenesis signalling from the tumor (Nagy et al., 2009). Alternative splicing gives rise to different isoforms of VEGF-A, which differ in their cell and matrix biding capacity and thus acts over different distances and results in different patterns of angiogenesis. The VEGF-A120 isoform dos not bind to the extracellular matrix and create a steep gradient to attract vessels, whilst the VEGF-A188 isoform is cell bound and can thus only generate in-growth in its absolute vicinity (Nagy et al., 2009). It can be summarized and concluded that the long-range acting isoform is responsible for initiating angiogenesis, whilst the locally acting is in charge for the finer patterning (Nagy et al., 2009). The isoform most commonly over expressed by tumor cells, VEGF-A165, have properties of both the others (Nagy et al., 2009) and it can be hypothesised that

22

this can be somewhat of an universal solution. Instead of being dependent on two factors the tumor cells can rely on only one to do both jobs with fairly acceptable results. 5.1.5 Bevacizumab In 1997, bevacizumab (Mab A.4.6.1), a humanised murine antibody against human VEGF-A, was reported in the literature to have efficacy in vivo on xenografts and the same year it entered clinical phase I trials (Ferrara and Kerbel, 2005b). Phase II trials followed, evaluating bevacizumab as single therapy or in combination with chemotherapy in colorectal cancer. By the time the phase III trial was ongoing in patients with colorectal cancer the enrollment was discontinued preterm since the combo of bevacizumab and 5-fluorouracil and leucovorin resulted in decreased hazard of death, increased the response (+10%), the median survival (+4.7 months), the progression-free survival (+4.4 months), and the duration of response (+3.3 months) with acceptable toxicity (Ferrara and Kerbel, 2005b). In 2004, this combination with bevacizumab was the first anti-angiogenic therapy to be approved by the FDA, and used as first-line therapy for metastatic colorectal cancer (Ferrara, 2009). Since then several other agents interfering with VEGF signalling has been approved for different conditions (Ferrara, 2009). 5.1.6 Toxicity, pharmacology and resistance Bevacizumab does not bind murine VEGF-A despite high homology and results in mild toxicity, and since the circulation time is long the optimal dosing schedule in rodents have been reported to be 1-2 mg/kg twice weekly (Ferrara and Kerbel, 2005b). In patients, the bevacizumab-related toxicities and adverse events (including thrombosis, bleeding, proteinuria, hypertension and nosebleed) which were all clinically manageable, but there were also some rare but serious adverse events, such as gastrointestinal perforations, wound healing problems and thromboembolic complications (Ferrara and Kerbel, 2005b). Clinical experience with anti-angiogenic agents have shown that their effects generally are transient and, while buying precious time for the patient, the VEGF-directed therapies in combination with cytostatic mainly prolong life and is rarely curative (Ferrara and Kerbel, 2005b; Jain et al., 2009). Several individual processes can confer resistance, either alone or in concert, and for example there is evidence of tumors switching their VEGF-dependence to other angiogenic pathways or the selection of tumor clones that are more hypoxia-resistant (Ferrara and Kerbel, 2005b). 5.1.7 The role of angiogenesis in neuroblastoma There are numerous reports of the importance of angiogenesis in neuroblastoma. The first report in 1996, counting the vascular index in untreated neuroblastoma tumors, showed that a high index correlated with a number of bad prognostic factors such as disseminated disease, MYCN amplification, unfavourable histology, and a poor survival (Meitar et al., 1996).

23

One key to this might lie in the Trk receptors. The Trk A receptor, which is up regulated in favourable neuroblastomas, correlates with decreased expression of angiogenic factors (on both mRNA and protein levels) in vitro and also resulted in reduced tumorigenic capacity of the cells in vivo together with decreased vascularisation (Eggert et al., 2000a). This is interesting since the favourable tumors are less vascularised and have a stromal histology rich in Schwann cells, which apart from producing differentiating and anti-proliferative factors also produce anti-angiogenic factors (Rossler et al., 2008). In primary material, eight important angiogenic factors showed to be expressed on mRNA level, and especially VEGF expression was found in advance stage tumors (Eggert et al., 2000b). Unfavourable neuroblastomas are often MYCN-amplified and is well vascularised, but the molecular role of MYCN in the angiogenesis of neuroblastoma has been unclear until the connection to Activin A was identified. Three secreted inhibitors of endothelial cell proliferation was found to disappear upon increased MYCN expression (Fotsis et al., 1999) and later analysis showed that one of the proteins was Activin A, a member of the tumor growth factor β (TGF-β) super family (Breit et al., 2000a). Activin A has important functions during development and is interesting for neuroblastoma since it can modulate neuronal differentiation (Breit et al., 2000a). It was found that MYCN could interact with the promoter of Activin A and thereby down regulate both the mRNA and protein (Breit et al., 2000b). Also, neuroblastoma cells generated to express Activin A showed reduced proliferation in vitro, decreased growth rate and angiogenesis in vivo, and inhibition of several key steps necessary for angiogenesis in endothelial cells in vitro (Panopoulou et al., 2005).

24

5.2 MTOR SIGNALLING – TAKING A TANGO WITH THE TARGET!

5.2.1 PI3K in cancer – raising a red card for a frequent player? There is an increasing wealth of information elucidating the role of the PI3K/Akt pathway in a number of cancers of different origin (Hennessy et al., 2005; Steelman et al., 2008). It is not surprising that alterations in players of this pathway, with its central role in responding to growth stimuli and cell survival, could contribute to several of the hallmark changes necessary for neoplastic growth and spread (Hanahan and Weinberg, 2000). There are several steps that could lead to abnormal activation of this pathway, including constitutive activating mutants, amplifications/over expression of activators, or loss/inactivating mutations of suppressors (Garcia-Echeverria et al., 2008). Targeting the PI3K pathway is riddled with difficulties to consider, and with diametrical positive and negative weights in the scale to address. On one hand, this pathway poses a very interesting target as it is deregulated in so many types of cancer and it is easier to inhibit an activated target than to try and restore a loss of function (Hennessy et al., 2005). On the other hand, there is a risk that the properties making the pathway such an interesting therapeutical target may also results in its downfall, as many of the molecules involved are so central and essential that inhibiting their functions might result in serious adverse effects in the clinic. It is also of importance to be able to select the patients that are most likely to repond and benefit from these types of therapies, and finely tune the dose to walk the narrow bridge between improved outcome and toxicity. 5.2.2 Signalling via the PI3K hub – all roads leading through Akt? Upon ligand binding and activation of transmembrane receptor tyrosine kinases (RTK) in the cell membrane, autophosphorylation of the cytoplasmic tails occur and through adaptor proteins they recruit and bind PI3K to the membrane (Engelman, 2009; Steelman et al., 2008). PI3K then generate the second messenger PtdIns[3,4,5]P3, which in turn recruit and anchor Akt (also known as protein kinase B) and also phosphatidyl-inositol kinase 1 (PDK1) to the membrane (Engelman, 2009; Steelman et al., 2008). PDK1 can then phosphorylate Akt on different residues, depending on the isoform of Akt (Steelman et al., 2008). The most abundantly expressed and in cancer implicated Akt-1 (henceforth referred to as Akt) is phosphorylated on threonine 308 (Steelman et al., 2008). Akt is also phosphorylated on serine 473 but the kinase responsible is yet to be elucidated, although PDK1, mTOR or autophosphorylation by Akt itself has been suggested (see further reasoning down below). Activated Akt is present in both the cytosol and in the nucleus, but its different roles in different locations are unclear (Steelman et al., 2008). mTOR is the major kinase responsible for regulating translation in response to nutrients and growth factor signalling, and it also integrate several growth signalling pathways to assure that cellular replication is only undertaken if the nutrient and energy levels are sufficient (Steelman et al., 2008).

25

Upon activation, Akt can phosphorylate and inhibit the tuberous sclerosis complex 1 and 2 (TSC1 or 2), thus releasing their repression of the Ras homologue enriched in brain (Rheb) (Steelman et al., 2008). The active GTP-Rheb then activates the kinase activity of mTOR if it is bound to Raptor (regulatory associated protein of mTOR) and the mLST8 protein, resulting in the formation of the active and rapamycin-sensitive mTOR complex 1 (mTORC1) (Steelman et al., 2008). mTOR can also associate with mLST8 and Rictor (rapamycin-insensitive companion of mTOR), creating the rapamycin-insensitive mTORC2 (Steelman et al., 2008). There are positive and negative regulating loops between Akt and the mTORCs which are not fully understood; mTORC1 can inhibit Akt via a negative feedback loop whilst mTORC2 can directly phosphorylate Akt at serine 473 and facilitate the threonine 308 phosphorylation (Steelman et al., 2008). It is also suggested that Akt can directly phosphorylate mTOR at serine 2448 and contribute to its activation, or that mTOR can be phosphorylated by the ribosomal p70 S6 kinase (p70S6K) on both the serine 2448 and threonine 2446 (Steelman et al., 2008). This intricate network of intertwined regulation raises the hypothesis that there is a regulatory balance between the mTORC 1, 2 and Akt, and this might have implications for the therapeutical inhibition of either target (Steelman et al., 2008). Upon activation, mTORC1 regulates the translational machinery by phosphorylating downstream key components. Phosphorylation of the eukaryotic translation initiation factor 4E-binding protein 1 (4EBP-1) releases the eukaryotic translation inititation factor ((eIF)-4E)), which can then be incorporated into the translation initiating complex (Bjornsti et al., 2004; Steelman et al., 2008). (eIF)-4E is rate limiting for cap-dependent translation, and especially drives the translation of mRNAs necessary for proliferation, survival and angiogenesis (Meric-Bernstam et al., 2009). mTORC1 also, together with PDK1, phosphorylate p70S6K at two different sites (Bjornsti and Houghton, 2004; Wullschleger et al., 2006) and p70S6K in turn drives cell growth by phosphorylating the ribosomal S6 protein and other targets important for cellular growth (Meric-Bernstam and Gonzalez-Angulo, 2009). Both (eIF)-4E and p70S6K have been implicated in transformation and are also coupled to poor prognosis in cancer (Meric-Bernstam and Gonzalez-Angulo, 2009). Translational initiation can also bypass Akt, as PDK1 directly can phosphorylate p70S6K (Granville et al., 2006). To be able to sense the cellular energy status, mTOR is dependent upon the AMP-activated protein kinase (AMPK) (Dancey, 2006). When the AMP/ATP ratio is low, the upstream kinase and tumor suppressor LKB1 (serine/threonine kinase 11) and/or an AMP analogue activate AMPK, which in turns inhibits the ability of mTORC1 to phosphorylate 4E-BP1 and p70S6K and also phosphorylate mTORC2, thereby additionally inhibiting mTORC1 (Wullschleger et al., 2006). The action of PI3K/Akt signalling is counteracted and balanced on several stages, but for cancer the most relevant might be the tumor suppressor phosphatase with tensin homology, deleted on chromosome 10 (PTEN). As PI3Ks generate PtdIns[3,4,5]P3, they are de-phosphorylated and deactivated

26

by PTEN (Cully et al., 2006). Several negative regulators of PI3K/Akt/mTOR signalling has emerged as tumor suppressors and loss of them have connections to cancer; loss of PTEN function trough inherited or somatic mutations have been found in a large fraction of cancers, and individuals with mutated TSC1 or 2 develop hamartomas (benign lesions) throughout the body (Wullschleger et al., 2006). Also, AMPK together with its activator LNK1, acting as negative regulators of PI3K/Akt/mTOR signalling, has been implicated in cancer (Petroulakis et al., 2006). 5.2.3 From Rapa Nui to Rapa Mycin… In early drug discovery, it was often the case that a newly discovered compound with interesting features would lead the way to the discovery of the target molecule or pathway that it acted on (Cohen, 2008). This paradigm has shifted and in the fast lane of drug discovery today, novel drugs are screened out of enormous libraries or specifically synthesised and expertly fitted onto the target, which in turn can be speedily elucidated from huge proteomic and/or genomic arrays of all types of cancers or even specific subtypes. The discovery of rapamycin is a typical early drug discovery saga. In an National Institute of Health (NIH) initiated screen for natural products a Streptomyces hygroscopicus bacteria, isolated from a soil sample taken at Rapa Nui (Easter Island), was shown to be producing a potent anti-fungal macrolide antibiotic (Georgakis et al., 2006). It showed interesting activity in the NCI screening program but its development as an anti-cancer agent was hampered due to problems with the formulation (Bjornsti and Houghton, 2004). The molecular target was found in the early 1990s in yeast and named the target of rapamycin (TOR) and only three years later the only known mammalian homologue, mTOR, was cloned (Wullschleger et al., 2006). Rapamycin was further found to have immunosuppressant activity and in 2000 Rapamune® (Wyeth) was approved to be used for renal allograft rejection (Hartford et al., 2007). Within the realisation that mTOR belonged with the PI3K super family and considering the increasingly bad reputation of this family being involved in a wide variety of cancers (Liu et al., 2009), the interest for rapamycin as an anti-cancer agent was renewed and restored. Rapamycin inhibit the mTORC1 complex by binding to the FK-506 binding protein (FKBP12) (Hay et al., 2004). Upon binding, rapamycin assume a specific conformation that allows binding to the FKBP12-rapamycin binding domain of mTOR (Graziani, 2009). Apparently, it is also possible for rapamycin to bind to mTOR without FKBP-12, but with low affinity (Graziani, 2009). The exact mechanism for rapamycin binding and inhibition of mTOR has for long been unknown (Wullschleger et al., 2006) but there have been speculations and some evidence that rapamycin destabilise the interaction between Raptor and mTOR in the rapamycine sensitive mTORC1 and thereby inhibits the ability to phosphorylate downstream effectors (Abraham et al., 2008; Hartford and Ratain, 2007). Only recently it was found that phosphatidic acid (PA), generated by phospholipase C from phosphatidylcholine in the membrane, is necessary for mTOR activity and is a part of the mTORC1 and 2 (Foster et al., 2009). According to this model, the mTORC exists in an equilibrium and during dissociation PA competes with FKBP12-rapamycin in mTOR binding, thus

27

prevent binding to either Raptor or Rictor (Foster and Toschi, 2009). This model might also explain why mTORC1 seem to be the rapamycin-sensitive, although mTORC2 have been shown to be rapamycin-sensitive at high doses and prolonged treatment (Foster and Toschi, 2009). The mTORC1 complex is less stable than the mTORC2, so during mTORC1 assembly there are increased stochastic opportunities for FKBP12-rapamycin to bind mTOR (Foster and Toschi, 2009). 5.2.4 …and onwards to the Olimus brotherhood of rapalogues Rapamycin has been hampered by problems with the formulation, predominately low bioavailability resulting in inter- and intra-individual differences (Dancey, 2006). Large efforts were put into modifying the mother compound towards increased solubility and better binding, and the band or rapalogue brothers one by one saw the light. Temsirolimus (CCI-779, Torisel®, Wyeth) was the first to be approved for use in advanced renal cell carcinoma and is currently in phase I-III trial for >10 cancer diagnoses, including advance solid tumors (Liu et al., 2009). Everolimus (RAD001, Afinitor® (and Certican® for immunosuppression), Novartis) is approved for soft tissue and bone sarcomas and just recently also for advanced kidney cancer and is currently in phase I-III trials for >10 cancer diagnoses, including advanced solid tumors and several metastatic cancers (Liu et al., 2009). Deforolimus/Ridaforolimus (AP23573/MK-8669, Merck/Ariad) is currently in phase I-III trials for >5 advanced malignancies (Liu et al., 2009). As these previously mentioned drugs all target mTORC1 trough direct binding of the complex partner FKBP12, there are also the dual mTORC1 and 2 rapalogue sisters AZD8055 (AstraZeneca) and OSI-027 (OSI) that both are in phase I-II trial for solid tumors and lymphomas (Liu et al., 2009). Due to the fact that mTOR belongs to the PI3K super family and share homology, it has been shown that the previously thought exclusive PI3K inhibitor LY294002 and the novel PI103, NVP-BEZ235, and EX147 have dual PI3K/mTOR inhibitory capacity (Feldman et al., 2009; Meric-Bernstam and Gonzalez-Angulo, 2009). In an attempt to dissect these functions apart, the newly synthesised PP242 and PP30 inhibit both mTORC 1 and 2 trough ATP-competition and exhibit high selectivity for mTOR over other PI3Ks (Feldman et al., 2009). Also Torin1, discovered in a screening, selectively inhibits mTOR in both the mTORC1 and 2 (Thoreen et al., 2009). These rapalogue TORkinib cousins (named after being TOR kinase domain inhibitors) thus represent the latest in dissecting the complex mTOR signalling. 5.2.5 Toxicity, pharmacology and resistance It is generally thought that the toxicity of the PI3K/Akt/mTOR pathway inhibitors will vary, both in type and severity, depending on the specific target and the drug selectivity for that target. Some toxicity observed in the clinic has been specific for this group of inhibitors and is directly related to their inhibitory targets, namely deregulated glucose and lipid metabolism (LoPiccolo et al., 2008). Yet, there is hope that cancer cells should be more reliant on these pathways to survive, so that the differential targeting of the normal versus the

28

cancerous tissues should shift in the favour of the normal tissues being less sensitive (LoPiccolo et al., 2008). The observed toxicities with Sirolimus, Temsirolimus, Everolimus and Deforolimus/Ridaforolimus have all been reversible and mild to moderate, including skin rash, mucositis, leukopenia, thrombocytopenia, hyperlipidemia and imbalances in electrolytes (Dancey, 2006). There is also the possibility that these toxicities could be used as a surrogate marker allowing for readout of target inhibition in a specific patient, but this remains to be validated (LoPiccolo et al., 2008). It also remains to be analysed if the immunosuppressant activity of the rapalogues, due to a block in the IL-2 response of T-cells, present a drawback for them being used in cancer therapy (LoPiccolo et al., 2008). The phosphorylation status of predominately p70S6K (and to some extent also others in the pathway, such as phosphorylated Akt, mTOR, etcetera) in tumor tissue or in more easily accessible peripheral blood monocytes, have been shown to be predictive alternative markers of target inhibition (Dancey, 2006; LoPiccolo et al., 2008). All the different rapalogues that have been tested in the clinic so far exhibit different pharmacology (Dancey, 2006). Several of these agents are taken orally, a plus as it increases patient safety, comfort and reduce hospitalisation, but pharmacokinetic problems include a non-linear clearance, high distribution volumes, partitioning into red blood cells and limited absorption (Dancey, 2006). Several hypotheses on the development of resistance towards the mTOR inhibitors have been suggested, including mutations in mTOR or FKBP12 (or other proteins in the mTORC) that impedes binding and decrease inhibitory capacity, deregulation of signal components or effectors downstream, increased expression of multidrug resistance transporters (MDR) to decrease drug exposure (Fasolo et al., 2008; Kurmasheva et al., 2006). Also, deregulation and/or mutations in the angiogenic signalling pathways, where the PI3K/Akt/mTOR pathway is involved, could lead to decreased inhibition of angiogenesis (Kurmasheva et al., 2006). 5.2.6 The role of this wicked team in the neuroblastoma playoff The PI3K/Akt pathway has been implicated in neuroblastoma. Growth factor signalling by the IGF and its receptor (IGFR), who signals through the PI3K/Akt pathway, have important roles in regulating cell growth, differentiation and survival and aggressive neuroblasts often have established autocrine stimulatory IGF loops (Sartelet et al., 2008). IGFR has also been shown to be expressed in the majority of primary neuroblastomas (Fulda, 2009). Also, Trk receptor signals to promote cell survival are relayed through the PI3K/Akt pathway and these neurotrophic factors have an established role in neuroblastoma, with TrkA/C being expressed in favourable neuroblastoma and TrkB is a marker of poor prognosis (Sartelet et al., 2008). Although the tumor suppressor PTEN, a negative regulator of PI3K signalling,is unfrequently mutated or deleted in neuroblastoma (Fulda, 2009), decreased

29

PTEN expression has been detected in aggressive neuroblastoma (Sartelet et al., 2008). As an alternative mechanism for inactivation, the PTEN promoter has been shown to be hypermethylated in up to 25% of primary neuroblastomas (Fulda, 2009). It has been previously shown in neuroblastoma that constitutive over expression of Akt had a protective effect against chemotherapy induced apoptosis, and the authors conclude that activated Akt is neuroprotective (Li et al., 2007). The role of angiogenesis in neuroblastoma has been investigated and as stated previously, the vascularisation and expression of VEGF-A is correlated to a poor prognosis. The regulation of VEGF expression is coupled both to the PI3K/Akt pathway, as VEGF is up regulated in response to growth factors such as IGF or epidermal growth factor (EGF) which both signals through RTKs, and the mTOR pathway, since VEGF is a direct transcriptional target of the hypoxia-sensor HIF1α and mTOR signalling (Sartelet et al., 2008). Moreover the platelet-derived growth factor (PDGF) signal via its receptor PDGFR and further on through the PI3K/Akt pathway (Sartelet et al., 2008). There are several other pathways and proteins that signal through Akt and where target inhibition affects the phosphorylation and/or levels of Akt, such as retinoic acid or RNA interference (RNAi) against ALK (Sartelet et al., 2008). Maybe the most compelling evidence of the role of Akt in neuroblastoma was when a tissue microarray of a large cohort of neuroblastoma primary tumors showed that Akt was frequently phosphorylated, both at serine 473 and threonine 308, and its down stream effector p70S6K (Opel et al., 2007). It was revealed that both phosphorylation sites of Akt, alone or together, could be used as a novel prognostic marker of decreased overall or event-free survival, and the phosphorylation was also correlated to MYCN expression and other markers of poor prognosis (Opel et al., 2007). In addition, a recent meta-mining study of neuroblastoma gene expression compared the expression fingerprint of a large cohort of primary tumors with a database of treatment expression profiles, and could sort out six compounds that was predicted to have a therapeutical effect, one of them being the mTOR inhibitor rapamycin (De Preter et al., 2009).

