The Repeat-In-Toxin Family Member TosA Mediates Adherence ofUropathogenic Escherichia coli and Survival during Bacteremia

Patrick D. Vigil,a Travis J. Wiles,b Michael D. Engstrom,a Lev Prasov,c Matthew A. Mulvey,b and Harry L. T. Mobleya

Department of Microbiology and Immunology, University of Michigan Medical School, Ann Arbor, Michigan, USAa; Division of Microbiology and Immunology,Department of Pathology, University of Utah, Salt Lake City, Utah, USAb; and Department of Human Genetics, University of Michigan Medical School, Ann Arbor,Michigan, USAc

Uropathogenic Escherichia coli (UPEC) is responsible for the majority of uncomplicated urinary tract infections (UTI) and rep-resents the most common bacterial infection in adults. UPEC utilizes a wide range of virulence factors to colonize the host, in-cluding the novel repeat-in-toxin (RTX) protein TosA, which is specifically expressed in the host urinary tract and contributessignificantly to the virulence and survival of UPEC. tosA, found in strains within the B2 phylogenetic subgroup of E. coli, servesas a marker for strains that also contain a large number of well-characterized UPEC virulence factors. The presence of tosA in anE. coli isolate predicts successful colonization of the murine model of ascending UTI, regardless of the source of the isolate.Here, a detailed analysis of the function of tosA revealed that this gene is transcriptionally linked to genes encoding a conservedtype 1 secretion system similar to other RTX family members. TosA localized to the cell surface and was found to mediate (i) ad-herence to host cells derived from the upper urinary tract and (ii) survival in disseminated infections and (iii) to enhance lethal-ity during sepsis (as assessed in two different animal models of infection). An experimental vaccine, using purified TosA, pro-tected vaccinated animals against urosepsis. From this work, it was concluded that TosA belongs to a novel group of RTXproteins that mediate adherence and host damage during UTI and urosepsis and could be a novel target for the development oftherapeutics to treat ascending UTIs.

Repeat-in-toxin (RTX) proteins are widespread among Gram-negative bacteria, with more than 1,000 family members de-

tected in a survey of genome sequences from 251 bacterial species(21). Two common features present in known RTX family mem-bers are a characteristic glycine- and aspartate-rich repeat near theC terminus of the protein and a conserved type 1 secretion system(T1SS) that exports the protein into the extracellular environ-ment, bypassing the periplasmic space (21, 37). The model proteinfor the RTX family, alpha-hemolysin, inserts into host mem-branes and forms pores that allow an influx of Ca2� into host cells,altering host physiology or leading to cell death (37). AdditionalRTX family members have displayed a wide array of functions inbacterial pathogens; secreted proteases (24, 29) and lipases (9, 40),cross-linkers of cellular actin that cause host cell rounding (28),and surface-associated coats of protein that form the bacterialS-layer (26, 30) represent a few examples of these diverse func-tions. However, most RTX family members remain uncharacter-ized. Given the widespread distribution and diverse roles thatknown family members contribute to bacterial pathogenesis, theidentification and characterization of novel RTX family membersremains an important area of research.

One of the best characterized RTX family members, alpha-hemolysin, enhances host damage in the urinary tract during anEscherichia coli infection (32). In addition, this protein contributesto disseminated infections (5, 12), such as those that result froman ascending urinary tract infection (1, 6, 11). Indeed, it is esti-mated that Gram-negative bacilli, including E. coli, are the cause ofup to 24% of cases of bacteremia annually in the United Statesalone (10). Despite the importance of this virulence determinant,not all uropathogenic E. coli (UPEC) strains produce this toxin (4,18). However, additional uncharacterized RTX family membershave been detected in the genomic sequences of uropathogens

(21), raising the possibility that these proteins serve as alternativesto alpha-hemolysin.

The human pyelonephritis/urosepsis isolate E. coli CFT073contains two annotated RTX family members: hlyA, encodingalpha-hemolysin, and tosA (originally annotated as upxA) (38). Insilico analysis has previously indicated that tosA shares little ho-mology with other characterized RTX family members (27) andmight represent a novel virulence factor of UPEC. Subsequentanalysis of the region surrounding tosA revealed that the gene iscarried on a pathogenicity-associated island (PAI) and appears tobe linked to genes encoding a T1SS composed of a tolC homologand homologs of hlyB and hlyD (27). Our previous work (34)revealed that tosA is only expressed in the host environment andcontributes significantly to the success of this UPEC strain in col-onizing an animal model of an ascending urinary tract infection(UTI). However, it remains unclear whether this novel RTX pro-tein functions in a similar way as alpha-hemolysin, or whether itconfers a different set of advantages to the bacterium.

