The Transcriptional Regulator HbxA Governs Development, … · indicated that conidial size in the ΔhbxA mutant was signiﬁcantly larger than those formedbythewildtype(Fig.3). The

The Transcriptional Regulator HbxA Governs Development,Secondary Metabolism, and Virulence in Aspergillus fumigatus

Timothy Satterlee,a Binita Nepal,a Sophie Lorber,b Olivier Puel,b Ana M. Calvoa

aDepartment of Biological Sciences, Northern Illinois University, DeKalb, Illinois, USAbToxalim (Research Centre in Food Toxicology), Université de Toulouse, INRAE, ENVT, INP-Purpan, UPS, Toulouse, France

ABSTRACT Aspergillus fumigatus is the leading cause of invasive aspergillosis, whichin immunocompromised patients results in a mortality rate as high as 90%. Earlierstudies showed that HbxA is a global regulator in Aspergillus flavus affecting mor-phological development and secondary metabolism. Here, we determined its role inA. fumigatus, examining whether HbxA influences the regulation of asexual develop-ment, natural product biosynthesis, and virulence of this fungus. Our analysis dem-onstrated that removal of the hbxA gene caused a near-complete loss of conidialproduction in the mutant strain, as well as a slight reduction in colony growth. Other as-pects of asexual development are affected, such as size and germination of conidia.Furthermore, we showed that in A. fumigatus, the loss of hbxA decreased the expres-sion of the brlA central regulatory pathway involved in asexual development, as wellas the expression of the “fluffy” genes flbB, flbD, and fluG. HbxA was also found toregulate secondary metabolism, affecting the biosynthesis of multiple natural prod-ucts, including fumigaclavines, fumiquinazolines, and chaetominine. In addition, us-ing a neutropenic mouse infection model, hbxA was found to negatively impact thevirulence of A. fumigatus.

IMPORTANCE The number of immunodepressed individuals is increasing, mainlydue to the greater life expectancy in immunodepressed patients due to improve-ments in modern medical treatments. However, this population group is highly sus-ceptible to invasive aspergillosis. This devastating illness, mainly caused by the fun-gus Aspergillus fumigatus, is associated with mortality rates reaching 90%. Treatmentoptions for this disease are currently limited, and a better understanding of A. fu-migatus genetic regulatory mechanisms is paramount for the design of new strate-gies to prevent or combat this infection. Our work provides new insight into theregulation of the development, metabolism, and virulence of this important oppor-tunistic pathogen. The transcriptional regulatory gene hbxA has a profound effect onA. fumigatus biology, governing multiple aspects of conidial development. This is rel-evant since conidia are the main source of inoculum in Aspergillus infections. Impor-tantly, hbxA also regulates the biosynthesis of secondary metabolites and the patho-genicity of this fungus.

KEYWORDS Aspergillus fumigatus, HbxA, aspergillosis, conidiation, geneticregulation, metabolome, virulence

The opportunistic human pathogen Aspergillus fumigatus is a known cause of a widerange of illnesses, including invasive aspergillosis (IA). Immunodeficient individualsare particularly susceptive to these diseases (1, 2). This population group includes organtransplant patients, individuals with genetic immunodeficiencies or receiving chemo-therapy, and HIV patients (3–8). The main site of entry leading to A. fumigatus infectionsis the respiratory tract. Healthy individuals are able to eliminate the inhaled fungalconidia (asexual spores) through mucociliary clearance. The remaining fungal spores

Citation Satterlee T, Nepal B, Lorber S, Puel O,Calvo AM. 2020. The transcriptional regulatorHbxA governs development, secondarymetabolism, and virulence in Aspergillusfumigatus. Appl Environ Microbiol 86:e01779-19. https://doi.org/10.1128/AEM.01779-19.

Editor Irina S. Druzhinina, Nanjing AgriculturalUniversity

Copyright © 2020 American Society forMicrobiology. All Rights Reserved.

Address correspondence to Ana M. Calvo,[email protected].

Received 1 August 2019Accepted 18 November 2019

Accepted manuscript posted online 22November 2019Published

GENETICS AND MOLECULAR BIOLOGY

crossm

February 2020 Volume 86 Issue 3 e01779-19 aem.asm.org 1Applied and Environmental Microbiology

21 January 2020

on May 30, 2021 by guest

http://aem.asm

.org/D

ownloaded from

https://doi.org/10.1128/AEM.01779-19https://doi.org/10.1128/ASMCopyrightv2mailto:[email protected]://crossmark.crossref.org/dialog/?doi=10.1128/AEM.01779-19&domain=pdf&date_stamp=2019-11-22https://aem.asm.orghttp://aem.asm.org/

encounter epithelial cells or alveolar macrophages responsible for phagocytosis andkilling of spores and for the initiation of a proinflammatory response that recruitsneutrophils. Neutrophils are able to destroy hyphae from germinated conidia that evadedmacrophages. However, patients who are neutropenic are at high risk of developing IA,with a mortality rate of up to 90% (9–13).

The small size of the A. fumigatus conidia contributes to its pathogenicity, reachingthe lung alveoli and establishing an infection that can become systemic (2). In addition,A. fumigatus produces numerous secondary metabolites (14–21) that are consideredpart of the fungal chemical arsenal required for niche specialization (22), includinghost-fungus interactions. Some of these metabolites act as immunosuppressants, whichmay be in association with pathogenic processes. For most IA infections, early diagnosisis critical, followed by treatment with antifungal drugs such as azoles, typically, vori-conazole (23, 24). Recently, strains of A. fumigatus have been shown to gain drugresistance; thus, it is necessary to identify new targets to control or prevent thepotentially lethal infections caused by A. fumigatus (24).

Fungal regulatory genes could constitute some of these novel genetic targets todesign antifungal therapies. In this work, we focused on studying the homeobox (Hbx)transcriptional regulator gene hbxA. Hbx proteins are a class of transcriptional regula-tors that govern development in many eukaryotes, including animals, plants, and otherfungi (25). A homolog of this gene in Aspergillus flavus has been shown to regulateaspects of morphological differentiation, including asexual development (26). A recenthbx1-dependent transcriptome analysis revealed that this gene controls numerousgenes involved in morphogenesis and secondary metabolism (27). We hypothesize thatthe homolog of hbx1 in A. fumigatus, hbxA, may play a similar role in the regulationof development and secondary metabolism in this important opportunistic humanpathogen.

Our study revealed that in A. fumigatus, a lack of hbxA leads to a slight reduction incolony growth and a near-complete loss of conidial production. Furthermore, weshowed that loss of hbxA decreased the expression of genes in the brlA centraldevelopmental pathway, as well as the expression of the “fluffy” genes flbB, flbD, andfluG. Other aspects of asexual development were affected in the absence of hbxA, suchas the size and germination rate of conidia. In addition, metabolomics analysis of thehbxA mutant indicated that this gene is a master regulator that governs the biosyn-thesis of numerous natural products. With respect to the effect of hbxA on pathoge-nicity, infection of neutropenic mice showed an increase in virulence in the hbxAdeletion mutant compared to the A. fumigatus wild-type strain.