30

5.3 PI3K SIGNALLING – DISRUPT THE CHAIN OF COMMAND!

5.3.1 The role of the PI3K pathway in cancer Several of the recent year’s clinical progress with novel targeted agents has been achieved by ‘drugging the cancer kinome’ with trastuzumab (Herceptin®), imatinib (Gleevec®), gefitinib (Iressa®) and erlotinib (Tarceva®) (Workman et al., 2006). Much about the role of PI3K/Akt pathway signalling in cancer has been discussed herein previously. Isoform-specific pharmaceutical targeting of the PI3K family’s different members has generated a great deal of interest and there are currently >400 patents in this area (Marone et al., 2008). Apart from being implicated in cancer, the PI3K family and their products have also been shown to be deregulated in several other disease, such as chronic inflammations, metabolic disease, and cardiovascular problems (Marone et al., 2008). 5.3.2 The PI3K family – keep on adding the complexity layers Where we previously just shortly addressed the role of PI3K in the signalling from RTKs, there is a great deal more to understand. The PI3K family are divided into three classes (I, II, or III) based on structure homology and preferred substrate (Marone et al., 2008). We will herein focus on the class IA PI3Ks. As briefly mentioned previously, mTOR in nowadays accepted as belonging to the PI3K super family and falls under the class IV (Marone et al., 2008). As a preparation step, the phosphatidylinositide-4 kinases (PI4Ks) can phosphorylate PtdIns to generate PtdIns(4)P (Marone et al., 2008). Although the class I PI3Ks in vitro are capable of phosphorylating PtdIns to PtdIns(3)P, PtdIns(4)P to PtdInd(3,4)P2 and PtdIns(4,5)P2 to PtdIns(3,4,5)P3, their in vivo preferred conversion is from PtdIns(4,5)P2 to PtdIns(3,4,5)P3 (Marone et al., 2008). The PI3Ks are heterodimeric protein, consisting of one catalytic and one regulatory subunit (Steelman et al., 2008). In class IA there are three different p110 catalytic subunits (p110α, p110β, and p110δ) and five different regulatory subunits (p50α, p55α, p85α, p85β, and p55γ) (Engelman, 2009) where p50α and p55α are splice variants of p85α (Liu et al., 2009). The class IA PI3Ks can be activated by a large number of different cell-surface receptors but, while PI3K containing the p110β can be activated by G-protein coupled receptors, the p85 regulatory subunit is critical to activate PI3K signalling in response to activated RTKs (Engelman, 2009). The p110α and p110β are ubiquitously expressed (Engelman, 2009) but the long held belief that they were functionally redundant was disproved as knock-out studies in mice have showed that they have different roles (Liu et al., 2009). Upon ligand binding, receptor dimerisation and autophosphorylation, the regulatory p85 subunit binds to the receptor (Engelman, 2009). This binding happens either directly trough Src homnology (SH2) domains in the p85 subunit, trough phosphorylated adaptor proteins such as insulin receptor

31

substrate 1 (IRS1) or by direct binding of Ras to the p110 subunit (Fasolo and Sessa, 2008). When the p85/p110 PI3K bind to the activated receptor it is also recruited to the membrane where its substrate is located and, due to a conformational change upon binding to the activated receptors, the p85 regulatory subunit releases its inhibition on the p110 catalytic subunit (Engelman, 2009). The activated catalytic p110 subunit then catalyse the transformation of PtdIns(4,5)P2 to PtdIns(3,4,5)P3 which accumulate in the membrane (Engelman, 2009). This accumulation attracts proteins with pleckstrin homology (PH) domains, such as Akt and PDK1, to the membrane where PDK1 and PDK2 (which is thought to be mTOR) phosphorylate and activate Akt (Engelman, 2009). The further downstream signalling pathway has been described herein previously. The PI3K/Akt signalling pathway are counteracted by the tumor suppressor phosphatase PTEN as described previously, but also by the SH2 domain-containing inositol phosphatase (SHIP) that catalyses the conversion of PtdIns(3,4,5)P3 to PtdIns(3,4)P2 (Marone et al., 2008). 5.3.3 Selective PI3K inhibitors – how was it with that selectivity? There has been a great deal of interest in finding PI3K inhibitors, both natural and synthesised. Wortmannin, a fungal metabolite isolated from the bacteria penicillin wortmannin, bind irreversibly to and inhibit the kinase activity of all isoforms of PI3K (Garcia-Echeverria and Sellers, 2008; Liu et al., 2009). A drawback of wortmannin for in vitro and in vivo settings is that it is rapidly hydrolysed (Marone et al., 2008), reported t½ about 10 minutes under normal culture conditions. PWT-458 is a novel pegylated derivative of wortmannin that is supposed to have an improved therapeutical index (Garcia-Echeverria and Sellers, 2008; Steelman et al., 2008). The first synthetic small molecule pan-PI3K inhibitor was LY294002 (Lilly) that asserts its effects through ATP competition (Garcia-Echeverria and Sellers, 2008; Marone et al., 2008; Steelman et al., 2008). LY294002 have been used extensively to reveal the PI3K signalling pathway, but has low selectivity and is associated with considerable toxicity in vivo (Liu et al., 2009). SF-1126, a water soluble prodrug of LY294002, is a pan-PI3K and mTOR inhibitor with improved pharmacodynamic properties and is currently in a phase I trial (Garcia-Echeverria and Sellers, 2008). The drug delivery in this field changed upon the realisation that mTOR belongs to the PI3K super family and that many of the previously thought exclusive PI3K inhibitors also in addition exert various degrees of mTORC1 and 2 inhibition. Some PI3K inhibitors are reconsidered as dual PI3K/mTOR inhibitors, whilst in parallel isoform specific inhibitors are being developed. Several novel dual PI3K/mTOR inhibitors; BEZ235 (Novartis), BGT226 (Novartis), XL147 (Exelixis), SF1126 (Semafore); and more class I or isoform-specific inhibitors; BKM120 (Novartis), XL765 (Exelixis), GDC0941 (Genentech), PX-866 (Oncothyreon), CAL-101 (Calistoga); are currently evaluated at phase I-II trials in different cancer diagnoses (Liu et al., 2009).

32

5.3.4 But in this myriad of drugs, what do one chose? The pyridofuropyrimidine PI103 was discovered in a high-throughput screening and was consecutively found to be a selective PI3K class IA inhibitor with IC50 values in the low nM range for p110α, β, δ and γ (Raynaud et al., 2007), but with a preference for p110α (Knight et al., 2006). It was also found that p110α and DNA-dependent kinase (DNA-PK) were pharmalogues, i.e. pharmacologic homologues (Simon, 2006). Subsequently, PI103 was shown to have activity in vitro and in vivo against glioma, and that PI103 also inhibited mTOR simultaneously with PI3K (Fan et al., 2006). This dual inhibitory capacity is not surprising, since both DNA-PK and mTOR are members of the before mentioned class IV PI3K group. PI103 has shown efficacy in different cancer types both in vitro (Fan et al., 2007; Kojima et al., 2008; Park et al., 2008; Prevo et al., 2008) and in vivo (Chaisuparat et al., 2008; Chen et al., 2008; Fan et al., 2006). 5.3.5 PDK1 inhibitors – emerging from the darkness While much effort has been focused onto generating and/or finding specific PI3K inhibitors, it seems like PDK1 nearly became forgotten. Interestingly, in mammals there are only a single isoform of PDK1 (Liu et al., 2009). Apart from phosphorylation and activating Akt, PDK1 also activate several other kinases that regulate proliferation and cell survival (Granville et al., 2006). During the last years there have been a substantial increase in the interest for generating specific inhibitors of PDK1 and many of the major drug developing companies have series of analogues in the pipeline (Peifer et al., 2008). The majority of these are ATP competitors and bind to the ATP binding-site of PDK1 and frequently also to a rather large series of related kinases, although with different preference (Peifer and Alessi, 2008). To date, many of the developed inhibitors are to unselective and thus therapeutically unsuitable and/or are based on a chemical rigid scaffold that leaves them with poor physiochemical properties and low in vivo potency despite high in vitro kinase inhibition ability (Peifer and Alessi, 2008). Also the problem with inadequate selectivity poses a problem, as targeting several kinases can potentially be therapeutically beneficial (vertical targeting), but it can also confer additional toxicity (Peifer and Alessi, 2008). The bacterial product staurosporine, developed into the antibiotic Midostaurine, was modified to generate UCN-01 which inhibits both PDK1 and other kinases (Granville et al., 2006), among them also the checkpoint kinase 1 (Chk1) (Fulda, 2009). It has passed phase I trials with hyperglycaemia as the dose-limiting toxicity and are currently in phase II trial (Granville et al., 2006). Other inhibitors (BX-795, BX-912 and BX-320) have been identified in high-throughput screens and further modified to inhibit the catalytic activity of PDK-1 (Granville et al., 2006). The compound celecoxib (Celebra®, Pfizer) belongs to the coxib family of non-steroidal anti-inflammatory drug (NSAID) and was developed as a an inhibitor of the cyclooxygease-2 (COX-2) enzyme (Schonthal et al., 2008). COX-2 is the rate-limiting enzyme in the inflammatory cascade that converts arachidonic acid into the prostaglandins and other eicosanoids (Schonthal et al., 2008). It has been well established that celecoxib has the ability to prevent colon

33

cancer, and possibly also other types of cancer (Schonthal et al., 2008). While celecoxib remain on the market, rofecoxib (Vioxx®, Merck) and valdecoxib (Bextra®, Searle&Company) was withdrawn due to cardiotoxicity (Schonthal et al., 2008). Surprisingly, some of the anti-tumor activity of celecoxib in vitro and in vivo seemed to be apart from its anti-inflammatory effects and without involvement of COX-2, and it become increasingly clear that celecoxib have pharmacological activity outside inhibiting COX-2 (Schonthal et al., 2008). Upon the realisation that celecoxib was an weak inhibitor of PDK1 a series of celecoxib analogues, one of them named OSU03012, was developed that preferentially targeted PDK1 through ATP-competition and that lacked COX-2 inhibition (Zhu et al., 2004). OSU03012 has shown promising in vitro (Cen et al., 2007; Johnson et al., 2005; Tseng et al., 2005; Zhang et al., 2007) and in vivo (Gao et al., 2008; Sargeant et al., 2007; Wang et al., 2008; Weng et al., 2008) activity in several cancer models. OSU03012 has been purchased by Arno Therapeutics, renamed to AR12, been accepted as an IND (Investigational New Drug) by the FDA and has advanced into phase I clinical trials (see www.arnothera.com/ar12.html). 5.3.6 Toxicity, pharmacology and resistance There is evidence that targeting a selected PI3K isoform might be sufficient to inhibit the growth of a certain cancer type, and since the different p110 catalytic isoforms seems to have differential roles in signalling there is hope that specifically inhibiting a single isoform might reduce toxicity (Liu et al., 2009). The hereto anticipated toxicities of targeting PI3K and PDK1 is thought to be insulin resistance (hyperinsulinaemia and/or hyperglycaemia) and is most likely related to on target effects of inhibiting the IGF pathway (Engelman, 2009). Readily available surrogate tissues can be used to measure the repose to therapy by measure the phosphorylation levels of Akt or p70S6K (Liu et al., 2009). Also, as the PI3K/Akt pathway is important for insulin signalling, there are hopes that insulin or glucose levels in blood can be used as a surrogate marker (Liu et al., 2009). As with all other targeted drugs, the PI3K or the PDK1 inhibitors are not thought to be without drawbacks. The concerns for acquired resistance against the PI3K inhibitors (specific, dual and pan-inhibitors) include somatic activating mutations in p110, resulting in conformational changes and loss off the p85 inhibitory effect, and/or amplifications and activating mutations in the p85 regulatory subunit (Engelman, 2009; Liu et al., 2009). Mutations in the pleckstrin homology (PH) of Akt, leading to promiscuous binding to the membrane in the absence of PtdIns(3,4,5)P3 and constitutive phosphorylation at serine 473 have been reported (Engelman, 2009; Liu et al., 2009). Deregulation of PDK1 in cancer does not seem to be frequent, but there are reports of amplification and over expression (Liu et al., 2009).

34

The homology of the PI3Ks and the fact that many of the drugs used or in the pipeline are dual inhibitors are also promising (Liu et al., 2009), as the concept of ‘vertical pathway inhibition’ has evolved (Fulda, 2009). The ability to simultaneously target more than one molecule might lead to less risk of acquired drug resistance (Liu et al., 2009). As clinical resistance often occurs through mutations in the target protein, a two hit event where two kinases (or several more) all have to acquire not only mutations but mutations that confers a selective advantage, is less likely (Liu et al., 2009). 5.3.7 PI3K and PDK1 in neuroblastoma Both PI3K and PDK1 signalling is most likely of importance in neuroblastoma as it has been shown to express and relying on several RTKs known to signal through the PI3K/Akt pathway (Sartelet et al., 2008), including BDNF, EGF, VEGF and IGF (Fulda, 2009). Expression analysis of the class IA PI3K in primary neuroblastomas compared to normal adrenal gland tissue by quantitative PCR showed that the mRNA expression of the catalytic p110δ and the regulatory p85α subunit was increased and correlated to each other (Boller et al., 2008). This indicatated that the p110δ/p85α PI3K is over expressed in neuroblastoma, whilst the p110α and β isoforms was unchanged (Boller et al., 2008). Furthermore, when correlating the expression to clinical parameters the p110δ/p85α PI3K was found to be over expressed in neuroblastomas without MYCN amplification and in samples from children under the age of 1 year, both being favourable prognostic factors (Boller et al., 2008). In vitro, p110δ/p85α and the p110α PI3K mRNA was over expressed in half of the cell lines investigated, and down regulation of either p110α or p110δ resulted in impaired growth and decreased the cells ability to respond to growth factor stimulation in vitro (Boller et al., 2008). Primary neuroblastoma has been shown to express COX-2 and treatment with celecoxib showed in vitro and in vivo efficacy, possibly some of this effect could be mediated through the PDK1 inhibitory effect of celecoxib (Johnsen et al., 2004). UCN-01, the stausporine analogue mentioned earlier, or 17-hydroxystausporine has been tested in neuroblastoma in vitro (Shankar et al., 2004). UCN-01 was cytotoxic to neuroblastoma cells, induced apoptosis, and an S phase arrest (Shankar et al., 2004). Treatment with UCN-01 was associated with decreased Akt phosphorylation at serine 473 and 308, and of serine 9 at GSK3β (Shankar et al., 2004). The PPTP has tested several inhibitors that interfere with the PI3K/Akt pathway; the monoclonal anti-IGF-1 antibody SCH717454 (Kolb et al., 2008a), the multi-target tyrosine kinase inhibitor sunitinib (Maris et al., 2008b), and the tyrosine kinase inhibitor of EGFR/ErbB2 lapatinib (Gorlick et al., 2009). Of these, the anti-IGF-1 antibody SCH717454 was the most promising, as it generated four intermediate and two low responses in the six xenograft models of neuroblastoma it was tested in (Kolb et al., 2008a). Sunitinib showed two ‘intermediate’ and two ‘low’ responses (Maris et al., 2008b) and lapatinib showed only six ‘low’ responses (Gorlick et al., 2009).

35

Inhibiting the PI3K (and most likely also mTOR and other related kinases) with LY294002 in the MYCN-driven mouse neuroblastoma model resulted in decreased tumor mass together with decreased MYCN levels, but with unchanged MYCN mRNA expression (Chesler et al., 2006). The same was observed with LY294002 in vitro and was concluded to occur through a GSK3β-dependent mechanism (Chesler et al., 2006). Upon treatment with LY294002 the phosphorylation of Akt decreased whilst it increased on MYCN, a process that targets MYCN to degradation (Chesler et al., 2006). When PI3K activate Akt it phosphorylates GSK3β and negatively regulate its activity but upon PI3K inhibition Akt is not phosphorylated, GSK3β is active and phosphorylate MYCN for degradation (Chesler et al., 2006).

36

5.4 TRANSCRIPTION SIGNALLING – MESSING WITH MYC! 5.4.1 Myc signalling in cancer – the naughty, the bad and the ugly? The oncoprotein Myc has a long history in cancer (Meyer et al., 2008). The human homologue of a virus causing avian leukaemia was discovered over a quarter of a century ago and named Myc (Meyer and Penn, 2008). Myc has aided in the discovery and understanding of processes that drive cancer, such as insertional mutagenesis, chromosomal translocations and amplifications (Meyer and Penn, 2008). Since its discovery, the family of Myc proteins (c-Myc, MYCN and L-Myc) and especially c-Myc has cemented their role in cancer. Myc is activated in a vide variety of malignancies (Vita et al., 2006) and the expression levels of Myc in increased in tumor cells compared to normal (Luscher et al., 2007). There are several processes that can activate Myc, both on the genetic (mutations, amplification, translocation) and protein level (over expression, increased stability, mutations) but the most common is through amplification (Vita and Henriksson, 2006). MYCN has been shown to be able to transform normal cells, it is essential to drive cells through cell cycle check points and supply the growing cell with building material by increasing metabolism and biosynthesis (Meyer and Penn, 2008). The transformation achieved by Myc in vitro is efficient and often does not require any other oncogene to be deregulated, whilst the in vivo situation (in human cancers as well) Myc alone is not always sufficient to drive transformation and additional event are often required (Prochownik, 2008). Myc has also been shown to play a part in global genomic stability, in apoptosis and cellular differentiation (Meyer and Penn, 2008). Due to the large number of extracellular and intracellular signals that convey on Myc, it is though to act as a hub that interpret and integrate all these signals (Meyer and Penn, 2008). It appears that these functions of Myc are of essence in higher organisms, as Myc is not found in yeast and worms (Meyer and Penn, 2008). The generation of Myc knockout mice has further underlined its essential function, as both c-Myc and MYCN knockout mice are lethal around embryonic day 10, whilst L-Myc knockouts are viable (Meyer and Penn, 2008). Several mouse models have been generated to prove the role of Myc in tumorigenesis (Meyer and Penn, 2008). 5.4.2 The story of an overachieving little protein In the mid-1980s it was shown that Myc was a transcriptional activator and its partner Max was identified in the early 1990s. Myc and Max are both basic helix-loop-helix leucine zipper proteins that form heterodimers and binds to a defined sequence in the E-boxes of promoters (Adhikary et al., 2005). Max can form heterodimers with other members of the Mad and Mnt family and then repress translation, or it can form homodimers that can bind but nor activate or repress translation (Adhikary and Eilers, 2005). Proliferating cells generally have increased Myc-Max complex, while the Max-Mad/Mnt dominates in differentiating or resting cells (Adhikary and Eilers, 2005). Max is an obligate partner of Myc in transforming cells and necessary for binding to DNA (Adhikary and Eilers, 2005).

37

There is an astonishing number of genes that are thought to be regulated by Myc (it is estimates that Myc can bind to over 25000 genes in humans) and this is most likely connected with its proposed role as a central translational hub (Adhikary and Eilers, 2005). It is also believed that some of the binding sites of Myc might also drive transcription of microRNAs (miRNA) that in turn regulate gene expression by binding and inhibiting the translation of mRNAs (Eilers et al., 2008). Myc itself is regulated by several processes. The protein levels of Myc change during the cell cycle in normal cells (Luscher and Larsson, 2007) and the protein has a very short half life (Eilers and Eisenman, 2008). Myc is controlled by Ras through two pathways, both via the mitogen-activated protein kinases (MAPK) (Adhikary and Eilers, 2005) and the PI3K pathway (Bachireddy et al., 2005). There are two phosphorylation sites on MYCN that has to be phosphorylated in concert to direct MYCN for degradation, and Ras is in charge of both (Bachireddy et al., 2005). Upon growth stimuli, Ras is activated and it in turn activate the extracellular signal-regulated kinase (ERK) (Bachireddy et al., 2005). Myc is phosphorylated on serine 62 by ERK and becomes stabilised (Adhikary and Eilers, 2005). Upon decreased growth stimulation, Akt release its inhibition of GSK3β, which then can recognise Myc phosphorylated on serine 62 and phosphorylate it on threonine 58 and destabilise it (Junttila et al., 2008). With both sites phosphorylated Myc can be recognized by prolyl isomerase 1 (PIN1) and converted from cis to trans, then recognised and dephosphorylated on serine 62 by protein phosphatase 2A (PP2A) and with only the threonine 58 phosphorylation ubiquitinylated by the ubiquitin ligase complex and targated for destruction by the proteasome (Junttila and Westermarck, 2008). 5.4.3 Inhibiting Myc - the emasculation of a long standing dream? Targeting Myc presents as an interesting approach in many types of cancer and several strategies has been adopted to achieve this (Vita and Henriksson, 2006). As Myc has a dual role, being involved in both proliferation but also sensitising cells to apoptosis, there are hopes that targeting either characteristic could be beneficial for cancer treatment (Vita and Henriksson, 2006). Inhibiting Myc could be achieved using several molecular strategies and on different biological levels, including interfering with Myc expression at the transcription and/or protein level, disrupt its dimerisation with Max and/or other factors, interrupt its binding to DNA, or promote Myc degradation (Vita and Henriksson, 2006). There is also the possibility of inhibiting of alter the expression of Myc target genes (Vita and Henriksson, 2006). Small molecule inhibitors could possibly be used to target Myc at several of the described steps and screening of chemical libraries have been successful in identifying several compounds with interesting efficacy (Lu et al., 2003; Vita and Henriksson, 2006). 10058-F4 was discovered in a screening of a chemical library using a yeast two-hybrid system due to its ability to disrupt the c-My-Max interaction (Yin et al., 2003). It was also shown to inhibit the growth in vitro and in vivo of rat fibroblasts over expressing c-Myc (Yin et al., 2003). Since its discovery it has

38

shown potency in several other types of cancers in vitro (Gomez-Curet et al., 2006; Huang et al., 2006; Sampson et al., 2007), but in vivo there were no significant inhibition of prostate xenografts (Guo et al., 2009). 5.4.4 Toxicity, pharmacology and resistance Since its discovery there has been some effort put into modifying 10058-F4 and also to understand its mechanism of action. A major hurdle with Myc-Max targeting compounds was the limited potency and the high concentrations that had to be used to inhibit cell growth, a feature that might limit their clinical use (Wang et al., 2007). A range of second-generation 10058-F4 analogues was generated with increased efficacy, but whilst protein-protein and protein-DNA interaction was improved this did not universally translated into improved efficacy in cellular based systems (Wang et al., 2007). It was also established that 10058-F4 bind to monomeric Myc (Wang et al., 2007) in the basic helix-loop-helix region and inhibit Myc-Max interaction through local conformational changes in the protein structure (Follis et al., 2008). Max has been shown to exists in two isoforms and both the Myc-Max heterodimerisation and DNA binding depends on the Max isoform, and that 10058-F4 is more effective in inhibiting the Myc-Max complex with one isoform over the other (Follis et al., 2009). Furthermore, three biding sites have been identified on c-Myc that disrupt its dimerisation to Max and 10058-F4 can occupy all three sites (Hammoudeh et al., 2009). This work has been further elaborated to understand the chemical and structural basis for disruptors of Myc-Max interaction (Mustata et al., 2009). To my knowledge there is currently only one published report on the use of 10058-F4 in vivo and it establish that after i.v. administration 10058-F4 have a fast metabolism and although rather high plasma and tissue levels are achieved the distribution to tumor tissues is approximately only 10% of the given dose and it is rapidly cleared (Guo et al., 2009). One can only make the general assumption that the observed pharmacokinetics and toxicity of 10058-F4 in mice would approximately reflect the human situation, but to my knowledge, no Myc inhibitor have hereto proceeded past the earliest preclinical stage of testing. As Myc seems to be such a central regulator of a vide variety of cellular processes it is likely that inhibiting it will be associated with toxicity. There are several mechanisms whereby tumor cells hypothetically could develop resistance towards Myc targeted therapy, but to my present knowledge no data exists as these agents have not yet advanced so far. Hypothetical reasoning paints a picture where mutations in the Myc protein with decreased binding of the inhibitor, Max, or DNA could result in resistance. Also increased metabolism of inhibitors, by up regulation of metabolic system, or increased transport out of cells, are possible mechanisms. When using oligonucleotide approaches to inhibit Myc expression at DNA or RNA level, increased degradation, reduced uptake and/or expression could evolve as a resistance mechanism.

39

5.4.5 MYCN in neuroblastoma The association of Myc with neuroblastoma goes to the history books as the MYCN member of the Myc family was discovered in neuroblastoma (Schwab, 2004), and amplification of it could be coupled to aggressive disease and decreased survival. The amplification can be from fifty to hundreds of copies and whereas DNA analysis indicates no mutations in the MYCN protein instead it is the increased dosage that is thought to drive tumorigenesis, tumor cells can express 40-60 fold more MYCN mRNA (Schwab, 2004). Co-amplification of other genes in concert with MYCN has been observed and investigated, but the additional genes do not affect patient prognosis (Schwab, 2004). MYCN have also been observed to be amplified in other cancer types at a low incidence (Schwab, 2004). Whereas the activation of Myc in cancer does not show a uniform preference for a specific diagnosis, MYCN exhibit this preference for tumors of neuroectodermal lineage (Schwab, 2004), and whilst c-Myc is expressed in a wide variety of tissues, the expression of MYCN is restricted to the early stages of embryonal development (Lu et al., 2003). MYCN is expressed in the neuroblasts of the neural crest, where it plays an important role for the proliferation and migration of these cells (Grimmer and Weiss, 2006). In evidence for its role in disease, targeted deletion of MYCN in mice results in cerebellar hypoplasia whereas directed expression of MYCN in the neuronal crest results in the retention of hyperplastic ganglia that does not respond to death stimuli (Hansford et al., 2004) and the formation of neuroblastoma like tumors (Weiss et al., 1997). Targeting MYCN in neuroblastoma is an interesting therapeutic approach (Lu et al., 2003). There are a connection between MYCN expression and differentiation in neuroblastoma, as treatment with retinoic acid decrease the MYCN mRNA levels and induce differentiation and undifferentiated neuroblasts can differentiate by the loss of MYCN expression (Grotzer et al., 2009). Also in the transgenic MYCN-driven model of neuroblastoma, down regulation of MYCN by peptide nucleic acid resulted in decreased tumor incidence and progression (Burkhart et al., 2003). Also inhibitors of other pathways that have MYCN as a downstream target are interesting, such as Shh or wingless (Wnt)/β-catenin (Grotzer et al., 2009). The regulation of miRNAs by MYCN is also of interest in neuroblastoma, since screening has found miRNAs that correlate to MYCN amplification and one miRNA cluster that is a direct target of MYCN (Grotzer et al., 2009).

40

6 AIMS This thesis focus on the preclinical evaluation of six novel targeted therapies in neuroblastoma, a malignancy of the young child. The overall aim of this thesis was to investigate potential new substances for the treatment of neuroblastoma. The aims also encompassed improvements of the xenograft models used, the establishement of the MYCN-driven spontaneous transgenic model of neuroblastoma, and the evaluation of in vivo data. The specific aims of this thesis were:

To investigate the effects of the monoclonal humanised antibody bevacizumab (Avastin®), targeting the pro-angiogenic factor VEGF-A, in vivo in neuroblastoma.

To investigate the staus of the mTOR pathway in primary

neuroblastoma, evaluate the efficacy of the mTOR inhibitors rapamycin and its novel analogue CCI-779 in vitro and in vivo, and to look into the molecular mechanisms of action.

To evaluate the expression of the PI3K pathway in primary

neuroblastoma, evaluate the efficacy of the PDK1 inhibitor OSU03012 and the dual PI3K/mTOR inhibitor PI103 in vitro and in vivo, and to look into the molecular mechanism of action.

