Therapeutic Implications of p53 Status on Cancer ... · joining, one of the main DSB-repair pathways, currently under clinical investigation. Here, we ... vating the ATM/p53 signaling

Cell Fate Decisions

Therapeutic Implications of p53 Status on CancerCellFateFollowingExposure to IonizingRadiationand the DNA-PK Inhibitor M3814Qing Sun1, Yige Guo1, Xiaohong Liu1, Frank Czauderna1, Michael I. Carr1,Frank T. Zenke2, Andree Blaukat2, and Lyubomir T. Vassilev1

Abstract

Inhibition of DNA double-strand break (DSB)repair in cancer cells has been proposed as a newtherapeutic strategy for potentiating the antican-cer effects of radiotherapy. M3814 is a novel,selective pharmacologic inhibitor of the serine/threonine kinase DNA-dependent protein kinase(DNA-PK), a key driver of nonhomologous end-joining, one of the main DSB-repair pathways,currently under clinical investigation. Here, weshow that M3814 effectively blocks the repair ofradiation-induced DSBs and potently enhancesp53 phosphorylation and activation. In p53wild-type cells, ataxia telangiectasia–mutated(ATM) and its targets, p53 and checkpoint kinase2 (CHK2), were more strongly activated by com-bination treatment with M3814 and radiationthan by radiation alone, leading to a completep53-dependent cell-cycle block and prematurecell senescence. Cancer cells with dysfunctionalp53 were unable to fully arrest their cell cycle andentered S and M phases with unrepaired DNA,leading to mitotic catastrophe and apoptotic celldeath. Isogenic p53-null/wild-type A549 and HT-1080 cell lines were generated and used to demonstrate that p53 plays acritical role in determining the response to ionizing radiation and M3814. Time-lapse imaging of cell death and measuringapoptosis in panels of p53 wild-type and p53-null/mutant cancer lines confirmed the clear differences in cell fate,dependent on p53 status.

Implications:Our results identify p53 as a possible biomarker for response of cancer cells to combination treatment withradiation and a DNA-PK inhibitor and suggest that p53 mutation status should be considered in the design of futureclinical trials.

Visual Overview: http://mcr.aacrjournals.org/content/molcanres/17/12/2457/F1.large.jpg.

IntroductionMammalian cells are continuously exposed to endogenous

and exogenous insults that induce DNA damage and threatenthe faithful transmission of their genetic information to the

progeny. To preserve DNA integrity, cells have evolved anelaborate molecular machinery to repair DNA lesions andprotect from their cancerogenic consequences, known as theDNA damage response (DDR; ref. 1). The guardian of the

1Translational Innovation Platform Oncology, EMD Serono Research andDevelopment Institute, Inc., Billerica, Massachusetts. 2Translational InnovationPlatform Oncology, Biopharma Research and Development, Merck KGaA,Darmstadt, Germany.

Note: Supplementary data for this article are available at Molecular CancerResearch Online (http://mcr.aacrjournals.org/).

Q. Sun and Y. Guo contributed equally to this article.

Corresponding Author: Lyubomir T. Vassilev, EMD Serono Research andDevelopment Institute, Inc., 45A Middlesex Turnpike, Billerica, MA 01821.Phone: 978-294-1115; E-mail: [email protected]

Mol Cancer Res 2019;17:2457–68

doi: 10.1158/1541-7786.MCR-19-0362

�2019 American Association for Cancer Research.

MolecularCancerResearch

www.aacrjournals.org 2457

on April 11, 2020. © 2019 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst September 24, 2019; DOI: 10.1158/1541-7786.MCR-19-0362

http://crossmark.crossref.org/dialog/?doi=10.1158/1541-7786.MCR-19-0362&domain=pdf&date_stamp=2019-11-12

http://crossmark.crossref.org/dialog/?doi=10.1158/1541-7786.MCR-19-0362&domain=pdf&date_stamp=2019-11-12

http://mcr.aacrjournals.org/content/molcanres/17/12/2457/F1.large.jpg

http://mcr.aacrjournals.org/

genome and master tumor suppressor p53 is a central regu-latory node in the DDR, playing a key role in the coordinationof multiple protective mechanisms in DNA-damagedcells (2–4).

Currently, DNA-damaging agents are among the mostwidely used cancer therapeutics. Of the many different typesof DNA lesions, double-strand breaks (DSB) are the mostdifficult to repair, and if left unrepaired can induce cell-cycle arrest and/or apoptosis, and ultimately cancer celldeath (5, 6). Therefore, targeting their repair has been pro-posed as a novel therapeutic strategy for potentiating theanticancer effects of radiotherapy or systemic DSB-inducingchemotherapies (7–9).

DSBs are repaired by a complex set of molecular interactionsvia two major pathways, nonhomologous end-joining (NHEJ)and homologous recombination (HR; ref. 6). The DNA-dependent protein kinase (DNA-PK) catalytic subunit(DNA-PKcs), together with five additional protein factors(Ku70, Ku80, XRCC4, ligase IV, and Artemis), is the maindriver of DSB repair via NHEJ (10, 11). This pathway is activein all cell-cycle phases and is believed to repair most DSBs incancer cells (12). Kinase activity of DNA-PK is essential forproper and timely DSB repair and the long-term survival ofcancer cells (7, 13). Therefore, inhibitors of DNA-PK activityare expected to enhance the therapeutic efficacy of radiationand DSB-inducing chemotherapeutic agents. Several lines ofevidence strongly support the hypothesis that pharmacologicinhibition of DNA-PK could effectively sensitize cancer cells toexogenous DNA damage induced by ionizing radiation (IR)and certain types of chemotherapy (14–18). The potentialtherapeutic benefits of inhibiting DNA-PK activity in cancercells have been studied extensively using early tool com-pounds (7). However, the cellular and molecular conse-quences of pharmacologic intervention in DSB repair byDNA-PK inhibitors remain poorly understood.

M3814 is a clinical-stage inhibitor of DNA-PK activity thatbelongs to a new generation of potent and selective smallmolecules. M3814 effectively suppresses IR-induced NHEJrepair, potentiates the response to radiation in cancer cells,and regresses human tumor xenografts in clinically relevantmouse models (19). It thereby offers a novel therapeuticmodality for enhancing the antitumor effect of radiotherapy.M3814 also provides a specific molecular probe for studyingthe consequences of pharmacologic blockade of radiation-induced DSB repair in cancer cells. Here, we show thatM3814 intervenes in the radiation-induced DDR by overacti-vating the ATM/p53 signaling axis, leading to diametricallyopposite fates of irradiated cancer cells. In p53 wild-typecancer cells, M3814 reinforces p53-mediated cell-cycle arrest,leading to a complete cell-cycle block and premature senes-cence. In contrast, DNA-PK inhibition in irradiated p53-dys-functional cancer cells caused incomplete arrest, aberrantmitosis, and ultimately cell death by mitotic catastrophe.Using engineered isogenic p53 wild-type/null cancer celllines, we demonstrate that p53 functional status determinesthe fate of irradiated cancer cells in the presence of DNA-PKinhibition. Our studies reveal a critical role for p53 andidentify the tumor suppressor as a potential predictive markerfor response to combination therapy with radiation and aDNA-PK inhibitor.

Materials and MethodsCell lines and reagents

A549 NucLight Green (cat. #4492) and HeLa NucLight Green(cat. #4490) cell lines were purchased fromEssen Biosciences andmaintained according to the manufacturer's recommendations.All other cell lineswere obtained,Mycoplasma free, from theMerckTissue Culture Bank (Merck KGaA). Cells were originally pur-chased from ATCC, ECACC, or DSMZ and kept in liquid nitrogenat low passage until used. Short tandem repeats were analyzed toconfirm cell line identity, and mycoplasma infection was exclud-ed by a PCR-based testing. LoVo, SK-MEL-28, SK-N-SH, A375,A549,NCI-H460, RKO,HCT116, andHT-1080 cells are p53wild-type. HeLa, FaDu, NCI-H1299, DU145, HT29, SW480, and A431cells are p53-null/mutant or deficient. Cells were maintained inthe following media purchased from GIBCO: Eagle MinimumEssentialMedium (EMEM; SK-MEL-28, SK-N-SH, RKO,HT-1080,HeLa, FaDu, and DU145); Dulbecco's Modified Eagle Medium(DMEM; A375, A549, and A431); RPMI-1640 (NCI-H460 andNCI-H1299), F-12K (LoVo); and McCoy's 5a (HCT116, HT29).Culturemediumwas supplemented with 10% fetal bovine serum(cat. #35-015-CV, Corning Life Science). TP53 mutation statuswas obtained from the current version of the p53 Database(https://p53.fr/tp53-database; accessed 2019). Cells were irradi-ated using the Gamma Cell 40 Exactor instrument (MDSNordion, Inc). M3814, M3814R, M3541, and VX-984 were syn-thesized in the department of Medicinal Chemistry at MerckKGaA. Nutlin-3a (cat. #S8059), daunorubicin (cat. #S3035), andNU-7441 (cat. #S2638) were purchased from Selleckchem. Allcompounds were dissolved in DMSO to make 10 mmol/L stocksolution and kept frozen at �20�C until use.