To explore this question, we characterized the expression of thegenes in the region of the tosA locus and identified niches in thehost that induce tosA expression in an animal model of ascendingUTI. We then explored the function of TosA using in vitro tissue

Received 2 August 2011 Returned for modification 15 September 2011Accepted 7 November 2011

Published ahead of print 14 November 2011

Editor: S. R. Blanke

Address correspondence to Harry L. T. Mobley, hmobley@umich.edu.

Supplemental material for this article may be found at http://iai.asm.org/.

Copyright © 2012, American Society for Microbiology. All Rights Reserved.

doi:10.1128/IAI.05713-11

0019-9567/12/$12.00 Infection and Immunity p. 493–505 iai.asm.org 493

on March 9, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

culture systems and in vivo models of UTI, bacteremia, and sepsisto cover the full range of environments UPEC encounter duringtheir natural course of infection. Finally, we explored the use ofpurified TosA protein in an experimental animal vaccine model toprotect against urosepsis. These results indicate that while the toslocus shares many features with the hly locus, TosA appears to playa distinct role in UPEC pathogenesis.

MATERIALS AND METHODSBacterial strains, plasmids, and primers. Strains and plasmids are listedin Table 1, and primers are presented in Table 2. E. coli CFT073 wasisolated from blood and urine cultures from a patient with acute pyelo-nephritis (36). An isogenic strain lacking the gene tosA was already con-structed by our group for use in a previous study (22). A plasmid contain-ing the gene for green fluorescent protein (GFPmut3.1) under theconstitutive em7 promoter, pGENmut3.1 (M. C. Lane, unpublisheddata), was electroporated into wild-type CFT073 cells for use in the mu-rine model of ascending UTI.

The pBAD-tosA plasmid was constructed by PCR amplifying the tosAgene using the following conditions: 1 �g of CFT073 genomic DNA wasmixed with 4 �l of 2.5 mM deoxynucleoside triphosphate mixture, 5 �l of5� GC Phusion buffer (NEB), 2 �l of 10 �M primer mixture, 1 U ofPhusion polymerase in a 0.25-�l volume (NEB), and 12.75 �l of distilledwater. PCRs were cycled according to the following protocol: (i) 98°C for30 s, (ii) 98°C for 30 s, (iii) 64°C for 30 s, (iv) 72°C for 4 min, (v) repeatsteps ii to iv 30 times, and finally (vi) 72°C for 5 min. PCR products wereligated into TOPO Blunt PCR cloning vector (Invitrogen) according tothe manufacturer’s instructions. A clone containing the correct insert wasselected, and the plasmid was extracted and purified using a Qiagen plas-mid miniprep kit and cut with BglII and EcoRI restriction enzymes(NEB). The DNA fragment containing the tosA sequence was purifiedafter agarose gel electrophoresis using a Qiagen gel extraction kit andligated overnight with a BglII/EcoRI (NEB)-cut pBAD/Myc-HisA vector(Invitrogen) using T4 DNA ligase (NEB) according to the manufacturer’sinstructions. Ligation products were electroporated into E. coli TOP10(Invitrogen), and the resulting colonies were screened for protein expres-sion after culture in Luria-Bertani (LB) medium supplemented with 10mM L-arabinose at 37°C for 3 h (referred to as inducing conditions).

The araBP-tosC construct of CFT073 was engineered using the lambdared recombinase system (7) (Fig. 1A). Two PCR products were created;one included a cassette conferring kanamycin resistance amplified fromthe pKD4 plasmid, and the other from the pKD46 plasmid included thearabinose-inducible promoter. These two products were created such thatthe 5= end of the pKD4 fragment and the 3= end of the pKD46 productcontained regions of homology to the genomic region upstream of tosC.