To establish the MYCN-driven spontanteous transgenic model of

neuroblastoma and to investigate the efficacy of the Myc-Max disruptor 10058-F4 in vitro and in vivo.

41

7 MATERIALS AND METHODS 7.1 IN VITRO 7.1.1 Neuroblastoma cell lines The neuroblastoma cell lines used include SK-N-AS, SH-SY5Y, IMR-32, SK-N-BE(2), SK-N-FI, SK-N-DZ, SK-N-SH and Tet21N. The culture conditions of these cells were: SH-SY5Y in Paper I as described previously (Backman et al., 2005). In Paper II-IV the cells were grown in: EagleMEM (SH-SY5Y) or RPMI1640 (SK-N-AS, IMR-32, SK-N-BE(2), SK-N-FI, SK-N-DZ, SK-N-SH and Tet21N) all supplemented with 10% serum and 2mM L-glutamine. All cells were grown at 37ºC in a humidified chamber and at 5% CO2. For all treatments in vitro, OptiMEM supplemented with 2mM L-glutamine was used. The Tet21N cells with tetracycline-regulated MYCN expression (Paper II and III) was treated with doxycycline and hence MYCN was turned off 24 hours prior to experiments. 7.1.2 Inhibitors, drugs and agents 7.1.2.1 Targets and structure The drugs used included and was obtained from; Paper I, bevacizumab (a kind gift by Genentech); Paper II, rapamycin (LC Laboratories), CCI-779 (a kind gift from Wyeth) and LY294002 (Cell Signaling); Paper III, OSU03012 (a kind gift by Arno Therapeutics) and PI103 (Cayman Chemicals); and Paper IV, 10058-F4 (Sigma-Aldrich). 7.1.2.2 Dissolving For in vitro and in vivo use, bevacizumab was diluted in sterile PBS (Paper I). Rapamycin and CCI-779 stock was diluted in 99.5% ethanol, whilst LY294002 stock was diluted in DMSO (Paper II). For in vitro use, Rapamycin, CCI-779 or LY294002 were diluted further in OptiMEM, whilst for in vivo use Rapamycin or CCI-779 were diluted in 5% PEG 400 / 5% Tween 20 / 0.9% sterile saline (Paper II). OSU03012 and PI103 stock was both diluted in DMSO and for in vitro use further diluted in OptiMEM, whilst for in vivo use they were diluted in 0.5% methylcellulose / 0.1% Tween 80 /sterile saline (Paper III). 10058-F4 stock was diluted in DMSO and for in vitro use further diluted in OptiMEM, whilst for in vivo use it was diluted in sterile saline (Paper IV). 7.1.3 Viability assays 7.1.3.1 FMCA and MTT cell viability assays In Paper I, the fluorescent microculture cytotoxicity assay was used to asses cell viability upon treatment with bevacizumab as described previously (Wickstrom et al., 2007). The MTT assay used in paper II-IV was done as described previously (Johnsen et al., 2004). 7.1.3.2 Clonogenic assay In Paper II, the clonogenic assay was performed as described previously (Baryawno et al., 2008). In paper IV, a soft agar clonogenic assay was performed, where a single cell suspension in 0.4% agarose is plated in 12 well

42

plates on 0.6% agarose. Media containing 10058-F4 was added and changed every 3-4 days. After 14 days living cells and colonies were visualised with MTT reagent. 7.1.3.3 Fluorescent-activated cell sorting (FACS) In Paper II and III, cell cycle analysis by FACS with DAPI stained cells was performed as described previously (Baryawno et al., 2008). 7.1.3.4 Transmembrane potential assay In Paper III the TMRE probe staining was done as described previously (Johnsen et al., 2004). 7.1.4 Immunoblotting 7.1.4.1 Harvest, protein preparation and blotting In Paper I, protein samples were boiled, separated by SDS/PAGE electrophoresis, blotted onto nitrocellulose membrane and blocked with 5% non-fat dry milk in 0.1% Tween/PBS. In paper II-IV, preparation of protein and blotting was done as described previously (Baryawno et al., 2008). 7.1.4.2 Antibodies and reagents The antibodies used in Paper I was a polyclonal rabbit anti-human IgG conjugated to horseradish peroxidase (HRP). The antibodies used in Paper II was phospho-AKT(ser473), phospho-TOR(ser2448), phospho-S6K1(thr389), phospho-4E-BP1(ser65), phospho-GSK-3b(ser9), AKT, mTOR, S6K1, 4E-BP1, GSK-3b, caspase-9, caspase-3, PARP, cyclin D1 (Cell Signaling), MYCN (Oncogene Research Products) and b-actin (Sigma-Aldrich). Additional antibodies used in Paper III was phospho-Akt (thr308), phospho-PDK1(ser241), PI3K p110α, PI3K phopho-p85(tyr458)/phospho-p55(tyr199), caspase-7 and MYCN (all Cell Signal). Secondary detection was done as described previously (Baryawno et al., 2008). 7.1.5 Immunohistochemistry 7.1.5.1 Preparation, antibodies and detection In Paper I, the immunohistochemical analysis of xenograft material was done as described previously (Svensson et al., 2002). The immunohistochemical analysis and the biobank of primary material in Paper II was performed as described previously (Johnsen et al., 2004) and the procedure was identical in Paper III. The antibodies used was phospho-Akt(ser473), Akt, phosho-mTOR(ser2448) and mTOR (all Cell Signal). Additional antibodies used in Paper II was phospho-PDK1(ser241), PI3Kp110α, phopho-p85(tyr458) (and phospho-p55(tyr199)) (all from Cell Signaling). For all studies on human material in Paper II and III, ethical approval was obtained by the Karolinska University Hospital Research Ethics Committee. Tissues from the xenograft experiment in Paper II was prepared in the same manner as the primary material, and probed using antibodies against phospho-AKT(ser473), phospho-mTOR (ser2448), phospho-S6K1 (thr389), AKT, mTOR and S6K1 (all Cell Signaling), Ki-67 (NeoMarkers), MYCN (Oncogene Research Products) or cleaved caspase-3 (R&D Systems,

43

Abingdon, UK). All secondary detection was done as described previously (Baryawno et al., 2008). 7.1.5.2 Stereological quantification of immunohistochemical staining The stereological quantification in Paper I was dose as described previously (Wassberg et al., 1999). In Paper II, proliferation, apoptosis and angiogenesis was quantified by counting fifteen randomly selected fields per slide and four slides per group for each staining. Proliferation (Ki-67) is expressed as the number of positive cells over the total number of cells and apoptosis (caspase-3) and angiogenesis (BS-1) as average number of positive cells/vessels per field. 7.1.6 ELISA and mRNA analysis 7.1.6.1 Enzyme-linked immunosorbent assay (ELISA) ELISA analysis on the levels of circulating VEGF-A in animals in Paper I was done using a commercially available kit (R&D Systems) to the manufacturers instructions. Also measuring VEGF-A in cell culture supernatants in Paper II was done using a commercially available kit (R&D Systems) to the manufacturers instructions. 7.1.6.2 Analysis of mRNA The extraction of RNA for quantification of cyclin D1, MYCN and β-microglobulin mRNA and the analytical procedure was done as described previously (Kagedal et al., 2004). For MYCN mRNA quantification: the forward primer ACCCTGAGCGATTCAGATGAT, reverse GTGGTGACAGCCTTGGTGTT, and the probe GGAGAAGCGGCGTTCCTCCTC. For cyclin D1 mRNA quantification: the forward primer AACAAACAGATCATCCGCAAAC, reverse ACCATGGAGGGCGGATT, and the probe TCTGTGCCACAGATGTGAA. For b2-microglobulin mRNA quantification: the forward primer GAGTATGCCTGCCGTGTG, reverse AATCCAAATGCGGCATCT and the probe CCTCCATGATGCTGCTTACATGTCTC. The probes were labeled with FAM and TAMRA (Applied Biosystems). 7.2 IN VIVO 7.2.1 Housing and husbandry The animals (Paper I-IV) were housed in groups when possible, given nesting material and shelters, and kept on a 12 h day/night cycle with food and water ad libitum. Animal studies were done with permission from the relevant Animal Ethical Board and in accordance with national regulations. 7.2.2 Xenograft models For all xenograft studies (Paper I-IV) animals were xenografted at an age of 5-6 weeks by a method described elsewhere (Morton and Houghton, 2007). The animals chosen for xenografting were NMRI nude mice from M&B (Paper I), Taconic (Paper II) and Scanbur (Paper III-IV).

44

Animals were xenografted s.c. with SH-SY5H/IMR-32/SK-N-AS (30x106, Paper I and II), SH-SY5Y (30x106, Paper II), SK-N-BE(2) (20x106, Paper III and IV). In Paper I-IV the tumors were measured every or every other day with a digital calliper, drugs were administrated as described below, animals were sacrificed by CO and cervical dislocation, blood was drawn from the hearth and all material collected was snap-frozen in liquid nitrogen and transferred to -80°C freezer for storage. For Paper II-IV the tumor volume was calculated with the formula length x width2 x 0.44. In Paper I the blood was allowed to clot and serum was collected, whilst in Paper II the blood was taken in heparinised tubes and thus plasma collected. The drugs were administered at the following doses and routes; Paper I, bevacizumab (5 mg/kg i.p. twice weekly); Paper II, rapamycin (5 mg/kg, i.p. daily) or CCI-779 (20 mg/kg i.p. daily); Paper III, OSU03012 (100 mg/kg, per os (p.o.) daily) or PI103 (10 mg/kg i.p. daily); or Paper IV, 10058-F4 (25 mg/kg, i.p., daily). Controls were given sterile saline (Paper I) or no treatment (Paper II-IV). 7.2.3 Transgenic model For Paper IV, the transgenic model of neuroblastoma (Weiss et al., 1997) was obtained from the Mouse Model of Human Cancer Consortium (MMHCC) repository (http://mouse.ncifcrf.gov) as a N16 backcross to the 129X1/SvJ strain (The Jackson Laboratories, http://jaxmice.jax.org/strain/000691.html) and upon establishing a founder pair it was maintained as an inbred stock. The animals were housed in groups when possible, given nesting material and shelters, kept on a 12 h day/night cycle with food and water ad libitum, and breeding was done in harems. Animal was biopsied at weaning, genotyped (as positive of negative) by the method recommended by the MMHCC, and received abdominal palpations 2-3 times weekly from weaning. Upon the presence of a palpable tumor the animal was randomised to treatment (10058-F4, 25 mg/kg i.p. daily for the first 14 days, thereafter three times weekly) or no treatment (controls). All animals were followed closely for signs of toxicity or tumor-related sign of discomfort. The animals were sacrificed when tumor progression warranted it and/or the animal showed a decreased general health. The transgenic study was evaluated in two parallel settings to avoid missing potential treatment effects. Setting A constituted the treated group compared to a control group three times larger, whilst in setting B a time-matched control was selected out of the setting A group for each treated animal with the criteria that the time from birth until tumor take deviated maximally ±3 days. The experiment was evaluated based on the time from birth until tumor development, time from birth until sacrifice, and time from tumor development until sacrifice (i.e. the number of days spent in treatment). Animal studies were done with permission from the relevant Animal Ethical Board and in accordance with national regulations. 7.3 STATISTICAL ANALYSIS In Paper I all statistics were calculated in the Statistica 5.1 Software, whilst in Paper I-IV the PCNONLIN version 2.0 and GraphPad Prism was used. In Paper I all statistical differences were tested using the Mann-Whitney U-test. In Paper II the EC50 calculations were done as described elsewhere (Baryawno et al., 2008). For analysing differences between two or more independent

45

groups the Mann–Whitney U-test and the Kruskal–Wallis test (non-parametric ANOVA) followed by Dunn’s multiple comparison tests were used. All statistical tests were two-sided. Testing for synergistic or additive effects of combination therapy the data was done as described previously (Ponthan et al., 2007). In Paper III and IV, tumor growth (weights, volume and volume index) was analysed with the Mann-Whitney test. Survival curves were tested with Log-rank (Mantle-Cox) test and analysis of the number of animals that achieved tumor growth delay was done with Fishers Exact test.

46

8 RESULTS AND DISCUSSION 8.1 PAPER I 8.1.1 Description of the study This paper describes the use of bevacizumab as single therapy in three xenograft models with different characteristics. The cell lines chosen for xenografting comprised a 1p deleted, SK-N-AS; a combined 1p deleted and MYCN-amplified, IMR-32; and a poorly differentiated cell line established from a bone marrow metastasis with a 1q trisomy, SH-SY5Y (information from American Type Culture Collection, accessed October 2009). When xenografted onto nude mice, all three cell lines have previously been shown to express circulating VEGF-A and its reciprocal receptor VEGFR-2 in both the tumor and endothelial compartment (Backman and Christofferson, 2005). 8.1.2 Results The fluorescent microculture cytotoxicity assay (FMCA) showed that bevacizumab was not cytotoxic to either neuroblastoma cells or to bovine capillary endothelial cells. Neuroblastoma cells were xenografted onto nude mice and upon the establishment of a tumor (0.3 mL) the animals were randomised to treatment (bevacizumab, 5 mg/kg i.p., twice weekly) or controls (saline). The tumor volume was significantly reduced in all groups treated with bevacizumab and the difference between controls and treated became significant at day 8-12, with a T/C value around 0.6 for all three cell lines investigated. Also, the tumor weight at sacrifice was significantly reduced and treatment also gave rise to a delayed tumor progression for SK-N-AS and IMR-32 (6 or 31 days respectively, tumor delay not investigated in SH-SY5Y). Upon excision, tumors from animals treated with bevacizumab appeared flatter, discoid, paler and firmer than controls, which were spherical, soft and both hemorrhagic and necrotic upon macroscopical examination. Bevacizumab was well tolerated in both the short and long-term treatment and no toxicity was observed. Mice without tumors were treated with bevacizumab and compared to naïve untreated mice, without exhibiting signs of toxicity. Stereological quantification of angiogenic parameters in the tumors showed a variable and inconsistent pattern of changes, the most consistent and significant being the reduction in the SH-SY5Y cell line. Also, quantification of the tumor dynamics showed an inconsistent pattern of viable, proliferating and apoptotic tissues. What was commonly noted was the frequent appearance of perivascular cuffs, sleeve-like arrangements of viable cells surrounding a vessel. In these cuffs, proliferating cells was found close to the central vessel whilst apoptotic cells were found in the perimeter. Measuring the levels of circulating VEGF-A in serum, a significant increase was noted in all cell lines after treatment with bevacizumab. This increase was

47

between 145-530% compared to the controls and in the case of the prolonged treatment of SK-N-AS or IMR-32 tumors, it increased further. 8.1.3 Discussion In neuroblastoma, the VEGF/VEGFR autocrine loop has been shown to be able to sustain survival under hypoxic conditions (Das et al., 2005). In our study, bevacizumab was not cytotoxic to neuroblastoma cells in vitro, but these experiments were performed under normoxic conditions. It is possible that the effects of bevacizumab on neuroblastoma cells would have been more profound under hypoxic conditions, as the cells then would have to rely more on the HIF1α-induced autocrine loop of expressed VEGF to survive. In addition, a weakness in this study is that we have not made attempts to address whether the tumor cells are able to survive and propagate upon stimulation of murine VEGF. There is substantial sequence homology between the human and murine VEGF-A and bevacizumab bind exclusively human VEGF-A (Ferrara et al., 2005a). There are studies showing that the amount of murine stromal recruitment to the xenografted tumor cells, an inherent property of different tumor cell lines, is inversely correlated to bevacizumab efficacy (i.e. stromal rich tumors respond less efficient) (Crawford et al., 2009) and this has not been evaluated in our study. There are also studies in neuroblastoma xenografts comparing bevacizumab with the VEGF-Trap (Aflibercept®, Regeneron), a decoy receptor composed of segments from VEGFR 1 and 2 (Kim et al., 2002). The VEGF-Trap binds both murine and human VEGF-A and also all isoforms of human VEGF-A, and the authors speculate that both the improved circulation time and the dual murine and human VEGF-A targeting might be responsible for the increased efficacy observed (Kim et al., 2002). Although, bevacizumab apparently was effective in vivo on these three xenografted cell lines as both tumor volumes and tumor weight was reduced and the tumor growth delayed, it is difficult to elucidate and conclude the mechanism of action. The dissimilar patterns of tumor dynamics and angiogenic parameters between the different cell lines are hard to interpret and possibly additional methods could bring some clarity. An intriguing explanation put forward is that treatment with bevacizumab could induce normalisation of vessels. This hypothesis suggests that as excessive VEGF signalling in tumors results in abnormal vessels and patterning, inhibiting and decreasing the expression might prune and remodel the vasculature and return it to its normal state (Jain, 2005). For bevacizumab this has proven to be true, and leads to improved blood flow, decreased interstitial pressure and improved oxygenation; all factors leading to improved delivery of chemotherapy and increased chemo- and radio-sensitivity (Heath et al., 2009). Bevacizumab can thus be thought of acting in two reciprocal and complementary settings. Firstly, it could inhibit tumor growth by inhibiting the neovascularisation of hypoxic tissues in the small tumor or metastasis, but not affect the normal, maturated vessels that no longer rely on VEGF signalling. In the second setting of a large and established hypoxic tumor with abnormal vascularisation, bevacizumab could normalise and improve delivery of other agents but not eradicate the existing vasculature.

48

This normalization has been shown in preclinical models after treatment with bevacizumab, improved the drug delivery and was time dependent (Dickson et al., 2007), so for clinical use it is important to optimize the delivery schedule to benefit from it (Heath and Bicknell, 2009). Reduction of circulating endothelial and endothelial progenitor cells has been observed when using bevacizumab in the clinic, but the significance of this remains to be clarified (Heath and Bicknell, 2009). The appearance of perivascular cuffs and the differential patterning of cells staining positive for proliferation and apoptosis are consistent with the hypothesis that nutrient and oxygen necessary for proliferation is found in vicinity of the vessel and, and as the tissue grows beyond the diffusible capacity the cells distant from the vessel dies. The rise in serum VEGF-A levels during treatment is also an interesting finding and has been reported by others (Sims et al., 2008). This has been reported to occur also in patients upon treatment and is thought to arise from increased VEGF production (as the tumors get increasingly hypoxic by prolonged treatment), increased distribution and decreased clearance (as VEGF-Bevacizumab complexes are formed) (Shih et al., 2006). There are also reports of bevacizumab being without activity in a preclinical model of neuroblastoma, both alone and in combination with the epidermal growth factor receptor inhibitor erlotinib (Beaudry et al., 2008). The use of bevacizumab as a single agent in this study is not optimal and should be complemented by combining it with chemotherapeutic agents used in the clinical management of neuroblastoma (ironotecan, vincristine, cisplatin, and etcetera). This will most likely increase the efficacy, as observed by others (Crawford and Ferrara, 2009) and as this is how it has been approved for clinical use. To advance these agents into the clinic, there are concerns about establishing anti-angiogenic biomarkers to assess treatment efficacy (Jain et al., 2009). The ability to evaluate a possible beneficial effect, or lack thereof, is of great importance both in the integration of these agents into current treatment protocols and to judge if a specific patient is responding or not. Response of solid tumors are usually based on changes in actual tumor sizes, and as anti-angiogenic agents are not cytotoxic, rather cytostatic, and target the stromal compartment over the tumor compartment, it is unlikely that they will primarily generate tumor shrinkage but rather disease and tumor volume stabilisation (Jain et al., 2009). In addition, tumors might change over time and in response to treatment and the difficulty of repeated biopsies further highlight the need of non-invasive imaging techniques that can assess the tumor dynamics and to weight this together with other markers to a composite biomarker (Jain et al., 2009). Also an array of different biomarkers might have to be developed and evaluated in concert; prognostic markers to assess a patients overall outcome regardless of treatment, predictive markers to select patients likely to respond and direct biological, surrogate and/or pharmacokinetic markers to evaluate the ogoing treatment (Jain et al., 2009).

49

There have been a long standing consensus that as anti-angiogenic therapies target the genetically stable endothelium the problem of developing resistance should be non-existing, but the clinical experience has shown that the anti-angiogenic effects are rather transient and that biomarkers of resistance or loss of efficacy is also wanted (Jain et al., 2009). Bevacizumab has been tested in the pediatric oncology population in small scale, but there are concerns about specific pediatric short and long-term toxicity. To my knowledge, two studies have been published on the compassionate use of bevacizumab in children and young adults with solid tumors. These included a total of 4 neuroblastomas, resulting in one partial response (Benesch et al., 2008) and no objective responses (Glade Bender et al., 2008). These studies also addressed the issues of pharmacokinetics and side-effects in children, with the conclusion that bevacizumab was well tolerated and without detectable bone growth perturbation (Benesch et al., 2008; Glade Bender et al., 2008). Bevacizumab has been tried in other pediatric malignancies such as recurrent low-grade glioma, with reported seven objective responses of which one was a complete, three partial and three minor, with the majority having durable responses (Packer et al., 2009). There are currently two studies (one actively recruiting and one to be opened) including patients with recurrent/refractory/relapsed neuroblastoma on combination treatment of bevacizumab with cyclophosphamide, zoledronic acid and an anti-GD2 antibody (www.clinicaltrials.gov, keyword bevacizumab and neuroblastoma, accessed October 2009). In conclusion, bevacizumab as a single therapy showed efficacy in three models of neuroblastoma in vivo and considering the clinical availability and the rather well tolerated toxicity profile, it is an option to consider in neuroblastoma therapy.