RESULTShbxA is required for normal fungal growth and asexual development in A.

fumigatus. To determine the role of hbxA in A. fumigatus, two strains were generated,an hbxA deletion strain and a complementation strain (see Fig. S1A and B in thesupplemental material). The deletion of hbxA was confirmed by diagnostic PCR, yieldingthe expected 2.8-kb PCR product. The complementation strain was also verified by PCR,producing a 2.7-kb DNA fragment. In addition, the strains were confirmed by assessinghbxA expression levels with quantitative reverse transcription-PCR (qRT-PCR) (Fig. S1C).hbxA transcripts were absent in the ΔhbxA mutant strain, while the complementationstrain showed restoration of hbxA expression similar to that of the wild type. Next, thegrowth of all the strains was evaluated in point-inoculated cultures growing on solidglucose minimal medium (GMM) for 7 days. Our results indicated an approximately1.4-fold reduction in the growth of the ΔhbxA mutant compared to the controls (Fig. 1).

The absence of hbxA resulted in an almost aconidial strain. Specifically, a significantreduction of approximately 100-fold in conidial production with respect to the wildtype was observed (Fig. 1A and 2A). Complementation of the hbxA deletion mutantwith the hbxA wild-type allele restored normal conidiation. To gain insight into thehbxA mechanism that controls sporulation in A. fumigatus, we examined the expressionof the genes in the conidiation central regulatory pathway, brlA, abaA, and wetA (28).

Satterlee et al. Applied and Environmental Microbiology

February 2020 Volume 86 Issue 3 e01779-19 aem.asm.org 2


http://aem.asm

.org/D

ownloaded from

https://aem.asm.orghttp://aem.asm.org/

Deletion of hbxA resulted in a significant reduction in the expression of all three genescompared to the wild type (Fig. 2B to D).

Additionally, the expression of the fluffy genes flbB, flbD, and fluG was also down-regulated in the absence of hbxA (Fig. 2E to G). Interestingly, microscopic observations

FIG 1 hbxA is required for normal colony development. CEA10 wild-type (WT), ΔhbxA mutant, andcomplementation (Com) strains were point inoculated on solid GMM and allowed to grow in the dark at37°C. (A) Images of the colonies after 5 days of growth. (B) Quantification of colony growth measured asthe colony diameter. Error bars are used to indicate standard error. Different letters on the columnsindicate values that are statistically different (P � 0.05), as determined by ANOVA with the Tukey testcomparison. This experiment was performed three times with three biological replicates in eachexperiment.

FIG 2 Asexual development is strongly regulated by hbxA in A. fumigatus. Wild-type (WT), ΔhbxA mutant, and complementation (Com) strains weregrown in liquid GMM stationary cultures for 72 h. (A to G) Cores from the mycelial mats were collected at 48 h and 72 h, and conidia were quantified(A). RNA was also extracted from mycelia to perform qRT-PCR. Relative gene expression levels of brlA (B), abaA (C), wetA (D), flbB (E), flbD (F), and fluG(G) are shown. All values were normalized to the wild-type 48-h samples. Error bars indicate the standard error. Different letters on the columns indicatevalues that are statistically different (P � 0.05), as determined by ANOVA with the Tukey test comparison. This experiment was performed two timeswith three biological replicates in each experiment. For qRT-PCR, technical replicates were also run for each biological replicate.

Role of the HbxA Regulator in Aspergillus fumigatus Applied and Environmental Microbiology



http://aem.asm

.org/D

ownloaded from


indicated that conidial size in the ΔhbxA mutant was significantly larger than thoseformed by the wild type (Fig. 3).

The absence of hbxA affects germination rates of A. fumigatus conidia. Tofurther examine the role of hbxA on conidia in A. fumigatus, an assay was performed toevaluate germination rates. As early as 2 h postinoculation, spores from the hbxAmutant started to produce germ tubes, while spores from wild-type or complementa-tion strain remained ungerminated (Fig. 4A). Only after 6 h did the wild-type sporesbegin to germinate, but at that point, more than 70% of the ΔhbxA mutant spores werealready germinated (Fig. 4B).

Based on the rapid germination rate observed in the hbxA deletion mutant com-pared to that of the control strains, biomass yields were also evaluated (Fig. 4C).Cultures were grown for 24 h and then lyophilized to determine the dry weight of thefungal biomass. Our results indicated that the ΔhbxA mutant strain generated almost2-fold the amount of biomass in comparison to the wild-type and complementationstrains (Fig. 4C).

Deletion of hbxA causes an increase in sensitivity to the cell wall stressor SDS.Since the absence of hbxA resulted in increased spore size and precocious germination,it is possible that concomitant hbxA-dependent alterations in cell wall integrity couldoccur. To test this hypothesis, the strains were grown on GMM containing differentconcentrations of SDS. While all strains demonstrated colony growth reduction whenexposed to all SDS concentrations tested, the mutant exhibited greater sensitivity tothat compound than did the control and was unable to grow at a concentration of0.015%, a condition that still allowed the growth of wild-type and complementationcolonies (Fig. S2).

Exposure to a high concentration of sucrose partially rescues the hbxA conidi-ation defect. Osmotic stress has been shown to affect development of filamentousfungi, for example, increasing conidiation (29, 30). We examine whether hbxA stillinfluences conidiation when exposed to osmotic stress. For most of the osmoticstressors tested, no significant difference was noticed in any of the strains except when

FIG 3 The size of conidia is influenced by hbxA. Wild-type (WT), ΔhbxA mutant, and complementation(Com) strains were grown on GMM, and spores were collected after 72 h. Samples were observed undera microscope, and the spore diameter was measured. (A) Micrographs of conidia. (B) Measurements ofspore diameter from 40 spores of each strain. Error bars indicate the standard error. Different letters onthe columns indicate values that are statistically different (P � 0.05), as determined by ANOVA with theTukey test comparison. This experiment was performed three times with three biological replicates ineach experiment.




http://aem.asm

.org/D

ownloaded from


the ΔhbxA mutant was grown in the presence of 1 M sucrose (Fig. S3). Under thiscondition, the ΔhbxA mutant strain produced more conidia than when grown on GMMalone.

Secondary metabolism in A. fumigatus is regulated by hbxA. In A. flavus, hbx1 isa regulator of the production of numerous secondary metabolites, including aflatoxin,aflatrem, and cyclopiazonic acid (26). Similarly, we observed a broad regulatory scopeof hbxA on secondary metabolism in A. fumigatus (Fig. 5). Our results revealed that theproduction of fumigaclavines, fumiquinazolines, and chaetominine was detected in theΔhbxA mutant but at a significantly lower levels than in either the wild-type or comple-mentation strain.

