Stephen Hsu, Fei Huang, Liming Wang, Sipra Banerjee,Sidney Winawer, and Eileen Friedman2

Laboratory of Gastrointestinal cancer Research, Memorial Sloan-Ketteringcancer center, New York, New York 10021 [5. H., F. H., S. W., E. F.),and Department of Cancer Biology, Research Institute, The ClevelandClinic Foundation, Cleveland, Ohio 44195 IL. W., S. B.J

Vol. 5, 909-917, September 1994 cell Growth & Differentiation 909

The Role of nm23 in Transforming Growth Factor �1 -

mediated Adherence and Growth Arrest’

Abstrad

nm23 has properties of a metastasis suppressor gene andalso has been implicated in the control of response totransforming growth fador 131 (TGFI31) by studies inmelanoma cells. In this report, we have examined therole of nm23 in two HT29 colon carcinoma sublines atdifferent stages in tumor progression with differentresponses to TGFfJ1 : the HD3 subline, which showsTGF131 -induced growth arrest and differentiation; andthe more invasive and tumorigenic U9 subline, whichinduces tumors 7-fold as large as those induced byHD3 cells with one-half the latency. Analysis bysemiquantitative reverse transcription-polymerase chainreadion showed that antisense phosphorothiolatedoligonucleotides to the nm23 initiation site (nm23 ASoligos) decreased nm23 mRNA levels 2-8-fold in HD3and U9 cells when normalized to fP-adin mRNA levels.However, a role for nm23 in TGF131 -mediated responsescould only be found in HD3 cells. nm23 AS oligosinhibited the differentiation property of cell adherenceover 90% in HD3 cells, and this loss of adherence couldbe partially blocked by concurrent treatment withTGF131 . In contrast, U9 cell adherence was notdetedably altered by nm23 AS oligos, whether added inthe presence or absence of TGFI31 . The TGFI31 -inducedinhibition of HD3 cell proliferation was blocked bynm23 AS oligos, whereas the TGF131 -inducedproliferation of U9 cells was unaffeded by nm23 ASoligos. TGFI31 increases nm23 mRNA and protein levelsin HD3 cells, which may explain the opposing effects ofnm23 AS oligos and TGF131 in these cells. No mutationin the coding sequence of nm23 was detected in U9cells to explain the lack of effeds of nm23 AS oligos.nm23 mRNA and protein levels were similar in the twolines.

We have recently shown that TGF131 induces twodistind signal transdudion pathways in epithelial cells(Z. Yan et aL, J. Biol. Chem., 269:13231-13237, 1994),one leading to increased cell adherence and growtharrest in HD3 cells, with the other leading to increasedinvasion and tumorigenicity in U9 cells. The data in thecurrent study indicate that nm23 fundions only in the

TGF131 signaling pathway leading to growth arrest anddifferentiation. After colon carcinoma cells haveprogressed to a more aggressive phenotype and useTGF131 to stimulate growth and invasion (S. Hsu, et aL,Cell Growth & Duff., 5: 267-275, 1 994), the secondTGF131 signaling pathway is used which does not includenm23. Loss of nm23 fundion occurs in melanoma cellsbecause of a decrease in expression level, whereas bythis model in more aggressive colon carcinoma cells,loss of nm23 fundion occurs by use of an alternativeTGFf31 signaling pathway.

Introdudion

Expression of the nm233 gene has been inversely correlatedwith tumor metastatic potential in rodent melanoma modelsand in human metastatic malignant melanomas (1-4). Lownm23 mRNA levels have been seen in human primaryinfiltrating ductal breast carcinomas with lymph node in-volvement and other indicators of poor prognosis (5, 6),although no correlation was seen with the NDP kinase

activity of nm23 (7). Reduced expression of nm23 has alsobeen correlated with metastasis of hepatocellular carcino-mas (8). In contrast, evidence has been presented for nm23RNA overexpression, DNA amplification, and mutation inaggressive childhood neuroblastomas (9), suggesting thatmolecular alterations in nm23 other than its reduced ex-pression can be associated with tumor aggression. In-creased nm23-H1 and nm23-H2 mRNA levels (1 0) and,using RNase protection analysis, absence of nm23 muta-tions in colon carcinomas of both low and high metastaticpotential have been reported (1 1 ), suggesting that nm23plays no role in colon cancer metastases. However, asso-ciations of nm23-H1 allelic deletions with distant metasta-ses of colorectal cancer have been observed (1 2), and de-letions in the coding sequence of nm23-H1 and allelicdeletions of this gene have been observed associated withsome colorectal adenocarcinomas with metastases (1 3).

Malignant melanomas with low expression of nm23 pro-liferate in response to TGFJ31 , whereas transfection of wild-type nm23 into these cells inhibits this response (1), sug-gesting that the nm23 gene product may regulate a TGF�31 -

induced signaling system. We have shown that whenhuman colon carcinoma cells become more aggressive inVivo, they no longer are inhibited by TGF�1 in vitro butinstead are stimulated to proliferate (1 4). We have devel-

oped cell lines that model these responses (1 5, 1 6). In thecurrent study, we have shown that, in weakly tumorigenicHD3 cells, TGFf31 -induced growth inhibition and cell ad-herence can be blocked by AS phosphorothiolated oligos to

Received 10/28/93; revised 6/1 3/94; accepted 6/27/94.1 Supported by National cancer institute Grants ROl CA45783 (to E. F.) and

Gi Oncology Training Grant IT 32CA09628 (to 5. W.).2 To whom requests for reprints should be addressed, at Memorial Sloan-Kettering cancer center, Box 244, 1275 York Avenue, New York, NY 10021.