50

8.2 PAPER II 8.2.1 Description of the study This study evaluates the efficacy of the mTOR inhibitor Rapamycin (Sirolimus, Rapamune®, Wyeth) on neuroblastoma in vitro and in vivo, and compare it to its novel analogue CCI-779 (Temsirolimus, Torisel®, Wyeth). The study also focuses on the effects of mTOR inhibition on down- and up-stream signalling events in neuroblastoma in vitro and in vivo. Cell lines used in vitro was the previously described SH-SY5Y, IMR-32, and SK-N-AS together with; SK-N-BE(2), established from a disseminated disease at relapse, with a MYCN-amplification and p53 mutation; SK-N-FI, established from a metastasis of a poorly differentiated neuroblastoma and with an MDR phenotype; SK-N-SH, established as a sub-line of the SK-N-MC cell line; and SK-N-DZ, derived from a bone marrow metastasis of a poorly differentiated neuroblastoma (information from American Type Culture Collection, accessed October 2009). Of these cell lines, three are MYCN-amplified and express high levels of the protein (IMR-32; SK-N-BE(2), SK-N-DZ), three are not amplified but express MYCN (SK-N-AS, SK-N-FI, SK-N-SH) and one are neither amplified and with low MYCN expression (SH-SY5Y). To study the different drugs under different levels of MYCN expression, the Tet21N cell line was used, where the non-amplified neuroblastoma SH-EP cell line has a stable construct inserted with MYCN-expression regulated by tetracycline (Lutz et al., 1996). The SH-SY5Y cell line was used as xenografts in vivo. 8.2.2 Results Immunohistochemical staining of a panel of 30 primary neuroblastomas representing different clinical (age, sex and stage), biological (MYCN amplification, 1p deletion, DNA ploidy) subsets stained positive for phosphorylated Akt serine 473 and mTOR serine 2448. In addition, four ganglioneuromas showed staining of phosphorylated Akt and mTOR in the tumor derived ganglia but not in the surrounding stroma, whereas non-malignant adrenals from children showed weak staining in the cortex but not in the medulla. Investigation of the effect of rapamycin or CCI-779 in vitro on seven neuroblastoma cell lines with different MYCN status, showed that both rapamycin and CCI-779 was dose-dependently cytotoxic with a biological EC50 in the low µM range (range 9-19 µM), and that the MYCN-amplified cell lines was significantly more sensitive against either rapamycin or CCI-779. Also, the Tet21N cell line with tetracycline-regulated MYCN expression was significantly more sensitive towards rapamycin or CCI-779 when MYCN was on than when MYCN was off. A clonogenic assay further supported the anti-proliferative effects of rapamycin or CCI-779 on neuroblastoma cells in vitro, as the clonogenic capacity was significantly reduced in a dose-dependent fashion. Cell cycle analysis by DAPI staining and FACS showed a pronounced accumulation of cells with a hypo-diploid DNA content (sub-G1 fraction, i.e. apoptotic) SH-SY5Y cells over 24-96 hours of treatment with rapamycin, whilst rapamycin only seem to modestly increase the fraction of sub-G1 SK-N-AS

51

cells. Treatment with CCI-779 increased the sub-G1 fraction in both cell lines. In SK-N-AS cell treatment with rapamycin induced a transient G1 block, whilst treatment with CCI-779 in both cell lines seemed to accumulate cells in S or G2 phase. Western blot of SH-SY5Y or SK-N-AS cells treated with either rapamycin or CCI-779 showed cleavage and activation of caspase-3 and poly(ADP)-ribose polymerase (PARP) in the apoptotic cascade. In an attempt to increase the efficacy by dual targeting in the same pathway, neuroblastoma cells were treated in vitro with a combination of either of the mTOR inhibitor rapamycin or CCI-779 together with the PI3K inhibitor LY294002, resulting in a synergistic or additive effect. In vivo, established (0.2 mL) SH-SY5Y xenografts in nude mice were randomised to receive either no treatment (Ctrl, n=9), rapamycin (5 mg/kg i.p., n=9) or CCI-779 (20 mg/kg i.p., n=8) daily for 12 consecutive days. The tumor growth was significantly decreased after 3 days of treatment with rapamycin and 4 days with CCI-779, compared to untreated controls. At sacrifice, tumors treated with rapamycin or CCI-779 were reduced by 56 or 71%, respectively, compared to untreated controls. Staining of tumor tissues and stereological quantification showed significant reductions in the proliferation marker Ki67, increased activation of the apoptotic marker caspase-3, and decreased microvessel density as assessed by the endothelial marker BS1. In vitro, treatment with either rapamycin or CCI-779 reduced the secretion of VEGF-A. To confirm target inhibition, western blotting of SH-SY5Y or SK-N-AS cells treated with rapamycin or CCI-779 showed reduced phosphorylation of the mTOR downstream targets p70S6K at threonine 389 and 4E-BP1 at serine 65. Furthermore, treatment of SH-SY5Y, SK-N-AS or IMR-32 cells with rapamycin or CCI-779 showed reduced mTOR serine 2448 phosphorylation, whilst the phosphorylation of Akt on serine 473 increased. Immunohistochemical staining of tumor tissue from the in vivo experiment also showed increased Akt serine 473 phosphorylation and reduced mTOR phosphorylation at serine 2448. It also confirmed target inhibition, as the threonine 389 phosphorylation of p70S6K was reduced upon treatment with rapamycin or CCI-779. Western blot analysis of cells treated in vitro showed that treatment with rapamycin or CCI-779 phosphorylated GSK3β at serine 9. There were also a down regulation of the expression of MYCN and cyclin D1 in upon rapamycin or CCI-779 treatment. This down regulation of MYCN and cyclin D1 was also present in vivo in xenografts treated with rapamycin or CCI-779. 8.2.3 Discussion In this study we observed immunoreactivity of phosphorylated Akt serine 473 and mTOR serine 2448 in all primary neuroblastoma samples investigated, irrespectively of biological or clinical characteristics. Activated Akt has also been observed by others and it has been found to be correlated to other

52

prognostic markers that can be used as an independent prognostic marker of poor prognosis (Opel et al., 2007). A recent paper performing a meta-analysis of a large merged neuroblastoma mRNA microarray data set found several genes to be deregulated, but Akt was not mentioned among them (De Preter et al., 2009). In our study the available biobank of material is somewhat limited, compared to the 116 in the tissue microarray mentioned previously, and a more extensive analysis is perhaps warranted, and also to include the threonine 308 phosphorylation of Akt. The presence of activated mTOR phosphorylated on serine 2448 has to our knowledge not previously been reported in neuroblastoma and should be investigated in other banks of clinical material. Additionally, the autophosphorylation of mTOR on serine 2481 should be investigated. Neuroblastoma has been shown to over express, be dependent on and be prognostically correlated to several signalling pathways (Trk, EGF, VEGF, IGF, PDGF) that relay their signals through the PI3K/Akt hub, and it can be concluded that this pathway is activated and presents as an interesting therapeutical target in neuroblastoma (Opel et al., 2007; Sartelet et al., 2008). Rapamycin or its analogue CCI-779 proved to be cytotoxic to a panel of neuroblastoma cell lines in vitro, with EC50 values in the 10-20 µM range. The antiproliferative effect of rapamycin in vitro on a vide range of cancer cell lines is beyond the scope of this work, but the activity of rapamycin on neuroblastoma in vitro has been reported by others (Coulter et al., 2008; De Preter et al., 2009; Guerreiro et al., 2006; Houghton et al., 2008a; Marimpietri et al., 2007; Misawa et al., 2003). The effects of CCI-779 had not previously been described, but since then there are reports (Coulter et al., 2008). Cell cycle analysis of SH-SY5Y cells treated with rapamycin showed a pronounced accumulation of cells with sub-G1 DNA-content and western blotting revealed activation of caspase-3 and PARP, suggesting that the cells underwent apoptosis. On the other hand, the SK-N-AS cells showed only a minor increase of sub-G1 cells upon rapamycin treatment, but still we observed activation of caspase-3 and PARP. A potential explanation for this discrepancy might lie in the process of autophagy. Autophagy, the formation of membrane-bound vesicles destined to lysosomes for degradation, is found to act in concert with apoptosis and one of the key players in regulating this process, through its role in sensing the energy-status of the cell, is mTOR (Easton et al., 2006). Whilst mTOR is activated autophagy is inhibited, but when entering a low cellular energy-status, the AMP/ATP ratio increases and activates AMPK which in turn induces autophagy by stimulating the TSC1/2 (Eisenberg-Lerner et al., 2009). Autophagy has been described in the murine neuroblastoma cell line N2a where differentiation with retinoic acid treatment increased autophagy and inhibitors of autophagy (the pan-PI3K inhibitor LY294002) was associated with decreased neuronal differentiation, and mTOR inhibition (by rapamycin) also impaired neuronal differentiation (Zeng et al., 2008). The role of autophagy and its balance against apoptosis in neuroblastoma during treatment with rapamycin or its analogues and the connection to neuronal differentiation should be more clearly investigated.

53

In contrast, treatment with CCI-779 increased the sub-G1 fraction in both cell lines, concomitant with activation of caspase-3 and PARP. In the SK-N-AS cell line treated with rapamycin we observed a transient G1 arrest at 24 hours. Others report predominately G1 arrest after incubation with rapamycin. A reason to why we observe only a transient G1 arrest and large sub-G1 fraction might lie in the doses, the 16 µM used is above the EC50 values for both SK-N-AS and SH-SY5Y (12.8 and 10.5 µM, respectively) and thus the cells rather go through to apoptosis or autophagy than become arrested. Treating with CCI-779 predominately accumulated cells in the S/G2 phase of the cell cycle, and we currently do not know the reason to this. Attempting to increase the efficacy by vertical targeting both PI3K and mTOR, a combination of rapamycin or CCI-779 with LY294002 was tested. In SK-N-BE(2) we observed overall synergistic effects, whilst in the SK-N-AS cell line we observed synergistic effects at lower concentrations (i.e. under the EC50) and additive effects at higher concentrations. Since then it has become increasingly clear that LY294002 apart from being a pan-selective PI3K inhibitor is also an inhibitor of mTOR (Foster and Toschi, 2009). Therefore, it is difficult to dissect apart if this synergistic and/or additive effect is due to more efficient mTOR inhibition, dual PI3K/mTOR effects, or by targeting some other related kinase. In vivo, both rapamycin and, to a greater but not significant degree, CCI-779 inhibited the growth of established xenografts. The difference in efficacy could be due to the fact that the rapalogue CCI-779 is either more efficient in targeting mTOR or have better pharmacological properties (the initial reason for modifying rapamycin) or it is a combination of both factors. CCI-779 is given in a higher dose than rapamycin (20 mg/kg versus 5 mg/kg) and these doses were selected based on previously reported in vivo dosing. The in vivo experiments could be improved by a proper pharmacokinetic investigation of both the levels of circulating drug, and the levels of drug in different compartments (i.e. in the tumor tissue). Also, ideally the route of administration should be investigated as other ways of delivering the drugs most definitely affects the pharmacokinetics. Follow-up by assessing the target inhibition by the phosphorylation status of downstream effectors was done. The phosphorylation status of Akt, mTOR and p70S6K was investigated by immunohistochemistry in the tumor tissue. Upon treatment, Akt increased its phosphorylation at serine 473, but the phosphorylation of the target mTOR serine 2448 and the downstream effector p70S6K threonine 389 was reduced. This is consistent with a model where inhibiting mTOR results in a feedback loop and Akt is activated, and has been observed previously (Liu et al., 2009). Upon treatment in vivo, at sacrifice we also observed a reduction on the amount of proliferating cells and an increase in the amount of apoptotic cells, compared to untreated controls. The treated animals also had a reduction in the vessel density. This anti-angiogenic effect of rapamycin or CCI-779 treatment can be explained trough VEGF-A. As described previously, upon hypoxia tumor cells increase their VEGF-A production and secretion to stimulate and attract in-growth of vessels to support the growing tissue. Rapamycin, and the rapalogues, are thought to decrease VEGF-A expression

54

by inhibiting the mTORC1 dependent translation of the VEGF-A stimulator and hypoxia sensor HIF1α (Liu et al., 2009). There are reports of rapamycin being able to inhibit the VEGF-A response in neuroblastoma cells in vitro (Beppu et al., 2005; Kurmasheva et al., 2007; Nakamura et al., 2006) and in vivo (Marimpietri et al., 2007), and rapamycin and the rapalogues have shown such capacity in several other cancers both in vitro and in vivo (Liu et al., 2009). in vitro we observed a reduction of VEGF-A upon treatment with either rapamycin or CCI-779. In vivo, it is not clear weather the reduced proliferation and increased apoptosis is an effect of the drug acting directly on the cells or via decreased vascularisation, most likely it is a combination of both and some additional work could be done to clarify this. Upon treatment in vitro we could also confirm target inhibition by the observed reduction in phosphorylation of p70S6K and 4E-BP1 and mTOR whilst we saw an up regulation of Akt phosphorylation, identical with what we observed in vivo and as reported by others (Engelman, 2009; Liu et al., 2009; Sun et al., 2005). We could also observe an up regulation of the phosphorylation of GSK3β, a target of Akt. When Akt becomes phosphorylated and activated it phosphorylates GSK3β on serine 9, thereby negatively regulating and inhibiting its ability to inhibit downstream targets (Kockeritz et al., 2006). This was observed simultaneously with a decrease in the levels of the cell cycle regulator cyclin D1 and the transcription factor MYCN in vitro and in vivo. Both cyclin D1 and MYCN are previously described targets of GSK3β (Kenney et al., 2004). Down regulation of MYCN after using inhibitors of PI3K and mTOR has been observed by others. In vitro treatment with rapamycin on glioma showed down regulation of both c-myc an cyclin D1 mRNA (Gera et al., 2004). In vitro treatment of neuroblastoma cell lines with rapamycin, CCI-779, a monoclonal antibody against IGFR, or a combination resulted in decreased MYCN protein levels and increased MYCN phosphorylation (Coulter et al., 2009). Inhibiting PI3K with the pan-selective LY294002 resulted in decreased MYCN levels in vitro and in vivo in the MYCN driven transgenic model of neuroblastoma, an effect observed to act through protein stabilization as mRNA levels of MYCN was unchanged and it was thought to occur via GSK3β (Chesler et al., 2006). Also, treatment of neuroblastoma cells in vitro with the nucleoside analogue ARC that act as a global inhibitor of transcription gave rise to a reduction in the MYCN protein levels concomitant with decreased Akt and GKS3β phosphorylation (Radhakrishnan et al., 2008). In the absence of growth signals, GSK3β is unphosphorylated and exerts a negative regulation on both Myc and cyclin D1, by phosphorylating and target them for proteasomal degradation (Kockeritz et al., 2006). In our material we observe an up regulation of the phosphorylation of Akt and GSK3β and thus MYCN and cyclin D1 should be stabilised as GSK3β is inhibited, but in the contrary we observe that MYCN and cyclin D1 protein is down regulated whilst mRNA levels are unchanged. It is a weakness of this study not to have investigated both the phosphorylation status of MYCN and the possible mechanisms for this, for example the effects of mTOR inhibition on the ERK pathway. Possible this could have further elucidated if the observed down regulation of MYCN and cyclin D1 protein occurs through a GSK3β dependent mechanism or not.

55

Also, there are studies where the PI3K inhibitor wortmannin and LY294002 was shown to be able to down regulate MYCN protein expression in IGF-stimulated neuroblastoma cells while rapamycin was not (Misawa et al., 2003). It might also be of interest to study the mTOR inhibitors in combination with inhibitors of proteasomal activity (for instance Bortezomib) to see what happens with the MYCN levels. Rapamycin or CCI-779 in vitro was more effective (lower EC50) in neuroblastoma cell lines with MYCN amplification, and these mTOR inhibitors were also studied in neuroblastoma cells with tetracycline-regulated MYCN expression and displayed increased sensitivity as MYCN was on. Clearly, the MYCN regulatory capacity of inhibitors of the PI3K/Akt/mTOR pathway needs to be more closely studied. There are two clinical studies with CCI-779 recruiting neuroblastoma patients (www.clinicaltrials.gov, keyword neuroblastoma and Temsirolimus, accessed October 2009). One study of biomarkers in relapsed/refractory pediatric solid tumors has been terminated due to lack of effect. In the other study, adding CCI-779 to the existing protocol of chemotherapy to treat children with advanced stage high-risk neuroblastoma, the recruitment has been temporarily suspended. In addition, there are several studies testing rapamycin, CCI-779 and RAD-001 (keywords Sirolimus, Temsirolimus, Everolimus, child, pediatric and cancer) for children with cancer, and also for its immunosuppressant activities, so there is a build-up of knowledge on how to clinically use these new drugs in the pediatric area. In conclusion, the PI3K/Akt and mTOR pathway signalling seems to be activated in neuroblastoma and inhibitors of mTOR appear to have efficacy in vitro and in vivo. This warrants further investigation of the effect of these agents in neuroblastoma, especially with a focus on MYCN.

56

8.3 PAPER III 8.3.1 Description of the study This study evaluates the effect of the PDK1 inhibitor OSU03012 (AR12, Arno Therapeutics) or the dual PI3K/mTOR inhibitor PI103 in neuroblastoma in vitro and in vivo. The study make use of the previously descried cell lines SH-SY5Y, SK-N-AS, SK-N-BE(2), IMR-32, and the Tet21N cell line with tetracycline-regulated MYCN expression in vitro. SK-N-BE(2) cells were used as xenografts in vivo. 8.3.2 Results Immunohistochemical staining of primary neuroblastomas detected phosphorylated PDK1 serine 241, expression of the catalytic p110α PI3K subunit, and phosphorylation of the regulatory p85α tyrosine 458 (and the p55 tyrosine 199 splice variant of p85) in the cytoplasm of tumor cells. Upon treatment with either OSU03012 or PI103 western blot revealed inhibition of downstream signalling as PDK1 phosphorylation at serine 241 was reduced, most drastically after OSU03012 treatment of SH-SY5Y, concomitant with decreased Akt phosphorylation at serine 473 and threonine 308. Treatment with PI103 did not appear to affect the levels of p110α or the phosphorylation status of p85α/p55 in the MYCN-amplified SK-N-BE(2) cell line, whilst in SH-SY5Y it resulted in increased levels of p110α and drastically reduced the phosphorylation of p85α/p55. Both OSU03012 and PI103 reduced the phosphorylation of GSK3β in both cell lines. The in vitro growth inhibitory effect of OSU03012 or PI103 was evaluated in four neuroblastoma cell lines over 24, 24 or 72 hours. Both compounds induced a time- and dose-dependent growth inhibition with EC50 values in the low µM range, but whilst OSU03012 ablated survival around 8 µM the treatment effect of PI103 seemed to flatten out at 2 µM and increased drug concentrations did not lead to further decreased survival. In regard of their lower EC50 values, the MYCN-amplified cell lines seemed more sensitive against OSU03012 or PI103. This was further tested in the Tet21N cell line with tetracycline-regulated MYCN expression showed that the cells were more sensitive against OSU03012 when MYCN was on compared to when MYCN was off. The same effect, but to a lesser extent was observed when these cells were treated with PI103. Analysis of the cell cycle distribution of neuroblastoma cells after incubation with PDK1 or PI3K/mTOR inhibitors showed a pronounced S phase arrest after treatment with OSU03012, whereas treatment with PI103 resulted in a G1 arrest. Whilst treatment with OSU03012 resulted in the accumulation of sub-G1 cells with hypodiploid DNA content (i.e. apoptotic cells), only a minor increase in the amount of sub-G1 cells were observed after treatment with PI103. In concordance with the previous observation, analysis of the mitochondrial membrane potential showed that depolarisation occurred only after treatment with OSU03012, and not with PI103. Western blotting of proteins in the apoptotic cascade after treatment with OSU03012 showed cleavage of caspase-9, PARP and somewhat of caspase-7

57

but not of caspase-3, where no activation of these proteins was observed after treatment with PI103. In vitro treatment with OSU03012 or PI103 of the MYCN-amplified cell lines SK-N-BE(2) or IMR-32 resulted in down regulation of the G1/S transition regulator cyclin D1 and also to reduce the levels of MYCN. In vivo, animals with established (0.2 mL) tumors were randomised to receive either no treatment (Ctrl), OSU03012 (100 mg/kg p.o.) or PI103 (10 mg/kg i.p.) for 10 consecutive days. Both the tumor volume and the tumor weight of animals treated with either OSU03012 or PI103 was significantly reduced compared to untreated controls. The tumor growth was also delayed in animals treated with OSU03012 or PI103 as both the time and the number of animals that did not two-, four-, or six-double their tumor volume was significantly delayed and decreased, respectively. Both treatment with OSU03012 and PI103 was associated with some toxicity. 8.3.3 Discussion In primary neuroblastoma tumors, immunohistochemical staining showed activation of PDK1, the presence of the PI3K p110α catalytic subunit and activation of the regulatory p85α subunit. An articel investigating the PI3K expression in neuroblastoma observed increased mRNA expression of the catalytic p110δ/p85α heterodimer in primary material, and that the expression of this PI3K isoform pair could be correlated to favourable prognostic characteristics (Boller et al., 2008). In this paper the mRNA expression of p110α and p110β was unchanged in the clinical material, but down regulation of either p110α or δ resulted in decreased growth in vitro (Boller et al., 2008). Using the PDK1 inhibitor OSU03012 we observed reduced PDK1 phosphorylation, as might be expected. Treatment with the dual PI3K/mTOR inhibitor PI103 increased the levels of the catalytic p110α subunit but decreased the phosphorylation of the regulatory p85α subunit in the SH-SY5Y cell line, but levels remained unchanged in the amplified SK-N-BE(2) cell line. The unchanged levels of the catalytic p110α subunit are in concordance with what others have observed previously (Fan et al., 2006). Treatment with either OSU03012 or PI103 resulted in a reduction of the phosphorylation on serine 473 and threonine 308 on Akt and decreased phosphorylation of GSK3β, which also has been observed by others previously (Knight et al., 2006; Raynaud et al., 2007; Sargeant et al., 2007; Zhu et al., 2004). This study could also benefit by the addition of blots showing the full length proteins to clarify whether the observed reductions are solely in the phosphorylation status of the proteins and not in the overall amount of the protein. The in vitro growth inhibitory effect that we observed has been described for both compounds in several different forms of cancer previously. It was interesting to observe that whilst OSU03012 progressively by dose and time finally nearly ablated cell survival, the curves for PI103 seemed to flatten out. This led us to the hypothesis that whilst OSU03012 is cytotoxic to cells, PI103

58

have more of a cytostatic effect. These data was also in concordance with blotting of proteins in the apoptotic cascade, where treatment with OSU03012 resulted in activation of caspases and PARP while PI103 did not. Also the data on the cell cycle analysis supports this hypothesis, since treatment with OSU03012 resulted in an increase in the fraction of apoptotic sub-G1 cells, PI103 treatment resulted in a dominating G1 arrest and only minor amounts of apoptotic sub-G1 cells. A G1 arrest without large amounts of apoptotic cells has been observed with PI103 treatment by others previously in other cancers (Fan et al., 2007; Fan et al., 2006; Kojima et al., 2008) whereas in some lines there is a combination of an arrest an apoptosis (Chaisuparat et al., 2008). Parts of the reported apoptotic effects of OSU03012 might be through the generation of reactive oxygen species, as it has been shown to induce autophagy in hepatocellular carcinoma (Gao et al., 2008). We also tested both OSU03012 and PI103 in vivo in a MYCN-amplified xenograft model of neuroblastoma and saw a good effect, where both compounds reduced the tumor volume and weight after 10 days of treatment together with a tumor growth delay. The ability of these compounds to inhibit the growth of this cell line in vivo is impressive as this is a very fast growing MYCN-amplified and p53 mutated model. Treatment with PI103 and OSU03012 at the indicated doses was associated with some toxicity. The in vivo experiment warrants further investigation of in vivo target inhibition and assessing downstream signalling, by investigating the phosphorylation status of for example Akt. Analysis of the tumor dynamics (proliferation, apoptosis, angiogenesis, and etcetera) should further illuminate the mechanism of action in vivo. Also, a proper pharmacokinetic study could be undertaken to investigate if modifying the dosing or administration could improve drug efficacy. With the PDK1 inhibitor OSU03012 and the dual PI3K/mTOR inhibitor PI103 we also observed that MYCN-amplified cell lines appeared more sensitive and that a neuroblastoma cell line with a tetracycline-regulated MYCN expression was more sensitive when MYCN was on, especially for OSU03012. As with the mTOR inhibitors we also noted that MYCN and cyclin D1 was down regulated upon treatment. As described previously this can occur through a mechanism involving GSK3β, where Akt phosphorylate and inhibit GKS3β. We did observe both decreased Akt and GSK3β phosphorylation upon treatment, indicating that GKS3β is active to phosphorylate and target both MYCN and cyclin D1 for proteasomal degradation. To improve this study, the phosphorylation status of MYCN on both the serine 62 and the threonine 58 should be investigated and also the activity status of the ERK pathway upon PDK1 or PI3K/mTOR inhibition, as the initial phosphorylation of MYCN to be targeted by GSK3β is done by ERK (Junttila and Westermarck, 2008). In the normal developing nervous system the regulation of MYCN is important for the expansion of neuronal precursor cells (NPCs) trough the sonic hedgehog (Shh) signalling pathway (Knoepfler et al., 2006). Deregulation of molecules in the Shh pathway have been shown to be linked to medulloblastoma (Toftgard, 2000), a neuroectodermal brain tumor of

59

childhood. It is believed that in NPCs during development MYCN is a critical mediator of proliferation and survival through the Shh pathway, signalling through the PI3K/Akt hub (Knoepfler and Kenney, 2006). It has also been shown that IGF signalling is vital for NPCs (Kenney et al., 2004). Disruption of the Shh pathway potentially leads to premature cell cycle exit, differentiation and failure of the neuronal development whilst abnormal activation potentially leads to neoplastic growth (Knoepfler and Kenney, 2006). A model is proposed in where MYCN is expressed as a target of Shh signalling simultaneous with IGF signalling through RTKs that activates PI3K and Akt (Knoepfler and Kenney, 2006). In this model, PI3K/Akt activation by IGF and the subsequent inhibited GSK3β stabilise MYCN and cyclin D1 protein (Knoepfler and Kenney, 2006). Currently there is one study recruiting adult patients with advanced or recurrent solid tumors or lymphomas to treatment with OSU03012 (www.clinicaltrials.gov, keyword AR12, accessed October 2009) but no studies are registered on PI103. Targeting PDK1, the PI3K family and mTOR presents an interesting rationale in cancer and as many of the developed inhibitors show promising activity it should not be forgotten that the toxicity with these types of drugs can be extensive, especially for the pan-selective inhibitors (Workman et al., 2006). Taken together, these data indicate that the PDK1 inhibitor OSU03012 and the dual PI3K/mTOR inhibitor PI103 show interesting efficacy in vitro and in vivo in neuroblastoma and warrants further preclinical investigation.