Western analysisA375, A549, HCT116, and RKO cells (5� 106) were seeded in

100-mmdishes. The next day, cells were treated with the DNA-PKinhibitor M3814 (1 mmol/L) or the ATM inhibitor M3541(1 mmol/L) 1 hour before exposure to IR (5 Gy). Lysates wereprepared 6 or 24 hours after radiation using 1� RIPA lysis buffer(cat. #9806, Cell Signaling Technology) supplemented with pro-tease inhibitor cocktail (MilliporeSigma; cat #11836170001),Pefabloc (MilliporeSigma; cat #11429868001 and phosSTOPphosphatase inhibitor (MilliporeSigma; cat #4906837001).Equal amounts of lysates were loaded onto NuPAGE Bis-Trisgels, obtained fromThermoFisher Scientific.Nitrocellulosemem-branes from Thermo Fisher were used for protein transfer andimmunoblotted with the following antibodies: p-ATM (S1981,ab81292), KAP1 (ab22553), and p-KAP1 (S824, ab133440) fromAbcam Biotechnology, p-CHK2 (T68, CST2197), p-p53 (S15,CST9284), p53 (DO-7; CST48818), p21 (12D1; CST2947),CHK2 (CST6334), CHK1 (CST2360), PUMA (CST12450), andp-CHK1 (S345, CST2348) from Cell Signaling Technology,GAPDH (sc47724) and ATM (SC23921) from Santa Cruz Bio-technology, and vinculin (V9131) from Sigma-Aldrich. Westernblots were analyzed using GE ImageQuant LAS 4000 with Super-Signal West Pico Chemiluminescent Substrate (cat. #34080;Thermo Fisher) and/or SuperSignal West Femto MaximumSensitivity Substrate (cat. #34094; Thermo Fisher).

Quantitative RT-PCRCells were seeded in 6-well plates (105 cells/well), and the next

day, treated as described (compounds added 1 hour prior to

Sun et al.

Mol Cancer Res; 17(12) December 2019 Molecular Cancer Research2458



https://p53.fr/tp53-database


irradiation). Total RNAwas isolated 6- and24-hours after IR usingRNeasy Mini Kit (cat. #74104, Qiagen) following the manu-facturer's protocol. Reverse transcription was performedusing superscript VILO Master Mix (Invitrogen) as describedby the manufacturer. Quantitative PCR was performed withTaqMan Gene-Expression Master Mix from Invitrogen andTaqMan gene-expression assays from Applied Biosystems:HS00355782-m1 forCDKN1A (p21),HS00248075-m1 for BBC3(PUMA), HS00540450-s1 for MDM2, and HS02786624-g1 forGAPDH. Relative target gene expression was normalized toGAPDH gene expression and calculated as fold change relativeto the DMSO control.

Protein kinase assaysDNA-PK was purified fromHeLa nuclear extracts and its kinase

activity measured at ATP concentrations near Km (10 mmol/L).The reaction was initiated by the addition of biotinylated STK-substrate (61ST1BLC, Cisbio), Mg-ATP, calf thymus DNA, andstaurosporine, and incubated at 22�C for 60 minutes. EDTA wasadded to stop the reaction, and phospho-STK was detected byeuropium-labeled anti-phospho-STK antibody (61PSTKLB, Cis-bio), and streptavidin-labeled XL665 (610SAXAC, Cisbio) as theFRET acceptor. Plateswere analyzed on aRubystar (BMGLabtech)microplate reader (excitation wavelength: 337 nm; emissionwavelengths: 665 and 615 nm).

ATM kinase assays were performed using TR-FRET. Humanrecombinant ATM (14-933, Eurofins) or ATR/ATRIP (14-953,Eurofins) were preincubated in assay buffer for 15 minutes at22�C with a range of M3814 concentrations or vehicle. Thereaction was started by the addition of purified c-myc–taggedp53 (23-034, Eurofins) and ATP for 30 minutes at 22�C andanti-phospho-p53(Ser15)-Eu (61P08KAY, Cisbio) and anti-cmyc (61MYCDAB, Cisbio]) anibodies added. After 2 hoursof incubation, plates were analyzed in an EnVision reader(PerkinElmer). Data were normalized to a DMSO control,and IC50 values were determined by nonlinear regressionanalysis.

The activity of recombinantly expressed PI3 kinase familymembers was tested in assay buffer containing 10 mmol/Lphosphatidylinositol 4,5-bisphosphate and Mg-ATP (concen-tration as required). The reaction is initiated by the addition ofthe ATP solution. After incubation for 30 minutes at roomtemperature, the reaction is stopped by solution containingEDTA and biotinylated phosphatidylinositol-3,4,5-trispho-sphate. Detection buffer is added containing europium-labeled anti-GST monoclonal antibody, GST-tagged GRP1 PHdomain, and streptavidin allophycocyanin. The homogenoustime-resolved fluorescence (HTRF) signal is determinedaccording to the formula HTRF ¼ 10,000� (Em 665 nm/Em620 nm).

Recombinant human mTOR is incubated with 50 mmol/LHEPES pH 7.5, 1 mmol/L EGTA, 0.01% Tween 20, 2 mg/mLsubstrate, 3 mmol/L MnCl2 and [g-33P-ATP] (specific activityapproximately 500 cpm/pmol, concentration as required). Thereaction is initiated by the addition of MnATP mix. Afterincubation for 40 minutes at room temperature, the reactionis stopped by the addition of 3% phosphoric acid solution. Tenmicroliters of the reaction is then spotted onto a P30 filtermatand washed three times for 5 minutes in 75 mmol/L phospho-ric acid and once in methanol prior to drying and scintillationcounting.

Kinase selectivity testingTesting of activity in a panel of protein kinases was performed

by Merck Millipore using an HTRF assay with a radioactivelylabeled ATP. Two hundred eighty-four recombinant purifiedprotein/lipid kinases or conventionally purified protein/lipidkinases were used. The percentage of effect activity was deter-mined by comparison with vehicle-treated controls corrected forbackground. M3814was tested at fixed concentration (1 mmol/L)or serially diluted for IC50 determination.

p-DNA-PK activity (MSD) assayApproximately 5 � 106 A549, A375, or RKO cells were seeded

in 100-mm culture dishes and incubated with M3814 for 1 hourbefore irradiation at 5 Gy. Cells were harvested and lysed inMesoScale Discovery (MSD) lysis buffer (cat. #R60TX-3; MSD) sup-plementedwith protease inhibitor cocktail (Cat. #11836170001)and phosSTOP phosphatase inhibitor (cat. #04906837001;Sigma-Aldrich). Ninety-six-well MSD plates were coated withcapture antibodies against phosphorylated (p)-DNA-PK(ab128914), and totalDNA-PK (ab32566,Abcam), and incubatedat 4�C overnight. The next day, plates coated with capture anti-bodies were blocked for nonspecific binding with blocker A (cat.#R93BA-4, MSD) incubated sequentially with equal amounts oflysates, primary detection antibody (WH0005591M2, Sigma-Aldrich), and secondary detection antibody (cat. #R32AC-5,anti-mouse SULFO-Tag; MSD) and read by a Sector Imager1300 (MSD).

IncuCyte live-cell imagingCells (1,000 or 2,000) were seeded in 96-well plates (Cat

#353219, Corning Inc) and cultured overnight. The next day,cells were treatedwith 1mmol/LM3814 for 1 hour and exposed toIR (2 Gy or 5 Gy). Real-time cell death/apoptosis was monitoredusing the IncuCyte Live-Cell Imaging System (Essen BiosciencesInc) by adding the mix-and-read IncuCyte CytoTox Red Reagent(cat #4362) or Caspase-3/7 Green Reagent (cat. #4440, EssenBioscience, Inc). Relative cell death, on day 4, was calculated bydividing the number of red objects per view by percent cellconfluence and normalizing to the DMSO-treated sample.Real-time cell growth/viability was calculated as the percentconfluence or the number of green nuclei when A549 Nuclightor HeLa Nuclight cells were used.

Cell-cycle analysisExponentially proliferating cells were irradiated at 5 Gy after

1-hour treatment with 1 mmol/L M3814 and cultured for 24, 48,and 72 hours. Cells were washed, harvested, and fixed in 70%ethanol. Cells were then stained with BD propidium iodide/RNase solution (cat #550825) for 15 minutes at room temper-ature. The cell cycle was analyzed using a BD FACSCanto flowcytometer (BD Biosciences). BrdUrd cell-cycle analyses wereperformed as previously described (26) using an FITC BrdUrdFlow Kit from BD Biosciences (cat #559619). Briefly, cells weretreated with DMSO or 1 mmol/L M3814 for 1 hour followed by 5Gy IR. After 24 hours, cells were labeled with BrdUrd for 1 hour,washed, harvested, and stained with FITC-conjugated anti-BrdUrd antibody followed by 7-AAD staining. Cell-cycle profileswere obtained on a BD FACSCanto flow cytometer and thepercentages of cells in G1, S, and G2–M phases were calculatedusing FlowJo v10 software (FlowJo, LLC) software. For senescencestaining, cells were seeded in 6-well plates and treated with

p53 Controls Cell Response to IR and M3814

www.aacrjournals.org Mol Cancer Res; 17(12) December 2019 2459




M3814 (1 mmol/L) plus/minus IR (5 Gy) and incubated for6 days. Cells were washed, fixed, and incubated with b-Galstaining solution (Senescence b-Galactosidase Staining Kit; cat.#9860; Cell Signaling Technology) at 37�C overnight withoutCO2.