3 The abbreviations used are: nm23, nonmetastatic 23 gene; NDP, nucleo-

side diphosphate kinase; TGF�31 , transforming growth factor f31 ; AS oligos,antisense oligonucleotides; RT-P�R, reverse transcription-polymerase chain

reaction; bp, base pair(s); MBP, myelin basic protein; MAP, mitogen-acti-vated protein; DMEM, Dulbecco’s modified Eagle’s medium; cDNA, com-plementary DNA; SDS, sodium dodecyl sulfate; SSC,standard saline citrate.

A

80

U)

C.)

C,)

I

Ca)a)

.C

�04

Ca)C.)

a)a.

40

I

0AS AS RD CT

+TG FBi

B

80

40

(I)

a)

C.)

0)

C

a)

a)

�0

4

Ca)U

a)a.

Fig. 1. Phosphorothiolated AS oligos to nm23 inhibit HD3 cell adherence(A) but have only marginal effects on U9 cell adherence (B). Cells wereincubated with either 10 �M nm23 AS, 1 0 �M nm23 AS plus 5 ng/ml TGFf31,1 0 �M random sequence phosphorothiolated oligos (RO), or left untreated for24 h (CT); then nonadherent cells were removed with two washes with

phosphate-buffered saline. The remaining adherent cells were counted

following trypsinization and normalized to control values. Data, mean;bars, SE.

AS AS RD CT+TGFB1

910 nm23 in TGFf31 -mediated Adherence and Growth Arrest

nm23. These AS oligos, in contrast, do not modulate eitheradherence or TGF�1 growth stimulation in the highly tu-morigenic colon Carcinoma Cell line U9. These data mdi-cate a role for nm23 only in TGFf31 signaling leading togrowth inhibition and differentiation but not in TGF�1 sig-naling leading to proliferation and invasion.

Results

nm23 was implicated in the TGF�31 signaling pathway be-

cause melanoma cells with low nm23 expression lost pro-liferative response to TGFf31 when transfected with the

wild-type nm23 expression plasmid (1). We found a parallelsystem in two sublines of the HT29 colon carcinoma line.Although both lines have equal numbers ofTGFj3 receptors,undifferentiated U9 cells are growth stimulated by TGF31,whereas enterocytic differentiated HD3 cells are growthinhibited (1 5-1 7). Since the differences in response to

TGF�1 in colon carcinoma cells were not due to differencesin levels of expression of nm23 mRNA (data not shown),

another explanation was sought. We examined the role ofnm23 in two different TGFf31 -induced responses, growthinhibition and adherence, in the colon carcinoma cell linesusing AS oligos.

We had shown previously that enterocytic Cell adherenceis mediated by TGFf31 , which increases cell surface expres-

sion of integrin a2 (1 6). Enterocytic differentiated HD3 cellsproduce and activate TGF�31 (1 5), which they use to main-tam increased expression of adhesion molecules and tight

adherence to plastic and collagen I (1 5, 1 6). We sought toblock the effect ofautocrine TGFf31 on HD3 cell adherence

by nm23 AS oligos. Twenty-one-nucleotide long phospho-rothiolated AS oligos were made to the nm23 DNA se-

quence beginning at the initiation site (see “Materials andMethods”). We observed in each of several experimentsthat HD3 cells incubated with the nm23 AS oligos lostadherence to the tissue culture plasticware. A 1 -day expo-sure to nm23 AS oligos left over 95% of the cells looselyadherent to the Petri dish (Fig. 1A; one of 3 duplicateexperiments with similar results). Phosphorothiolated oligosof random sequence inhibited adherence by only 19%,whereas 7% of control cells became loosely adherent inthese experiments (Fig. 1A). Photomicrographs showed thatindividual flat, tightly adherent HD3 cells (Fig. 2A) becamerounded after nm23 AS treatment (Fig. 2C). HD3 cells thathad been adherent to one another in small monolayerpatches remained laterally adherent after nm23 AS treat-ment but lost their adherence to the plate, forming smallorganoid bodies (Fig. 2, compare C and F with A and B).Thus, the nm23 AS oligos inhibited cell to substratum con-tact, not cell-to-cell adhesion. The random sequence oligoshad no major effect on cell morphology (Fig. 2B). nm23 ASoligos inhibition of HD3 cell adherence could be blockedby concurrent treatment of cells with TGF�31 . In each ofthree experiments, TGF�31 partially restored HD3 cell ad-herence (Fig. 1A), and cell morphology became more flat-tened than cells treated with nm23 AS oligos alone (Fig. 2,D and F, compare with C and E). Thus, nm23 maintainsadherence of enterocytic differentiated HD3 cells to thesubstratum. In contrast, nm23 AS oligos only inhibited U9cell adherence slightly (Fig. 1 B) compared to random se-quence oligos, and the small effect was not modulated byconcurrent treatment with TGF�31 . The marginal effect onadherence caused by the nm23 AS oligos might be due to

a toxic effect on the NDP kinase activity of the nm23protein (21).

One explanation for the lack of effect of the nm23 ASoligos on U9 cell adherence could have been the lack ofdegradation of nm23 mRNA in AS-treated U9 cells. Thiswas not the case. Analysis of mRNA populations in HD3and U9 cells either untreated or treated with either nm23 ASor random sequence phosphorothiolated oligos was per-formed by semiquantitative RT-PCR. The level of f3-actinmRNA was used as an internal control in each sample.nm23 AS oligos decreased nm23 mRNA levels in both U9and HD3 cells, normalized to �-actin mRNA levels (Fig.3A) in duplicate experiments. Densitometry showed that ASoligos decreased nm23 mRNA levels to 1 2% of controllevels in U9 cells and to 43% of control levels in HD3 cellswhen normalized to �3-actin expression levels (Fig. 3B).