60

8.4 PAPER IV 8.4.1 Description of the study This study evaluates the effect of the Myc-Max disruptor 10058-F4 on the MYCN-amplified SK-N-BE(2) neuroblastoma cells previously described, in vitro and in vivo. 10058-F4 was evaluated in vivo both in a xenograft model using the SK-N-BE(2) cells and also on the transgenic MYCN-driven spontaneous mouse model of neuroblastoma. 8.4.2 Results The Myc-Max disruptor 10058-F4 decreased the survival and the clonogenic capacity of the MYCN-amplified and p53 mutated SK-N-BE(2) cell line in vitro. The cytotoxic effect was dose-dependent and 10058-F4 abrogated both the survival and the ability to form clones in soft agar at doses between 25-50 µM. In vivo, animals carrying established (0.2 mL) tumors were randomised to receive either no treatment (Ctrl) or 10058-F4 (25 mg/kg i.p.) for 10 consecutive days. 10058-F4 showed limited activity in this model, as neither the tumor volume nor the tumor weight was significantly reduced compared to controls at sacrifice. The tumor growth delay can be measured by the time from randomisation until the tumor two-, four-, or six-doubles its volume, i.e. when the animal has a tumor volume index (TVI) of TVI>2, TVI>4 or TVI>6. Also, the number of animals in each group that reaches TVI>2, TVI>4 of TVI>6 was investigated. Upon analysis of the tumor growth delay, there was a significant delay for tumors treated with 10058-F4 to TVI>2, TVI>4 or TVI>6 in volume. Furthermore, there was also significantly fewer animals in the group treated with 10058-F4, compared to the controls, that had an event, i.e. that passed TVI>2, TVI>4 or TVI<6. All tumors doubled their tumor volume, but in the group treated with 10058-F4 7 of 8 had a TVI>4, and only 2 of 8 had a TVI>6. On the contrary, 10058-F4 showed interesting potential in the transgenic spontaneous MYCN-driven mouse model of neuroblastoma. These animals develop palpable abdominal tumors in a window of 35-70 days post birth. Upon the discovery of a tumor the animal was randomised to receive either no treatment (Ctrl) or 10058-F4 (25 mg/i.p. daily for 2 weeks and thereafter three times weekly). The animals were followed closely until the tumor progression and/or the general health status of the animal warranted sacrifice. The animals were evaluated on three different parameters; time from birth until tumor development, from birth until sacrifice, and the time spend in treatment (i.e. the time elapsed between tumor development and sacrifice). The experiment was evaluated in two different but parallel settings to assure that no treatment effects were potentially overseen. In setting A, a control group (n=27) three times larger than the treated group (n=9) was used. In Setting B, a time-matched control selected out of the setting A control group was assigned to each treated animal, with the criteria that the matched pair differed no more than ±3 days from birth until the tumor developed.

61

Analysis of the data in either setting A or B showed that there was no significant difference in the time from birth until the tumor developed, i.e. there were no starting difference between the groups. When analysing the survival curves of the time from birth until sacrifice in either setting A or B both indicated an prolonged survival for animals treated with 10058-F4, but this was not significant. Upon analysis of the time from tumor development until sacrifice, i.e. the number of days in treatment, there was a significant increase in the group treated with 10058-F4, irrespectively if the data was evaluated in setting A or B. Animals treated with 10058-F4 did 16.9 ± 10.5 (mean ± SD) days in treatment while controls in setting A 9.5 ± 6.1 days and in Setting B 9 ± 5.2 days. The treatment with 10058-F4 was associated with some toxicity, which interestingly was more pronounced in the NMRI nude mice used for the xenograft study than in the 129X1SvJ strain that the transgenic mice are backcrossed onto. 8.4.3 Discussion The observation that 10058-F4 is cytotoxic to neuroblastoma cells in the µM range is similar to what has previously been described by others in different cancer cell lines. In vivo, in the SK-N-BE(2) xenografts we observed only a modest and no significant effects on tumor volume or weight, whilst a significant growth delay was observed. In the spontaneous transgenic model we observed that the animals could go longer in treatment from when the tumor was detected until the animals had to be sacrificed. There are several differences in the models that can be argued to have a role in this. The overall poor effect of 10058-F4 in vivo (no observed tumor regression in either model) has been observed by others in a prostate xenograft model (Guo et al., 2009) and could in part be due to limited deliverance of 10058-F4 to the tumor cells. Studying the pharmacokinetic of 10058-F4 showed a fast metabolism after i.v. administration at the MTD, with a rather high plasma peak (delivering 20 mg/kg gave a maximal of 300 µM in plasma at 5 minutes post-administration) and rapid clearance as the levels declined to undetectable over 6 hours (Guo et al., 2009). The t½ was about 1 hour and although 10058-F4 was found in all investigated tissues the levels of 10058-F4 in the tumor 5 minutes post-administration was the lowest of all investigated tissues and with a peak of around 10 µM after 15 minutes (Guo et al., 2009). Analysing the area under curve it was estimated that the xenograft tumors are exposed to only 10% of the given dose and no changes in the expression of c-Myc or Max was observed upon treatment (Guo et al., 2009). It is not clear whether the low distribution to tumor tissue is true characteristic of 10058-F4 or not, and one could hypothesise that a poorly vascularised tumor would be exposed to much less drug than a well vascularised. The SK-N-BE(2) xenograft tumors grow fast, have large central necrotic and hemorrhagic areas, and are poorly vascularised and this fact could contribute to a decreased drug

62

delivery, compared to the transgenic model where the tumor appears more ordered with proper and abundant vascularisation only occasionally with central necrosis and hemorrhage. A proper pharmacokinetic study should have been undertaken when comparing these tumor models and also various modes of drug delivery considered to possibly improve the efficacy, for example through repeated dosing or continuous dosing via implanted osmotic pumps. Upon treatment we observed some toxicity, mainly weight loss which has been reported by others but was then attributed rather to the xenografts per se than 10058-F4 (Guo et al., 2009). Another important difference between these models is the p53 status of either model; whilst the SK-N-BE(2) cells used for xenografting are p53 mutated (Tweddle et al., 2003) the transgenic animals are p53 wild type (Chesler et al., 2008). The p53 protein has a central role in sensing cellular stress, especially DNA damage, and can bind and activate genes that halt the cells in the G1 phase of the cell cycle to repair the damage (Tweddle et al., 2003). In neuroblastoma, mutations in p53 are rare in primary tumors and when observed it is mainly in relapsed patients or patients with progressive tumors (Tweddle et al., 2003). In this context, both models resembles high-risk patients due to their MYCN status, but the transgenic model more resembles a patient at diagnosis, with functional p53 and the xenograft model more resembles a patient at relapse or progressive disease where p53 is mutated. Several lines of evidence in other types of cancer support a role of functional p53 in the regression of c-Myc-driven tumors (Luscher and Larsson, 2007). It has been shown that the loss of a single p53 allele in mice generated to over express c-Myc in the hepatocytes was enough to reduce the latency of tumor formation (Beer et al., 2004). A system with directed and tetracycline-regulated c-Myc expression in hematopoetic cells resulted in c-Myc induced lyphomas, which when bred onto a single p53 allele background had reduced latency to tumorigenesis (Giuriato et al., 2006). Upon c-Myc inactivation all tumors initially regressed but, compared to the p53 wild type, the single p53 allele tumors always relapsed and restoring p53 function resuted in sustained regression (Giuriato et al., 2006). In these animals it was found that after c-Myc was inactivated in the p53 deficient mice, expression of the anti-angiogenic factor thrombospondin-1 (TSP-1) was decreased (Giuriato et al., 2006). TSP-1 has been shown to be inhibited by c-Myc and also to be regulated by p53, and the expression of TSP-1 was rescued by restoring p53 function (Giuriato et al., 2006). The author thus concluded that the loss of p53 inhibited complete tumor regression by decreasing TSP-1 and thus sustained angiogenesis (Giuriato et al., 2006). There have been connections with oncogenes such as c-Myc to what is called oncogene-induced senescence (OIS) (Prochownik, 2008). OIS is an irreversible cell cycle arrest that occurs as a response to the over expression of oncogenes and is thought to constitute a defence against cancer, and required the function of several tumor suppressor genes among them p53 (Wu et al., 2007). Several tetracycline-regulated c-Myc driven tumors in mice (lyphoma, osteosarcoma, hepatocellular carcinoma) were shown to undergo OIS upon

63

withdrawal of c-Myc expression, but knockdown of p53 suppressed OIS after c-Myc inactivation (Wu et al., 2007). The mechanisms behind this are not clear (Wu et al., 2007). This paints a picture in where the p53 status are of importance during Myc inactivation, but one can hereto only speculate if these results of c-Myc also extends to MYCN. This study would be improved by investigating what is happening in the tumors of treated animals by measuring if the levels of MYCN is reduced upon treatment and quantify the tumor dynamics with regards to proliferation, apoptosis, vascularisation and possibly also markers of OIS. The transgenic animals in this experiment were evaluated based on the time from birth until tumor development and not by genotype. This approach of discarding the genotype and sort by time until tumor development has been published by others and, for hereto unknown reasons there have been extensive difficulties in genotyping these animals. With the novel genotyping by simple PCR we have hopes that assigning proper genotypes to these animals might further clarify our results. The dual mode of evaluating the transgenic data (evaluating the treated animals against and control group three times larger or by using time-matched controls) was undertaken to avoid missing potential treatment effects, but does not seem to make a difference. Furhtermore, 10058-F4 needs to bee extensively investigated to establish whether it is an inhibitor of MYCN as well as c-Myc, and this is underway. There is work undertaken to further improve and understand the structural rational behind the binding of small molecules like 10058-F4 to Myc and the subsequent disruption of binding to Max. Hopefully this will generate more and improved Myc inhibitors.

64

9 SUMMARY AND CONCLUSIONS Neuroblastoma, a childhood tumor of the sympathetic nervous system, has been shown to be reliant upon several signalling pathways invoved in angiogenesis, proliferation, and transcriptional regulation. Key signalling molecules in these pathways have also been shown to be dysregulated in neuroblastoma and connected to a poor patient survival. There is a vast plethora of novel targeted therapied developed against these pathways and its key players. Unfortunately, these therapies are predominately developed for adult oncology and the percolation of them to the pediatric oncology population has been slow and somewhat insufficient. In this thesis we have evaluated six novel targeted substances in neuroblastoma in vitro, and in vivo on xenografts and a transgenic model.

The humanised monoclonal antibody bevacizumab (Avastin®) inhibiting the pro-angiogenic factor VEGF-A was not cytotoxic to neuroblastoma cells in vitro under normoxic conditions, and treatment in vivo resulted in a reduced tumor growth and delayed tumor progression in three xenograft models of neuroblastoma.

Primary neuroblastoma tumors were shown to express activated mTOR

and Akt. The mTOR inhibitors rapamycin (Rapamune®) and its novel analogue CCI-779 (Torisel®) both showed efficacy in vitro on a panel of neuroblastoma cell lines, and in vivo on a xenograft model. In vitro, MYCN-amplified cell lines and cell lines generated to express MYCN was more sensitive to mTOR inhibition. Upon treatment with the mTOR inhibitors, the downstream signalling pathways was down regulated concomitant with a down regulation of MYCN and cyclin D1 protein both in vitro and in vivo.

Primary neuroblatstomas were shown to express activated PDK1 and

PI3K. The PDK1 inhibitor OSU03012 and the dual PI3K/mTOR inhibitor PI103 both showed efficacy in vitro on a panel of neuroblastoma cell lines, and in vivo in a neuroblastoma xenograft model. As observed with the mTOR inhibitors, OSU03012 and PI103 also seemed more effective against MYCN-amplified cells or cells generated to over express MYCN and they also resulted in the down regulation of MYCN and cyclin D1 protein in vitro.

The Myc-Max inhibitor 10058-F4 showed efficacy in vitro against

MYCN-amplified cells and also in vivo, both in a MYCN-amplified xenograft and in the transgenic MYCN-driven spontaneous neuroblastoma model.

In conclusion, these inhibitors appear to have efficacy in neuroblastoma and their targets are overexpressed in primary material. As several of them are becoming clinically available it will be interesting to observe their development.

65

10 FUTURE PERSPECTIVES Some of the agents described herein have already taken some steps towards and into the pediatric oncology area. Bevacizumab is becoming increasingly available for the pediatric population and there are more and more clinical reports and trials published. The emerging picture is that bevacizumab is well tolerated, but the high prospects set for cure has unfortunately not been met. More consistenly, the observed responses has been to buy the patient precious time. There were initial concerns of angiogenesis-inhibition in children resulting in unacceptable side-effects and long-term toxicities, as the growing child presumably is more dependent on functional vasculogenesis than the adult, but these have not been fulfilled. The Children’s Oncology Group has published a phase I trial and pharmacokinetic study of bevacizumab in pediatric patients with refractory solid tumors and reports that no dose-limiting toxicities or growth perturbations were seen. The conclusion was drawn that it was well tolerated, but no objective responses were observed. In addition, voices have been raised on the issue of the cost of bevacizumab treatment. The main concern for bevacizumab continues to be the development of biomarkers to both select the patients most likely to respond and to evaluate if the treatment is beneficial. The mTOR inhibitor rapamycin have been rather extensively tested and used in the pediatric area as an immunosuppressant. This makes it a promising agent, as the pediatric dosing and side-effects have been studied. There are many clinical trials ongoing evaluating rapamycin in childhood solid tumors, and a handful of trials in hematological cancers. Temsirolimus (CCI-779) is also being evaluated in the pediatric population, and for neuroblastoma. Weighing these two against each other is a delicate balance; the experience with rapamycin is more extensive but it has a diffucult pharmacological profile, whereas temsirolimus is less used hetero but with improved pharmacokinetics. Also the other rapalogue brothers, Everolimus and Ridaforolimus/Deforolimus, are advancing into the clinic and into the pediatric area, as there are a few reported trials on each. As the mTOR inhibitors have been tested in children and reports are that it is well tolerated, the main concern is their immuno-suppressant activities. This is both due to the suceptability of the patient to opportunistic and/or pathogen related infections and to the aspect of the patient mounting an immuno-response against tumor cells and if this can aid in eradicating the disease. Many of the currently used standard chemotherapeutic drugs are also limited by bone-marrow toxicity and renders the patients quite immunosupressed. It is hereto unknown if treatment with mTOR inhibitors affects the patient’s ability to mount an immunological respons against the tumor and if this in turn affects the survival and outcome. The development of biomarkers for patient selection and treatment benefit with mTOR inhibitors are slowely underway. For bevacizumab, rapamycin or CCI-779 it is not clear where they should be inserted into the treatment protocol, if they should be included up-front, at

66

maintenance therapy or at relapse. The consensus picture one can conclude from the reported ongoing trials is that towards combination treatment. The PDK1 inhibitor OSU03012 has advanced into clinical trials (as AR12) in the adult setting for solid tumors and lymphomas, whilst there are none reported for the dual PI3K/mTOR inhibitor PI103. Both these agents are promising and at least OSU03012 is entering the clinic, but it will surely take some time before it reaches the pediatric area. The main concerns about these will, apart from their efficacy, be both their toxicity profile and what potential acute and long-term side-effects they will have in the pediatric population. As the main toxicities have been related to the glucose metabolism, it is unclear how this will affect the growing child. The Myc-Max inhibitor 10058-F4 is only in the very early stages of preclinical development as there is only one in vivo study published hereto. Although the concept of Myc inhibition is promising in many types of cancer, and MYCN inhibition especially in neuroblastoma, the displayed issues with the actual compound and its bioavailability needs additional work that is currently addressed. Large screens are also ongoing with the hopes of identifying novel MYCN inhibitors that in the future might be of clinical interest in neuroblastoma. It is my sincere hope and humble wish that some of the work presented in this thesis in some way or form may contribute in solving the neuroblastoma enigma, and that it improves the survival for these patients. All reports on ongoing clinical trials have been collected by searching for keywords (bevacizumab, rapamycin, Sirolimus, Rapamune, CCI-779, Temsirolimus, Torisel, Everolimus, RAD-001, Ridaforolimus, Deforolimus, OSU03012, AR12, PI103, child, pediatric, cancer, neuroblastoma) on www.clinicaltrials.gov.

‘Det är så det ska vara / Det är så vi vill ha det nu Det är så det ska vara / Som en perfekt och underbar lag

Perfekt och oförstörbar / Som Jag…’ (Gravitation, Verkligen, 1996).

67

11 ACKNOWLEDGEMENTS There are many persons involved in me starting on this path and reaching the goal, but there are even more persons that contributed to keeping me on the track and patiently waiting for me to get there… Without further due, I give my sincere gratitude and thanks to: My supervisors Per, ’Och Du har tagit mig från kylan in / I min bok är Du för evigt…’ (Ansgar & Evelyne, The Hjärta och Smärta EP). Thank you for taking me on at a point where I was lost and for taking me into your fantastic group. I feel blessed that you see and bring forth so much in me that I constantly fail to see. With your warm, caring and compassionate personality and your creative and energetic scientific drive you are truly both the hub and the engine of this extraordinary group. It has been an honour, and a privilege, to be and have been your student, your protégée, and foremost your friend. John Inge, ’Du är min hjälte för Du vågar vara rak / Du är min hjälte för Du är precis så svag som Jag’ (Vinternoll2, 2002). Endless of thanks for all that you have done for me during these years. Your door has always been open for chit-chats about science, life, music and all other important (and unimportant) things. Working and travelling together have been a blast, I will remember Inglewood forever! Thank you also for being a mentor in science and in life, for support when days are grey, for believing in me and saying so, and most of all for being such a fantastic guy. Although, I must confess that from time to time I find it immensely difficult to figure out the gibberish of your mumbling Norwegian dialect… Baldur, ’Allt Du har väntat på krymper på nära håll / Allting omkring Dig är långsamt som Jag / Allt Du har väntat på kommer så småningom’ (På nära håll, B-sidorna 95-00, 2000). Being ‘Helan och Halvan’ of this group, it must really look funny seeing us together! Standing nearly two meters tall (and me nearly half a meter below), you are the sweetest and most darling person one can imagine. Being around you is relaxing and nice, apart from the time you threatened to rip the heads off me and Ninib! I really think its time to abandon Tromsø and get a place here, but stock up on the licorice-chocolate before you move! The wonderful Kogner group Lotta, you truly are the Head Commander of the lab and a loving ’mother’ for all the PhD-students. Without you we would all be as lost as a bunch of squirrels wearing drag at the Nobel dinner… Endless of thanks for all the small and large things you have helped me with and learned me, and all the laughs! ‘Som Jag önskar Jag var värd Dig / Att Jag kunde ge Dig någonting lika stort / Allt värt att veta har Du lärt Mig / Men Du säger att Jag inte står i skuld’ (Håll ditt huvud högt, Turné 2008). You are of such an easy-going nature and your attitude that all is possible is invigorating. And your attention of the precious small things in everyday life; good coffee with your cardamom cake, can not all days be like that?

68

Helena, our little Speedy Gonzales! I do not know anyone who has so much energy! I admire your drive and that you are not afraid to make decisions in life, and sticking to them! Your kind-hearted spirit, warmness and openness makes you a great friend to confide in. And although the rest of us feel like zombies when you are zooming through life like a gerbil on methamphetamine, you are mindful to stop up, take in and enjoy what the world has to offer. ‘Har Du tänkt på att vi nästan aldrig lyfter vår blick från marken / Mot den svarta rymden ovanför molnen’ (Vy från ett luftslott, Tillbaka till samtiden, 2007). I wish I could grant you all good in life, but I suspect that you just have been chosen by someone with that intention. H+H for evermore! Ninib, my extra brother in the lab, you are possibly the kindest, most generous, and caring person I know! You give without hesitation and always ensure that everyone around you is happy. You truly master the art of making a gal feel special and appreciated. ’Jag har ett foto någonstans / Där vi är drottningar och kungar’ (Ensammast i Sverige, Tillbaka till samtiden, 2007). If you keep playing your cards this nicely, I might share my recipe for Baba Ghanoush… Furthermore, I am sure that someday, when the world is ready for it, upon announcing the Nobel Price for solving the enigma of the stem cells your name will be involved. Agnes, if I could wish for one thing, it would be to have just one percent of your calmness (some might even suggest that I need it!). You approach problems and obstacles, both scientific and worldly, with a composed and methodical mind. ‘Det verkar så enkelt vännen / Ändå är det så obegripligt svårt’ (M, Du&Jag, Döden, 2005). You have an admirable ability to be present here and now, and give of yourself without hesitation. Thanks for all our discussions on work and life; I truly value your input and advices. On top of this you are also a really fun friend and a great mommy; I do not know where you find the time? Parallel universes or worm holes? Jelena, you did not only bring a lot of brains to our group, you brought beauty. You make the rest of us want to go the extra mile in the morning, appearing at work with hopes of radiate just an ounce of the flare and effortless cool elegance that you master perfectly. Coming in from the side, like me, we already knew that you belonged here and it feels like you have been with us forever. You also have an enormous heart and always take the time to listen and to be there, for the serious and for the laughs. Malin, I can not wait until you join us! You finally fulfil the Kogner group conspiracy to brain-drain Uppsala completely. But we always know where to keep our roots, we are never moving! Thanks for all the long hours spent commuting and the time in the animal facility, I am grateful that you found the strength to keep up and put up with me when I ambiguously tried to work at supersonic speed. Emma, our little party animal! Though you do not formally belong to our group, in heart and spirit you do! Thanks for hilarious discussions, high and low, at the morning coffee and for so much fun during our conference trips! And I promise solemnly, if we share rooms again, not to talk in my sleep and try to climb into your bed at night when sleepwalking. ‘Walking down the street, in Berlin city…’

69

Ann-Mari, the latest star in our constellation, and oh, you shine so brightly! My newfound friend in the never-ending second hand hunt for the perfect coffeepot or 1950s buttons. I do hope our textile conservation movement will get a footing! Thanks for endless support with all the small and large things; you are a fantastic ‘go-and-do-it’ type of person. And thank you for showing and reminding me that finding a kindred spirit lies within the shared similarities, irrespectively of the apparent differences. Tony, although we have not seen much of you hereto, I am certain that you will fit right in! You are a fun guy with great dance moves! I look forward to you teaching us the clinical stuff soon. Catarina, thanks for bringing in the clinical perspective in our group and for all discussions on both scientific and non-scientific subjects, and for being so generous and inviting us in to your home, both in Stockholm and in Linköping. Ebba, thanks for being so enthusiastic, energetic and interested in many things, and for fun trips together. I do hope that you find a way of combining both the doctor stuff and science. Staffan, for sharing your message, ‘science is FUN!’ And for being such a sport at getting me to understand statistics, I am increasingly interested but never aspire to reach your level. Anna DeGeer and Lena-Maria Carlsson, our adopted PhDs. Thanks for being such fun and easy-going girls, always up for a chit-chat about everything! And how would we ever be updated on everything at CCK without you?! Anna, good luck with your future carrier, and Lena-Maria, it is great that you finally belong with us! I really feel that you will have it better with us. The Childhood Cancer Research Unit Birgitta, thanks for support with all small and large things over the years! We were hesitant over how to survive without you, but realise that your time is much better spent in the sandbox with Edward. Desiree, taking over after Birgitta was a pair of not only fashionable but also large shoes to fill, but as with everything else you have done it perfectly, and always with a sunny smile! Thanks to all persons at the unit for contributing to a great working atmosphere and for being such a fun crowd! I am pretty sure that few other workplaces are blessed with such diverse and entertaining morning coffee conversations! Jan-Inge, Marianne, Anders, Martina, Annika, Julio, AnnaCarin Carina, Åsa, Malin, Elisabet, Carina, Mats, Krister, Göran, Stefan, Johan. Co-authors For good publications and cooperation: Bäckman, Holmquist, Azarbayjani, Pontan, Fuskevåg, Redfern, Lindskog, Lövborg, Viktorsson, Lewensohn, Larsson, Gullbo, Orrego, Henriksson, Kågedal, Castro, Stenerlöw, Eriksson, Öqvist, Holm, Gustavsson.