Deletion of hbxA increases virulence of A. fumigatus in a murine model. Due tothe fact that hbxA plays an important role in regulating A. fumigatus development aswell as its metabolome, we hypothesized that hbxA could also be relevant in virulence.

FIG 4 The absence of hbxA results in earlier spore germination in A. fumigatus. Liquid GMM cultures of wild-type (WT),ΔhbxA mutant, and complementation (Com) strains were inoculated with 106 spores/ml. Every 2 h postinoculation, analiquot of 500 �l of culture was collected to observe conidial germination. (A) Micrographs of germinating conidia atdifferent time points. (B) Percentage of germinated conidia. (C) Amount of biomass produced by each strain after 24 hunder liquid shaking conditions. Error bars are used to indicate standard error. Different letters on the columns indicatevalues that are statistically different (P � 0.05), as determined by ANOVA with the Tukey test comparison. This experimentwas performed four times with three biological replicates in each experiment.




http://aem.asm

.org/D

ownloaded from


To investigate this possibility, we used a neutropenic murine infection model. As shownin Fig. 6, the ΔhbxA mutant strain was significantly more virulent than were thecontrols.

DISCUSSION

In humans, the primary route of A. fumigatus infections is through the inhalation ofairborne conidia that can eventually germinate in the lungs of a host. An investigationof the genes that influence fungal development, as well as other aspects of A. fumigatusbiology, could provide interesting targets to develop treatments against this opportu-nistic human pathogen. In the phylogenetically close and agriculturally importantfungus A. flavus, the transcription regulatory gene hbx1, a homolog of hbxA, was foundto regulate several aspects of morphological differentiation, including asexual devel-opment, as well as the synthesis of several secondary metabolites (26). Homologs ofhbxA have also been identified in other fungi beyond the Aspergillus genus, forexample, in Magnaporthe oryzae and in species of the genus Fusarium. In these species,while no connection of the possible role of hbx1 or hbxA homologs with virulence or

FIG 5 hbxA regulates the production of multiple secondary metabolites in A. fumigatus. Spores of A. fumigatus wild-type (WT), deletion(ΔhbxA mutant), and complementation (Com) strains were inoculated in liquid yeast extract-glucose-supplements (YES) medium.Cultures were incubated at 37°C, and supernatant was collected after 7 days for secondary metabolite extraction and analysis. (A toC) Analysis of ergot alkaloids fumigaclavine A, B, and C. (D and E) Analysis of fumiquinazoline A/B (D) and C/D (E). (F) Analysis ofchaetominine. Error bars are used to indicate standard error. Different letters on the columns indicate values that are statisticallydifferent (P � 0.05), as determined by ANOVA with the Tukey test comparison. This experiment was performed two times with fourbiological replicates in each experiment.




http://aem.asm

.org/D

ownloaded from


secondary metabolism was reported, the studies indicated a role in asexual develop-ment (31–33). Our analysis of A. fumigatus hbxA demonstrated that this gene hasindeed a conserved role in the regulation of conidial production. Additionally, otheraspects of conidial formation and function were influenced by hbxA in this fungus. Inthe absence of hbxA, conidia appear enlarged and present a high germination rate.

The mechanism of action of hbxA on conidiation includes the activation of thecentral regulatory pathway brlA, abaA, and wetA genes (28). The expression of thesethree genes in this signaling pathway is significantly reduced in the absence of hbxA.This decrease in expression could lead to the observed reduction in conidial productionin the hbxA mutant. In addition, examination of the effect of hbxA on the expression ofother genetic regulatory elements upstream of the brlA central regulatory pathwayshowed that fluG, a well-known developmental regulator (34), is also hbxA dependent.In addition, the expression of flbB and flbD was also found to be positively regulated byhbxA. FlbB has been previously shown to promote asexual development in A. fumigatus(35). FlbD has not been characterized in A. fumigatus (28); however, in A. nidulans, flbDhas been shown to also promote conidiation (36). It is possible that HbxA couldregulate the expression of these fluffy developmental genes directly, which couldconsequently affect the brlA pathway. In addition, since flbD expression is dependenton the FlbB-FlbE protein complex (35, 36), it is possible that hbxA could affect theexpression of flbD indirectly by controlling flbB transcription. Interestingly, the presenceof highly concentrated sugars, particularly sucrose and fructose, resulted in a significantincrease in conidial production in the hbxA deletion mutant. Currently, the mechanismthat triggers conidiation under these conditions is unknown.

In A. fumigatus and other fungi, development and secondary metabolism aregenetically linked (22, 37, 38). As in A. flavus (26), in our study, we show that hbxAregulates not only development in A. fumigatus but also the production of multiplemetabolites. Analysis of the hbxA-dependent metabolome revealed four differentclasses of compounds whose synthesis is under the influence of this regulator. Amongthem are ergot alkaloids (fumigaclavine) and fumiquinazoline. These compounds pres-ent bioactive properties; fumigaclavine has been shown to affect the nervous systemsof the host and induce apoptosis, while fumiquinazoline presents cytotoxicity thatinhibits neutrophils and aids A. fumigatus during infection (17, 39). Fumigaclavines and

FIG 6 hbxA negatively regulates virulence in a mouse model. Six-week-old mice were rendered neutro-penic by the administration of cyclophosphamide and Kenalog-10 treatments. Fifty mice divided into 5separate groups were used (i.e, each group contained 10 mice). Mice were infected with 2 � 106

conidia/mouse of A. fumigatus wild-type (WT), deletion (ΔhbxA mutant), and complementation (Com)strains and monitored daily for a total of 7 days. Two controls that did not received fungal spores wereincluded in this analysis, with a group that was rendered neutropenic (uninfected) and another group nottreated with cyclophosphamide or Kenalog-10 (untreated). Statistical analysis of survival was carried outby a Kaplan-Meyer pairwise comparison using a log rank test. d, days.




http://aem.asm

.org/D

ownloaded from


fumiquinazolines accumulate in asexual structures, and their production is linked tobrlA expression (16, 17, 20, 21). Similarly, chaetominine is absent in the aconidial ΔbrlAmutant strain (misidentified as tryptoquivaline F) (20). It is possible that the hbxAregulatory role in the expression of genes involved in the synthesis of these com-pounds is indirect and mediated, at least in part, by its effect on brlA. In addition, thesynthesis of chaetominine, a metabolite that is being tested to combat leukemia cells(40), is also controlled by hbxA. At the moment, it is unknown how this compound isproduced or regulated in A. fumigatus. Chaetominine is structurally similar to fumiquina-zolines; however, no evidence showing a link between their respective biosynthesis hasbeen yet established. The present study reports a gene in A. fumigatus that controls theproduction of chaetominine.