The 3= end of the pKD4 product contained a linking primer that was thereverse complement of a linking primer carried on the 5= end of thepKD46 product. Each of the two PCR products was created (see above) inseparate PCR products according to the PCR protocol outlined for pBAD-tosA vector creation, except that the extension step was modified to 60°Cfor 5 min. The resulting PCR products were gel purified as describedabove and combined in the same PCR to create a chimeric PCR productcontaining the two products linked end-to-end in a PCR as describedabove with the one modification. Ten thermal cycles (steps ii to iv above)were conducted without any primers to combine the two products. After10 cycles, the cycling was paused, PCR primers corresponding to the 5=end of pKD4 and the 3= end of PKD46 fragments were added, and cyclingwas continued for an additional 30 cycles to amplify the combined prod-uct. Chimeric PCR products were purified using a DNA Clean & Concen-trator kit (Zymo Research). Purified PCR products were electroporatedinto CFT073(pKD46), and standard protocols were followed to completethe Lambda Red recombination procedure (7). Clones were checked byWestern blotting with TosA antiserum for protein production aftergrowth in the arabinose-inducing conditions described above.

Reverse transcription-PCR (RT-PCR) and quantitative PCR(qPCR). RNA was isolated from bacteria collected from urine expelledfrom infected mice or from bacteria cultured in LB medium with aerationas described by Vigil et al. (34). Briefly, three groups of five CBA/J femalemice each were transurethrally inoculated with 108 CFU of wild-typeCFT073. Starting at 5 h postinfection, urine samples were collected frominfected mice three times daily for 3 days. The samples were centrifuged at13,000 rpm in a benchtop centrifuge for 1 min to pellet the bacteria, thesupernatant was removed, and 20 �l of RNA Protect (Qiagen) was addedto each pellet. Pellets were frozen at �80°C until later use. RNA wasextracted using an RNeasy minikit (Qiagen), and cDNA was created witha SuperScript II reverse transcriptase kit (Invitrogen), according to themanufacturer’s instructions.

TABLE 2 Primers used in this study

Primer Orientationa Sequence (5=–3=)RT-PCR

tosR-C F AACATTGAATAATGTGTAATGGTATGGCAG

R GCTCTGTTCAAGTACCGCAATGGAtosC-B F AGGATCAGATGCTCCACGGTATGC

R ACGAAGAAACTCGCCAACAGAACGtosB-D F TATCGTGATGAATGAAGGCCGGGT

R AAGGGCTGCCTGTACATCTGTCAAtosD-A F TCTGACAGACAGGAACGGAA

R TGGCATTCTTCCCAGAATCCCTCT

qPCRtosR F GGTATGGCAGATCATATACAGCGG

R ATTCACTTCACCACGAATACCGGGtosC F ACCCGGTATTCGTGGTGAAGTGAA

R GCTCTGTTCAAGTACCGCAATGGAtosB F TATCATGTGCTTCAGCCTGGAGGT

R TCCGTAATATGCCCTGAATCGCCAtosD F TGCTGACACTGGATGATACCCGAA

R TGCTGACACTGGATGATACCCGAAc0364 F GTGGCAGGTTGTTGTTTGGGAACT

R GCAATACTTGCTACATTCCACCCAc0365 F TTATCTGGAAGGCAGAAGGAGGTC

R TGAAACGCCGAGGTTATTAGCApBADtosABglII TATATAAGATCTATGAAAATGATTT

TTACCGGTAAGGpBADtosAEcoRI GACCCAGAATTCAATTACACCATT

CGCATCAATAATATTa F, forward; R, reverse.

TABLE 1 Strains and plasmids used in this study

E. coli strain orplasmid Phenotype

Source orreference

StrainsCFT073 Wild-type pyelonephritis/urosepsis

strain25, 38

CFT073 araBP-tosC Arabinose-inducible tosA expressionin wild-type background; T1SSintact

This study

CFT073 �tosA Deletion mutant of tosA in wild-typebackground

22

TOP10 Laboratory strain Invitrogen

PlasmidspBAD-tosA Encodes arabinose-inducible tosA

without type 1 secretion systemThis study

pGENmut3.1 Encodes GFP M. C. Lane

Vigil et al.