(-I _3AS+i�.ri

Cell Growth & Differentiation 911

Fig. 2. Effect of phosphorothio-lated nm23 AS oligos on morphol-

ogy and adherence of HD3 cells.A, untreated HD3 cells; B, HD3

cells treated for 24 h with 10 �M

random phosphorothiolated oh-gos; C, HD3 cells treated for 24 h

with 10 hiM nm23 AS; D, HD3 cellstreated for 24 h with 1 0 �M nm23AS and 5 ng/mh TGF�31; E, lowermagnification of HD3 cells treated

with 10 �M nm23 AS for 24 h; F,lower magnification of HD3 cellstreated with 10 �M nm23 AS plus 5ng/ml TGFf31 for 24 h. A-D, X 88;Eand F, x 35.

Thus, nm23 AS oligos were effective in reducing nm23mRNA levels in both U9 and HD3 cells but only affectedadherence in HD3 cells. The smaller depression of nm23mRNA levels in HD3 cells may be due to a compensatoryincrease induced by autocrine TGFI31 (15, 19). An increasein nm23 mRNA level was induced by exogenous TGF�1only in HD3 cells, not in U9 cells, and will be discussedmore fully (Figs. 8 and 9).

A second effect of TGF�1 was examined. TGFf31 inhibitsthe proliferation of HD3 cells by blocking phosphorylationof the retinoblastoma protein (1 7). HD3 cells were culturedwith either 1 0 �M nm23 AS or 1 0 �M of phosphorothiolatedoligonucleotides of random sequence as control in the pres-ence or absence of 20 ng/ml TGF�31 . Prior studies showedthat 2 days of TGFI31 treatment inhibited HD3 growth only20-30%; therefore, only small variations in growth couldbe measured (1 5). Longer-term experiments could not bedone because nm23 AS oligos itself was growth inhibitory,possibly through its effects on the NDP kinase activity ofnm23 (21).

Blocking nm23 expression by AS oligos prevented theinhibition ofHD3 cells byTGF�1 in each offivecell growthexperiments. TGF31 inhibited HD3 cell growth over 30%(t < 0.001) in cells concurrently treated with phosphoro-thiolated oligos of random sequence, whereas no growthinhibition by TGF�31 was seen when HD3 cells were cul-tured with nm23 AS oligos and TGFj31 (Fig. 4). These resultsindicated that the nm23 protein played a role in a second

TGF�1 -mediated response, growth inhibition.TGFf31 stimulates the growth of U9 cells (16) by increas-

ing phosphorylation of the retinoblastoma protein (1 7). Thisgrowth stimulation by TGFf31 was small in these experi-ments, about 20% over control levels after 2 days. A 20%growth stimulation of U9 cells by TGF�1 was seen whethercells were treated in the presence of nm23 AS oligos orrandom sequence oligos (Fig. 5). Although nm23 AS oligosdecreased nm23 mRNA levels 2-3-fold in both U9 andHD3 cells, only the TGFf31 signaling pathway in HD3 cellswas affected. Neither U9 cell adherence nor proliferationwas measureably altered by treatment with nm23 AS oligos.

HD3 U9II

ARCARC

30

B

A

nm23-

�-actin -

.T ASRDCT

Treatment of Celia

Fig. 3. A, nm23 AS ohigos reduce nm23 mRNA levels in both HD3 and U9cells. HD3 and U9 cells (5 X 104/well) were treated with 10 hiM of eithernm23 AS or random sequence ohigos or left untreated for 24 h. Total RNA

was extracted, and the nm23 and )3-actin mRNAs in each sample wereamplified by semiquantitative RT-PCR (see “Materials and Methods”); the533-bp nm23 product and the 429-bp fI-actin product were separated by

agarose gel electrophoresis, and the amplified bands were identified byNorthern analysis (see ‘Materials and Methods”). B, nm23 mRNA levels innm23 AS-treated (AS) and random phosphorothiolated oligo-treated (RD)

cells by RT-PCR normalized to f3-actin mRNA levels by densitometry of (A)(shorter exposure for f3-actin).

Random nm23AS

TGFBI - +

C.)0.

e

a-J

‘5z

E

C

0

aC.)

EC

100

80

60

40

20

0

- +

t<0.001

Fig. 4. nm23 AS oligos block the inhibitory effect of TGFf31 on the prohif-eration of HD3 cells. HD3 cells were plated at 5 x 104/well in 24-well

plates, 8 wells/point, in serum-free ITS-DMEM (see “Materials and Methods”)

supplemented with either 1 0 �M nm23 AS or random sequence phosphoro-thiolated ohigo with (+) or without (-) 20 ng/ml TGF�1, as indicated. Twodays later, cells in the supernatant and cells remaining adherent to the plastic

were pooled after separate trypsinizations and counted visually. Each datapoint is the mean of eight independent determinations. Bars, SE. Student’sone-tailed ttest was used to analyze data pairs, as shown. TGF31 induced astatistically significant (t < 0.001) decrease in cell number only in thepresence of random sequence ohigos. No statistical difference was seen whennm23 AS ohigos were tested.

I

912 nm23 in TGF31 -mediated Adherence and Growth Arrest

We (L. W. and S. B.) have reported deletions in thecoding region of nm23-H1 in some colon tumors (1 3).Possibly the lack ofeffect of nm23 AS oligos in U9 cells wasdue to a deletion or mutation in the gene which rendered itinactive. The entire coding region of the nm23-H1 allele inU9 cells was sequenced following RT-PCR. The PCR prod-uct generated from U9 total RNA appeared identical in sizeto the one generated from normal colonic mucosal RNA(533 bp; Fig. 6). Sequencing of the PCR product generatedfrom the expressed nm23-H1 allele demonstrated no dele-tion or mutation in this gene in U9 cells (data not shown).Thus, the lack of effect of nm23 AS oligos on TGFI31 sig-naling in U9 cells was not caused by a deletion or mutationin the coding region of the nm23 gene.