Due to the fact that hbxA is important in A. fumigatus morphogenesis and secondarymetabolism, we investigated whether this gene is relevant in virulence. To test thispossibility, we used the neutropenic mouse infection model. Surprisingly, the lack ofhbxA did not attenuate the virulence of this fungus; on the contrary, it enhanced it,resulting in higher mortality rates in the group of animals infected by the deletion strainthan in the group inoculated with the wild-type strain. While the production ofsecondary metabolites was hampered in the mutant, and the conidial size was larger,these traits did not reduce virulence in the mutant strain. It is possible that thepremature germination observed in the hbxA mutant could have accounted for theincrease in virulence, allowing the deletion mutant to rapidly establish itself in the host.This could lead to an accelerated and enhanced fungal infection in neutropenic micecompared to that infected with the wild type. The increased amounts of biomass yieldproduced by the ΔhbxA mutant strain also suggest a greater capacity to colonize thehost than with the wild type. In addition, the detected increased sensitivity to SDS inthe mutant could reflect premature changes in cell wall composition during the earlyspore germination process which do not appear to be detrimental to infection.

In conclusion, we have established that the homeobox gene hbxA has a broadimpact on the biology of A. fumigatus, affecting its development, secondary metabo-lism, and virulence. Specifically, we have shown that hbxA is necessary for normalasexual development, governing the expression of the fluffy genes fluG, flbB, and flbD,as well as the expression of those genes in the central developmental signalingpathway, brlA, abaA, and wetA. With respect to the role of hbxA on the A. fumigatusmetabolome, our study revealed that the production of several fungal alkaloids, as wellas chaetominine, is under its control. We also established that hbxA negatively affectspathogenicity, as a lack of hbxA increases virulence, possibly through the advantage ofearly germination and greater biomass production. For this reason, an hbxA loss-of-function strategy would not the suitable against A. fumigatus infection. Future studieswill focus on elucidating whether forced overexpression of this regulator would havethe opposite effect on virulence and on the production of beneficial secondary me-tabolites such as chaetominine. Additional studies will also provide further insight intothe identification of additional hbxA-dependent genetic elements involved in theregulation of conidiation, triggering the germination and synthesis of fungal naturalproducts.

MATERIALS AND METHODSCulture conditions. All strains used in this work are listed in Table 1. Strains were grown on glucose

minimal medium (GMM) at pH 6.5 in the dark at 37°C, unless otherwise indicated. Agar at a concentration

TABLE 1 List of strains used in this study

Strain Genotype Source

CEA10 Wild type Gift from Robert CramerCEA17 pyrG1 Gift from Robert CramerTTRS8 pyrG1 ΔhbxA::pyrGA.parasiticus This studyTTRS12 pyrG1 ΔhbxA::pyrGA.parasiticus hbxA::ptrAA.oryzae This study




http://aem.asm

.org/D

ownloaded from


of 1% was used for solid cultures. Stocks of each strain were maintained at – 80°C in 30% glycerol. Thespore inoculum was generated on GMM plus 1 M sucrose and washed with sterile water before use.

Strain construction. (i) Generation of the �hbxA mutant strain. To obtain the hbxA deletionstrain, an hbxA deletion cassette was first generated by fusion PCR, as described by Szewczyk et al. (41).The Afum_hbxA_P1 and Afum_hbxA_P2 primers were used to PCR amplify the 5= untranslated region(UTR) of the hbxA locus in the A. fumigatus genome, while the Afum_hbxA_P3 and Afum_hbxA_P4primers were used to amplify the 3= UTR fragment. The middle fragment containing the selection markerwas PCR amplified from plasmid pPG28 (42) using primers Afum_hbxA_P5 and Afum_hbxA_P6. Themarker used was pyrG from Aspergillus parasiticus. The three fragments were then fused by PCR usingprimers Afum_hbxA_P7 and Afum_hbxA_P8. All primers utilized in this study are listed in Table 2. Thefused PCR product was transformed into A. fumigatus CEA10 (pyrG� ptrA�) by a polyethylene glycol-mediated transformation, as previously described (Cary et al. [26]). Transformants were selected onhalf-strength potato dextrose agar (PDA) without uracil. Potassium chloride (0.6 M) was used as anosmotic stabilizer in the regeneration medium. Transformants were confirmed by diagnostic PCR withprimers Afum_hbxA_P0 and Apara_pyrG_R. A selected hbxA deletion transformant, TTRS8, was used inthis study.

(ii) Generation of the complementation hbx1 strain. To generate the complementation strain, atwo-fragment fusion PCR method was utilized joining the hbxA locus and the selection marker gene ptrAfrom Aspergillus oryzae. First, the hbxA locus was amplified from the A. fumigatus genomic DNA usingprimers Afum_hbxA_Com_P1 and Afum_hbxA_Com_P2, while the ptrA marker was amplified fromthe plasmid pPTRI (TaKaRa Bio, Mountain View, CA, USA) with primers Afum_hbxA_Com_P3 andAfum_hbxA_Com_P4. The two PCR products were then fused in a similar manner as described aboveusing primers Afum_hbxA_Com_P1 and Afum_hbxA_Com_P4. The fusion cassette was transformed intothe ΔhbxA mutant strain TTRS8. Transformants were selected on Czapek-Dox (CZ) medium (Difco,Franklin Lakes, NJ, USA) containing 1 �g/ml pyrithiamine. Confirmation of the reinsertion of hbxA in thetransformants was determined by diagnostic PCR with primers Afum_hbxA_qPCR_F and R_ptrA_Check.A selected hbxA complementation strain, TTRS12, was used in this study. The pertinent genotypes of allstrains are listed in Table 1.

Morphological analysis. (i) Colony growth. The wild-type, ΔhbxA mutant, and complementationstrains were point inoculated on GMM. The colony diameter was measured after 5 days of incubation at37°C. The experiment was carried out with three replicates.