Caspase assayCells were seeded in 96-well plates (500–2,000 cells/well)

and incubated overnight. The next day, cells were treated with1 mmol/L M3814 1 hour before Gy IR. After a 4-day incubation,mix-and-read Caspase-Glo 3/7 Reagent (cat. #G8090; PromegaCorporation) was added, and cells were incubated for 1 hour atroom temperature on a plate shaker. Luminescencewasmeasuredwith the EnVision 2104 Multimode plate reader and normalizedto the DMSO-treated controls.

Generation of TP53-knockout cell linesGene editing was performed using ribonucleoprotein com-

plexes of synthetic single guide RNA (an optimized 80-merscaffold sequence added to the 30 end of the TP53 target sequenceGUUGCAAACCAGACCUCAGG, Synthego) and Streptococcuspyogenes CAS9 protein, containing N- and C-terminal nuclearlocalization signals (Cas9 2NLS Nuclease, Synthego). SgRNAwascomplexedwithCas9protein at amolar ratio of 3:1 (sgRNA:Cas9)to form ribonucleoproteins (RNP). To transfect target cells withthe sgRNA:Cas9 RNP, CAS9 Plus reagent and LipofectamineCRISPRMAX (Thermo Fisher; cat. #CMAX00001) prediluted inOpti-MEM I Reduced Serum Medium (Thermo Fisher; cat.#31985070) were added.

Uponmixing, the samplewas incubated at 25�C for 15minutesto form Cas9 RNP/lipofectamine CRISPRMAX complexesand then added to the cells. At 72 hours after transfection, cellswere harvested, and gene-editing efficiency was analyzed usingthe GeneArt Genomic Cleavage Detection kit (Thermo Fisher;cat. #A24372). Genomic DNAwas isolated by adding ProteinDe-grader and cell lysis buffer and running a thermal denaturingprotocol (68�C, 15 minutes, 95�C, 10 minutes, 4�C hold). Thefollowing primers were used to generate amplicons for the Sur-veyor assay (p53 genomic forward: CAG-TCA-CAG-CAC-ATG-ACG-GA, p53 genomic reverse: CTT-GGG-GAG-ACC-TGT-GCA-A). For the Surveyor assay/T7 Endonuclease I assay, aliquots ofPCR products were denatured (95�C, 5 minutes) and reannealedas follows: 95�C–85�C, �2�C/second followed by 85�C–25�C,�0.1�C/second, 4�C hold). Upon completion of the reannealingreaction, the detection enzyme T7 Endonuclease I was added tocleave DNA heteroduplexes. The presence of indels in DNA fromcell pools and relative cleavage efficiencywas assessed through gelelectrophoresis. The MDM2 antagonist, Nutlin-3a (10 mmol/L),which effectively blocks the proliferation of p53 wild-type cells,was used to enrich the cell population in p53-null clones.

ImmunofluorescenceCells were fixed with cold methanol or 4% paraformaldehyde

and blocked with MAXblock medium (Active Motif, cat #15252)overnight. Cells fixed on coverslips were sequentially incubatedwith primary antibodies: anti-tubulin rabbit antibody (Abcam;cat #ab18251) and anti-gH2AX ser139 mouse monoclonal anti-body (cat #05-636; EMD Millipore; diluted 1:500–1:1,000 inblocking buffer, followed by incubation with secondary antibo-dies (diluted 1:400 in TBST anti-rabbit Alexa Fluor 488 (cat #711-545-152), and anti-mouse Alexa Fluor 594 (cat #715-585-150)

from Jackson ImmunoResearch Labs. Coverslips were thenmounted with ProLong Gold Antifade Mountant (cat. #P36934,Invitrogen). Imageswere acquired and analyzedwith a ZeissMIC-074 and Axiocam 506 color camera (Carl Zeiss Microscopy, LLC).

Statistical analysesAll statistical tests were performedwithGraphPad PRISM version

7.0 (GraphPadSoftware Inc.). Thedatawere analyzedwithStudent ttests. P values � 0.05 were considered statistically significant. Allassays were conducted independently at least three times, unlessindicated otherwise, and representative data are shown as mean �SD. Significance values are �,P<0.05; ��,P<0.01, and ��,P<0.001.NS stands for nonsignificant (P > 0.05).

ResultsInhibition of DNA-PK activity boosts the p53 response toradiation-induced DSBs

M3814 is a novel, highly potent and selective, ATP-competitiveDNA-PK inhibitor (Fig. 1A; ref. 19). It showed 0.6 nmol/L IC50

against DNA-PK at low ATP concentrations in vitro, and a widemargin of selectivity against the closest members of the PI3Kfamily to which DNA-PK belongs. M3814 was practically inactivewhen tested against a panel of 276 other members of the largerkinase family (19). In cultured cancer cells, M3814 suppressedDNA-PK autophosphorylation at Ser2056, a marker of DNA-PKactivation in response to DSBs (20), with an IC50 of 100 to 500nmol/L in several tested cancer cell lines (19). These propertiesmade M3814 an excellent molecular tool for mechanistic cellularstudies.

One-micromolar M3814 effectively inhibited radiation-induced DNA-PK autophosphorylation (>80%) in A549,HCT116, and RKO cells (Fig. 1B), and IR-induced DNA DSBrepair as illustrated in A549 cells by the persistence of gH2AX foci(Fig. 1C and D), while not affecting other relevant DDR kinasessuch as ATM and ATR (19). Therefore, this concentration wasapplied in most of the cellular studies described herein. UsingM3814 as amolecular probe,we aimed to dissect themechanismsinvolved in determining the fate of irradiated cancer cells in thepresence of DNA-PK inhibitor.

Because p53 has an important role in the coordination ofcellular events in the DDR, we first assessed the impact ofM3814 on the p53 response to IR-induced DSBs. Two wild-type p53-expressing cancer cell lines, A375 and A549, wereexposed to a single dose of IR (5 Gy) in the presence or absenceof 1 mmol/L DNA-PK inhibitor and the levels of key phospho-proteins involved in the DDR were analyzed by Western blotting(Fig. 2A).

Phospho-ATM (Ser1981), a marker of ATM activation, wasupregulated by IR alone; however, M3814 substantially increasedradiation-induced phosphorylation of ATM. Stronger activationof ATM translated into a substantial increase in the protein levelsof its phosphorylation targets, p-KAP1 (Ser824), p-CHK2 (Thr68),p-p53 (Ser15), and total p53, as well as p-CHK1 (Ser345) in bothcell lines. The consequences of ATM pathway overactivation wererevealed by strongly elevated expression of the p53 target genes,p21,MDM2, and PUMA,measured 6 and 24 hours after radiationin both cell lines (Fig. 2B). The levels of these p53 transcriptionaltargets, mediating its main functions in the DDR, cell-cycle arrestand apoptosis, were 2–5-fold higher than the levels induced by IRalone. Similar results were obtained in two additional p53

Sun et al.





wild-type cancer cell lines, HCT116 and RKO, in which M3814enhanced the ATM-dependent p53 response to IR (Supplemen-tary Fig. S1). Additionally, the selective ATM inhibitorM3541 (21) blocked the p53 boost by M3814 indicating thatATM overactivation is the primary mechanism behind theenhanced p53 response (Supplementary Fig. S1).

Elevated expression of the pan-CDK inhibitor p21, togetherwith increased activities of the cell-cycle checkpoint proteinsCHK1 and CHK2, predicted stronger cell-cycle arrest in thepresence ofM3814. These expectationswere confirmedbyBrdUrdcell-cycle analyses in the p53 wild-type cancer cells A375 andA549 (Fig. 2C). M3814 alone had no significant effect on cell-cycle progression, and radiation partially arrested the cell cycle inboth lines, predominantly in G1 but also in G2–M phase. How-ever, combined treatmentwith IR andM3814 induced a completeproliferation block with practically no S-phase cells and predom-inantly G2–M arrest. Our results suggest that M3814 stronglyboosts the p53 response to DNA DSBs in p53 wild-type cancercells, leading to a fortified cell-cycle block. These effects were due

to the inhibition of DNA-PK catalytic activity, because neither thep53 boost nor the subsequent reinforced cell-cycle arrest could beinduced by the M3814 distomer (Supplementary Fig. S2A). Thisstructurally identical stereoisomer, designated M3814R, hasapproximately 20-fold lower cellular potency against DNA-PKand offers an excellent negative control for mechanistic cellularstudies. Back-to-back testing of the eutomer anddistomer showedincreased activation of p53 signaling (Supplementary Fig. S2Band S2C) and complete cell-cycle block (Supplementary Fig. S2D)only by the eutomer M3814 (Supplementary Fig. S2B and S2C).Similarly, two other DNA-PK inhibitors, VX-984 (22) and KU-57788 (N-7441; ref. 23), demonstrated activation of the p53response compared with IR alone (Supplementary Fig. S2C). Theselective ATM inhibitor M3541 abrogated DNA-PK inhibitor–induced p53 boost (Supplementary Fig. S1) and the completecell-cycle arrest in irradiated A375 cells (Supplementary Fig. S2E),suggesting that these events are downstream of the ATMpathway.Altogether, our data revealed that DNA-PK inhibition in thepresence of DNA DSBs overactivates the ATM/p53 signaling axis

0

20

40

60

80

100

120

0 0.2 0.4 0.6 0.8 1

p-D

NA

-PK

/t-D

NA

-PK

(%)

M3814 (µmol/L)

A549RKOHCT116

M3814Assay/target

Activity (IC50)Selectivity (x-fold)

nmol/L 6.0KP-ANDnmol/L 000,01MTA

PI3Kα 550xPI3Kβ 417xPI3Kγ >1,000xPI3Kδ 158x

x000,01>ROTm

276 kinase panel Selective

M3814

A

CIR

IR+M3814

DMSO

A549 cells

M3814

D

B

***

180

160

140

120

100

80

60

40

20

0

4 h 24 h

Cel

ls w

ith >

10 fo

ci (%

)

IR IR

IR+M

3814

IR+M

3814

Figure 1.