Regulation of nm23 expression by TGF�1 on the RNAlevel was compared. Treatment with TGFI31 for 1-4 h

000� 200

a)

U)

a)C.)

increased nm23 mRNA levels 2-6 fold in each of twoenterocytic differentiated, TGF31 growth-inhibited celllines, HD3 and HD4 (Northern blots in Fig. 7; Fig. 8, blotsnormalized to f3-actin levels at each time point). In contrast,TGF�31 did not increase nm23 expression in either of twoundifferentiated, TGFf31 growth-stimulated cell lines, U9 orHP1 (Fig. 7; Fig. 8, data normalized to j3-actin levels). Two

nm23 genes have been reported, with nm23-H1 encoding

a Mr 1 8,500 species and nm23-H2 a Mr 1 7,000 species (1,2, 6). Two nm23 protein species of these sizes were ob-served in cytoplasmic extracts from each of the four celllines by Western blotting with anti-peptide antisera, dem-onstrating that nm23 proteins were made in each line (Fig.9). TGF�31 treatment for 8 to 24 h increased nm23 proteinlevels about 30% in HD3 cells but did not modulate levelsin U9 cells (Fig. 9). Thus, TGF�1 acts to increase nm23expression in cells it differentiates and growth inhibits butdoes not increase expression in cells resistant to differenti-ation and growth inhibition by TGFf31.

The nm23-H2 allele is identical in sequence to the hu-man c-myctranscription factor PuF (20). Induction of nm23mRNA by TGFf31 in HD3 cells did not lead to increasedc-myc expression but the opposite. One to 4 h of TGF�31treatment induced nm23 expression but inhibited c-mycexpression in HD3 cells(Fig. 10). In contrast, TGF�31 inhib-ited c-myc expression but had no effect on nm23 expressionin U9 cells. Thus, while inhibition of c-myc expression iscommon to the TGF�31 response in both cell lines, no directlink between nm23 expression and expression of c-mycwas seen.

The HD3 and U9 cell lines do not differ in mutation ordeletion in four genes responsible for colon cancer devel-

000

0

a)

U)

a)C.)

50

40

30

20

io

0Random nm23AS

0 1 2 4 1D1DT

- �,.$..1 HD3

��*�-#{149} HD4

- #{149}..�*. u9

-Il12301033

653

517

453

394

298

Th-1 �

Cell Growth & Differentiation 913

4 F. Huang, et a!., manuscript in preparation. S 5� Hsu, S. Sauma, and E. Friedman, manuscript in preparation.

TGFB1 - + - +

t<0.00i t<0.001

Fig. 5. nm23 AS oligos do not block the U9 cell proliferation induced by

TGF�1 . U9 cells were plated at 6 X 1 04/well in 24-well plates, 8 wells/point,

in serum-free ITS-DMEM (see ‘Materials and Methods”) supplemented witheither 1 0 �M nm23 AS or random sequence phosphorothiolated oligo with(+) or without (-) 20 ng/ml TGF)31 , as indicated. Two days later, cells in the

supernatant and cells remaining adherent to the plastic were pooled after

separate trypsinizations and counted visually. Each data point is the mean ofeight independent determinations. Bars, SE. Student’s one-tailed t test wasused to analyze data pairs, as shown. TGFf31 induced a statistically signifi-

cant (t < 0.001 ) increase in proliferation in the presence of either oligonu-

cleotide.

M N9

Fig. 6. PCR-amplified nm23-H1 coding sequence from normal colon mu-cosa (N) and cell line U9 (9). Molecular weight markers (M( in base pairs arein the first lane. PCR products were separated on 3.5% Nusieve GTG agarose

gel in TAE buffer and stained by ethidium bromide. Data is from the sameexperiment with unnecessary intervening lanes cut.

opment (1 8): APC, p53, DCC, and p53.4 However, U9colon carcinoma cells were more tumorigenic in athymicmice than the related HD3 cell line, forming tumors 7 timesas large (Fig. 11). Similar data was obtained for a much

Hr of TGF�1 Treatment

$ Hi

#{149}#{149}...#{149} �ta9�tin

Fig. 7. Northern blots of nm23 mRNA levels and one representative �-actin

control blot after 0, 1 , 2, 4, and 24 h ( 1DT) of treatment or 24 h of culturewithout treatment ( JD) with 5 ng/ml TGFf31 in HD3, HD4, U9, and HP1

cultures. Lines to the left of the blots mark the position of the nm23 mRNA.

smaller tumor cell inoculum (2 X 1 o�; Ref. 1 9). Injection of106 cells also demonstrated a difference in tumor latencybetween the two lines (Fig. 1 1 ). Palpable tumors arose after3 (±1) days in each mouse injected with U9 cells, whiletumor formation was induced in HD3 cells with a longerlatency of 8 (± 1 ) days. The increased tumorigenicity of U9cells also could not be ascribed to mutation or deletion inthe Hi allele of nm23 (Fig. 6). However, the TGF�1 sig-naling pathways in HD3 and U9 cells (Fig. 12 and “Dis-cussion”) differ in their activation of ras proteins (22), MAPkinases (22), and, by our model and preliminary data,5 in

HD3

6

5

4

3

2

I

HD3

C

U

a)

0

#{149}0

N

a)E

0

zU)

a)

a)

-J

4

zE

30EU

1.5

1.0

0.5

0.0C’)(‘*1

EC

0

ug

10 200 10 20

Hours of TGFBI Treatment

nm23

DAYS AFTER INJECTION

their use of nm23. Possibly the increased tumorigenicity ofU9 cells is due, at least in part, to the use of an alternateTGFI31 signaling pathway which does not include the tu-mor suppressor nm23.