(ii) Conidial production. To assess whether hbxA regulates conidiation in A. fumigatus, 106 spores/mleach of the wild-type, ΔhbxA mutant, and complementation strains were inoculated into 25 ml of liquidGMM. Cultures were grown under stationary conditions, allowing an air interphase to promote devel-

TABLE 2 Primers used in this study

Primer Sequence

Afum_hbxA_P0 GTGGTGACAGTGGTGGTTTCCCAfum_hbxA_P1 GGTGCTTAGTTCCCTGGATGGACAAfum_hbxA_P2 AAGGGACGGCGGAGAAGAAGAfum_hbxA_P3 GTAGTGGTAGGCAGGAGGCATGAfum_hbxA_P4 TGCTTGTAGTCACCGATCACCATTCCAfum_hbxA_P5 CTTCTTCTCCGCCGTCCCTTGGATCCTATGGATCTCAGAACAATATACCAfum_hbxA_P6 CATGCCTCCTGCCTACCACTACGTCGACATCACCCTTACCCAAfum_hbxA_P7 CAAGACAGAATGACTGCCCAAACTGGAfum_hbxA_P8 CAGTCACCCCATTCCACAGCTApara_pyrG_R CAGGAGCAGCATAAATTCCACGACCAfum_hbxA_Com_P1 CAAGACAGAATGACTGCCCAAACTGGAfum_hbxA_Com_P2 GGCTCATCGTCACCCCATTTTGTTAAGAAGCGTTGCCATTGCGTGAAfum_hbxA_Com_P3 TCACGCAATGGCAACGCTTCTTAACAAAATGGGGTGACGATGAGCCAfum_hbxA_Com_P4 TCAATGGGCAATTGATTACGGGATCCR_ptrA Check CAGCTGCCATCTACGAACCCACAFUM 18SqPCR F TAGTCGGGGGCGTCAGTATTCAGCAFUM 18S qPCR R GTAAGGTGCCGAGCGGGTCATCATAFUM hbxA qPCR F GGAGGAGACCGATAAAGCCAACGAAFUM hbxA qPCR R GCCGTCATTCCGATCCTGCTCAFUM brlA qPCR F TGCACCAATATCCGCCAATGCAFUM brlA qPCR R CGTGTAGGAAGGAGGAGGGGTTACCAFUM abaA qPCR F CCGCCGCAGGAGACTAGTCAGAFUM abaA qPCR R CTGTCGTGAACGCTAACGCCGAFUM wetA qPCR F TTGACTCGCTGTCAAGTGATTGTGGAFUM wetA qPCR R TGGTGGATTTGTGGTGGGGAGTTAFUM flbB qPCR F GCCTTGACACGACGACAGGAACAFUM flbB qPCR R CTGAGCGTCGTTCTGCCCTAFUM flbD qPCR F GGGAGCGATTCCACCAGAACCAFUM flbD qPCR R ATGGGGCTTCGACTCGGCAFUM fluG qPCR F GGGGTAGCTCTACAGAATGCGACTAFUM fluG qPCR R CCATTGGTACGGCTCGATGTCC




http://aem.asm

.org/D

ownloaded from


opment. Cores (7-mm diameter) were collected from the mycelial mats to quantify conidia after 48 h and72 h of incubation at 37°C. The cores were homogenized in water, and spores were counted under anEclipse E-400 bright-field microscope (Nikon, Inc., Melville, NY, USA) using a hemocytometer (HausserScientific, Horsham, PA). The experiments were performed in triplicate.

(iii) Effect of osmotic stress on hbxA-dependent growth and conidiation. To examine thepossible role of hbxA on osmotic stress resistance, the wild-type, ΔhbxA mutant, and complementationstrains were point inoculated on solid GMM and GMM plus 0.6 M KCl, 1 M sucrose, 0.7 M NaCl, or 1.2 Msorbitol. The cultures were incubated in the dark at 37°C for 7 days. Colony growth was assessed by thecolony diameter. Under these conditions, conidia were also quantified. Cores were collected from thecolonies, and spores were counted as described above.

(iv) Cell wall stress test. To assess whether hbxA influences the sensitivity to cell wall stress, thewild-type, ΔhbxA mutant, and complementation strains were point inoculated on solid GMM containing0%, 0.01%, 0.015%, or 0.02% SDS. The experiment was performed in triplicate. Cultures were incubatedat 37°C for 72 h.

(v) Germination assay. Flasks with 50 ml of liquid GMM were inoculated with conidia (106 spores/ml)of wild-type, ΔhbxA mutant, and complementation strains. Every 2 h postinoculation, 500 microliters ofculture was collected from each flask for spore quantification under the microscope using a hemocy-tometer. Micrographs were taken with a Nikon Eclipse E-600 microscope with a total magnification of�400. The experiment was performed in triplicate.

(vi) Determination of dry weight. Cultures of 50 ml of liquid GMM inoculated with 106 spores/mlof wild-type, ΔhbxA mutant, and complementation strains were grown in a shaker incubator at 250 rpmat 37°C. After 24 h of incubation, the total content was transferred to a 50-ml Falcon tube and centrifugedat 3,500 rpm for 5 min. The supernatant was removed, and the biomass was lyophilized for 48 h and thenweighed.

Gene expression analysis. Petri dishes containing 25 ml of liquid GMM were inoculated with conidia(106 spores/ml) of A. fumigatus CEA10 wild-type (WT), ΔhbxA mutant, and complementation strains.Cultures were incubated under stationary conditions at 37°C in the dark. Total RNA was extracted fromlyophilized mycelial samples using TRIsure reagent (Bioline, Taunton, MA, USA), according to themanufacturer’s instructions. cDNA was synthesized with Moloney murine leukemia virus (MMLV) reversetranscriptase (Promega, Madison, WI, USA). qRT-PCR was performed with the Applied Biosystems 7000real-time PCR system using SYBR green dye for fluorescence detection. cDNA was normalized to A.fumigatus 18S ribosomal gene expression, and the relative expression levels were calculated using the2�ΔΔCT method (43). The primer pairs used are indicated in Table 2.

Liquid chromatography and mass spectrometry analysis. Sample analysis was performed usinghigh-performance liquid chromatography (HPLC) coupled to an LTQ Orbitrap XL high-resolution massspectrometer (HRMS; Thermo Fisher Scientific, Les Ulis, France). Extracts were resuspended in 500 �l ofacetonitrile-water (50:50 [vol/vol]) and then mixed with 250 �l of acetonitrile, and 10 �l of this suspen-sion was injected into a reversed-phase (150 mm by 2.0 mm) 5-�m Luna C18 column (Phenomenex,Torrance, CA, USA) operated at a flow rate of 0.2 ml/min. A gradient program was performed with 0.1%formic acid (phase A) and 100% acetonitrile (phase B) with the following elution gradient: 0 min of 20%B, 30 min of 50% B, 35 to 45 min of 90% B, and 50 to 60 min of 20% B. HRMS acquisitions were achievedwith electrospray ionization (ESI) in the positive and negative modes, as follows: spray voltage of �4.5 kV,capillary temperature of 350°C, sheath gas (N2) flow rate of 40 arbitrary units (AU), and auxiliary gas (N2)flow rate of 6 AU in the positive mode; and spray voltage of �3.7 kV, capillary temperature of 350°C,sheath gas (N2) flow rate of 30 AU, and auxiliary gas (N2) flow rate of 10 AU in the negative mode. FullMS spectra were acquired at a resolution of 60,000 with a range of mass-to-charge ratio (m/z) set to50 to 800. The chaetominine standard was purchased from BioAustralis Fine Chemicals (Smithfield,Australia).