M3814 is a potent and selective inhibitor of DNA-PK activity and DSB repair in cancer cells. A,M3814 chemical structure and summary of in vitroM3814 activityand selectivity from profiling data. M3814 was tested for activity in a panel of 284 kinases at 1 mmol/L concentration and at a full concentration range against thekinases inhibitedmore than 50% in the screen to determine IC50. Selectivity represents the fold difference between IC50 for M3814 and the closest members ofthe PI3K family (19). B,M3814 effectively inhibits DNA-PK activity in cultured cancer cells, A549, RKO, and HCT116. DNA-PK inhibition was determined by DNA-PKautophosphorylation (p-DNA-PKSer2056/total DNA-PK) 1 hour after IR (5 Gy) in the presence or absence of indicated M3814 concentrations by an MSD-basedassay. C,M3814 inhibits DSB repair in cancer cells. Exponentially growing A549 cells were exposed to M3814 (1 mmol/L) or IR (5 Gy) in the presence or absence ofM3814 (1 mmol/L) and cell nuclei and gH2AX foci were visualized by immunofluorescence 4 hours later. Scale bars, 10 mm. D, A549 cells were treated as above inthe presence or absence of M3814 (1 mmol/L). At least 200 cells in five different fields were counted at 4 and 24 hours after radiation. The number of cells with>10 gH2AX foci is expressed as a percentage of irradiated DMSO controls at 4 hours (100%).






and enhances the protective function of cell-cycle checkpoints incancer cells expressing wild-type p53.

Irradiated p53 wild-type and p53-deficient cancer cells responddifferently to DNA-PK inhibition

As the ATM/p53 response to IR was strongly potentiated byM3814, we examined the cellular consequences of combined IRand M3814 treatment of cancer cells by real-time imaging usingthe IncuCyte instrument.We chose two cell lines, A549 andHeLa,widely used in cell biology due to their larger size and relativelyflat morphology. Clones of these lines, A549NucLight Green andHeLa NucLight Green, have been engineered to homogeneouslyexpress nuclear-restricted green fluorescence protein (GFP), thusallowing better live visualization of nuclear morphology andanalyses of nuclear count. A549 NucLight Green (p53 wild-type)and HeLa NucLight Green (p53-dysfunctional) also permit prob-ing p53's role in the response to IR-induced DSBs in the presenceof a DNA-PK inhibitor.

Exponentially growingA549NucLight andHeLaNucLight cellswere exposed to a single 5 Gy IR dose and their proliferation wasfollowed by IncuCyte, which allows cell proliferation curves to begenerated based on real-time measurement of nuclear count.M3814 (1 mmol/L) alone had a minimal effect on cell growthkinetics as expected from a selective DNA-PK inhibitor (19). IRpartially inhibited proliferation of both cell lines. However, thecombination of IR and M3814 resulted in a strong proliferationblock (Fig. 3A). The substantial upregulation of the key cell-cyclecheckpoint molecules downstream of ATM (CHK2, CHK1) andp53 (p21) was expected to potentiate cell-cycle arrest in responseto radiation damage as observed in A549 cells (Fig. 2C). Indeed, asingle IR (5 Gy) dose in the presence of M3814 led to a complete

cell-cycle block in the G1 and G2–M phase for 3 consecutive days(Fig. 3B; Supplementary Figs. S3 and S4A). Under the sameconditions, p53-dysfunctional HeLa cells, in which HPV E6protein mediates p53 degradation (24), showed only a partialcell-cycle arrest, predominantly in G2–M phase. The arrest wasunstable, and within the next 24 hours cells underwent mitoticslippage and cell-cycle reentry, as indicated by the emergence ofsub-G1 and 8n fractions associated with cell death and polyploi-dization (Fig. 3B; Supplementary Fig. S3).

Live-imaging and time-lapse photography of A549 NucLightand HeLa NucLight cells exposed to IR and M3814 over 7 daysfurther highlighted the dramatically different outcomes in thesetwo cell populations (Fig. 3C; Supplementary Fig. S4). A549 cellsshowed a sustained proliferation block, acquired a classic senes-cence phenotype, characterized by large cell size and flat mor-phology (Fig. 3C; Supplementary Fig. S4A, B-video), and stainedintensely for SA-b-Gal (Supplementary Fig. S4C). Lack of visiblemitotic cells confirmed our previous observations, indicating thatthe strong G2–M arrest occurs in the G2 phase. The senescencephenotype developed gradually, reaching a plateau between days4 and 6whenmost cells acquired pronounced senescence features(Supplementary Fig. S4A and S4B). Two other p53 wild-typecancer lines, A375 and H460, underwent a similar completecell-cycle arrest, and most cells acquired premature senescencephenotype with substantially larger cell size compared withproliferating control cells (Supplementary Fig. S5A).

To assess the reversibility of the senescence phenotype inducedby M3814 in irradiated cells, we treated exponentially prolifer-ating A549 cell with IRþM3814 for 7day untilmost of the cells inthe population developed full senescence phenotype. TheMDM2antagonist nutlin-3a, previously shown to induce complete cell-

p-CHK2

p-p53

p53

p-ATM

p-KAP1

p-CHK1

M3814 (1 µmol/L)IR (5 Gy)

GAPDH

+ +--+ +- -

A375 A549

CHK2

ATM

KAP1

CHK1

+ + --+ +- -

A

47% 12%

S:41%

49% 11% 66% 16% 37% 62%

S:40% S:18%

DNA 7-AAD-A

Brd

U-F

ITC

-A

IR+M3814IRM3814DMSO

42% S:40% S:16%

12% 47% 13% 55% 29%

IR+M3814S:2%

IRM3814DMSO

46%

DNA 7-AAD-A

Brd

U-F

ITC

-A

35% 63%

S:1%

0

2

4

6

8

10

12

14

16

18

6 h24 h

0

2

4

6

8

10

12

14B

0

5

10

15

20

25

30

35

40

mR

NA

(fold

cha

nge)

0

5

10

15

20

25

30

mR

NA

(fold

cha

nge)

0

2

4

6

8

10

12

6 h24 h

0

2

4

6

8

10

12

14

16

18

C**

*

*

*

***

**

*

*

**

*

*

*

*NS

NSNS

NS NS

NS NS NS

*

p21 MDM2 PUMA

**

*

NS*

p21 MDM2 PUMA

Figure 2.

Inhibition of DNA-PK activity by M3814 overactivates the p53 response to radiation-induced DSBs. A, The p53 wild-type cancer cells, A375 and A549, wereincubated with 1 mmol/L M3814 for 1 hour followed by IR (5 Gy). Six hours later, protein levels were analyzed byWestern blotting with antibodies against ATM andp-ATM (S1981), KAP1 and p-KAP1 (S824), CHK2 and p-CHK2 (T68), CHK1 and p-CHK1 (S345), p53 and p-p53 (S15), and GAPDH. B, Cells treated as above wereused to determine changes in mRNA expression of the p53 target genes, p21, MDM2, and PUMA, by qPCR, normalized to GAPDH and expressed as fold changecompared with the DMSO controls. C, Irradiated A375 and A549 cells treated with M3814 as above were analyzed for cell-cycle distribution after a BrdUrd pulse,24 hours after IR.

Sun et al.





cycle arrestwith senescencephenotype,wasused as a control (25).Both nutlin-3a and IR þ M3814 effectively induced prematuresenescence phenotype (Supplementary Fig. S5B). Senescent cellpopulations were then washed with and incubated in drug-freemedia for another 7 days. To detect cells that might have escapedsenescence, BrdUrd was added for 24 hours and cells undergoingactive proliferationwere identified by immunofluorescence stain-ing with anti-BrdUrd-FITC antibody. No cells in active S-phasewere detected in IR þ M3814 treated cells but proliferating cellswere visualized in the nutlin-induced controls (SupplementaryFig. S5B). These experiments confirmed previous findings thatnutlin-induced senescence phenotype is reversible (25) but indi-cated that IR þM3814 induced senescence is durable; no cells inS-phase were found after 7 days in drug-free media (Supplemen-tary Fig. S5B). Time-lapse imaging of the senescent A549 cells afterremoval of M3814 and incubation in drug-free media for 7 daysshowed nomitotic events or changes in cell size andmorphology,confirming the stability of the senescence phenotype induced byIR þ M3814 (Supplementary Fig. S5C). These results indicatedthat DNA-PK inhibition is a strong inducer of premature anddurable senescence in irradiated p53 wild-type cancer cells.