70

For believing in me early on Barbro, my chemistry and biology teacher at senior compulsory school. You lit the first flame of interest. I must not have been the easiest of student but you persevered, giving endlessly from your big hearth and saturating the lessons with your enthusiasm and passion. You are a role model for life. Staffan, my physics and math teacher at high school. Although you regretted having to fail me in physics you never gave up on me. And as much as I have to say that I never did or will understand math or physics, the little I do understand, you put in there with a lot of patience and teaching spirit. Jan, my professor at college and subsequently my mentor. I do believe that you saw something in me from the beginning when I stepped into you classroom, defiant and full of questions. You taught me creative thinking, challenged me and my thinking and allowed me to grow. Thank you for easing the way for me, in whatever I have pursued, and for continuing to be a source of interesting discussions. Jörgen, the supervisor of my graduate thesis. You took me on and endured my first stumbling steps in the lab. Thank you for introducing me into your group and helping me on the way. For starting me on the dissertation road Rolf, thanks for the kick-start and for giving me the chance of pursuing this. Barbro, new and scared in the lab you took me and Dieter under your wings. With equal parts of strict discipline and good laughs, thank you for teaching me and sharing you vast knowledge. Collaborators Björn-Helge Haug and the Trond Flaegstadt group, thanks for letting me party with you in a cold Berlin and Björn-Helge, I am sure that soon you will be able to get ’musen att släppa till’… Hanna Zirath and Marie Arsenian-Henrikssons group, for nice social and scientific exchange and Hanna, I hope that I did not torment you to much during our summer in the basement of the animal house. You will have to teach me everything about zebra fishes! Helena Caren and the Tommy Martinsson group, for making me understand slightly more about you utterly complicated work and Helena, going to Amsterdam with you was great! Nina Wollmer Solberg and the Cecilia Nauclair group, for endless enthusiasm on the CMV project and Nina, always with a smile! People making the way a lot easier The Animal facility, I would be lost without you! Not only are you fantastic, you do it all with a laugh! You guys have shared your expertise, your knowledge and your everyday good-to-have-at-hand tricks to me and you have not hesitated a second to help me out, money or not. Kicki, what you do not know

71

about our furry friends are not worth knowing, I am in awe! Thanks for our wonderful long discussions about life and everything, and for letting me tourment you students from time to time. Anna-Lena, you are so good spirited and the best mom for all our little naked aliens in the basement! Magnus and Leo, the technical boys, whom without everything would grind to a sad halt. Sandra, the Almighty Keeper of the Breeding! You are fantastic in every way; I have no more to say! Nathalie, you are both naughty and fierce! You are hilarious, cracking smiles around you even on the dullest or boring of days! The CCK crowd: Stig, Slavica, Maria H, Maria B, Walid, Padraig, Ciss, Xin and Dali. You all make the days brighter! Thanks for a lot of fun both in the lab and outside, and for all the stuff I most probably have borrowed from you…. Friends Thanks to friends from: High School and lajv: Hanna, Christian, Torgny, Markus, Sandra, Carl-Johan The collage years: Eva-Maria, Micke, Sara, Katrin, Johanna BMC: Andrei, Igor, Harriet and Erik, Anca Daniel, and now mine: Lars, Karolin and Oskar; Viktor, Tomoko and Björn; Fredrik, Elin and Gustav Per B, who is ’född i en spökstad’ (Spökstad, B-sidorna 95-00, 2000). Thanks for the magic high school years and for staying my friend beyond, how I wish we could build a time machine and revisit those days! ’Och Jag vet inte varför, men Jag återvänder alltid hit / Det var väl något vi gjorde, något vi sa här som förändrade mitt liv’ (Järnspöken, Du & Jag Döden, 2005). In you I find another searching spirit, someone to share serious conversations of the hearth and soul with, ponder political and worldly issues, and to continuously be astonished by the peculiar ways of people. ’Och Jag blir verkligen så glad / För Du är verkligen precis som Jag’ (Verkligen, B-sidorna 95-00, 2000). Emma ’Jag skulle alltid vara den som stod bakom Dig / Jag skulle alltid svara när Du kallade på mig’ (Generation Ex, Tillbaka till samtiden, 2007). Sweet E, what and where would I bee without you? Since ending up together in a project in college you are one of my very closes and best friends. Sharing each others highs and lows in life, talking about absolutely everything and nothing; I could not ask for a more true and steadfast friend. Thank you for always being there and, although we do not hear from each other all the time, you show me that good friendship does not age and go stale, and it does not decay by distance or time. And to Oskar, thank you for always putting a smile on my face, for taking care of my sweet E and for always dare to question everything and think freely. Dieter, ’Mina tankar är så klara nu / Alla frågetecken slätas ut / När bomben faller vill Jag vara där Du är / Vår hämnd blir ljuv / Det är Vi mot världen igen’ (Vi mot världen, The hjärta och smärta EP, 2005). We started this together and we get somewhat a fairytale ending, both defending in the same year (although you were a tad bit quicker). Since we stepped in together in that office, we have been on the same wavelength. With you, I have shared the best and the worst, the everyday dull jog-trot, scientific discussions, and partying like the night will never end (really, does it ever?). I hope the day never comes when we run out

72

of words, but I am pretty sure that it will never happen. If it does, I am more than happy to be silent in your company. ’Du frågar mig vad kärlek är / Men Jag vet inget om det där / Bara sånt som man kan mäta kan Jag förstå’ (Våga vara rädd, Tillbaka till samtiden, 2007). You are the most faithful and loyal friend one could ever ask for and you always find the silver lining in life. I hope that I can be every bit as good of a friend to you as you are to me. IKEA forever! Family The Perup clan: Ingemar and Christina; Alexander and Marielle; Ingeli and Rob; Eva and Janne; Ingolf, Birgitta, Mina and Tobias; Ola, Malin, Svante and Nadja; Charlotta, Allistair, Saskia and Stella. The Wallin clan: Thore and Gunda; Torbjörn, Eva and Veronica Thanks for lovingly taking me into your family, for all support during these years and for being so understanding when my head have been full of work, and thanks for all wonderful distractions: dinners, holidays and travels. Torbjörn, prepare the outdoor tub and put the beer on cooling, I’m coming over! The Oker-Blom clan: Inga; Annika and Cecilia; Alexander, Jacqueline, Maximilian, Carolina and Andrea; Cecilia and Peter; Johan, Stacey, Emma, Weasley, Sophie and Alyce; Nicholas and Kayla. The Segerström Clan: Anders; Lennart and Sol; Liselott and Fredrik; Leo; Agneta, Amanda, Andreas and Jessica. Endless thanks for just being my family. There must have been many times that you all must have wondered what I was up to all these years. And now, here is the book! I do hope that I now will have much more time at hand to spend with all of you! Alexander, start thinking of some difficult questions! To those who are not besides us anymore, but in our thoughts and our hearths: ’Min släkt är full av hjältar, decennier av slit / Brustna hjärtan slitna leder, deras stolthet bar mig hit / Nu är de gömda bakom stjärnor, vid vintergatans kant / De är glömda men de talar, genom pennan i min hand / Och de bar mig ända hit’ (Elite, Vapen&Ammunition, 2002). Brita, with the kindest of hearts. Nalle, you would have been so proud of me, I wish you could have been here. Majvor, you are already immensely missed. Anita, Anton and David, my added family. How lucky I am to have not only the wonderful Anita, but also two grown-up, non-teasing, mature and well-mannered bonus brothers. (Hey parents, where did you mislay all the X chromosomes!) Thanks for all the fun times, both at home and at trips. And I am not convinced that David and I are not related somehow, as we unmistakably share the piglet-gene. Anders and Björn, my darling brothers! Although we have chosen different paths in our professional life, we are all very passionate about what we do and are not scared of projects, small or large! I am so proud of your skills, your craftsmanship and I am in awe of your entrepreneurial spirit. ‘Älskling, Jag har aldrig kunnat lära Dig någonting / I bästa fall så kan Jag bidra med en känsla’ (Berlin, Tillbaka till samtiden, 2007). Karin and Torbjörn, dearest mommy and daddy. If there is possibly someone more proud than me that this thesis is finally done, it is how proud you are of

73

me. And I am so thankful that you tell me and show me all the time. I believe that the key thing to have gotten me this far is that I have an insatiable urge to figure everything out, and this trait of character was founded and nourished by you making everything I wanted to take on possible. I am grateful that you always have been attentive to my need of support, guidance and help; I can sometimes be unbearably stubborn and need to find my own way. Maja, my cute dog! Driving across Sweden on a whim to bring you home was possible one of the best things I have done. I can not see a day without playing with you, taking long walks or just watching Animal Planet together. You give so much joy and love; you are a precious member of our little family! Astrid, my little Siberian dwarf-hamster in heaven. It is incredible that your big personality could fit into such a small body. Thanks for the time here, you eased my loneliness and you are missed. Daniel, all big and fancy words flee trying to describe what you mean to me. ‘Jag kan inte ens gå, utan din luft i mina lungor / Jag kan inte en stå, när Du inte ser på, och genomskinligt grå / Blir Jag utan dina andetag / Vad vore Jag, utan dina andetag?’ (Utan dina andetag, B-sidorna 95-00, 2000). I feel blessed to be with you, ’Jag har hittat någonting vackert / Vännen, ser Du vad Jag ser? (Musik Non Stop, Hagnesta Hill, 1999). You bring balance to me and a calm place where I can see more clearly. You also bring endless love into my life and into me, a force that generate more momentum than I thought I had in me. ‘Jag är alltid tryggast när Du är en liten bit ifrån / En rörelse i ögonvrån’ (Så nära får ingen gå, Verkligen 1995). I am so proud of you, of us, of what we have and what we have built together. ’Har alltid sett oss som Ansgar och Evelyne’, (Ansgar&Evelyne, The hjärta och smärta EP, 2005). You have been with me on this journey, endlessly patient with long commuting hours, weekend animal work and a lot of my hesitance. Whereto the next journey sets sail I do not know yet, but I have already made reservations for you in a first class cabin with a nice view and chocolates on the pillows. The future is ours! ’Så länge hjärtat mitt slår, minns Jag dig när / Du stack ett hål, i min kevlarsjäl’ (Kevlarsjäl, Hagnesta Hill, 1999).

’Det är långt mellan Flen och Paris Men nära en trettioårskris’

(The hjärta och smärta EP, 2005)

74

12 REFERENCES Ablett, S, Doz, F, Morland, B, and Vassal, G (2004). European collaboration in trials of new agents for children with cancer. Eur J Cancer 40, 1886-1892.

Abraham, RT, and Eng, CH (2008). Mammalian target of rapamycin as a therapeutic target in oncology. Expert Opin Ther Targets 12, 209-222.

Adhikary, S, and Eilers, M (2005). Transcriptional regulation and transformation by Myc proteins. Nat Rev Mol Cell Biol 6, 635-645.

Aguzzi, A, Wagner, EF, Williams, RL, and Courtneidge, SA (1990). Sympathetic hyperplasia and neuroblastomas in transgenic mice expressing polyoma middle T antigen. New Biol 2, 533-543.

Alam, G, Cui, H, Shi, H, Yang, L, Ding, J, Mao, L, Maltese, WA, and Ding, HF (2009). MYCN promotes the expansion of Phox2B-positive neuronal progenitors to drive neuroblastoma development. Am J Pathol 175, 856-866.

Bachireddy, P, Bendapudi, PK, and Felsher, DW (2005). Getting at MYC through RAS. Clin Cancer Res 11, 4278-4281.

Backman, U, and Christofferson, R (2005). The selective class III/V receptor tyrosine kinase inhibitor SU11657 inhibits tumor growth and angiogenesis in experimental neuroblastomas grown in mice. Pediatr Res 57, 690-695.

Balis, FM, Fox, E, Widemann, BC, and Adamson, PC (2009). Clinical drug development for childhood cancers. Clin Pharmacol Ther 85, 127-129.

Barbosa, MD, Nguyen, QA, Tchernev, VT, Ashley, JA, Detter, JC, Blaydes, SM, Brandt, SJ, Chotai, D, Hodgman, C, Solari, RC, Lovett, M, and Kingsmore, SF (1996). Identification of the homologous beige and Chediak-Higashi syndrome genes. Nature 382, 262-265.

Baryawno, N, Sveinbjornsson, B, Eksborg, S, Orrego, A, Segerstrom, L, Oqvist, CO, Holm, S, Gustavsson, B, Kagedal, B, Kogner, P, and Johnsen, JI (2008). Tumor-growth-promoting cyclooxygenase-2 prostaglandin E2 pathway provides medulloblastoma therapeutic targets. Neuro Oncol 10, 661-674.

Beaudry, P, Nilsson, M, Rioth, M, Prox, D, Poon, D, Xu, L, Zweidler-Mckay, P, Ryan, A, Folkman, J, Ryeom, S, and Heymach, J (2008). Potent antitumor effects of ZD6474 on neuroblastoma via dual targeting of tumor cells and tumor endothelium. Mol Cancer Ther 7, 418-424.

Beer, S, Zetterberg, A, Ihrie, RA, McTaggart, RA, Yang, Q, Bradon, N, Arvanitis, C, Attardi, LD, Feng, S, Ruebner, B, Cardiff, RD, and Felsher, DW (2004). Developmental context determines latency of MYC-induced tumorigenesis. PLoS Biol 2, e332.

Benesch, M, Windelberg, M, Sauseng, W, Witt, V, Fleischhack, G, Lackner, H, Gadner, H, Bode, U, and Urban, C (2008). Compassionate use of bevacizumab (Avastin) in children and young adults with refractory or recurrent solid tumors. Ann Oncol 19, 807-813.

Beppu, K, Nakamura, K, Linehan, WM, Rapisarda, A, and Thiele, CJ (2005). Topotecan blocks hypoxia-inducible factor-1alpha and vascular endothelial growth factor expression induced by insulin-like growth factor-I in neuroblastoma cells. Cancer Res 65, 4775-4781.

Bjornsti, MA, and Houghton, PJ (2004). The TOR pathway: a target for cancer therapy. Nat Rev Cancer 4, 335-348.

75

Blaauwbroek, R, Groenier, KH, Kamps, WA, Meyboom-de Jong, B, and Postma, A (2007). Late effects in adult survivors of childhood cancer: the need for life-long follow-up. Ann Oncol 18, 1898-1902.

Boller, D, Schramm, A, Doepfner, KT, Shalaby, T, von Bueren, AO, Eggert, A, Grotzer, MA, and Arcaro, A (2008). Targeting the phosphoinositide 3-kinase isoform p110delta impairs growth and survival in neuroblastoma cells. Clin Cancer Res 14, 1172-1181.

Bosma, GC, Custer, RP, and Bosma, MJ (1983). A severe combined immunodeficiency mutation in the mouse. Nature 301, 527-530.

Bosma, MJ, and Carroll, AM (1991). The SCID mouse mutant: definition, characterization, and potential uses. Annu Rev Immunol 9, 323-350.

Bourdeaut, F, Trochet, D, Janoueix-Lerosey, I, Ribeiro, A, Deville, A, Coz, C, Michiels, JF, Lyonnet, S, Amiel, J, and Delattre, O (2005). Germline mutations of the paired-like homeobox 2B (PHOX2B) gene in neuroblastoma. Cancer Lett 228, 51-58.

Brahimi-Horn, MC, and Pouyssegur, J (2009). HIF at a glance. J Cell Sci 122, 1055-1057.

Breit, S, Ashman, K, Wilting, J, Rossler, J, Hatzi, E, Fotsis, T, and Schweigerer, L (2000a). The N-myc oncogene in human neuroblastoma cells: down-regulation of an angiogenesis inhibitor identified as activin A. Cancer Res 60, 4596-4601.

Breit, S, Rossler, J, Fotsis, T, and Schweigerer, L (2000b). N-myc down-regulates activin A. Biochem Biophys Res Commun 274, 405-409.

Brodeur, GM (2003). Neuroblastoma: biological insights into a clinical enigma. Nat Rev Cancer 3, 203-216.

Brodeur, GM, Minturn, JE, Ho, R, Simpson, AM, Iyer, R, Varela, CR, Light, JE, Kolla, V, and Evans, AE (2009). Trk receptor expression and inhibition in neuroblastomas. Clin Cancer Res 15, 3244-3250.

Brodeur, GM, Pritchard, J, Berthold, F, Carlsen, NL, Castel, V, Castelberry, RP, De Bernardi, B, Evans, AE, Favrot, M, Hedborg, F, and et al. (1993). Revisions of the international criteria for neuroblastoma diagnosis, staging, and response to treatment. J Clin Oncol 11, 1466-1477.

Brodeur, GM, Seeger, RC, Barrett, A, Berthold, F, Castleberry, RP, D'Angio, G, De Bernardi, B, Evans, AE, Favrot, M, Freeman, AI, and et al. (1988). International criteria for diagnosis, staging, and response to treatment in patients with neuroblastoma. J Clin Oncol 6, 1874-1881.

Brodeur, GM, Seeger, RC, Schwab, M, Varmus, HE, and Bishop, JM (1984). Amplification of N-myc in untreated human neuroblastomas correlates with advanced disease stage. Science 224, 1121-1124.

Burkhart, CA, Cheng, AJ, Madafiglio, J, Kavallaris, M, Mili, M, Marshall, GM, Weiss, WA, Khachigian, LM, Norris, MD, and Haber, M (2003). Effects of MYCN antisense oligonucleotide administration on tumorigenesis in a murine model of neuroblastoma. J Natl Cancer Inst 95, 1394-1403.

Burkhart, CA, Norris, MD, and Haber, M (2002). A simple method for the isolation of genomic DNA from mouse tail free of real-time PCR inhibitors. J Biochem Biophys Methods 52, 145-149.

Burkhart, CA, Watt, F, Murray, J, Pajic, M, Prokvolit, A, Xue, C, Flemming, C, Smith, J, Purmal, A, Isachenko, N, Komarov, PG, Gurova, KV, Sartorelli, AC, Marshall, GM, Norris, MD, Gudkov, AV, and Haber, M (2009). Small-molecule multidrug resistance-associated protein 1 inhibitor reversan increases the therapeutic index of chemotherapy in mouse models of neuroblastoma. Cancer Res 69, 6573-6580.

76

Caren, H, Abel, F, Kogner, P, and Martinsson, T (2008). High incidence of DNA mutations and gene amplifications of the ALK gene in advanced sporadic neuroblastoma tumours. Biochem J 416, 153-159.

Carol, H, Lock, R, Houghton, PJ, Morton, CL, Kolb, EA, Gorlick, R, Reynolds, CP, Maris, JM, Keir, ST, Billups, CA, and Smith, MA (2009). Initial testing (stage 1) of the kinesin spindle protein inhibitor ispinesib by the pediatric preclinical testing program. Pediatr Blood Cancer 53, 1255-1263.

Cavazzana-Calvo, M, and Fischer, A (2007). Gene therapy for severe combined immunodeficiency: are we there yet? J Clin Invest 117, 1456-1465.

Ceci, A, Felisi, M, Baiardi, P, Bonifazi, F, Catapano, M, Giaquinto, C, Nicolosi, A, Sturkenboom, M, Neubert, A, and Wong, I (2006). Medicines for children licensed by the European Medicines Agency (EMEA): the balance after 10 years. Eur J Clin Pharmacol 62, 947-952.

Cen, L, Hsieh, FC, Lin, HJ, Chen, CS, Qualman, SJ, and Lin, J (2007). PDK-1/AKT pathway as a novel therapeutic target in rhabdomyosarcoma cells using OSU-03012 compound. Br J Cancer 97, 785-791.

Chaisuparat, R, Hu, J, Jham, BC, Knight, ZA, Shokat, KM, and Montaner, S (2008). Dual inhibition of PI3Kalpha and mTOR as an alternative treatment for Kaposi's sarcoma. Cancer Res 68, 8361-8368.

Chayka, O, Corvetta, D, Dews, M, Caccamo, AE, Piotrowska, I, Santilli, G, Gibson, S, Sebire, NJ, Himoudi, N, Hogarty, MD, Anderson, J, Bettuzzi, S, Thomas-Tikhonenko, A, and Sala, A (2009). Clusterin, a haploinsufficient tumor suppressor gene in neuroblastomas. J Natl Cancer Inst 101, 663-677.

Chen, JS, Zhou, LJ, Entin-Meer, M, Yang, X, Donker, M, Knight, ZA, Weiss, W, Shokat, KM, Haas-Kogan, D, and Stokoe, D (2008). Characterization of structurally distinct, isoform-selective phosphoinositide 3'-kinase inhibitors in combination with radiation in the treatment of glioblastoma. Mol Cancer Ther 7, 841-850.

Cheng, AJ, Cheng, NC, Ford, J, Smith, J, Murray, JE, Flemming, C, Lastowska, M, Jackson, MS, Hackett, CS, Weiss, WA, Marshall, GM, Kees, UR, Norris, MD, and Haber, M (2007). Cell lines from MYCN transgenic murine tumours reflect the molecular and biological characteristics of human neuroblastoma. Eur J Cancer 43, 1467-1475.

Chesler, L, Goldenberg, DD, Collins, R, Grimmer, M, Kim, GE, Tihan, T, Nguyen, K, Yakovenko, S, Matthay, KK, and Weiss, WA (2008). Chemotherapy-induced apoptosis in a transgenic model of neuroblastoma proceeds through p53 induction. Neoplasia 10, 1268-1274.

Chesler, L, Goldenberg, DD, Seales, IT, Satchi-Fainaro, R, Grimmer, M, Collins, R, Struett, C, Nguyen, KN, Kim, G, Tihan, T, Bao, Y, Brekken, RA, Bergers, G, Folkman, J, and Weiss, WA (2007). Malignant progression and blockade of angiogenesis in a murine transgenic model of neuroblastoma. Cancer Res 67, 9435-9442.

Chesler, L, Schlieve, C, Goldenberg, DD, Kenney, A, Kim, G, McMillan, A, Matthay, KK, Rowitch, D, and Weiss, WA (2006). Inhibition of phosphatidylinositol 3-kinase destabilizes MYCN protein and blocks malignant progression in neuroblastoma. Cancer Res 66, 8139-8146.

Christianson, SW, Greiner, DL, Hesselton, RA, Leif, JH, Wagar, EJ, Schweitzer, IB, Rajan, TV, Gott, B, Roopenian, DC, and Shultz, LD (1997). Enhanced human CD4+ T cell engraftment in beta2-microglobulin-deficient NOD-scid mice. J Immunol 158, 3578-3586.

Cohen, EE (2008). mTOR: the mammalian target of replication. J Clin Oncol 26, 348-349.

Cohn, SL, Pearson, AD, London, WB, Monclair, T, Ambros, PF, Brodeur, GM, Faldum, A, Hero, B, Iehara, T, Machin, D, Mosseri, V, Simon, T, Garaventa, A, Castel, V, and Matthay, KK

77

(2009). The International Neuroblastoma Risk Group (INRG) classification system: an INRG Task Force report. J Clin Oncol 27, 289-297.

Coulter, DW, Blatt, J, D'Ercole, AJ, and Moats-Staats, BM (2008). IGF-I receptor inhibition combined with rapamycin or temsirolimus inhibits neuroblastoma cell growth. Anticancer Res 28, 1509-1516.

Coulter, DW, Wilkie, MB, and Moats-Staats, BM (2009). Inhibition of IGF-I receptor signaling in combination with rapamycin or temsirolimus increases MYC-N phosphorylation. Anticancer Res 29, 1943-1949.

Crawford, Y, and Ferrara, N (2009). VEGF inhibition: insights from preclinical and clinical studies. Cell Tissue Res 335, 261-269.

Croy, BA, and Chapeau, C (1990). Evaluation of the pregnancy immunotrophism hypothesis by assessment of the reproductive performance of young adult mice of genotype scid/scid.bg/bg. J Reprod Fertil 88, 231-239.

Cully, M, You, H, Levine, AJ, and Mak, TW (2006). Beyond PTEN mutations: the PI3K pathway as an integrator of multiple inputs during tumorigenesis. Nat Rev Cancer 6, 184-192.

Cunliffe, VT, Furley, AJ, and Keenan, D (2002). Complete rescue of the nude mutant phenotype by a wild-type Foxn1 transgene. Mamm Genome 13, 245-252.

Dancey, JE (2006). Therapeutic targets: MTOR and related pathways. Cancer Biol Ther 5, 1065-1073.

Das, B, Yeger, H, Tsuchida, R, Torkin, R, Gee, MF, Thorner, PS, Shibuya, M, Malkin, D, and Baruchel, S (2005). A hypoxia-driven vascular endothelial growth factor/Flt1 autocrine loop interacts with hypoxia-inducible factor-1alpha through mitogen-activated protein kinase/extracellular signal-regulated kinase 1/2 pathway in neuroblastoma. Cancer Res 65, 7267-7275.

De Preter, K, De Brouwer, S, Van Maerken, T, Pattyn, F, Schramm, A, Eggert, A, Vandesompele, J, and Speleman, F (2009). Meta-mining of neuroblastoma and neuroblast gene expression profiles reveals candidate therapeutic compounds. Clin Cancer Res 15, 3690-3696.

Dickson, PV, Hamner, JB, Sims, TL, Fraga, CH, Ng, CY, Rajasekeran, S, Hagedorn, NL, McCarville, MB, Stewart, CF, and Davidoff, AM (2007). Bevacizumab-induced transient remodeling of the vasculature in neuroblastoma xenografts results in improved delivery and efficacy of systemically administered chemotherapy. Clin Cancer Res 13, 3942-3950.

Easton, JB, and Houghton, PJ (2006). mTOR and cancer therapy. Oncogene 25, 6436-6446.

Eaton, GJ (1976). Hair growth cycles and wave patterns in "nude" mice. Transplantation 22, 217-222.

Eggert, A, Grotzer, MA, Ikegaki, N, Liu, XG, Evans, AE, and Brodeur, GM (2000a). Expression of neurotrophin receptor TrkA inhibits angiogenesis in neuroblastoma. Med Pediatr Oncol 35, 569-572.

Eggert, A, Ikegaki, N, Kwiatkowski, J, Zhao, H, Brodeur, GM, and Himelstein, BP (2000b). High-level expression of angiogenic factors is associated with advanced tumor stage in human neuroblastomas. Clin Cancer Res 6, 1900-1908.