Pathogenicity analysis. Pathogenicity studies using a neutropenic mouse model were carried out aspreviously described (44), with minor modifications. Briefly, 6-week-old female outbred ICR Swiss miceweighing approximately 25 g were used for this experiment. Fifty mice divided into 5 separate groupswere used (each group contained 10 mice). Animals were rendered neutropenic by intraperitonealinjection of cyclophosphamide (150 mg/kg of body weight) on days �4, �1, and 3 postinfection andtriamcinolone (Kenalog; 40 mg/kg) on the day of infection. The immunosuppressed mice were infectedwith fungal spores of A. fumigatus CEA10 wild-type, ΔhbxA mutant, and complementation strains.Sedated mice (10 mice per strain) were infected by nasal instillation of 2 � 106 spores/40 �l phosphate-buffered saline (PBS). Postinfection mice were observed three times daily. Mice that survived to day eightwere euthanized.

This study was carried out in strict accordance with the Guide for the Care and Use of LaboratoryAnimals of the National Research Council. The protocol was approved by the Institutional Animal Careand Use Committee of Northern Illinois University (permit no. 12-0006). All efforts were made to minimizesuffering. Humane euthanasia by CO2 inhalation was performed when mice met criteria indicating amoribund state; these endpoints include behaviors of unresponsiveness to tactile stimuli, inactivity,lethargy, staggering, anorexia, and/or clinical signs of bleeding from the nose or mouth, laboredbreathing, agonal respirations, purulent exudate from the eyes or nose, abnormally ruffled fur, or greaterthan 20% weight loss. The method of euthanasia by CO2 inhalation is consistent with recommendationsof the Panel on Euthanasia of the American Veterinary Medical Association.

Statistical analysis. Statistical analysis was applied to analyze all of the quantitative data in thisstudy utilizing analysis of variance (ANOVA) in conjunction with a Tukey multiple-comparison test using




http://aem.asm

.org/D

ownloaded from


a P value of �0.05 for samples that are determined to be significantly different. The exception was forpathogenicity assays, in which a Kaplan-Meyer survival test was applied.

SUPPLEMENTAL MATERIALSupplemental material is available online only.SUPPLEMENTAL FILE 1, PDF file, 0.4 MB.

ACKNOWLEDGMENTThis study was funded by Northern Illinois University.

REFERENCES1. Knutsen AP, Slavin RG. 2011. Allergic bronchopulmonary aspergillosis in

asthma and cystic fibrosis. Clin Dev Immunol 2011:843763–843713. https://doi.org/10.1155/2011/843763.

2. Osherov N. 2012. Interaction of the pathogenic mold Aspergillus fumiga-tus with lung epithelial cells. Front Microbiol 3:346. https://doi.org/10.3389/fmicb.2012.00346.

3. Denning DW. 1998. Invasive aspergillosis. Clin Infect Dis 26:781– 803.https://doi.org/10.1086/513943.

4. Pagano L, Girmenia C, Mele L, Ricci P, Tosti ME, Nosari A, Buelli M, PicardiM, Allione B, Corvatta L, D’Antonio D, Montillo M, Melillo L, Chierichini A,Cenacchi A, Tonso A, Cudillo L, Candoni A, Savignano C, Bonini A,Martino P, Del Favero A, GIMEMA Infection Program, Gruppo ItalianoMalattie Ematologiche dell’Adulto. 2001. Infections caused by filamen-tous fungi in patients with hematologic malignancies. A report of 391cases by GIMEMA infection program. Haematologica 86:862– 870.

5. Marr KA, Carter RA, Boeckh M, Martin P, Corey L. 2002. Invasive asper-gillosis in allogeneic stem cell transplant recipients: changes in epide-miology and risk factors. Blood 100:4358 – 4366. https://doi.org/10.1182/blood-2002-05-1496.

6. Wiederhold NP, Lewis RE, Kontoyiannis DP. 2003. Invasive aspergillosis inpatients with hematologic malignancies. Pharmacotherapy 23:1592–1610. https://doi.org/10.1592/phco.23.15.1592.31965.

7. Kliasova GA, Petrova NA, Parovichnikova EN, Gotman LN, Isaev VG,Mikhaı̆lova EA, Ustinova EN, Khoroshko ND, Vishnevskaia ES, Kreme-netskaia AM, Kravchenko SK, Kaplanskaia IB, Kokhno AA, Ptitsin SA,Liubimova LS, Mendeleeva LP, Mitish NE, Galstian GM, Ryzhko VV, Toche-nov AV, Savchenko VG. 2005. Invasive pulmonary aspergillesis [sic]. TerArkh 77:65–71. (In Russian.)

8. Post M, Lass-Floerl C, Gastl G, Nachbaur D. 2007. Invasive fungal infec-tions in allogeneic and autologous stem cell transplant recipients: asingle-center study of 166 transplanted patients. Transpl Infect Dis9:189 –195. https://doi.org/10.1111/j.1399-3062.2007.00219.x.

9. Schmitt HJ, Blevins A, Sobeck K, Armstrong D. 1990. Aspergillus speciesfrom hospital air and from patients. Mycoses 33:539 –541. https://doi.org/10.1111/myc.1990.33.11-12.539.

10. Latgé JP. 1999. Aspergillus fumigatus and aspergillosis. Clin Microbiol Rev12:310 –350. https://doi.org/10.1128/CMR.12.2.310.

11. Kontoyiannis D, Bodey G. 2002. Invasive aspergillosis in 2002: an update. EurJ Clin Microbiol Infect Dis 21:161–172. https://doi.org/10.1007/s10096-002-0699-z.

12. Oren I, Goldstein N. 2002. Invasive pulmonary aspergillosis. Curr Opin PulmMed 8:195–200. https://doi.org/10.1097/00063198-200205000-00008.

13. Sherif R, Segal BH. 2010. Pulmonary aspergillosis: clinical presentation,diagnostic tests, management and complications. Curr Opin Pulm Med16:242–250. https://doi.org/10.1097/MCP.0b013e328337d6de.

14. Frisvad JC, Samson RA. 1990. Chemotaxonomy and morphology ofAspergillus fumigatus and related taxa, p 201–208. In Samson RA, Pitt JI(ed), Modern concepts in Penicillium and Aspergillus classification. Ple-num Press, New York, NY.

15. Botterel F, Cordonnier C, Barbier V, Wingerstmann L, Liance M, Coste A,Escudier E, Bretagne S. 2002. Aspergillus fumigatus causes in vitro elec-trophysiological and morphological modifications in human nasal epi-thelial cells. Histol Histopathol 17:1095–1101. https://doi.org/10.14670/HH-17.1095.