A different outcome was observed for the HeLa NucLight cells.Live time-lapse imaging of cells exposed to IR þ M3814 for 7consecutive days (Supplementary Fig. S4A and S4B-video). Theinitial partial M phase arrest, revealed by a rounded cell mor-phology, was followed by mitotic slippage and reentry into S-phase and mitosis with unrepaired DSBs, leading to apoptosis

and cell death with the characteristics of mitotic catastrophe(Supplementary Fig. S4B-video). Live quantification of cell deathevents in the A549 NucLight and HeLa NucLight cells exposed toIR þ M3814 confirmed that A549 cells are effectively protectedfrom death, whereas most of the HeLa cells did not survive thetreatment (Fig. 3D). The remarkable difference in outcome of p53wild-type A549, and p53-dysfuctional HeLa cells, suggested thatp53 functionality might be an important determinant of cell fate.However, a contribution of othermolecular events in addition to,or independent of, the p53 pathway could not be excluded whencomparing two different cell lines.

p53 is a critical determinant of cancer cell fate in response to IRand M3814

To assess the role of p53 in the cellular response to IR-inducedDSBs in the presence of a DNA-PK inhibitor, we generatedp53-null clones of A549 and HT-1080 cell lines using CRISPR/Cas9 technology. Two p53-null clones with deletion of thetargeted p53 gene segments and no detectable expression offull-size p53 protein were selected (Supplementary Fig. S6).Cell-cycle analyses of the A549 isogenic pair using BrdUrd label-ing showed that radiation alone partially inhibited the cell cycle,reducing the S-phase population from 45% to 17% in p53 wild-type cells. However, combination treatment with 5 Gy IR and 1mmol/L M3814 completely blocked cell-cycle progression, arrest-ing the cells in both G1 and G2–M (Fig. 4A). No visible roundedcells were present, indicating that the arrested population was in

A54

9N

ucLi

ght

HeL

a N

ucLi

ght

Day 7

Day 7

Day 0

A B C

0

400

800

1,200

1,600

2,000

0 1 2 3 4 5 6

Gre

en n

ucle

i cou

nts

Days after treatment

DMSOIRM3814IR+ M3814

0

200

400

600

800

1,000

1,200

0 1 2 3 4 5 6

Gre

en n

ucle

i cou

nts

Days after treatment

DMSOIRM3814IR+ M3814

Day 0

A549 Nuc

HeLa Nuc

24 h48 h72 h

100 μm

100 μm

100 μm

100 μm

A549 Nuc

HeLa Nuc

0

20

40

60

80

100

0 1 2 3 4 5 6

0 1 2 3 4 5 6

DMSOM3814IRIR+M3814

0

20

40

60

80

100DMSOM3814IRIR+M3814

D

Rel

ativ

e ce

ll de

ath

Rel

ativ

e ce

ll de

ath

A549 Nuc

HeLa Nuc

A549 Nuc A549 Nuc

HeLa Nuc

HeLa Nuc

Cou

ntC

ount

24 h48 h72 h

DNA 7-AAD-A

2,000

1,500

1,000

500

0

1,000

800

600

400

200

0

00

200

400

600

800

1,000

500

1,000

1,500

2,000

2,500

G1

G1

G2–M

G2–M

Figure 3.

p53 wild-type and p53-deficient cells respond differently to IR and M3814. A, The p53 wild-type A549 NucLight, and p53-deficient HeLa NucLight cells wereexposed to a single dose of IR (5 Gy) and M3814 (1 mmol/L) and cultured for 6 days. The number of GFP-expressing nuclei per field was determined every 2 hoursby IncuCyte live imaging and plotted for each condition. B, A549 and HeLa cells were treated as above, and their cell-cycle profiles were analyzed 24-, 48-, and72-hours after IR. C, A549 NucLight and HeLa NucLight cells were treated as in A and incubated for 7 days. Live images were acquired by IncuCyte at 10�magnification every 2 hours for 7 consecutive days. Representative day 0 and 7 images are shown. Complete time-lapse videos can be accessed viaSupplementary Fig. S3. D,A549 NucLight and HeLa NucLight cells were treated as inA and C and incubated for 7 days. Real-time cell death was measured withIncuCyte by imaging cells every 2 hours in four different fields per condition after the addition of the Mix-and-Read CytoTox Red Reagent. Relative cell death wascalculated as a ratio of the number of red objects per view and the green nuclei count and plotted for 7 consecutive days.






theG2phase. The arrestwas stronger (2%S-phase) than that in theNutlin-3a control (5% S-phase). The MDM2 inhibitor activatesp53 via a nongenotoxic mechanism, preventing its degradation,and has been widely used as a specific activator of p53 anddownstream signaling (26). At 10 mmol/L, Nutlin-3a maximallystabilizes p53 and activates its cell-cycle arrest function in theseandmost other cancer cell lines (27). Cell-cycle distribution in thep53-null A549 cell population was not affected by Nutlin-3a,confirming its p53-deficient status. Here, the same combinationtreatment induced only a partial arrest, with 13% of the cellpopulation in S-phase. The G2–M arrest was unchanged, ataround 60%, suggesting that in the absence of functional p53,it is maintained by p53-independent mechanisms, most likelyCHK1 and CHK2, which were also elevated byM3814 treatment.These experiments clearly indicated that p53 is a key contributorto the complete cell-cycle arrest observed following irradiation ofA549 wild-type cells in the presence of a DNA-PK inhibitor.

Next, we looked at the consequences of combined IR andM3814 treatment using A549 isogenic cells and live imaging, asdescribed above. Continued real-time observation and time-lapsedigital imaging for 5 days after irradiation in the presence ofM3814 revealed morphologic changes reminiscent of those pre-viously observed in A549 and HeLa cell lines under identicalconditions (Fig. 3). Parental p53 wild-type cells underwent com-plete arrest and acquired a senescence phenotype 3–5days after IR(Fig. 4B; Supplementary Fig. S6-video). p53-null cells continuedto cycle, albeit at a significantly reduced rate, entered S-phase andmitosis with unrepaired DSBs, and most of them subsequentlyunderwent apoptosis induced by mitotic abnormalities (Fig. 4B;Supplementary Fig. S7-video). Apoptotic cell death was detected

by live Caspase-3/7 activity imaging only in the p53-null cells(Fig. 4C). Radiation alone was not able to effectively halt cellproliferation in both p53-wild-type or null clones (Fig. 4A; Sup-plementary Fig. S7-video). Similar cell-cycle effects (Supplemen-tary Fig. S8A) and different cell fates (Supplementary Fig. S8B)wereobservedwith the second isogenic pair of cell lines,HT-1080,under identical treatment conditions.

Together, our studies revealed that the fate of irradiated cancercells inwhichNHEJ repair is suppressed by aDNA-PK inhibitor, isdetermined by the presence or absence of functional p53. Thetumor suppressor levels, which were substantially upregulated byATM overactivation, imposed a strong break on the cell cycle inp53 wild-type cancer cells. This effect was primarily mediated byp53 but likely also involved the elevated activities of the cell-cyclecheckpoint regulators CHK1 and CHK2. The protective functionof p53 was lost in p53-deficient lines; these cells entered replica-tion andmitosis with unrepaired DSBs, which was detrimental totheir genomic and cellular integrity and resulted in the death ofmost cells.