494 iai.asm.org Infection and Immunity

on March 9, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

FIG 1 In vitro TosA expression constructs and putative tos operon structure. (A) Schematic illustrating construction of CFT073 araBP-tosC. A chimeric PCRconstruct consisting of two plasmid fragments generated from pKD4 and pKD46, containing a Kanr-conferring gene and an arabinose-inducible promoter,respectively, were amplified with primers that contain homology to the region between tosR and tosC (HR). A second set of primers, one the reverse complementof the other, were used as linking primers to combine the two PCR products together in a third PCR (LP). A schematic shows each ORF in the 15-kb region oftosA. The area denoted by brackets below genes, marked P1 to P4, illustrates amplicons that span adjacent genes. (B) Western blot of TosA induction. Culturesof CFT073 and CFT073 araBP-tosC were induced with 0.1 mM arabinose. At the indicated times, glucose was added to the cultures to give a final concentrationof ca. 0.2%. Cultures were harvested at 3 h and processed for Western blot analysis. Proteins were reacted with TosA antiserum. Overexpression of TosA at 30,60, and 90 min obscures the upper portion of these lanes. (C) RT-PCR of amplicons spanning the region between the two genes denote below each section. gDNA,genomic CFT073 DNA; (�) no RT, no-reverse-transcriptase control; cDNA, cDNA prepared from RNA from arabinose-induced bacteria. (D) qPCR resultsusing RNA isolated from bacteria collected either from five mice transurethrally infected with wild-type CFT073 or from LB culture of wild-type CFT073incubated at 37°C with aeration. Three replicates were normalized to the expression of gapA. In vivo, tosA expression was comparable to gapA expression (thatis, well expressed), whereas in vitro expression of tos genes represented only a fraction of gapA expression. (E) TosA purified from the cytoplasmic fraction ofarabinose-induced CFT073(pBAD-tosA) by gel filtration chromatography. A 0.8-�g portion of protein was loaded. M, protein standard markers; P, purifiedTosA. (F) Western blot with polyclonal TosA antiserum of wild-type (CFT073) and CFT073 araBP-tosC cells cultured under arabinose-inducing conditions. Atotal of 25 �l of late-exponential culture was loaded per lane; TosA marks the position just above the 250-kDa size standard. (G) Predicted molecular weights andamino acid identity to homologs for tos operon-encoded proteins. Homologs are as follows: PapB of Edwardsiella tarda (45% over 73 amino acids [aa]), TolC ofProteus mirabilis (44% over 392 amino acids [aa]), LssB family member of Neisseria sicca (62% over 707 aa), HlyD-like P. mirabilis (77% over 405 aa), outermembrane adhesin-like Shewanella woodyi protein (28% over 1,795 aa), LuxR/Sigma 70 family member of Citrobacter koseri (32% over 153 aa), and LuxR/UhpAfamily member of Vibrio campbelli (22% over 73 aa).

TosA Mediates UPEC Adherence and Bacteremia Fitness

February 2012 Volume 80 Number 2 iai.asm.org 495

on March 9, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

RT-PCR was performed on the same cDNA preparation or on a no-reverse transcriptase control using primers that spanned the 3= end of onegene to the 5= end of the adjacent gene according to the above protocol.The PCR products were visualized on a 1.2% agarose gel following elec-trophoresis, stained with ethidium bromide, and visualized on a Chemi-Doc imaging system (Bio-Rad).

Purification of TosA, generation of antiserum, and cell fraction-ation. For the purification of TosA, E. coli TOP10(pBAD-tosA) was cul-tured in LB medium with ampicillin (100 �g/ml) at 37°C with aeration(200 rpm) until reaching the early exponential phase. At this point,L-arabinose was added to a final concentration of 10 mM, and the cultureswere incubated for an additional 3 h. Cells were pelleted by centrifugation(8,000 � g, 15 min, 4°C) and frozen at �80°C until purification wasconducted. Pellets were thawed in 3 ml of phosphate-buffered saline(PBS) and passed three times through a French pressure cell press at20,000 lb/in2. Cell lysates were centrifuged (112,000 � g, 30 min, 4°C) topellet the unlysed cells and cell membrane material. The clarified super-natant was filtered through a 0.2-�m-pore-size syringe filter (Millipore).The lysate was immediately loaded onto a HiPrep Sephacryl-300 26/60 gelfiltration column (GE Healthcare), and the column was run with PBScontaining 0.5 M NaCl and 0.25 M urea. Collected fractions were analyzedby SDS-PAGE for the presence of TosA. Pooled fractions were concen-trated using Centricon Plus-70 filter units with a 100-kDa cutoff andwashed twice with 70 ml of Dulbecco PBS (pH 7.4; DPBS).

For generation of TosA antiserum, TosA was prepared by separatingcell lysate from the pBAD-tosA, prepared as described above, using SDS-PAGE. Bands of �250 kDa, corresponding to TosA, were excised frommultiple gels, pooled, and sent for commercial production of polyclonalTosA antiserum in rabbits (Rockland Immunochemical). Affinity purifi-cation of the resulting TosA antiserum was performed by cross-linkingpurified TosA to Ultralink Biosupport resin (Thermo Scientific) accord-ing to the protocols of the manufacturer.