16. Coyle CM, Panaccione DG. 2005. An ergot alkaloid biosynthesis gene andclustered hypothetical genes from Aspergillus fumigatus. Appl Environ Mi-crobiol 71:3112–3118. https://doi.org/10.1128/AEM.71.6.3112-3118.2005.

17. Coyle CM, Kenaley SC, Rittenour WR, Panaccione DG. 2007. Association

of ergot alkaloids with conidiation in Aspergillus fumigatus. Mycologia99:804 – 811. https://doi.org/10.3852/mycologia.99.6.804.

18. Khoufache K, Puel O, Loiseau N, Delaforge M, Rivollet D, Coste A,Cordonnier C, Escudier E, Botterel F, Bretagne S. 2007. Verruculogenassociated with Aspergillus fumigatus hyphae and conidia modifies theelectrophysiological properties of human nasal epithelial cells. BMCMicrobiol 7:5. https://doi.org/10.1186/1471-2180-7-5.

19. Dagenais TR, Keller NP. 2009. Pathogenesis of Aspergillus fumigatus ininvasive aspergillosis. Clin Microbiol Rev 22:447– 465. https://doi.org/10.1128/CMR.00055-08.

20. Gauthier T, Wang X, Santos JS, Fysikopoulos A, Tadrist S, Canlet C,Artigot MA, Loiseau N, Oswald IP, Puel O. 2012. Trypacidin, a spore-borne toxin from Aspergillus fumigatus, is cytotoxic to lung cells. PLoSOne 7:e29906. https://doi.org/10.1371/journal.pone.0029906.

21. Lim FY, Ames B, Walsh CT, Keller NP. 2014. Co-ordination between BrlAregulation and secretion of the oxidoreductase FmqD directs selectiveaccumulation of fumiquinazoline C to conidial tissues in Aspergillusfumigatus. Cell Microbiol 16:1267–1283. https://doi.org/10.1111/cmi.12284.

22. Calvo AM, Wilson RA, Bok JW, Keller NP. 2002. Relationship betweensecondary metabolism and fungal development. Microbiol Mol Biol Rev66:447– 459. https://doi.org/10.1128/mmbr.66.3.447-459.2002.

23. Patterson TF, Thompson GR, Denning DW, Fishman JA, Hadley S, HerbrechtR, Kontoyiannis DP, Marr KA, Morrison VA, Nguyen MH, Segal BH, SteinbachWJ, Stevens DA, Walsh TJ, Wingard JR, Young JA, Bennett JE. 2016. Execu-tive summary: practice guidelines for the diagnosis and management ofaspergillosis: 2016 update by the Infectious Diseases Society of America.Clin Infect Dis 63:433–442. https://doi.org/10.1093/cid/ciw444.

24. Lestrade PP, Bentvelsen RG, Schauwvlieghe AFAD, Schalekamp S, vander Velden WJFM, Kuiper EJ, van Paassen J, van der Hoven B, van der LeeHA, Melchers WJG, de Haan AF, van der Hoeven HL, Rijnders BJA, van derBeek MT, Verweij PE. 2019. Voriconazole resistance and mortality ininvasive aspergillosis: a multicenter retrospective cohort study. ClinInfect Dis 68:1463–1471. https://doi.org/10.1093/cid/ciy859.

25. Holland PW. 2013. Evolution of homeobox genes. Wiley Interdiscip RevDev Biol 2:31– 45. https://doi.org/10.1002/wdev.78.

26. Cary JW, Harris-Coward P, Scharfenstein L, Mack BM, Chang PK, Wei Q,Lebar M, Carter-Wientjes C, Majumdar R, Mitra C, Banerjee S, Chanda A.2017. The Aspergillus flavus homeobox gene, hbx1, is required for de-velopment and aflatoxin production. Toxins 9:315. https://doi.org/10.3390/toxins9100315.

27. Cary JW, Entwistle S, Satterlee T, Mack BM, Gilbert MK, Chang PK,Scharfenstein L, Yin Y, Calvo AM. 2019. The transcriptional regulatorHbx1 affects the expression of thousands of genes in the aflatoxin-producing fungus Aspergillus flavus. G3 (Bethesda) 9:167–178. https://doi.org/10.1534/g3.118.200870.

28. Park HS, Yu JH. 2016. Developmental regulators in Aspergillus fumigatus.J Microbiol 54:223–231. https://doi.org/10.1007/s12275-016-5619-5.

29. Han K, Lee D, Kim J, Kim M, Han K, Kim W, Park Y, Kim H, Han D. 2003.Environmental factors affecting development of Aspergillus nidulans. JMicrobiol 41:34 – 40.

30. Baidya S, Duran RM, Lohmar JM, Harris-Coward PY, Cary JW, Hong S-Y,Roze LV, Linz JE, Calvo AM. 2014. VeA is associated with the response tooxidative stress in the aflatoxin producer Aspergillus flavus. Eukaryot Cell13:1095–1103. https://doi.org/10.1128/EC.00099-14.

31. Kim S, Park S, Kim KS, Rho H, Chi M, Choi J, Park J, Kong S, Park J, GohJ, Lee Y. 2009. Homeobox transcription factors are required for conidi-ation and appressorium development in the rice blast fungus Magna-




http://aem.asm

.org/D

ownloaded from

https://doi.org/10.1155/2011/843763https://doi.org/10.1155/2011/843763https://doi.org/10.3389/fmicb.2012.00346https://doi.org/10.3389/fmicb.2012.00346https://doi.org/10.1086/513943https://doi.org/10.1182/blood-2002-05-1496https://doi.org/10.1182/blood-2002-05-1496https://doi.org/10.1592/phco.23.15.1592.31965https://doi.org/10.1111/j.1399-3062.2007.00219.xhttps://doi.org/10.1111/myc.1990.33.11-12.539https://doi.org/10.1111/myc.1990.33.11-12.539https://doi.org/10.1128/CMR.12.2.310https://doi.org/10.1007/s10096-002-0699-zhttps://doi.org/10.1007/s10096-002-0699-zhttps://doi.org/10.1097/00063198-200205000-00008https://doi.org/10.1097/MCP.0b013e328337d6dehttps://doi.org/10.14670/HH-17.1095https://doi.org/10.14670/HH-17.1095https://doi.org/10.1128/AEM.71.6.3112-3118.2005https://doi.org/10.3852/mycologia.99.6.804https://doi.org/10.1186/1471-2180-7-5https://doi.org/10.1128/CMR.00055-08https://doi.org/10.1128/CMR.00055-08https://doi.org/10.1371/journal.pone.0029906https://doi.org/10.1111/cmi.12284https://doi.org/10.1111/cmi.12284https://doi.org/10.1128/mmbr.66.3.447-459.2002https://doi.org/10.1093/cid/ciw444https://doi.org/10.1093/cid/ciy859https://doi.org/10.1002/wdev.78https://doi.org/10.3390/toxins9100315https://doi.org/10.3390/toxins9100315https://doi.org/10.1534/g3.118.200870https://doi.org/10.1534/g3.118.200870https://doi.org/10.1007/s12275-016-5619-5https://doi.org/10.1128/EC.00099-14https://aem.asm.orghttp://aem.asm.org/

porthe oryzae. PLoS Genet 5:e1000757. https://doi.org/10.1371/journal.pgen.1000757.