TP53 status as a predictive biomarker for combinationtreatment with IR and DNA-PK inhibitor

The distinct responses of p53-functional and -dysfunctionalcancer cells to IR andM3814were revealed by carefully examiningcells through live imaging but were not easily identifiable bystandard single-point assays. In fact, themostwidely used growth/viability assays, which quantify viable cell populations versusuntreated exponentially proliferating controls, were unable todifferentiate between strong cell-cycle inhibitors and cytotoxicagents. Indeed, the kinetic growth profiles of p53 wild-type and

A549 (p53-Null)

A549 (p53-WT)

IR + M3814 (Day 5)A B

50 μm

50 μm0

20406080

100120140160

0 1 2 3 4 5 6

DMSOIRM3814IR+M3814

A54

9 (p

53-W

T)

RIa3-niltuN 4183M + RIOSMD

A54

9 (p

53-N

ull)

46% 63% 32% 69% 14% 37%61%

8%

S:45% S:5% S:17% S:2% S:45%

9% 47%

DNA 7-AAD-A

Brd

U-F

ITC

-A

S:46% S:45% S:13% S:44%

45% 9% 45% 10% 45% 10% 59% 13% 25% 62%

S:28%

DNA 7-AAD-A

Brd

U-F

ITC

-A

M3814

RIa3-niltuN 4183M + RIOSMD M3814

020406080

100120140160

0 1 2 3 4 5 6

DMSOIRM3814IR+M3814

A549 (p53-WT)

Days

A549 (p53-Null)

Rel

ativ

e ap

opto

sis

Rel

ativ

e ap

opto

sis

C

Figure 4.

p53 is a critical determinant of cellular response to IR in the presence of M3814. A, CRISPR-generated isogenic pair of A549 lines (p53 wild-type and p53-null)were exposed to Nutlin-3a (10 mmol/L), M3814 (1 mmol/L), IR (5 Gy), or IR (5 Gy) plus M3814 (1 mmol/L) for 24 hours and their cell-cycle profiles were analyzedafter BrdUrd labeling for 1 hour prior to harvest. The percentage of cells in each cell-cycle phase was determined by FlowJo software. B, Cells treated as abovewith a combination of IR and M3814 were incubated for 5 days and live phase-contrast images were acquired at 20�magnification every 2 hours for 5consecutive days. Representative cell images shown on day 5. Time-lapse videos of IR alone and IRþM3814 treatment are accessible via Supplementary Fig. S7.C,A549 p53-WT and p53-Null cells were treated as in B and real-time cell apoptosis was measured with IncuCyte by imaging cells every 2 hours in four differentfields per condition for 6 days in the presence of Caspase-3/7 Green reagent. Relative cell apoptosis was calculated as a ratio of the number of green objects perview and percentage cell confluence and plotted for 6 consecutive days.

Sun et al.





p53-mutant (dysfunctional) cancer cells were nearly undistin-guishable (Fig. 5A). When cell confluence was used to monitorproliferation, both p53 wild-type and dysfunctional cell linesexposed to IR and M3814 showed a very strong inhibitory effectwith almost identical growth profiles. Comparisons betweensmall panels of p53 wild-type (A375, A549, and H460) andp53-null/mutant cells (HeLa, FaDu, and H1299) were unable toidentify the p53-dependence of the response (Fig. 5B).

To detect and quantify the two distinct cellular responses toIR and M3814 (cell-cycle arrest vs. cell death) observed by liveimaging, we used the IncuCyte instrument to count individual

cell death events in real-time. IncuCyte CytoToxRed reagent canpenetrate compromised cell membranes and stain DNA ofdying cells. The six-cancer cell line panel was exposed to IRand M3814 as above, and CytoToxRed-positive cells werecounted and plotted over the following 6 days (Fig. 6). Thecell images (Fig. 6A) and derived kinetic cytotoxicity curvesindicated that p53 wild-type cells are resistant to killing, andthat only p53-null/mutant cells suffer cell death consequences.Relative cell death in each sample was calculated from thenumber of dead cell events normalized to cell confluence onday 6; this clearly separated the effect in p53 wild-type from

Days after irradiation

0

20

40

60

80

100

120

140

IR M3814 M3814 + IR

Nor

mal

ized

cel

l con

fluen

ce (%

)

A375

A549

H460

HeLa

FaDU

H1299Cel

l con

fluen

ce (%

)

A B

020406080

100120

0 1 2 3 4 5 60

20406080

100120

0 1 2 3 4 5 60

20406080

100120

0 1 2 3 4 5 6

0

20

40

60

80

100

120

0 1 2 3 4 5 6

DMSOIRM3814M3814+IR

0

20

40

60

80

100

120

0 1 2 3 4 5 60

20

40

60

80

100

120

0 1 2 3 4 5 6

A375 A549 H460

HeLa H1299 FaDu

P53

-WT

P53

-def

icie

nt

NS

NS

NS

Figure 5.

Cell growth assays are unable to detect the p53-dependent response of cancer cells to IR and M3814.A, p53 wild-type (A375, A549, and H460) and p53-deficient(HeLa, FaDu, and H1299) cells were cultured in 96-well plates overnight. The next day, cells were exposed to 2 Gy IR and 1 mmol/L M3814 and incubated for6 days. Cell images were taken by IncuCyte from four different fields/condition every 2 hours for 6 consecutive days, and cell confluence was calculated andplotted as percent. B, Cell growth/viability of the six lines was determined from the confluence profiles above on day 4 and plotted as a percentage of theconfluence determined in the DMSO controls (set as 100%).

Days after irradiation

0

10

20

30

40

50

60

70

DMSO IR M3814 M3814 + IR

Rel

ativ

e ce

ll de

ath A375

A549

H460

HeLa

FaDU

H1299

A BFaDu HeLa H1299A375 A549 H460

p53 wild-type

p53-deficient

0

20

40

60

80

0 1 2 3 4 5 60

20

40

60

80

0 1 2 3 4 5 6

10

20

40

60

80

0 1 2 3 4 5 60

20

40

60

80

0 1 2 3 4 5 60

20

40

60

80

0 1 2 3 4 5 60

20

40

60

80

0 1 2 3 4 5 6

DMSOM3814IRIR+M3814

Rel

ativ

e ce

ll de

ath

NSNS NS

NS

NS

*

p53 WT p53-deficient

P < 0.05

80

60

40

20

0

Rel

ativ

e ce

ll de

ath

Figure 6.

Quantification of cancer cell death by live-cell imaging reveals a p53 status–dependent differential effect of IR and M3814 treatment. A, Real-time cell death wasmeasured continuously with IncuCyte by imaging cells every 2 hours in four different fields/condition after the addition of the Mix-and-Read CytoTox RedReagent in the six cell lines under the same treatment conditions described in Fig. 5A. Relative cell death was calculated as a ratio of the number of red objectsper view and percentage cell confluence and plotted for 6 continuous days. Representative images are shown above the corresponding profile for day 4.B, Relative cell death on day 4, calculated as above, was plotted for all cell lines and conditions. P values for the difference between the three p53 wild-type andthree p53-deficient cell lines were calculated for day 4 (inset).






that in p53-null/mutant cells (Fig. 6A). The sensitivity of thetwo small panels differed by several-fold (Fig. 6B). Thus,quantification of cell death in the population of treated cellsrevealed distinct differences in response and the important roleof p53 in determining cell fate.

Next, we used an endpoint apoptosis (caspase-3/7 activity)assay to further test and validate ourfindingswith a larger panel ofcancer cell lines. Eight additional solid tumor lines were added tothe previously characterized six-line panel, which now containedseven p53 wild-type (A375, A549, H460, LoVo, SK-MEL-28, SK-N-SH, and HT-1080) and seven p53-null/mutant (HeLa, FaDu,H1299, DU145, HT29, SW480, and A431) lines. The p53 dys-functional lines were either p53-null (H1299), p53-deficient(HeLa), or carried mutations known to disable p53 transcrip-tional activity considered key to its tumor suppressor func-tions (28). Testing of the expanded panel for caspase activity6 days after 2 Gy IR and M3814 treatment indicated a clearseparation between the cancer cell lines based on their p53functional status (Fig. 7A), revealing an average 5-fold differencebetween the sensitivity of p53-null/mutant versus p53 wild-typelines (Fig. 7B). These experiments confirmed and extended ourobservations to a larger randomly selected panel of cancer celllines.

Taken together, our results showed that inhibition of DNA-PKcatalytic activity and the repair of IR-induced DSBs alters thenatural response to radiation by boosting ATM/p53 signaling.This fortifies their cell-cycle arrest function, leading to inductionof nearly complete premature senescence in the cell populationexpressing wild-type p53. In the absence of functional p53,cancer cells lose their ability to execute the p53 protectionprogram and undergo detrimental changes, ultimately leadingto cell death. These opposing outcomes are dependent on thepresence of functional p53. Therefore, TP53 status is a criticaldeterminant of cancer cell fate and could offer a potentialpredictive biomarker for combination treatment with radiationand DNA-PK inhibitors.

DiscussionThe cellular response to DNA DSBs is complex and includes a

highly regulated set of mechanisms and pathways that haveevolved to minimize the detrimental consequences of the mostlethal lesions andassureproper and efficient repair (29).NHEJ andHR are two main DSB-repair pathways regulated by the serine/threonine kinasesDNA-PKandATM, respectively.DNA-PK is a keydriver of NHEJ repair, whereas ATM regulates both HR and NHEJrepair, as well as the cellular checkpoint machinery (30). Inresponse to DSBs, the p53 master tumor suppressor is activatedby direct ATM phosphorylation on multiple sites (2). In addition,ATM-mediated phosphorylation of its negative regulator, the E3ubiquitin ligase MDM2, leads to p53 stabilization and activa-tion (31, 32). Although multiple p53 transcriptional targets areaffected in the DDR, p21 and PUMA have been most well char-acterized and are considered key molecular mediators of thecheckpoint functions of p53 (2). The pan-CDK inhibitor p21 isa potent driver of cell-cycle arrest at the G1/S and G2–M bor-der (33). PUMA is the main player in the induction of the p53-dependent intrinsic apoptotic pathway (34). By controlling thesetwo functions, p53 arrests the cell cycle and protects cells fromentering S and M phases with unrepaired DSBs or eliminatesheavily damaged cells via apoptosis to prevent cancerogenic con-sequences of geneticmutation and aneuploidy (1). The abilities ofp53 to control the fate of DNA-damaged cells have established thetumor suppressor as a key component of the DDR (2). In its cell-cycle checkpoint function, p53 is assisted by CHK1 and CHK2,which can also mediate G2–M and G1/S arrest (29).