Cell fractionation was performed on E. coli TOP10(pBAD-tosA) andthe CFT073 araBP-tosC construct cultured in LB medium with ampicillin(100 �g/ml) and 1 mM calcium chloride or with kanamycin (25 �g/ml)and 1 mM calcium chloride, respectively. At the early exponential phase,each culture was treated with 0.1 mM L-arabinose for 40 min; after thisinduction period, glucose was added to a final concentration of 0.2%, andthe cultures were incubated for 4 h postinduction. Bacteria were harvestedby centrifugation (8,000 � g, 15 min, 4°C) and frozen at �20°C. The cellswere thawed in 8 ml of PBS, lysed by passage through a French pressurecell press at 20,000 lb/in2, and centrifuged briefly (5,200 � g [CFT073araBP-tosC] to 18,840 � g [pBAD-tosA], 10 min, 4°C) to remove unlysedcells, and the supernatant was centrifuged (112,000 � g, 45 min, 4°C). Thesupernatant, representing soluble cytoplasmic and periplasmic proteins,was carefully removed and stored; pellets, representing membrane frac-tions, were washed two to three times with PBS and subsequently treatedwith 1% Triton X-100 for 30 min at room temperature. The membraneswere spun again as described above; the supernatant, enriched for innermembrane proteins, was collected and stored. The remaining pellet, en-riched for outer membrane proteins, was washed two to three times, re-suspended with PBS, and stored at �20°C. Filtered culture supernatantwas collected and treated with ammonium sulfate to a final concentrationof 3.40 M at 4°C. Precipitated protein was centrifuged (16,900 � g), andthe protein pellet was resuspended in PBS. The resuspended material wasdialyzed against two changes of PBS, at 4°C. Millipore centrifugal filterunits with a 10,000-molecular-weight pore size were used to concentratethe dialyzed material. Concentrated culture supernatant, cytoplasmic/periplasmic, and membrane fractions, equivalent to 20 �g of total protein,were analyzed by Western blotting for the presence of TosA.

Limited proteolysis of the surface protein. The proteinase K assaywas performed on the pBAD-tosA and araBP-tosC constructs cultured andinduced under the same conditions as in the membrane fractionationassay, with the exception that each was cultured for 3 h postinduction.However, after these cells were pelleted and resuspended in 5 ml of PBS,

this material was divided into four 1-ml treatments containing either 10,50, or 500 �g of proteinase K or no proteinase K. Each treatment wasdigested for 1 h at 37°C; after this period, the reactions were stopped by theaddition of phenylmethylsulfonyl fluoride to a final concentration of 500�M. These cells were pelleted and washed three times with PBS beforebeing stored at �20°C. From each of the whole-cell treatments, 20 �g oftotal protein (CFT073 araBP-tosC construct) or 8 �g of total protein(pBAD-tosA construct) was analyzed by Western blotting for the presenceof TosA.

tosA expression. The tosA expression assay was conducted usingCFT073 or the CFT073 araBP-tosC construct cultured in LB medium or inLB medium plus kanamycin (25 �g/ml), respectively. At the early expo-nential phase, each culture was treated with 0.1 mM L-arabinose and sub-sequently treated with glucose to a final concentration of 0.2%, at 15, 30,60, or 90 min postinduction. All cultures were incubated for 3 h postin-duction and, after this period, the cells were pelleted and frozen at �20°C.The equivalent of 50 �l from the most concentrated culture, as deter-mined by the optical density at 600 nm (OD600), was analyzed by Westernblotting for the presence of TosA in each treatment.

Animal models of infection. All mouse studies were approved by theUniversity of Michigan Committee on the Use and Care of Animals. Apreviously described murine model of ascending UTI (14) was utilized asdescribed below for immunocytochemistry experiments. A recently de-veloped murine model of bacteremia (31) was used for nonlethal compe-tition studies.