32. Liu W, Xie S, Zhao X, Chen X, Zheng W, Lu G, Xu JR, Wang Z. 2010. Ahomeobox gene is essential for conidiogenesis of the rice blast fungusMagnaporthe oryzae. Mol Plant Microbe Interact 23:366 –375. https://doi.org/10.1094/MPMI-23-4-0366.

33. Zheng W, Zhao X, Xie Q, Huang Q, Zhang C, Zhai H, Xu L, Lu G, Shim W,Wang Z. 2012. A conserved homeobox transcription factor htf1 is re-quired for phialide development and conidiogenesis in Fusarium spe-cies. PLoS One 7:e45432. https://doi.org/10.1371/journal.pone.0045432.

34. Mah JH, Yu JH. 2006. Upstream and downstream regulation of asexualdevelopment in Aspergillus fumigatus. Eukaryot Cell 5:1585–1595.https://doi.org/10.1128/EC.00192-06.

35. Xiao P, Shin KS, Wang T, Yu JH. 2010. Aspergillus fumigatus flbB encodestwo basic leucine zipper domain (bZIP) proteins required for properasexual development and gliotoxin production. Eukaryot Cell9:1711–1723. https://doi.org/10.1128/EC.00198-10.

36. Garzia A, Etxebeste O, Herrero-García E, Ugalde U, Espeso EA. 2010. Theconcerted action of bZip and cMyb transcription factors FlbB and FlbDinduces brlA expression and asexual development in Aspergillus nidu-lans. Mol Microbiol 75:1314 –1324. https://doi.org/10.1111/j.1365-2958.2010.07063.x.

37. Bayram O, Braus GH. 2012. Coordination of secondary metabolism anddevelopment in fungi: the velvet family of regulatory proteins. FEMS Mi-crobiol Rev 36:1–24. https://doi.org/10.1111/j.1574-6976.2011.00285.x.

38. Calvo AM, Cary JW. 2015. Association of fungal secondary metabolism

and sclerotial biology. Front Microbiol 6:62. https://doi.org/10.3389/fmicb.2015.00062.

39. Li Y, Himaya S, Dewapriya P, Zhang C, Kim S. 2013. Fumigaclavine C froma marine-derived fungus Aspergillus fumigatus induces apoptosis inmcf-7 breast cancer cells. Mar Drugs 11:5063–5086. https://doi.org/10.3390/md11125063.

40. Yao J, Jiao R, Liu C, Zhang Y, Yu W, Lu Y, Tan R. 2016. Assessment of thecytotoxic and apoptotic effects of chaetominine in a human leukemia cellline. Biomol Ther (Seoul) 24:147–155. https://doi.org/10.4062/biomolther.2015.093.

41. Szewczyk E, Nayak T, Oakley CE, Edgerton H, Xiong Y, Taheri-Talesh N,Osmani SA, Oakley BR, Oakley B. 2006. Fusion PCR and gene targeting inAspergillus nidulans. Nat Protoc 1:3111–3120. https://doi.org/10.1038/nprot.2006.405.

42. Takahashi T, Chang P, Matsushima K, Yu J, Abe K, Bhatnagar D, Cleveland TE,Koyama Y. 2002. Nonfunctionality of Aspergillus sojae aflR in a strain ofAspergillus parasiticus with a disrupted aflR gene. Appl Environ Microbiol68:3737–3743. https://doi.org/10.1128/aem.68.8.3737-3743.2002.

43. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression datausing real-time quantitative pcr and the 2�ΔΔCT method. Methods 25:402– 408. https://doi.org/10.1006/meth.2001.1262.

44. Myers RR, Smith TD, Elsawa SF, Puel O, Tadrist S, Calvo AM. 2017. RtfAcontrols development, secondary metabolism, and virulence in Asper-gillus fumigatus. PLoS One 12:e0176702. https://doi.org/10.1371/journal.pone.0176702.




http://aem.asm

.org/D

ownloaded from

https://doi.org/10.1371/journal.pgen.1000757https://doi.org/10.1371/journal.pgen.1000757https://doi.org/10.1094/MPMI-23-4-0366https://doi.org/10.1094/MPMI-23-4-0366https://doi.org/10.1371/journal.pone.0045432https://doi.org/10.1128/EC.00192-06https://doi.org/10.1128/EC.00198-10https://doi.org/10.1111/j.1365-2958.2010.07063.xhttps://doi.org/10.1111/j.1365-2958.2010.07063.xhttps://doi.org/10.1111/j.1574-6976.2011.00285.xhttps://doi.org/10.3389/fmicb.2015.00062https://doi.org/10.3389/fmicb.2015.00062https://doi.org/10.3390/md11125063https://doi.org/10.3390/md11125063https://doi.org/10.4062/biomolther.2015.093https://doi.org/10.4062/biomolther.2015.093https://doi.org/10.1038/nprot.2006.405https://doi.org/10.1038/nprot.2006.405https://doi.org/10.1128/aem.68.8.3737-3743.2002https://doi.org/10.1006/meth.2001.1262https://doi.org/10.1371/journal.pone.0176702https://doi.org/10.1371/journal.pone.0176702https://aem.asm.orghttp://aem.asm.org/

RESULTShbxA is required for normal fungal growth and asexual development in A. fumigatus. The absence of hbxA affects germination rates of A. fumigatus conidia. Deletion of hbxA causes an increase in sensitivity to the cell wall stressor SDS. Exposure to a high concentration of sucrose partially rescues the hbxA conidiation defect. Secondary metabolism in A. fumigatus is regulated by hbxA. Deletion of hbxA increases virulence of A. fumigatus in a murine model.

DISCUSSIONMATERIALS AND METHODSCulture conditions. Strain construction. (ii) Generation of the complementation hbx1 strain. Morphological analysis. (ii) Conidial production. (iii) Effect of osmotic stress on hbxA-dependent growth and conidiation. (iv) Cell wall stress test. (v) Germination assay. (vi) Determination of dry weight. Gene expression analysis. Liquid chromatography and mass spectrometry analysis. Pathogenicity analysis. Statistical analysis.

SUPPLEMENTAL MATERIALACKNOWLEDGMENTREFERENCES

Documents

The Transcriptional Regulator HbxA Governs Development, … · indicated that conidial size in the ΔhbxA mutant was signiﬁcantly larger than those formedbythewildtype(Fig.3). The