Using the selective DNA-PK inhibitor M3814, we probed theconsequences of intervening in NHEJ repair of DSBs on the maincheckpoint controls and cell fate in the face of radiation damage.Four different p53 wild-type cancer cell lines exhibited substan-tially elevated p53 protein levels and transcriptional activity,demonstrated by 2- to 5-fold higher expression of key p53 targetgenes (p21, MDM2, and PUMA) signaling downstream of an

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

M3814 IR M3814 + IR

Rel

ativ

e ap

opto

sis

LovoSK-MEL-28SK-N-SHA375A549H460HT1080FaDUHeLaDU145HT29H1299SW480A431

A B

p53-

defic

ient

p53

wild

-type

P = 0.006

NS

NS

**NS

NS

NS NS

NS NS

4

3

2

1

0

Rel

ativ

e ap

opto

sis

p53 WT p53-deficient

Figure 7.

Endpoint caspase-3/7 Glo assay recapitulates the findings of live imaging. A, Fourteen cancer cell lines with different TP53 status [seven wild-type and sevenp53-deficient (p53-null, -mutant, or –dysfunctional)] were exposed to 2 Gy IR and 1 mmol/L M3814 as described in the Fig. 6 legend. On day 4, Mix-and-ReadCaspase -Glo 3/7 Reagent was added for 1 hour at room temperature. Luminescence was read and normalized to that in DMSO-treated controls (100%) andexpressed as fold difference. B, The P value of the difference between p53 wild-type and p53-defficient cell lines was calculated from the data in A.

Sun et al.





overactive ATM pathway. Our results revealed that M3814 inter-venes in the DDR of p53wild-type cancer cells in a unique way bystrongly activating the p53 tumor suppressor to levels unattain-able by the natural response to radiation. This boost reinforcedcell-cycle checkpoints and caused a complete block at the G1/SandG2–Mborder during exposure toM3814.Within several days,cancer cells acquired a durable premature senescence. The abilityofM3814 to induce senescencewas lost in p53-null A549 andHT-1080 cells, indicating that expression of functional p53 is a criticalrequirement for senescence induction.Moreover, targeted disrup-tion of the p53 gene in the presence of persistent DSBs turned offp53-mediated protection and the majority of the cells underwentaberrant mitoses and apoptosis. Ultimately, most cells in thepopulation were effectively killed by mitotic catastrophe. Theseresults confirmed the key role of p53 in the induction of a durablesenescence phenotype and the determination of cancer cell fate.

The mechanism of ATM overactivation by DNA-PK inhibitionis a likely consequence of persistent signals fromunrepairedDSBsto ATM, anddisruption of the previously unrecognized regulatoryloop between DNA-PK and ATM. Zhou and colleagues recentlyidentified several sites on the ATM protein that, when phosphor-ylated byDNA-PK, negatively regulate ATM catalytic activity (35).Disruption of these negative signals by a DNA-PK inhibitor isexpected to positively affect ATM activity. Although this circuitappears to function primarily in normal cells under physiologicconditions, it is not unlikely to affect overall ATM activity andsignaling during the DDR (23).

Despite the strong activation of PUMA, a key regulator of p53-dependent apoptosis, we observed no signs of increased apopto-sis in p53 wild-type cells under combined IR and M3814 treat-ment. This probably reflects the fact that epithelial tumor cellsfrequently disable their p53 apoptotic pathways during cancerdevelopment by different mechanisms, even if transcriptionalactivation of PUMA remains functional. Studies with the MDM2antagonist Nutlin-3a, which selectively activates p53 signaling,including PUMA expression, in p53 wild-type cancer cells, haveshown that most solid tumor–derived cells have preserved p53-dependent cell-cycle arrest but lost the ability to induce p53-dependent apoptosis (27).

Induction of p53-dependent accelerated senescence in irradi-ated A460 and A549 cells by early DNA-PK inhibitors and siRNAhas been previously reported (14). However, the specificmechan-isms behind this phenomenon have not been characterized. Ourdata support a model in which the p53 tumor suppressor plays acritical role in the effective induction of premature senescence by aDNA-PK inhibitor, in p53 wild-type cancer cell lines. It resultsfrom the abnormally high activation of p53, p21, CHK1, andCHK2 for extended periods due to continuous blockade of DSBrepair by M3814, imposing strong breaks on the cell-cyclemachinery. In contrast, the normal checkpoint response to thesamedoseof radiationmanifests as apartial arrest. This is possiblydue to the timely repair of IR-induced DSBs and turning off thecheckpoint response.

Our results revealed that by inhibitingDNA-PK activity,M3814intervenes in the natural cellular response to IR by overactivationof the ATM/p53 signaling axis and checkpoint controls, withprofound consequences for cancer cell fate. The combined effectof persistent unrepaired DSBs and inhibition of DNA-PK–mediated negative phosphorylation of ATM induces supernormalamounts of p53 protein, leading to reinforced cell-cycle arrest andthe effective protection of cancer cells from death by p53-depen-

dent premature senescence. Cancer cells lacking functional p53cannot avoid entry into replication and mitosis with unrepairedDSBs, leading to a high level of genome instability and ultimatelycell death. These alternative fates are predetermined by the p53status of cancer cells.

Validation of our in vitro findings in the local radiation settingin vivo presents significant challenges because both p53 wild-typeand p53-dysfunctional tumor growth should be effectively sup-pressed by IRþM3814 treatment and appear similar when tumorvolumes are measured. During a 6-week fractional radiation þM3814 mouse xenograft study, modeling the clinical radiationpractice, both the H460 (p53-WT) and FaDu (p53-mutant) xeno-graft tumors have regressed (19). However, the growth of somep53-WT tumors has returned after a significant time lapse, whereasnone of the p53-mutant, FaDu, tumors from the equivalent dosegroup have regrown during the duration of the experiment(110 days). These results agree with our model and suggest thatp53-dysfunctional background may predict better overall effect ofthe combination therapy approach. Although p53 appears to playa critical role in response to IR þ M3814 in vitro, one could notexclude the possibility that the tumor microenvironment couldaffect or modify this response in vivo. Further dedicated in vivostudies areneeded toaddress this andother outstandingquestions.

Inhibition of cancer cell proliferation is considered a positiveoutcome in cancer treatment, allowing control of tumor growth.However, it also protects cancer cells from the consequences ofDNAdamage and cell death, andmayhave undesirable long-termeffects, as senescent cellsmayhave tumor-promoting activity (36).Apoptotic cell death, observed with combination treatment inp53-null/mutant cells, is a preferred outcome, which can result inlocal tumor regression and/or eradication. Therefore, selectingpatients with p53-dysfunctional tumors for combination radio-therapy with DNA-PK inhibitors may increase the response rateand improve therapeutic outcomes. Our experiments have iden-tified TP53 status as a potential predictive biomarker of responseto radiation and DNA-PK inhibition. As approximately 50% ofhuman cancers disable p53 activity during tumor developmentthrough mutation or deletion of the TP53 gene (28), identifica-tion of these patients is both feasible and desirable. Ongoingclinical investigations of M3814 in combination with locoregio-nal radiotherapy may shed more light on the clinical relevance ofp53 as a predictive biomarker.

Disclosure of Potential Conflicts of InterestQ. Sun is a postdoc/scientist at EMD Serono R&D Institute Inc. X. Liu is a

principal scientist at EMD Serono. F. Czauderna is a group leader at EMDSerono. M.I. Carr is a postdoctoral scientist at EMD Serono, Inc. F.T. Zenke is asenior director for Merck Healthcare KGaA. A. Blaukat is head, translationalinnovation platform oncology, Merck KGaA. L.T. Vassilev is a senior director atEMD Serono. No potential conflicts of interest were disclosed by the otherauthors.

Authors' ContributionsConception and design: Q. Sun, Y. Guo, X. Liu, L.T. VassilevDevelopment of methodology: Q. Sun, Y. Guo, L.T. VassilevAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): Q. Sun, Y. Guo, F. Czauderna, M.I. Carr, F.T. ZenkeAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): Q. Sun, Y. Guo, F. Czauderna, M.I. Carr, F.T. Zenke,L.T. VassilevWriting, review, and/or revision of the manuscript: Q. Sun, Y. Guo, X. Liu,F. Czauderna, F.T. Zenke, L.T. VassilevStudy supervision: A. Blaukat, L.T. Vassilev






AcknowledgmentsWe thank Thomas Fuchss for the synthesis, analyses, and profiling of the

Merck KGaA compounds (M3814, M3814R, and M3541), Ulrich Pehl forcompound selectivity profiling, Christian Sirrenberg for development of theoriginal MSD assay protocol, and Young Choi for her experimental help withcell-cycle analyses. Thisworkwas funded byMerck KGaA,Darmstadt, Germany.

The costs of publicationof this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received April 6, 2019; revised July 23, 2019; accepted September 20, 2019;published first September 24, 2019.