Eilers, M, and Eisenman, RN (2008). Myc's broad reach. Genes Dev 22, 2755-2766.

Eisenberg-Lerner, A, Bialik, S, Simon, HU, and Kimchi, A (2009). Life and death partners: apoptosis, autophagy and the cross-talk between them. Cell Death Differ 16, 966-975.

78

Engelman, JA (2009). Targeting PI3K signalling in cancer: opportunities, challenges and limitations. Nat Rev Cancer 9, 550-562.

Engler, S, Thiel, C, Forster, K, David, K, Bredehorst, R, and Juhl, H (2001). A novel metastatic animal model reflecting the clinical appearance of human neuroblastoma: growth arrest of orthotopic tumors by natural, cytotoxic human immunoglobulin M antibodies. Cancer Res 61, 2968-2973.

Evans, AE (1980). Staging and treatment of neuroblastoma. Cancer 45, 1799-1802.

Fan, QW, Cheng, CK, Nicolaides, TP, Hackett, CS, Knight, ZA, Shokat, KM, and Weiss, WA (2007). A dual phosphoinositide-3-kinase alpha/mTOR inhibitor cooperates with blockade of epidermal growth factor receptor in PTEN-mutant glioma. Cancer Res 67, 7960-7965.

Fan, QW, Knight, ZA, Goldenberg, DD, Yu, W, Mostov, KE, Stokoe, D, Shokat, KM, and Weiss, WA (2006). A dual PI3 kinase/mTOR inhibitor reveals emergent efficacy in glioma. Cancer Cell 9, 341-349.

Fasolo, A, and Sessa, C (2008). mTOR inhibitors in the treatment of cancer. Expert Opin Investig Drugs 17, 1717-1734.

Feldman, ME, Apsel, B, Uotila, A, Loewith, R, Knight, ZA, Ruggero, D, and Shokat, KM (2009). Active-site inhibitors of mTOR target rapamycin-resistant outputs of mTORC1 and mTORC2. PLoS Biol 7, e38.

Ferrara, N (2009). Vascular endothelial growth factor. Arterioscler Thromb Vasc Biol 29, 789-791.

Ferrara, N, Hillan, KJ, and Novotny, W (2005a). Bevacizumab (Avastin), a humanized anti-VEGF monoclonal antibody for cancer therapy. Biochem Biophys Res Commun 333, 328-335.

Ferrara, N, and Kerbel, RS (2005b). Angiogenesis as a therapeutic target. Nature 438, 967-974.

Flanagan, SP (1966). 'Nude', a new hairless gene with pleiotropic effects in the mouse. Genet Res 8, 295-309.

Flickinger, KS, Judware, R, Lechner, R, Carter, WG, and Culp, LA (1994). Integrin expression in human neuroblastoma cells with or without N-myc amplification and in ectopic/orthotopic nude mouse tumors. Exp Cell Res 213, 156-163.

Folkman, J (2007). Angiogenesis: an organizing principle for drug discovery? Nat Rev Drug Discov 6, 273-286.

Follis, AV, Hammoudeh, DI, Daab, AT, and Metallo, SJ (2009). Small-molecule perturbation of competing interactions between c-Myc and Max. Bioorg Med Chem Lett 19, 807-810.

Follis, AV, Hammoudeh, DI, Wang, H, Prochownik, EV, and Metallo, SJ (2008). Structural rationale for the coupled binding and unfolding of the c-Myc oncoprotein by small molecules. Chem Biol 15, 1149-1155.

Foster, DA, and Toschi, A (2009). Targeting mTOR with rapamycin: one dose does not fit all. Cell Cycle 8, 1026-1029.

Fotsis, T, Breit, S, Lutz, W, Rossler, J, Hatzi, E, Schwab, M, and Schweigerer, L (1999). Down-regulation of endothelial cell growth inhibitors by enhanced MYCN oncogene expression in human neuroblastoma cells. Eur J Biochem 263, 757-764.

Frank, J, Pignata, C, Panteleyev, AA, Prowse, DM, Baden, H, Weiner, L, Gaetaniello, L, Ahmad, W, Pozzi, N, Cserhalmi-Friedman, PB, Aita, VM, Uyttendaele, H, Gordon, D, Ott, J,

79

Brissette, JL, and Christiano, AM (1999). Exposing the human nude phenotype. Nature 398, 473-474.

Fuchs, D, Christofferson, R, Stridsberg, M, Lindhagen, E, and Azarbayjani, F (2009). Regression of orthotopic neuroblastoma in mice by targeting the endothelial and tumor cell compartments. J Transl Med 7, 16.

Fukumura, D, and Jain, RK (2007). Tumor microvasculature and microenvironment: targets for anti-angiogenesis and normalization. Microvasc Res 74, 72-84.

Fulda, S (2009). The PI3K/Akt/mTOR pathway as therapeutic target in neuroblastoma. Curr Cancer Drug Targets 9, 729-737.

Gao, M, Yeh, PY, Lu, YS, Hsu, CH, Chen, KF, Lee, WC, Feng, WC, Chen, CS, Kuo, ML, and Cheng, AL (2008). OSU-03012, a novel celecoxib derivative, induces reactive oxygen species-related autophagy in hepatocellular carcinoma. Cancer Res 68, 9348-9357.

Garcia-Echeverria, C, and Sellers, WR (2008). Drug discovery approaches targeting the PI3K/Akt pathway in cancer. Oncogene 27, 5511-5526.

Georgakis, GV, and Younes, A (2006). From Rapa Nui to rapamycin: targeting PI3K/Akt/mTOR for cancer therapy. Expert Rev Anticancer Ther 6, 131-140.

Gera, JF, Mellinghoff, IK, Shi, Y, Rettig, MB, Tran, C, Hsu, JH, Sawyers, CL, and Lichtenstein, AK (2004). AKT activity determines sensitivity to mammalian target of rapamycin (mTOR) inhibitors by regulating cyclin D1 and c-myc expression. J Biol Chem 279, 2737-2746.

Giannini, G, Cerignoli, F, Mellone, M, Massimi, I, Ambrosi, C, Rinaldi, C, Dominici, C, Frati, L, Screpanti, I, and Gulino, A (2005). High mobility group A1 is a molecular target for MYCN in human neuroblastoma. Cancer Res 65, 8308-8316.

Giuriato, S, Ryeom, S, Fan, AC, Bachireddy, P, Lynch, RC, Rioth, MJ, van Riggelen, J, Kopelman, AM, Passegue, E, Tang, F, Folkman, J, and Felsher, DW (2006). Sustained regression of tumors upon MYC inactivation requires p53 or thrombospondin-1 to reverse the angiogenic switch. Proc Natl Acad Sci U S A 103, 16266-16271.

Glade Bender, JL, Adamson, PC, Reid, JM, Xu, L, Baruchel, S, Shaked, Y, Kerbel, RS, Cooney-Qualter, EM, Stempak, D, Chen, HX, Nelson, MD, Krailo, MD, Ingle, AM, Blaney, SM, Kandel, JJ, and Yamashiro, DJ (2008). Phase I trial and pharmacokinetic study of bevacizumab in pediatric patients with refractory solid tumors: a Children's Oncology Group Study. J Clin Oncol 26, 399-405.

Gomez-Curet, I, Perkins, RS, Bennett, R, Feidler, KL, Dunn, SP, and Krueger, LJ (2006). c-Myc inhibition negatively impacts lymphoma growth. J Pediatr Surg 41, 207-211; discussion 207-211.

Gorlick, R, Kolb, EA, Houghton, PJ, Morton, CL, Phelps, D, Schaiquevich, P, Stewart, C, Keir, ST, Lock, R, Carol, H, Reynolds, CP, Maris, JM, Wu, J, and Smith, MA (2009). Initial testing (stage 1) of lapatinib by the pediatric preclinical testing program. Pediatr Blood Cancer 53, 594-598.

Granville, CA, Memmott, RM, Gills, JJ, and Dennis, PA (2006). Handicapping the race to develop inhibitors of the phosphoinositide 3-kinase/Akt/mammalian target of rapamycin pathway. Clin Cancer Res 12, 679-689.

Graziani, EI (2009). Recent advances in the chemistry, biosynthesis and pharmacology of rapamycin analogs. Nat Prod Rep 26, 602-609.

Grimmer, MR, and Weiss, WA (2006). Childhood tumors of the nervous system as disorders of normal development. Curr Opin Pediatr 18, 634-638.

80

Grotzer, MA, Castelletti, D, Fiaschetti, G, Shalaby, T, and Arcaro, A (2009). Targeting Myc in pediatric malignancies of the central and peripheral nervous system. Curr Cancer Drug Targets 9, 176-188.

Guerreiro, AS, Boller, D, Shalaby, T, Grotzer, MA, and Arcaro, A (2006). Protein kinase B modulates the sensitivity of human neuroblastoma cells to insulin-like growth factor receptor inhibition. Int J Cancer 119, 2527-2538.

Guo, J, Parise, RA, Joseph, E, Egorin, MJ, Lazo, JS, Prochownik, EV, and Eiseman, JL (2009). Efficacy, pharmacokinetics, tisssue distribution, and metabolism of the Myc-Max disruptor, 10058-F4 [Z,E]-5-[4-ethylbenzylidine]-2-thioxothiazolidin-4-one, in mice. Cancer Chemother Pharmacol 63, 615-625.

Gustafsson, G (2008). Childhood cancer in the nordic countries. Report on Epidemiologic and Therapeutic Results From Registries and Working Groups.

Gutierrez, ME, Kummar, S, and Giaccone, G (2009). Next generation oncology drug development: opportunities and challenges. Nat Rev Clin Oncol 6, 259-265.

Hackett, CS, Hodgson, JG, Law, ME, Fridlyand, J, Osoegawa, K, de Jong, PJ, Nowak, NJ, Pinkel, D, Albertson, DG, Jain, A, Jenkins, R, Gray, JW, and Weiss, WA (2003). Genome-wide array CGH analysis of murine neuroblastoma reveals distinct genomic aberrations which parallel those in human tumors. Cancer Res 63, 5266-5273.

Hammoudeh, DI, Follis, AV, Prochownik, EV, and Metallo, SJ (2009). Multiple independent binding sites for small-molecule inhibitors on the oncoprotein c-Myc. J Am Chem Soc 131, 7390-7401.

Hanahan, D, and Weinberg, RA (2000). The hallmarks of cancer. Cell 100, 57-70.

Hansford, LM, Thomas, WD, Keating, JM, Burkhart, CA, Peaston, AE, Norris, MD, Haber, M, Armati, PJ, Weiss, WA, and Marshall, GM (2004). Mechanisms of embryonal tumor initiation: distinct roles for MYCN expression and MYCN amplification. Proc Natl Acad Sci U S A 101, 12664-12669.

Haraguchi, S, and Nakagawara, A (2009). A simple PCR method for rapid genotype analysis of the TH-MYCN transgenic mouse. PLoS One 4, e6902.

Hartford, CM, and Ratain, MJ (2007). Rapamycin: something old, something new, sometimes borrowed and now renewed. Clin Pharmacol Ther 82, 381-388.

Hay, N, and Sonenberg, N (2004). Upstream and downstream of mTOR. Genes Dev 18, 1926-1945.

Heath, VL, and Bicknell, R (2009). Anticancer strategies involving the vasculature. Nat Rev Clin Oncol 6, 395-404.

Hennessy, BT, Smith, DL, Ram, PT, Lu, Y, and Mills, GB (2005). Exploiting the PI3K/AKT pathway for cancer drug discovery. Nat Rev Drug Discov 4, 988-1004.

Hogarty, MD, Norris, MD, Davis, K, Liu, X, Evageliou, NF, Hayes, CS, Pawel, B, Guo, R, Zhao, H, Sekyere, E, Keating, J, Thomas, W, Cheng, NC, Murray, J, Smith, J, Sutton, R, Venn, N, London, WB, Buxton, A, Gilmour, SK, Marshall, GM, and Haber, M (2008). ODC1 is a critical determinant of MYCN oncogenesis and a therapeutic target in neuroblastoma. Cancer Res 68, 9735-9745.

Holash, J, Maisonpierre, PC, Compton, D, Boland, P, Alexander, CR, Zagzag, D, Yancopoulos, GD, and Wiegand, SJ (1999). Vessel cooption, regression, and growth in tumors mediated by angiopoietins and VEGF. Science 284, 1994-1998.

81

Holmgren, L, O'Reilly, MS, and Folkman, J (1995). Dormancy of micrometastases: balanced proliferation and apoptosis in the presence of angiogenesis suppression. Nat Med 1, 149-153.

Houghton, PJ (2009). How do we identify novel treatment for childhood cancer? Pediatr Blood Cancer 52, 310-311.

Houghton, PJ, Morton, CL, Kolb, EA, Gorlick, R, Lock, R, Carol, H, Reynolds, CP, Maris, JM, Keir, ST, Billups, CA, and Smith, MA (2008a). Initial testing (stage 1) of the mTOR inhibitor rapamycin by the pediatric preclinical testing program. Pediatr Blood Cancer 50, 799-805.

Houghton, PJ, Morton, CL, Kolb, EA, Lock, R, Carol, H, Reynolds, CP, Keshelava, N, Maris, JM, Keir, ST, Wu, J, and Smith, MA (2008b). Initial testing (stage 1) of the proteasome inhibitor bortezomib by the pediatric preclinical testing program. Pediatr Blood Cancer 50, 37-45.

Houghton, PJ, Morton, CL, Tucker, C, Payne, D, Favours, E, Cole, C, Gorlick, R, Kolb, EA, Zhang, W, Lock, R, Carol, H, Tajbakhsh, M, Reynolds, CP, Maris, JM, Courtright, J, Keir, ST, Friedman, HS, Stopford, C, Zeidner, J, Wu, J, Liu, T, Billups, CA, Khan, J, Ansher, S, Zhang, J, and Smith, MA (2007). The pediatric preclinical testing program: description of models and early testing results. Pediatr Blood Cancer 49, 928-940.

Huang, MJ, Cheng, YC, Liu, CR, Lin, S, and Liu, HE (2006). A small-molecule c-Myc inhibitor, 10058-F4, induces cell-cycle arrest, apoptosis, and myeloid differentiation of human acute myeloid leukemia. Exp Hematol 34, 1480-1489.

Hunter, T (1995). When is a lipid kinase not a lipid kinase? When it is a protein kinase. Cell 83, 1-4.

Ito, M, Hiramatsu, H, Kobayashi, K, Suzue, K, Kawahata, M, Hioki, K, Ueyama, Y, Koyanagi, Y, Sugamura, K, Tsuji, K, Heike, T, and Nakahata, T (2002). NOD/SCID/gamma(c)(null) mouse: an excellent recipient mouse model for engraftment of human cells. Blood 100, 3175-3182.

Iwamoto, T, Taniguchi, M, Wajjwalku, W, Nakashima, I, and Takahashi, M (1993). Neuroblastoma in a transgenic mouse carrying a metallothionein/ret fusion gene. Br J Cancer 67, 504-507.

Jain, RK (2005). Normalization of tumor vasculature: an emerging concept in antiangiogenic therapy. Science 307, 58-62.

Jain, RK, Duda, DG, Willett, CG, Sahani, DV, Zhu, AX, Loeffler, JS, Batchelor, TT, and Sorensen, AG (2009). Biomarkers of response and resistance to antiangiogenic therapy. Nat Rev Clin Oncol 6, 327-338.

Johnsen, JI, Kogner, P, Albihn, A, and Henriksson, MA (2009). Embryonal neural tumours and cell death. Apoptosis 14, 424-438.

Johnsen, JI, Lindskog, M, Ponthan, F, Pettersen, I, Elfman, L, Orrego, A, Sveinbjornsson, B, and Kogner, P (2004). Cyclooxygenase-2 is expressed in neuroblastoma, and nonsteroidal anti-inflammatory drugs induce apoptosis and inhibit tumor growth in vivo. Cancer Res 64, 7210-7215.

Johnson, AJ, Smith, LL, Zhu, J, Heerema, NA, Jefferson, S, Mone, A, Grever, M, Chen, CS, and Byrd, JC (2005). A novel celecoxib derivative, OSU03012, induces cytotoxicity in primary CLL cells and transformed B-cell lymphoma cell line via a caspase- and Bcl-2-independent mechanism. Blood 105, 2504-2509.

Joseph, JM, Gross, N, Lassau, N, Rouffiac, V, Opolon, P, Laudani, L, Auderset, K, Geay, JF, Muhlethaler-Mottet, A, and Vassal, G (2005). In vivo echographic evidence of tumoral vascularization and microenvironment interactions in metastatic orthotopic human neuroblastoma xenografts. Int J Cancer 113, 881-890.

82

Judware, R, Lechner, R, and Culp, LA (1995). Inverse expressions of the N-myc oncogene and beta 1 integrin in human neuroblastoma: relationships to disease progression in a nude mouse model system. Clin Exp Metastasis 13, 123-133.

Junttila, MR, and Westermarck, J (2008). Mechanisms of MYC stabilization in human malignancies. Cell Cycle 7, 592-596.

Kagedal, B, Kullman, A, Lenner, L, Trager, C, Kogner, P, and Farneback, M (2004). Pterin-dependent tyrosine hydroxylase mRNA is not expressed in human melanocytes or melanoma cells. Pigment Cell Res 17, 346-351.

Kaplan, J, De Domenico, I, and Ward, DM (2008). Chediak-Higashi syndrome. Curr Opin Hematol 15, 22-29.

Kenney, AM, Widlund, HR, and Rowitch, DH (2004). Hedgehog and PI-3 kinase signaling converge on Nmyc1 to promote cell cycle progression in cerebellar neuronal precursors. Development 131, 217-228.

Kerbel, RS (2008). Tumor angiogenesis. N Engl J Med 358, 2039-2049.

Keshelava, N, Houghton, PJ, Morton, CL, Lock, RB, Carol, H, Keir, ST, Maris, JM, Reynolds, CP, Gorlick, R, Kolb, EA, Wu, J, and Smith, MA (2009). Initial testing (stage 1) of vorinostat (SAHA) by the pediatric preclinical testing program. Pediatr Blood Cancer 53, 505-508.

Khanna, C, Jaboin, JJ, Drakos, E, Tsokos, M, and Thiele, CJ (2002). Biologically relevant orthotopic neuroblastoma xenograft models: primary adrenal tumor growth and spontaneous distant metastasis. In vivo 16, 77-85.

Kim, ES, Serur, A, Huang, J, Manley, CA, McCrudden, KW, Frischer, JS, Soffer, SZ, Ring, L, New, T, Zabski, S, Rudge, JS, Holash, J, Yancopoulos, GD, Kandel, JJ, and Yamashiro, DJ (2002). Potent VEGF blockade causes regression of coopted vessels in a model of neuroblastoma. Proc Natl Acad Sci U S A 99, 11399-11404.

Kirchgessner, CU, Patil, CK, Evans, JW, Cuomo, CA, Fried, LM, Carter, T, Oettinger, MA, and Brown, JM (1995). DNA-dependent kinase (p350) as a candidate gene for the murine SCID defect. Science 267, 1178-1183.

Knight, ZA, Gonzalez, B, Feldman, ME, Zunder, ER, Goldenberg, DD, Williams, O, Loewith, R, Stokoe, D, Balla, A, Toth, B, Balla, T, Weiss, WA, Williams, RL, and Shokat, KM (2006). A pharmacological map of the PI3-K family defines a role for p110alpha in insulin signaling. Cell 125, 733-747.

Knoepfler, PS, and Kenney, AM (2006). Neural precursor cycling at sonic speed: N-Myc pedals, GSK-3 brakes. Cell Cycle 5, 47-52.

Kockeritz, L, Doble, B, Patel, S, and Woodgett, JR (2006). Glycogen synthase kinase-3--an overview of an over-achieving protein kinase. Curr Drug Targets 7, 1377-1388.

Kojima, K, Shimanuki, M, Shikami, M, Samudio, IJ, Ruvolo, V, Corn, P, Hanaoka, N, Konopleva, M, Andreeff, M, and Nakakuma, H (2008). The dual PI3 kinase/mTOR inhibitor PI-103 prevents p53 induction by Mdm2 inhibition but enhances p53-mediated mitochondrial apoptosis in p53 wild-type AML. Leukemia 22, 1728-1736.

Kolb, EA, Gorlick, R, Houghton, PJ, Morton, CL, Lock, R, Carol, H, Reynolds, CP, Maris, JM, Keir, ST, Billups, CA, and Smith, MA (2008a). Initial testing (stage 1) of a monoclonal antibody (SCH 717454) against the IGF-1 receptor by the pediatric preclinical testing program. Pediatr Blood Cancer 50, 1190-1197.

83

Kolb, EA, Gorlick, R, Houghton, PJ, Morton, CL, Lock, RB, Tajbakhsh, M, Reynolds, CP, Maris, JM, Keir, ST, Billups, CA, and Smith, MA (2008b). Initial testing of dasatinib by the pediatric preclinical testing program. Pediatr Blood Cancer 50, 1198-1206.

Kuljaca, S, Liu, T, Tee, AE, Haber, M, Norris, MD, Dwarte, T, and Marshall, GM (2007). Enhancing the anti-angiogenic action of histone deacetylase inhibitors. Mol Cancer 6, 68.

Kurmasheva, RT, Harwood, FC, and Houghton, PJ (2007). Differential regulation of vascular endothelial growth factor by Akt and mammalian target of rapamycin inhibitors in cell lines derived from childhood solid tumors. Mol Cancer Ther 6, 1620-1628.

Kurmasheva, RT, Huang, S, and Houghton, PJ (2006). Predicted mechanisms of resistance to mTOR inhibitors. Br J Cancer 95, 955-960.

Kurooka, H, Segre, JA, Hirano, Y, Nemhauser, JL, Nishimura, H, Yoneda, K, Lander, ES, and Honjo, T (1996). Rescue of the hairless phenotype in nude mice by transgenic insertion of the wild-type Hfh11 genomic locus. Int Immunol 8, 961-966.

Lastowska, M, Chung, YJ, Cheng Ching, N, Haber, M, Norris, MD, Kees, UR, Pearson, AD, and Jackson, MS (2004). Regions syntenic to human 17q are gained in mouse and rat neuroblastoma. Genes Chromosomes Cancer 40, 158-163.

Li, Z, and Thiele, CJ (2007). Targeting Akt to increase the sensitivity of neuroblastoma to chemotherapy: lessons learned from the brain-derived neurotrophic factor/TrkB signal transduction pathway. Expert Opin Ther Targets 11, 1611-1621.

Liu, P, Cheng, H, Roberts, TM, and Zhao, JJ (2009). Targeting the phosphoinositide 3-kinase pathway in cancer. Nat Rev Drug Discov 8, 627-644.

Liu, T, Bohlken, A, Kuljaca, S, Lee, M, Nguyen, T, Smith, S, Cheung, B, Norris, MD, Haber, M, Holloway, AJ, Bowtell, DD, and Marshall, GM (2005). The retinoid anticancer signal: mechanisms of target gene regulation. Br J Cancer 93, 310-318.

Liu, T, Tee, AE, Porro, A, Smith, SA, Dwarte, T, Liu, PY, Iraci, N, Sekyere, E, Haber, M, Norris, MD, Diolaiti, D, Della Valle, G, Perini, G, and Marshall, GM (2007). Activation of tissue transglutaminase transcription by histone deacetylase inhibition as a therapeutic approach for Myc oncogenesis. Proc Natl Acad Sci U S A 104, 18682-18687.

Lock, R, Carol, H, Houghton, PJ, Morton, CL, Kolb, EA, Gorlick, R, Reynolds, CP, Maris, JM, Keir, ST, Wu, J, and Smith, MA (2008). Initial testing (stage 1) of the BH3 mimetic ABT-263 by the pediatric preclinical testing program. Pediatr Blood Cancer 50, 1181-1189.

LoPiccolo, J, Blumenthal, GM, Bernstein, WB, and Dennis, PA (2008). Targeting the PI3K/Akt/mTOR pathway: effective combinations and clinical considerations. Drug Resist Updat 11, 32-50.

Lu, X, Pearson, A, and Lunec, J (2003). The MYCN oncoprotein as a drug development target. Cancer Lett 197, 125-130.

Luscher, B, and Larsson, LG (2007). The world according to MYC. Conference on MYC and the transcriptional control of proliferation and oncogenesis. EMBO Rep 8, 1110-1114.

Lutz, W, Stohr, M, Schurmann, J, Wenzel, A, Lohr, A, and Schwab, M (1996). Conditional expression of N-myc in human neuroblastoma cells increases expression of alpha-prothymosin and ornithine decarboxylase and accelerates progression into S-phase early after mitogenic stimulation of quiescent cells. Oncogene 13, 803-812.