DiscussionLow expression of the nm23 gene correlates with increasedmalignant potential in several rodent tumor models and insome human cancers (1-7). There is both evidence for andagainst involvement of nm23 in colon cancer metastasis(10-13). nm23 protein expression has been found to betransiently increased during embryonic development of in-testinal epithelia (23), suggesting some role for wild-typenm23 in colonic differentiation. Data from transfectionstudies with melanoma cells (1 ) have indicated that nm23may in some way mediate cellular response to TGF31 . Wethus decided to investigate a possible role for nm23 in a

colon differentiation pathway that used TGF31.There are two major maturation lineages in the colon, to

mucin-producing goblet cells and to fluid- and salt-trans-porting enterocytic cells. Cell line models which undergogoblet cell differentiation have down-regulated both types I

and II receptors for TGFI3, suggesting no role for this factorin goblet cell maturation (17). Two roles for TGFf31 in

enterocytic differentiation, however, were found by ourgroup using cell line models. TGF�1 -induced growth arrestin early G1 correlated with inhibited phosphorylation of theretinoblastoma protein (1 7). TGFf31 also increased cell ad-herence by up-regulation of cell surface integrin ct2 (1 6).

In this report, we have shown that phosphorothiolated AS

oligos (two separate preparations) to the nm23 initiation siteblocked TGF�31 -induced growth inhibition in enterocyticcells and dramatically inhibited enterocytic cell adherence.

914 nm23 in TGFf31 -mediated Adherence and Growth Arrest

C

U

a)

0

0a)N

a)E

0

zU)a)

a)

-J

4

zE

Hours of TGFB1 Treatment

Fig. 8. Effect of TGFf31 treatment on nm23 expression in HD3 (U) and U9

(#{149})cell lines. Densitometry tracing of Northern blot analysis of nm23 mRNAlevels in cells treated with TGFf31. Values are normalized against f3-actin

mRNA levels in the same blots; then the normalized levels in the untreatedcultures are set equal to 1.

EHD31 EU9�

0 4 8 24 0 4 8 24 hr

Fig. 9. TGFf31 increases expression of nm23 on the protein level in HD3

cells but not in U9 cells, as shown by immunoblotting (see “Materials andMethods”). Parallel cultures were treated with 5 ng/ml TGFf31 for 0, 4, 8, and24 h. Data shown is representative of three experiments.

Fig. 10. EffectofTGFf3l treatmentonc-mycexpression in HD3 #{149})and U9

(#{149})cell lines. Densitometry tracing of c-myc mRNA levels in cells treatedwith TGFf31 . Values are normalized against f3-actin mRNA levels in the sameblots; then the normalized levels in the untreated cultures are set equal to 1.

‘�. 250EE

U.aU

Lu

�10>

0

� 50I-

Fig. 1 1. U9 cells (A) are more tumorigenic than HD3 cells (0) in athymicmice. Cells (1 o�; >99% viable by trypan blue exclusion) were injected s.c. in

the backskin of five male BALB/c nu/nu mice (ages 4-6 weeks). Tumors

arose in each mouse. Tumor volume = (width)2 X length/2. Points, mean;bars, SE.

Invasion& Tumor Growth

Fig. 12. Model showing two signal transduction pathways initiated byTGF�1 , one in the poorly tumorigenic HD3 cell line and the other in the

highly tumorigenic U9 cell line (data summarized from Ref. 22). The path-way leading to differentiation and growth arrest of HD3 cells activates rasproteins and inhibits two myelin basic protein kinases (MBP kinases) of Mr1 05,000 and 1 30,000 and the MBP/MAP kinase p57. In contrast, the TGF�31 -

initiated pathway leading to increased proliferation and invasion of U9 cells

activates p57 MAP kinase and the two MBP kinases of M� 105,000 and1 30,000 in a ras-independent pathway. Since the pathway in U9 cells doesnot include the ras activation step and nm23 AS oligos do not affect U9 cell

adhesion or proliferation, nm23 has been placed near p21 ras. Since nm23AS oligos inhibit HD3 cell adherence, can be blocked by concurrent TGFf31treatment, and also block TGFf31 -induced growth inhibition, nm23 has beenplaced in the TGF�1 signal transduction pathway, near ras activation. Theplacement of nm23 downstream of ras reflects both the identification ofnm23 as a putative transcription factor (20) and the different effects of TGFI31treatment on c-los activation in the two cell lines.

Cell Growth & Differentiation 915

6 S� Hsu, unpublished data.

HD3 Cells U9 Cells

,�.TGF�1 �

-TGFf3R- TGF�R-

p2lras p2lras �

nm123 nm23,�._...)

p57 MBPK+ p57 MBPK$

p105 MBPK $ p105 MBPK +

p130 MBPK $ p130 MBPK $

Differentiation& Growth Arrest

Adherence could be partially maintained if TGFI31 wasadded concurrently with the nm23 AS oligo, possibly be-cause TGFI31 induced nm23 transcription in these cells.

To our surprise, nm23 AS oligonucleotides had no effecton either adherence or proliferation in another colon car-cinoma cell line, the more aggressive, invasive (1 9), andundifferentiated (1 5) U9 line. TGF(31 increases cell prolif-eration in this line, coincident with increasing phosphory-lation of the retinoblastoma cell cycle protein (1 7). Sinceanalysis by RT-PCR showed nm23 mRNA levels were re-duced by the nm23 AS oligos in both HD3 and U9 lines, thelack of effect of nm23 AS oligos on any TGFJ31 -mediatedevent in U9 cells suggests nm23 may not play a role inTGF�31 signal transduction in U9 cells.