References1. Ciccia A, Elledge SJ. The DNA damage response: making it safe to play with

knives. Mol Cell 2010;40:179–204.2. Rashi-Elkeles S, Elkon R, Shavit S, Lerenthal Y, Linhart C, Kupershtein A,

et al. Transcriptional modulation induced by ionizing radiation: p53remains a central player. Mol Oncol 2011;5:336–48.

3. Williams AB, Schumacher B. p53 in the DNA-damage-repair process.Cold Spring Harb Perspect Med 2016;6:a026070.

4. Jackson SP, Bartek J. The DNA-damage response in human biology anddisease. Nature 2009;461:1071–8.

5. Hiom K. Coping with DNA double strand breaks. DNA Repair (Amst)2010;9:1256–63.

6. Kasparek TR, Humphrey TC. DNA double-strand break repair pathways,chromosomal rearrangements and cancer. Semin Cell Dev Biol 2011;22:886–97.

7. Salles B, Calsou P, Frit P, Muller C. The DNA repair complex DNA-PK, apharmacological target in cancer chemotherapy and radiotherapy.Pathol Biol (Paris) 2006;54:185–93.

8. Curtin NJ. DNA repair dysregulation from cancer driver to therapeutictarget. Nat Rev Cancer 2012;12:801–17.

9. Furgason JM, Bahassi el M. Targeting DNA repair mechanisms in cancer.Pharmacol Ther 2013;137:298–308.

10. Davis AJ, Chen DJ. DNA double strand break repair via non-homologousend-joining. Transl Cancer Res 2013;2:130–43.

11. Jette N, Lees-Miller SP. The DNA-dependent protein kinase: A multifunc-tional protein kinase with roles in DNA double strand break repair andmitosis. Prog Biophys Mol Biol 2015;117:194–205.

12. Blackford AN, Jackson SP. ATM, ATR, and DNA-PK: The trinity at the heartof the DNA damage response. Mol Cell 2017;66:801–17.

13. Dobbs TA, Tainer JA, Lees-Miller SP. A structural model for regulation ofNHEJ by DNA-PKcs autophosphorylation. DNA Repair (Amst) 2010;9:1307–14.

14. Azad A, Jackson S, Cullinane C, Natoli A, Neilsen PM, Callen DF, et al.Inhibition of DNA-dependent protein kinase induces accelerated senes-cence in irradiated human cancer cells. Mol Cancer Res 2011;9:1696–707.

15. Block WD, Merkle D, Meek K, Lees-Miller SP. Selective inhibition of theDNA-dependent protein kinase (DNA-PK) by the radiosensitizing agentcaffeine. Nucleic Acids Res 2004;32:1967–72.

16. Daido S, Yamamoto A, Fujiwara K, Sawaya R, Kondo S, Kondo Y.Inhibition of the DNA-dependent protein kinase catalytic subunit radio-sensitizesmalignant glioma cells by inducing autophagy. Cancer Res 2005;65:4368–75.

17. Hashimoto M, Rao S, Tokuno O, Yamamoto K, Takata M, Takeda S, et al.DNA-PK: the major target for wortmannin-mediated radiosensitization bythe inhibition of DSB repair via NHEJ pathway. J Radiat Res 2003;44:151–9.

18. Munck JM, Batey MA, Zhao Y, Jenkins H, Richardson CJ, Cano C, et al.Chemosensitization of cancer cells by KU-0060648, a dual inhibitor ofDNA-PK and PI-3K. Mol Cancer Ther 2012;11:1789–98.

19. Zenke FT, Zimmermann A, Sirrenberg C, Dahmen H, Vassilev L, Pehl U,et al. Abstract 1658: M3814, a novel investigational DNA-PK inhibitor:enhancing the effect of fractionated radiotherapy leading to completeregression of tumors in mice. Cancer Res 2016;76:Supplement.

20. Chen BP, ChanDW, Kobayashi J, Burma S, AsaithambyA,Morotomi-YanoK, et al. Cell cycle dependence of DNA-dependent protein kinase phos-phorylation in response to DNA double strand breaks. J Biol Chem 2005;280:14709–15.

21. Fuchss T,Mederski WW, Zenke FT, DahmenH, Zimmermann A, Blaukat A.Abstract 329: Highly potent and selective ATM kinase inhibitor M3541: Aclinical candidate drug with strong antitumor activity in combination withradiotherapy. Cancer Res 2018;78:Supplement.

22. Timme CR, Rath BH, O'Neill JW, Camphausen K, Tofilon PJ. The DNA-PK inhibitor VX-984 enhances the radiosensitivity of glioblastoma cellsgrown in vitro and as orthotopic xenografts. Mol Cancer Ther 2018;17:1207–16.

23. Dong J, Zhang T, Ren Y, Wang Z, Ling CC, He F, et al. Inhibiting DNA-PKcsin a non-homologous end-joining pathway in response to DNA double-strand breaks. Oncotarget 2017;8:22662–73.

24. Scheffner M, Huibregtse JM, Vierstra RD, Howley PM. The HPV-16 E6 andE6-AP complex functions as a ubiquitin-protein ligase in the ubiquitina-tion of p53. Cell 1993;75:495–505.

25. Huang B, Deo D, Xia M, Vassilev LT. Pharmacologic p53 activation blockscell cycle progression but fails to induce senescence in epithelial cancercells. Mol Cancer Res 2009;7:1497–509.

26. Vassilev LT, VuBT,Graves B, CarvajalD, Podlaski F, Filipovic Z, et al. In vivoactivation of the p53 pathway by small-molecule antagonists of MDM2.Science 2004;303:844–8.

27. Tovar C, Rosinski J, Filipovic Z, Higgins B, Kolinsky K, Hilton H, et al.Small-molecule MDM2 antagonists reveal aberrant p53 signaling incancer: implications for therapy. Proc Natl Acad Sci U S A 2006;103:1888–93.

28. Leroy B, Fournier JL, Ishioka C, Monti P, Inga A, Fronza G, et al. The TP53website: an integrative resource centre for the TP53mutation database andTP53 mutant analysis. Nucleic Acids Res 2013;41:D962–9.

29. Bassing CH, Alt FW. The cellular response to general and programmedDNA double strand breaks. DNA Repair (Amst) 2004;3:781–96.

30. Shiloh Y, Ziv Y. The ATM protein kinase: regulating the cellular response togenotoxic stress, and more. Nat Rev Mol Cell Biol 2013;14:197–210.

31. Maya R, Balass M, Kim ST, Shkedy D, Leal JF, Shifman O, et al. ATM-dependent phosphorylation ofMdm2on serine 395: role in p53 activationby DNA damage. Genes Dev 2001;15:1067–77.

32. Meek DW, Hupp TR. The regulation of MDM2 by multisite phosphory-lation–opportunities for molecular-based intervention to target tumours?Semin Cancer Biol 2010;20:19–28.

33. El-Deiry WS. p21(WAF1) mediates cell-cycle inhibition, relevant to cancersuppression and therapy. Cancer Res 2016;76:5189–91.

34. Roos WP, Kaina B. DNA damage-induced cell death by apoptosis.Trends Mol Med 2006;12:440–50.

35. Zhou Y, Lee JH, Jiang W, Crowe JL, Zha S, Paull TT. Regulation of the DNAdamage response by DNA-PKcs inhibitory phosphorylation of ATM.Mol Cell 2017;65:91–104.

36. Coppe JP, Desprez PY, Krtolica A, Campisi J. The senescence-associatedsecretory phenotype: the dark side of tumor suppression. Annu Rev Pathol2010;5:99–118.


Sun et al.




2019;17:2457-2468. Published OnlineFirst September 24, 2019.Mol Cancer Res Qing Sun, Yige Guo, Xiaohong Liu, et al. M3814Following Exposure to Ionizing Radiation and the DNA-PK Inhibitor Therapeutic Implications of p53 Status on Cancer Cell Fate

Updated version

10.1158/1541-7786.MCR-19-0362doi:

Access the most recent version of this article at:

Material

Supplementary

http://mcr.aacrjournals.org/content/suppl/2019/09/26/1541-7786.MCR-19-0362.DC1

Access the most recent supplemental material at:

Overview

Visual

http://mcr.aacrjournals.org/content/17/12/2457/F1.large.jpgA diagrammatic summary of the major findings and biological implications:

Cited articles

http://mcr.aacrjournals.org/content/17/12/2457.full#ref-list-1

This article cites 34 articles, 11 of which you can access for free at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mcr.aacrjournals.org/content/17/12/2457To request permission to re-use all or part of this article, use this link



http://mcr.aacrjournals.org/lookup/doi/10.1158/1541-7786.MCR-19-0362

http://mcr.aacrjournals.org/content/suppl/2019/09/26/1541-7786.MCR-19-0362.DC1

http://mcr.aacrjournals.org/content/17/12/2457/F1.large.jpg

http://mcr.aacrjournals.org/content/17/12/2457.full#ref-list-1

http://mcr.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mcr.aacrjournals.org/content/17/12/2457


Documents

Therapeutic Implications of p53 Status on Cancer ... · joining, one of the main DSB-repair pathways, currently under clinical investigation. Here, we ... vating the ATM/p53 signaling