Lutzner, MA, Lowrie, CT, and Jordan, HW (1967). Giant granules in leukocytes of the beige mouse. J Hered 58, 299-300.

84

Marimpietri, D, Brignole, C, Nico, B, Pastorino, F, Pezzolo, A, Piccardi, F, Cilli, M, Di Paolo, D, Pagnan, G, Longo, L, Perri, P, Ribatti, D, and Ponzoni, M (2007). Combined therapeutic effects of vinblastine and rapamycin on human neuroblastoma growth, apoptosis, and angiogenesis. Clin Cancer Res 13, 3977-3988.

Maris, JM, Courtright, J, Houghton, PJ, Morton, CL, Gorlick, R, Kolb, EA, Lock, R, Tajbakhsh, M, Reynolds, CP, Keir, ST, Wu, J, and Smith, MA (2008a). Initial testing of the VEGFR inhibitor AZD2171 by the pediatric preclinical testing program. Pediatr Blood Cancer 50, 581-587.

Maris, JM, Courtright, J, Houghton, PJ, Morton, CL, Kolb, EA, Lock, R, Tajbakhsh, M, Reynolds, CP, Keir, ST, Wu, J, and Smith, MA (2008b). Initial testing (stage 1) of sunitinib by the pediatric preclinical testing program. Pediatr Blood Cancer 51, 42-48.

Maris, JM, Hogarty, MD, Bagatell, R, and Cohn, SL (2007). Neuroblastoma. Lancet 369, 2106-2120.

Marone, R, Cmiljanovic, V, Giese, B, and Wymann, MP (2008). Targeting phosphoinositide 3-kinase: moving towards therapy. Biochim Biophys Acta 1784, 159-185.

Marrella, V, Poliani, PL, Sobacchi, C, Grassi, F, and Villa, A (2008). Of Omenn and mice. Trends Immunol 29, 133-140.

Mecklenburg, L, Nakamura, M, Sundberg, JP, and Paus, R (2001). The nude mouse skin phenotype: the role of Foxn1 in hair follicle development and cycling. Exp Mol Pathol 71, 171-178.

Meitar, D, Crawford, SE, Rademaker, AW, and Cohn, SL (1996). Tumor angiogenesis correlates with metastatic disease, N-myc amplification, and poor outcome in human neuroblastoma. J Clin Oncol 14, 405-414.

Meric-Bernstam, F, and Gonzalez-Angulo, AM (2009). Targeting the mTOR signaling network for cancer therapy. J Clin Oncol 27, 2278-2287.

Meyer, N, and Penn, LZ (2008). Reflecting on 25 years with MYC. Nat Rev Cancer 8, 976-990.

Misawa, A, Hosoi, H, Tsuchiya, K, and Sugimoto, T (2003). Rapamycin inhibits proliferation of human neuroblastoma cells without suppression of MYCN. Int J Cancer 104, 233-237.

Moats, R, Ma, LQ, Wajed, R, Sugiura, Y, Lazaryev, A, Tyszka, M, Jacobs, R, Fraser, S, Nelson, MD, Jr., and DeClerck, YA (2000). Magnetic resonance imaging for the evaluation of a novel metastatic orthotopic model of human neuroblastoma in immunodeficient mice. Clin Exp Metastasis 18, 455-461.

Monclair, T, Brodeur, GM, Ambros, PF, Brisse, HJ, Cecchetto, G, Holmes, K, Kaneko, M, London, WB, Matthay, KK, Nuchtern, JG, von Schweinitz, D, Simon, T, Cohn, SL, and Pearson, AD (2009). The International Neuroblastoma Risk Group (INRG) staging system: an INRG Task Force report. J Clin Oncol 27, 298-303.

Moore, HC, Wood, KM, Jackson, MS, Lastowska, MA, Hall, D, Imrie, H, Redfern, CP, Lovat, PE, Ponthan, F, O'Toole, K, Lunec, J, and Tweddle, DA (2008). Histological profile of tumours from MYCN transgenic mice. J Clin Pathol 61, 1098-1103.

Morowitz, MJ, Barr, R, Wang, Q, King, R, Rhodin, N, Pawel, B, Zhao, H, Erickson, SA, Sheppard, GS, Wang, J, Maris, JM, and Shusterman, S (2005). Methionine aminopeptidase 2 inhibition is an effective treatment strategy for neuroblastoma in preclinical models. Clin Cancer Res 11, 2680-2685.

Morton, CL, and Houghton, PJ (2007). Establishment of human tumor xenografts in immunodeficient mice. Nat Protoc 2, 247-250.

85

Mosse, YP, Laudenslager, M, Longo, L, Cole, KA, Wood, A, Attiyeh, EF, Laquaglia, MJ, Sennett, R, Lynch, JE, Perri, P, Laureys, G, Speleman, F, Kim, C, Hou, C, Hakonarson, H, Torkamani, A, Schork, NJ, Brodeur, GM, Tonini, GP, Rappaport, E, Devoto, M, and Maris, JM (2008). Identification of ALK as a major familial neuroblastoma predisposition gene. Nature 455, 930-935.

Mustata, G, Follis, AV, Hammoudeh, DI, Metallo, SJ, Wang, H, Prochownik, EV, Lazo, JS, and Bahar, I (2009). Discovery of novel myc-max heterodimer disruptors with a three-dimensional pharmacophore model. J Med Chem 52, 1247-1250.

Nagy, JA, Benjamin, L, Zeng, H, Dvorak, AM, and Dvorak, HF (2008). Vascular permeability, vascular hyperpermeability and angiogenesis. Angiogenesis 11, 109-119.

Nagy, JA, Chang, SH, Dvorak, AM, and Dvorak, HF (2009). Why are tumour blood vessels abnormal and why is it important to know? Br J Cancer 100, 865-869.

Nakagawara, A, and Ohira, M (2004). Comprehensive genomics linking between neural development and cancer: neuroblastoma as a model. Cancer Lett 204, 213-224.

Nakamura, K, Martin, KC, Jackson, JK, Beppu, K, Woo, CW, and Thiele, CJ (2006). Brain-derived neurotrophic factor activation of TrkB induces vascular endothelial growth factor expression via hypoxia-inducible factor-1alpha in neuroblastoma cells. Cancer Res 66, 4249-4255.

Naumov, GN, Akslen, LA, and Folkman, J (2006). Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch. Cell Cycle 5, 1779-1787.

Nehls, M, Pfeifer, D, Schorpp, M, Hedrich, H, and Boehm, T (1994). New member of the winged-helix protein family disrupted in mouse and rat nude mutations. Nature 372, 103-107.

Norris, MD, Burkhart, CA, Marshall, GM, Weiss, WA, and Haber, M (2000). Expression of N-myc and MRP genes and their relationship to N-myc gene dosage and tumor formation in a murine neuroblastoma model. Med Pediatr Oncol 35, 585-589.

Opel, D, Poremba, C, Simon, T, Debatin, KM, and Fulda, S (2007). Activation of Akt predicts poor outcome in neuroblastoma. Cancer Res 67, 735-745.

Packer, RJ, Jakacki, R, Horn, M, Rood, B, Vezina, G, MacDonald, T, Fisher, MJ, and Cohen, B (2009). Objective response of multiply recurrent low-grade gliomas to bevacizumab and irinotecan. Pediatr Blood Cancer 52, 791-795.

Pagnan, G, Di Paolo, D, Carosio, R, Pastorino, F, Marimpietri, D, Brignole, C, Pezzolo, A, Loi, M, Galietta, LJ, Piccardi, F, Cilli, M, Nico, B, Ribatti, D, Pistoia, V, and Ponzoni, M (2009). The combined therapeutic effects of bortezomib and fenretinide on neuroblastoma cells involve endoplasmic reticulum stress response. Clin Cancer Res 15, 1199-1209.

Panopoulou, E, Murphy, C, Rasmussen, H, Bagli, E, Rofstad, EK, and Fotsis, T (2005). Activin A suppresses neuroblastoma xenograft tumor growth via antimitotic and antiangiogenic mechanisms. Cancer Res 65, 1877-1886.

Pantelouris, EM (1968). Absence of thymus in a mouse mutant. Nature 217, 370-371.

Park, S, Chapuis, N, Bardet, V, Tamburini, J, Gallay, N, Willems, L, Knight, ZA, Shokat, KM, Azar, N, Viguie, F, Ifrah, N, Dreyfus, F, Mayeux, P, Lacombe, C, and Bouscary, D (2008). PI-103, a dual inhibitor of Class IA phosphatidylinositide 3-kinase and mTOR, has antileukemic activity in AML. Leukemia 22, 1698-1706.

Pastorino, F, Di Paolo, D, Piccardi, F, Nico, B, Ribatti, D, Daga, A, Baio, G, Neumaier, CE, Brignole, C, Loi, M, Marimpietri, D, Pagnan, G, Cilli, M, Lepekhin, EA, Garde, SV, Longhi, R,

86

Corti, A, Allen, TM, Wu, JJ, and Ponzoni, M (2008). Enhanced antitumor efficacy of clinical-grade vasculature-targeted liposomal doxorubicin. Clin Cancer Res 14, 7320-7329.

Pecori Giraldi, F, Mizobuchi, M, Horowitz, ZD, Downs, TR, Aleppo, G, Kier, A, Wagner, T, Yun, JS, Kopchick, JJ, and Frohman, LA (1994). Development of neuroepithelial tumors of the adrenal medulla in transgenic mice expressing a mouse hypothalamic growth hormone-releasing hormone promoter-simian virus-40 T-antigen fusion gene. Endocrinology 134, 1219-1224.

Peifer, C, and Alessi, DR (2008). Small-molecule inhibitors of PDK1. ChemMedChem 3, 1810-1838.

Peterson, JK, and Houghton, PJ (2004). Integrating pharmacology and in vivo cancer models in preclinical and clinical drug development. Eur J Cancer 40, 837-844.

Petroulakis, E, Mamane, Y, Le Bacquer, O, Shahbazian, D, and Sonenberg, N (2006). mTOR signaling: implications for cancer and anticancer therapy. Br J Cancer 94, 195-199.

Ponthan, F, Wickstrom, M, Gleissman, H, Fuskevag, OM, Segerstrom, L, Sveinbjornsson, B, Redfern, CP, Eksborg, S, Kogner, P, and Johnsen, JI (2007). Celecoxib prevents neuroblastoma tumor development and potentiates the effect of chemotherapeutic drugs in vitro and in vivo. Clin Cancer Res 13, 1036-1044.

Prevo, R, Deutsch, E, Sampson, O, Diplexcito, J, Cengel, K, Harper, J, O'Neill, P, McKenna, WG, Patel, S, and Bernhard, EJ (2008). Class I PI3 kinase inhibition by the pyridinylfuranopyrimidine inhibitor PI-103 enhances tumor radiosensitivity. Cancer Res 68, 5915-5923.

Pritchard-Jones, K, Kaatsch, P, Steliarova-Foucher, E, Stiller, CA, and Coebergh, JW (2006). Cancer in children and adolescents in Europe: developments over 20 years and future challenges. Eur J Cancer 42, 2183-2190.

Prochownik, EV (2008). c-Myc: linking transformation and genomic instability. Curr Mol Med 8, 446-458.

Radhakrishnan, SK, Halasi, M, Bhat, UG, Kurmasheva, RT, Houghton, PJ, and Gartel, AL (2008). Proapoptotic compound ARC targets Akt and N-myc in neuroblastoma cells. Oncogene 27, 694-699.

Raynaud, FI, Eccles, S, Clarke, PA, Hayes, A, Nutley, B, Alix, S, Henley, A, Di-Stefano, F, Ahmad, Z, Guillard, S, Bjerke, LM, Kelland, L, Valenti, M, Patterson, L, Gowan, S, de Haven Brandon, A, Hayakawa, M, Kaizawa, H, Koizumi, T, Ohishi, T, Patel, S, Saghir, N, Parker, P, Waterfield, M, and Workman, P (2007). Pharmacologic characterization of a potent inhibitor of class I phosphatidylinositide 3-kinases. Cancer Res 67, 5840-5850.

Roder, J, and Duwe, A (1979). The beige mutation in the mouse selectively impairs natural killer cell function. Nature 278, 451-453.

Rossler, J, Taylor, M, Geoerger, B, Farace, F, Lagodny, J, Peschka-Suss, R, Niemeyer, CM, and Vassal, G (2008). Angiogenesis as a target in neuroblastoma. Eur J Cancer 44, 1645-1656.

Rounbehler, RJ, Li, W, Hall, MA, Yang, C, Fallahi, M, and Cleveland, JL (2009). Targeting ornithine decarboxylase impairs development of MYCN-amplified neuroblastoma. Cancer Res 69, 547-553.

Saint Raymond, A, and Brasseur, D (2005). Development of medicines for children in Europe: ethical implications. Paediatr Respir Rev 6, 45-51.

87

Sampson, VB, Rong, NH, Han, J, Yang, Q, Aris, V, Soteropoulos, P, Petrelli, NJ, Dunn, SP, and Krueger, LJ (2007). MicroRNA let-7a down-regulates MYC and reverts MYC-induced growth in Burkitt lymphoma cells. Cancer Res 67, 9762-9770.

Sargeant, AM, Klein, RD, Rengel, RC, Clinton, SK, Kulp, SK, Kashida, Y, Yamaguchi, M, Wang, X, and Chen, CS (2007). Chemopreventive and bioenergetic signaling effects of PDK1/Akt pathway inhibition in a transgenic mouse model of prostate cancer. Toxicol Pathol 35, 549-561.

Sartelet, H, Oligny, LL, and Vassal, G (2008). AKT pathway in neuroblastoma and its therapeutic implication. Expert Rev Anticancer Ther 8, 757-769.

Schonthal, AH, Chen, TC, Hofman, FM, Louie, SG, and Petasis, NA (2008). Celecoxib analogs that lack COX-2 inhibitory function: preclinical development of novel anticancer drugs. Expert Opin Investig Drugs 17, 197-208.

Schwab, M (2004). MYCN in neuronal tumours. Cancer Lett 204, 179-187.

Schwab, M, Alitalo, K, Klempnauer, KH, Varmus, HE, Bishop, JM, Gilbert, F, Brodeur, G, Goldstein, M, and Trent, J (1983). Amplified DNA with limited homology to myc cellular oncogene is shared by human neuroblastoma cell lines and a neuroblastoma tumour. Nature 305, 245-248.

Schwab, M, Westermann, F, Hero, B, and Berthold, F (2003). Neuroblastoma: biology and molecular and chromosomal pathology. Lancet Oncol 4, 472-480.

Scotting, PJ, Walker, DA, and Perilongo, G (2005). Childhood solid tumours: a developmental disorder. Nat Rev Cancer 5, 481-488.

Servenius, B, Vernachio, J, Price, J, Andersson, LC, and Peterson, PA (1994). Metastasizing neuroblastomas in mice transgenic for simian virus 40 large T (SV40T) under the olfactory marker protein gene promoter. Cancer Res 54, 5198-5205.

Shankar, SL, Krupski, M, Parashar, B, Okwuaka, C, O'Guin, K, Mani, S, and Shafit-Zagardo, B (2004). UCN-01 alters phosphorylation of Akt and GSK3beta and induces apoptosis in six independent human neuroblastoma cell lines. J Neurochem 90, 702-711.

Shih, T, and Lindley, C (2006). Bevacizumab: an angiogenesis inhibitor for the treatment of solid malignancies. Clin Ther 28, 1779-1802.

Shimada, H, Umehara, S, Monobe, Y, Hachitanda, Y, Nakagawa, A, Goto, S, Gerbing, RB, Stram, DO, Lukens, JN, and Matthay, KK (2001). International neuroblastoma pathology classification for prognostic evaluation of patients with peripheral neuroblastic tumors: a report from the Children's Cancer Group. Cancer 92, 2451-2461.

Shinkai, Y, Rathbun, G, Lam, KP, Oltz, EM, Stewart, V, Mendelsohn, M, Charron, J, Datta, M, Young, F, Stall, AM, and et al. (1992). RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell 68, 855-867.

Simon, JA (2006). Using isoform-specific inhibitors to target lipid kinases. Cell 125, 647-649.

Sims, TL, Williams, RF, Ng, CY, Rosati, SF, Spence, Y, and Davidoff, AM (2008). Bevacizumab suppresses neuroblastoma progression in the setting of minimal disease. Surgery 144, 269-275.

Skalnik, DG, Dorfman, DM, Williams, DA, and Orkin, SH (1991). Restriction of neuroblastoma to the prostate gland in transgenic mice. Mol Cell Biol 11, 4518-4527.

Smith, MA, Morton, CL, Phelps, DA, Kolb, EA, Lock, R, Carol, H, Reynolds, CP, Maris, JM, Keir, ST, Wu, J, and Houghton, PJ (2008). Stage 1 testing and pharmacodynamic evaluation of

88

the HSP90 inhibitor alvespimycin (17-DMAG, KOS-1022) by the pediatric preclinical testing program. Pediatr Blood Cancer 51, 34-41.

Steelman, LS, Stadelman, KM, Chappell, WH, Horn, S, Basecke, J, Cervello, M, Nicoletti, F, Libra, M, Stivala, F, Martelli, AM, and McCubrey, JA (2008). Akt as a therapeutic target in cancer. Expert Opin Ther Targets 12, 1139-1165.

Steliarova-Foucher, E, Stiller, C, Kaatsch, P, Berrino, F, and Coebergh, JW (2005). Trends in childhood cancer incidence in Europe, 1970-99. Lancet 365, 2088.

Suggitt, M, and Bibby, MC (2005). 50 years of preclinical anticancer drug screening: empirical to target-driven approaches. Clin Cancer Res 11, 971-981.

Sun, SY, Rosenberg, LM, Wang, X, Zhou, Z, Yue, P, Fu, H, and Khuri, FR (2005). Activation of Akt and eIF4E survival pathways by rapamycin-mediated mammalian target of rapamycin inhibition. Cancer Res 65, 7052-7058.

Svensson, A, Backman, U, Jonsson, E, Larsson, R, and Christofferson, R (2002). CHS 828 inhibits neuroblastoma growth in mice alone and in combination with antiangiogenic drugs. Pediatr Res 51, 607-611.

Tajbakhsh, M, Houghton, PJ, Morton, CL, Kolb, EA, Gorlick, R, Maris, JM, Keir, ST, Wu, J, Reynolds, CP, Smith, MA, and Lock, RB (2008). Initial testing of cisplatin by the pediatric preclinical testing program. Pediatr Blood Cancer 50, 992-1000.

Talmadge, JE, Singh, RK, Fidler, IJ, and Raz, A (2007). Murine models to evaluate novel and conventional therapeutic strategies for cancer. Am J Pathol 170, 793-804.

Thoreen, CC, Kang, SA, Chang, JW, Liu, Q, Zhang, J, Gao, Y, Reichling, LJ, Sim, T, Sabatini, DM, and Gray, NS (2009). An ATP-competitive mammalian target of rapamycin inhibitor reveals rapamycin-resistant functions of mTORC1. J Biol Chem 284, 8023-8032.

Toftgard, R (2000). Hedgehog signalling in cancer. Cell Mol Life Sci 57, 1720-1731.

Träger C, Caren H, Kryh H, Martinsson T, Gustafsson G, Kogner P. (2009). A survey of neuroblastoma incidence, biology and outcome in Sweden 1982-2008.

Tseng, PH, Lin, HP, Zhu, J, Chen, KF, Hade, EM, Young, DC, Byrd, JC, Grever, M, Johnson, K, Druker, BJ, and Chen, CS (2005). Synergistic interactions between imatinib mesylate and the novel phosphoinositide-dependent kinase-1 inhibitor OSU-03012 in overcoming imatinib mesylate resistance. Blood 105, 4021-4027.

Tweddle, DA, Pearson, AD, Haber, M, Norris, MD, Xue, C, Flemming, C, and Lunec, J (2003). The p53 pathway and its inactivation in neuroblastoma. Cancer Lett 197, 93-98.

Wagner, LM, and Danks, MK (2009). New therapeutic targets for the treatment of high-risk neuroblastoma. J Cell Biochem 107, 46-57.

Wang, H, Hammoudeh, DI, Follis, AV, Reese, BE, Lazo, JS, Metallo, SJ, and Prochownik, EV (2007). Improved low molecular weight Myc-Max inhibitors. Mol Cancer Ther 6, 2399-2408.

Wang, YC, Kulp, SK, Wang, D, Yang, CC, Sargeant, AM, Hung, JH, Kashida, Y, Yamaguchi, M, Chang, GD, and Chen, CS (2008). Targeting endoplasmic reticulum stress and Akt with OSU-03012 and gefitinib or erlotinib to overcome resistance to epidermal growth factor receptor inhibitors. Cancer Res 68, 2820-2830.

Vassal, G (2009). Will children with cancer benefit from the new European Paediatric Medicines Regulation? Eur J Cancer 45, 1535-1546.

89

Wassberg, E, Hedborg, F, Skoldenberg, E, Stridsberg, M, and Christofferson, R (1999). Inhibition of angiogenesis induces chromaffin differentiation and apoptosis in neuroblastoma. Am J Pathol 154, 395-403.

Weiss, WA, Aldape, K, Mohapatra, G, Feuerstein, BG, and Bishop, JM (1997). Targeted expression of MYCN causes neuroblastoma in transgenic mice. EMBO J 16, 2985-2995.

Weiss, WA, Godfrey, T, Francisco, C, and Bishop, JM (2000). Genome-wide screen for allelic imbalance in a mouse model for neuroblastoma. Cancer Res 60, 2483-2487.

Weng, SC, Kashida, Y, Kulp, SK, Wang, D, Brueggemeier, RW, Shapiro, CL, and Chen, CS (2008). Sensitizing estrogen receptor-negative breast cancer cells to tamoxifen with OSU-03012, a novel celecoxib-derived phosphoinositide-dependent protein kinase-1/Akt signaling inhibitor. Mol Cancer Ther 7, 800-808.

Wickstrom, M, Johnsen, JI, Ponthan, F, Segerstrom, L, Sveinbjornsson, B, Lindskog, M, Lovborg, H, Viktorsson, K, Lewensohn, R, Kogner, P, Larsson, R, and Gullbo, J (2007). The novel melphalan prodrug J1 inhibits neuroblastoma growth in vitro and in vivo. Mol Cancer Ther 6, 2409-2417.

Vita, M, and Henriksson, M (2006). The Myc oncoprotein as a therapeutic target for human cancer. Semin Cancer Biol 16, 318-330.

Vitali, R, Mancini, C, Cesi, V, Tanno, B, Piscitelli, M, Mancuso, M, Sesti, F, Pasquali, E, Calabretta, B, Dominici, C, and Raschella, G (2009). Activity of tyrosine kinase inhibitor Dasatinib in neuroblastoma cells in vitro and in orthotopic mouse model. Int J Cancer 125, 2547-2555.

Workman, P, Clarke, PA, Guillard, S, and Raynaud, FI (2006). Drugging the PI3 kinome. Nat Biotechnol 24, 794-796.

Wu, CH, van Riggelen, J, Yetil, A, Fan, AC, Bachireddy, P, and Felsher, DW (2007). Cellular senescence is an important mechanism of tumor regression upon c-Myc inactivation. Proc Natl Acad Sci U S A 104, 13028-13033.

Wullschleger, S, Loewith, R, and Hall, MN (2006). TOR signaling in growth and metabolism. Cell 124, 471-484.

Yin, X, Giap, C, Lazo, JS, and Prochownik, EV (2003). Low molecular weight inhibitors of Myc-Max interaction and function. Oncogene 22, 6151-6159.

Zeng, M, and Zhou, JN (2008). Roles of autophagy and mTOR signaling in neuronal differentiation of mouse neuroblastoma cells. Cell Signal 20, 659-665.

Zhang, S, Suvannasankha, A, Crean, CD, White, VL, Johnson, A, Chen, CS, and Farag, SS (2007). OSU-03012, a novel celecoxib derivative, is cytotoxic to myeloma cells and acts through multiple mechanisms. Clin Cancer Res 13, 4750-4758.

Zhu, J, Huang, JW, Tseng, PH, Yang, YT, Fowble, J, Shiau, CW, Shaw, YJ, Kulp, SK, and Chen, CS (2004). From the cyclooxygenase-2 inhibitor celecoxib to a novel class of 3-phosphoinositide-dependent protein kinase-1 inhibitors. Cancer Res 64, 4309-4318.

90

’Jag kastar stenar i mitt glashus / Jag kastar pil i min kuvös Och så odlar Jag min rädsla / Jag sår ständigt nya frön

Och i mitt växthus är Jag säker / Där växer avund klar och grön Jag är livrädd för att leva / Och Jag är dödsrädd för att dö’

(Mannen i den vita hatten (16 år senare), Du & Jag döden, 2005)