Differences in the mechanism of TGFj31-initiated signaltransduction between TGFI31 growth-stimulated U9 cellsand TGF�1 growth-inhibited HD3 cells have been found.TGFf31 induces about a 50-fold increase in c-fos expressionin HD3 cells but only a 2-fold increase in U9 cells (19). InHD3 cells within 5-1 0 mm of addition, TGF�31 activates rasproteins, increasing their GTP binding. Ras activation oc-curs concomitantly with decreases in activity of MBP/MAPkinases of Mr 1 05,000 and 1 30,000 (Ref. 22; summarized inFig. 12). In marked contrast, within 10 mm the additionTGF�31 stimulates the activity of these two MBP kinaseswithout activating ras proteins in U9 cells (22). A third MBP

kinase, p57, is activated with a different time course in HD3cells and U9 cells. Since nm23 is known to be active inTGFJ31-mediated signal transduction in HD3 cells, one

model puts nm23 in the ras-dependent signal transductionpathway upstream of the MBP kinases. In this model, nm23would be in the ras-dependent pathway, which is unused inTGF�31 signal transduction in U9 cells (Fig. 1 2). Also by thismodel, the level of expression of nm23 would be irrelevantto TGFj31-mediated signaling in U9 cells as its proteinactivation pathway would not be used. Supporting thishypothesis is the recent finding that transfection of wild-type nm23 inhibits the motility of tumor cells (24). The U9cell line, not responsive to nm23 AS oligos, is very motile,and its motility through a polycarbonate membrane is in-creased by TGF�31 (1 9). The HD3 cell line, responsive tonm23 AS oligos, is about 4% as motile as U9 cells under thesame conditions (1 9). These data together place an activenm23 gene product in TGF�31-induced signaling in HD3cells, not in TGF�31-induced signaling in U9 cells. Sincenm23 mRNA and protein levels are similar in HD3 and U9cells, by this model the nm23 gene product must be func-tionally uninvolved in response to TGF�31 in U9 cells.

The U9 cell line is representative of a large percentage ofhuman colon cancers. In our earlier studies with resectedcolon carcinomas in primary culture, we found that one-half displayed growth stimulation by TGF31 or by theTGFf31 inducer, hexamethylene bisacetamide, while one-third displayed growth inhibition (14, 25). We have gener-ated colon carcinoma cell line models for these two sets ofhuman cancers. The resected colon cancers growth inhib-ited by TGF�31 were histologically well to moderately dif-ferentiated primary site cancers, morphologically similar tothe HD3 cell line (15, 19). The resected colon cancersgrowth stimulated by TGF�1 were in general the moreaggressive cancers, poorly differentiated like the U9 cellline (1 5, 1 9) or metastatic to the liver, a property alsoexhibited by U9 cells.6 Since the more aggressive humancolon cancers that we had studied in primary culture re-sponded to TGF�31 by proliferation like the U9 cells, theywould have switched their TGF�1 signal transduction path-ways from the ras-dependent, nm23 AS-inhibited pathwayfound in the less aggressive cancers and in differentiatedlines like HD3, to the ras-independent, nm23 AS-unaffectedpathway (Fig. 12). This switch in TGFf31 signaling withtumor progression may shunt nm23 into an unused TGF�1signaling pathway. By this model, nm23 is not activatedwhen aggressive colon cancer cells respond to exogenousor autocrine TGF�31 and thus cannot be used for suppres-sion of invasion or metastasis.

Materials and Methods

Cell Culture and Growth Assay. The human colon carci-noma cell lines U9, HP1, HD4, and HD3 were maintainedin DMEM, modified and supplemented as described (1 5).Growth modulation by human TGFf31 and/or nm23 AS wasperformed by direct cell counting exactly as described in 8parallel wells/point (1 5) on logarithmically growing cells inserum-free ITS-DMEM, which is DMEM supplemented withinsulin, transferrin, selenous acid, linoleic acid, fatty acidfree bovine serum albumin, gentamicin, and glutamine.

Materials. Human TGFI31 was purchased from R&D Sys-tems (Minneapolis, MN). All radioactive compounds werepurchased from NEN. The cDNA probe for nm23-H1 was a900 bp BamHl fragment of pNM23-H1 (6). The nm23

916 nm23 in TGFJ31 -mediated Adherence and Growth Arrest

cDNA clone and rabbit nm23 antipeptide 1 1 antibody werethe kind gifts of Dr. Pat Steeg, National Cancer Institute. Thephosphorothiolated oligo to the initiation codon and thefollowing six codons were 5’-ACG CTC ACA GTT GGCCAT GGT-3’. Two independent preparations were made byQuality Controlled Biochemicals (Hopkinton, MA), whoalso prepared random sequence control phosphorothio-lated oligonucleotides (two preparations) for this study.

Immunoblotting. Cells were lysed in high-salt lysisbuffer consisting of 50 m�i Tris-HCI (pH 8.0), 1 20 mrvt NaCI,0.5% Nonidet P-40, 1 00 mM sodium fluoride, 200 �M so-dium orthovanadate, and just before use, supplementedwith 1 mM phenylmethylsulfonyl fluoride, 10 pg/mI aproti-nm, and 10 pg/mI leupeptin. Phosphate-buffered saline-washed cells were lysed in this media and then pelleted at1 2 K in an Eppendorf microcentrifuge for 1 5 mm at 4#{176}C.Thesupernatant was removed and used at the cytosolic fraction.The pellet was vortexed in 2% SDS, heated to 1 00#{176}Cfor 5mm, resuspended, and repelleted for 5 mm as above. Thesupernatant was considered the particulate fraction. Lysate(60 pg each) was analyzed by 5-1 5% gradient SDS-poly-acrylamide gel electrophoresis, Western blotted onto Im-mobilon P membranes (Millipore), followed by nm23 de-tection with a 1 :75 dilution of nm23-H1 antipeptide 1 1antibody and 1251-protein A.

Northern Blotting Analysis of mRNA. Total RNA wasisolated as detailed (16). Total RNA (20 pg) was separatedby electrophoresis in a 1 .2% agarose-formaldehyde gel.The gel then was rinsed in 5 X SSC and blotted onto Nytranmembrane (S&S) in 10 x SSC overnight; UV cross-linked;and stained with 0.02% methylene blue-0.3 M sodium ac-etate (pH 5.5) to confirm even transfer; and photographed.The cDNA probe for nm23-H1 was a 900-bp BamHl frag-ment of pNM23-H1 (6). The c-myc cDNA probe was a1 .4-kilobase EcoRl fragment from the third exon of c-myc(Oncor, Gaithersburg, MD). All blots were prehybridized in1 X blocking reagent (Biotecx) containing 1 00 pg/mI dena-

tured salmon sperm DNA at 42#{176}Cfor 4 h and then hybrid-ized with random priming labeled cDNA probes at 42#{176}Covernight in low background hybridization reagent contain-ing 50% formamide (Biotecx). The blots then were washed

three times for 7 mm at room temperature and once for 20mm at 42#{176}Cwith 1 x SSC containing 1% SDS. Randompriming labeled 3-actin plasmid was rehybridized witheach blot as an internal control for the integrity and abun-dance of the mRNA blotted in each lane.

Tumor Growth in Nude Mice. Five male BALB/c flu/flunude mice (ages 4-6 weeks) were each injected s.c. on theback skin directly between the scapulae with 1 06 HD3 orU9 cells having over 99% viability by trypan blue exclusiontest. The tumor size was measured in two dimensions every2-3 days using calipers, and the volume was calculated as(width)2 x (length/2).

RT-PCR Amplification. Total RNA (1 pg) was used forreverse transcri ption usi ng the Superscript preamplificationsystem (GIBCO/BRL, Bethesda, MD). First-strand cDNAwas used directly for 35 cycles of PCR amplification (13)

using the GeneAmp PCR reagent kit (Perkin Elmer Cetus,San Diego, CA). For subsequent cloning, a pair of primers,hnm23c-5’ (AAGAATTCGGGTGCTGGCGGCTG) andhnm23 3 ‘ (GAGAATTTCAATGTGGTCTGCCCTCC), basedon the mRNA sequence (6) were designed to amplify theentire nm23-H1 coding sequence of 533 bp. PCR cycleswere denaturation for 1 mm at 94#{176}C,annealing for 1 mm at42#{176}C,and polymerization for 3 mm at 72#{176}C.The PCR

product was separated on 3.5% Nusieve GTG low meltingagarose gel and purified by Geneclean (BlO 1 01 , San Di-ego, CA), digested with EcoRl (Boehringer Mannheim, In-dianapolis, IN), purified by Geneclean, and cloned into theBluescript KS vector (Stratagene, San Diego, CA). Plasmidswith the nm23 insert were isolated from transformed XL-1cells (Stratagene) by making alkaline minipreps and weresequenced by the dideoxy method using the Sequenase 2.0sequencing kit (USB, Cleveland, OH). Ten individualclones from each PCR product were analyzed to confirmthe sequence.

For semiquantitative RT-PCR, the amplimers used were,sense nm23c 5’-CGTTTCGGGTGCTGGCGGCTG-3’ andantisense, nm23c 5’-AAGCAATGTGGTCTGCCCTCC-3’.f3-actin mRNA levels were analyzed as an internal controlusing amplimers of 5’-CCAGAGCAAGAGAGGCATCC-3’for the sense amplimer and 5’-CCGTGGTGGTGAAGCTG-TAG-3’ for the antisense amplimer. Reverse transcriptionwas as above. PCR conditions were denaturation for 1 mmat 94#{176}C,annealing for 2 mm at 56#{176}C,and then polymer-ization for 1 mm at 72#{176}C,but the number of cycles waslimited to 20. The PCR products, visualized by ethidiumbromide staining following agarose gel electrophoresis,were the predicted sizes of 533 and 429 bp for rim23 and�-actin, respectively. PCR products were then analyzed bySouthern blotting using rim23 and f3-actin cDNA probes.

References1 . Leone, A., Flatow, U., King, C. R., Sandeen, M. A., Margulies, I. M. K.,

Liotta, L., and Steeg, P. 5. Reduced tumor incidence, metastatic potential,

and cytokine responsiveness of nm23-transfected melanoma cells. Cell, 65:

25-35, 1991.

2. Stahl, J. A., Leone, A., Rosengard, A. M., Porter, L., King, C. R., and Steeg,

P. 5. Identification of a second human nm23 gene, nm23-H2. Cancer Res.,51:445-449, 1991.

3. Florenes, V. A., Aamdal, S., Myklebost, 0., Maelandsmo, G. M., Bruland,0. S., and Fodstad, 0. Levels of nm23 mRNA in metastatic malignantmelanomas: inverse correlation to disease progression. Cancer Res., 52:

6088-6091, 1992.

4. Steeg, P. 5., Bevilacqua, G., Pozzatti, R., Liotta, L. A., and Sobel, M. E.Altered expression of nm23, a gene associated with low tumor metastaticpotential during adenovirus 2 Ela inhibition of experimental metastasis.Cancer Res., 48: 6550-6554, 1998.

5. Bevilacqua, G., Sobel, M. E., Liofta, L. A., and Steeg, P. A. Association oflow nm23 RNA levels in human primary infiltrating ductal breast carcinomaswith lymph node involvement and other histopathological indicators of highmetastatic potential. Cancer Res., 49: 5185-5190, 1989.

6. Rosengard, A. M., Krutzsch, H. C., Shearn, A., Biggs, J. R., Barker,’ E.,Margulies, I. M. K., King, C. R., Liotta, L. A., and Steeg, P. 5. Reducednm23/awd protein in tumor metastasis and aberrant Drosophila develop-ment. Nature (Lond.), 342: 1 77-1 80, 1989.

7. Sastre-Garau, X., Lacome, M. L., Jouve, M., Veron, M., and Magdelenat,H. Nucleotide diphosphate kinase/nm23 expression in breast cancer: lack ofcorrelation with lymph-node metastasis. tnt. J. Cancer, 50: 533-538, 1992.

8. Nakayama, T., Ohtsuru, A., Nakao, K., Shima, M., Nakata, K., Watanabe,K., Ishii, N., Kimura, N., and Nagataki, S. Immunohistochemical analysis ofnucleoside diphosphatase (or nm23 gene product) expression in humanhepatocellular carcinomas. J. NatI. Cancer Inst., 84: 1 349-1 354, 1992.

9. Leone, A., Seeger, R. C., Hong, C. M., Hu, Y. Y., Arboleda, M. J., Brodeur,G. M., Stram, D., Slamon, D. J., and Steeg, P. 5. Evidence for nm23 RNAoverexpression, DNA amplification and mutation in aggressive childhoodneuroblastomas. Oncogene, 8: 855-865, 1993.

10. Haut, M., Steeg, P. 5., Willson, J. K. V., and Markowitz, S. D. Inductionof nm23 gene expression in human colonic neoplasms and equal expressionin colon tumors of high and low metastatic potential. J. NatI. Cancer Inst., 83:712-716, 1991.

1 1 . Meyeroff, L. L., and Markowitz, S. D. Increased nm23-H1 and nm23-H2mRNA expression and absence of mutations in colon carcinomas of low andhigh metastatic potential. J. NatI. Cancer Inst., 85: 1 47-1 51 , 1993.

1 2. Cohn, K. H., Wang, F., DeSoto-LaPaix, F., Solomon, W. B., Patterson, L.G., Arnold, M. R., Weimar, J., Feldman, J. G., Levy, A. T., Leone, A., and

Cell Growth & Differentiation 917

Steeg, P. S. Association of nm23-H1 allelic deletions with distant metastasesin colorectal carcinoma. Lancet, 338: 722-724, 1991.

1 3. Wang, L., Patel, U., Ghosh, L., Chen, H-C., and Banerjee, S. Mutation inthe nm23 gene is associated with metastasis in colorectal cancer. CancerRes., 53:717-720, 1993.

14. Schroy, P., Rikfin, J., Coffey, R.J., Winawer, S., and Friedman, E. Role ofTGF�1 in induction of colon carcinoma differentiation by hexamethylenebisacetamide. Cancer Res., 50: 261-265, 1990.

1 5. Hafez, M. M., Infante, 0., Winawer, S., and Friedman, E. TGF�1 acts asan autocrine-negative growth regulator in colon enterocytic differentiationbut not in goblet cell maturation. Cell Growth & Differ., 1: 61 7-626, 1990.

1 6. Hafez, M. M., Hsu, S., Yan, Z., Winawer, S., and Friedman, E. Two rolesfor TGF�1 in colon enterocytic differentiation. Cell Growth & Differ., 3:753-762, 1992.

1 7. Yan, Z., Hsu, S., Winawer, S., and Friedman, E. TGF�1 inhibits retino-blastoma gene expression but not pRB phosphorylation in TGF�1 growth-stimulated colon carcinoma cells. Oncogene, 7: 801-805, 1992.

1 8. Fearon, E. R., and Vogelstein, B. A genetic model for colorectal tumor-

igenesis. Cell, 61: 759-767, 1990.

19. Hsu, S., Huang, F., Hafez, M., Winawer, S., and Friedman, E. Coloncarcinoma cells switch their response to TGF�1 with tumor progression. CellGrowth & Duff., 5:267-275, 1994.

20. Postel, E. H., Berberich, S. J., Flint, S. J., and Ferrone, C. A. Human c-myctranscription factor PuF identified as nm23-H2 nucleoside diphosphate ku-nase, a candidate suppressor of tumor metastasis. Science (Washington DC),261: 478-480, 1993.

21 . Wallet, V., Mutzel, R., Troll, H., Barzu, 0., Wurster, B., Veron, M., andLacombe, M. A. Dictyostelium nucleoside diphosphate kinase is highly

homologous to nm23/awd proteins found in mammalian tumor metastasisand Drosophila development. J. NatI. Cancer Inst., 82: 1199-1202,1990.

22. Yan, z., Winawer, S., and Friedman, E. Two different signal transductionpathways can be activated by TGF�1 in epithelial cells. I. Biol. Chem., 269:13231-13237, 1994.

23. Lasko, M., Steeg, P. 5., and Westphal, H. Embryonic expression of nm23during mouse organogenesis. Cell Growth & Differ., 3: 873-879, 1992.

24. Kantor, I. D., McCormick, B., Steeg, P. S., and zetter, B. R. Inhibition ofcell motility after nm23 transfection of human and murine tumor cells.

Cancer Res., 53: 1971-1973, 1993.

25. Schroy, P. C., Carnright, K., Winawer, S. J., and Friedman, E. A. Heter.ogeneous responses of human colon carcinomas to hexamethylene bisacet-

amide. Cancer Res., 48: 5487-5494, 1988.