A zebrafish model of ExPEC pathogenesis as described by Wiles et al.(39) was used as a lethal sepsis model. Briefly, bacteria were prepared asdescribed above for the murine model, and 1 nl of a suspension containing1,000 CFU was microinjected into either the pericardial cavity or into theblood via the circulation valley of 48 h postfertilization zebrafish embryos.Cochallenge was conducted using equal mixtures of both strains and in-jecting 1,000 CFU total into each body site. To induce TosA synthesis,wild-type CFT073 and CFT073 araBP-tosC were cultured in minimal me-dium overnight, washed with sterile PBS, and suspended in PBS contain-ing 50 mM L-arabinose 0.5 h prior to injection. Infection proceeded asdescribed above, but zebrafish were maintained in water supplementedwith 10 mM L-arabinose during the course of the experiment. Lethalitywas assessed at regular intervals for 2 days following infection. CFUcounts were determined by homogenizing infected fish embryos in 500 �lof sterile PBS containing 0.5% Triton X-100 and plating serial dilutions onLB agar.

Cell adherence and intact bladder adherence assays. Adherence tocell lines cultured in vitro was measured using the following cell lines: Hs769.T, UM-UC-3, MM55.k, Vero, and HEK293 (American Type CultureCollection) cultured in Dulbecco modified Eagle medium containing10% fetal bovine serum (FBS), and SV Huc1 cultured in F12K containing10% FBS and RT4 grown in McCoy’s 5a medium containing 10% FBS(Invitrogen). All cell lines were cultured at 37°C and 5% CO2. Cells werecultured in sterile six-well plates until 90 to 95% confluence was reachedand then washed with 1 ml of sterile DPBS. Wild-type and CFT073 araBP-tosC strains were cultured in LB medium supplemented with 10 mML-arabinose for 3 h prior to infection, an OD600 reading taken, and thesamples were diluted in sterile DPBS and used to inoculate washed mam-malian cells at an average multiplicity of infection (MOI) of 0.6 (a lowMOI was used to maximize sensitivity of the adherence assay and avoidsaturation of receptors). The plates were centrifuged (500 � g, 5 min) andincubated at 37°C and 5% CO2 for 10 min. The cells were washed twicewith 1 ml of sterile PBS and then lifted off in 1 ml of 0.9 mM EDTA– 0.25%trypsin solution (Invitrogen). Serial dilutions of cell suspensions werespread onto LB agar plates, and CFU counts were obtained after overnightgrowth at 37°C. The input dilution of bacteria was also plated to deter-mine the CFU count for each inoculum.

A modification of the murine model of ascending UTI described abovewas developed to test adherence of UPEC on intact bladder epithelium.Female C57BL/6 mice were transurethrally inoculated with 2 � 106 CFU

Vigil et al.

496 iai.asm.org Infection and Immunity

on March 9, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

of either wild-type CFT073 or CFT073 araBP-tosC cultured under thearabinose-inducing conditions described above in a total volume of 25 �l.At 30 min after inoculation, these mice were euthanized, and the bladderswere removed and cut in half with a sterile scalpel blade. The bladderswere washed in 1 ml of sterile DPBS for 5 min on a rotating microcentri-fuge mixer under low speed, transferred to new tubes, and washed a sec-ond time to remove nonadherent bacteria. Washed bladders were trans-ferred to 3 ml of sterile PBS, homogenized, and plated on LB agar platesfor the determination of CFU. Recovered bacteria were compared to CFUcounts of the inoculum.

Immunogold-transmission electron microscopy. Immunogold la-beling of intact bacterium was carried out by culturing wild-type CFT073,E. coli TOP10 pBAD-tosA, and CFT073 araBP-tosC cells in LB mediumsupplemented with 10 mM arabinose for 3 h until late exponential phaseof growth. Bacterial suspension (10 �l) was spotted on nickel coatedFormvar/carbon film nickel-coated TEM grids (EMS). After 15 min, theliquid was wicked away with filter paper and blocked with 10 �l of DPBScontaining 5% goat normal serum and 5% bovine serum albumin (BSA)for 15 min. Blocking solution was exchanged with 10 �l of TosA antise-rum diluted 1:250 in DPBS with 5% goat serum, 0.1% cold water fish skingelatin, and 0.1% BSA-c (EMS). After 15 min, excess fluid was wickedaway with filter paper and exchanged for 10 �l of incubation solution for5 min. The wash was repeated and then exchanged with 10 �l of goatanti-rabbit IgG conjugated with 10-nm gold particles (EMS) diluted 1:250in incubation solution. After 15 min, grids were washed twice with incu-bation solution and twice with distilled water. Grids were air dried andimaged on a Philips CM-100 transmission electron microscope. Grids fornegative staining were incubated with 10 �l of 1% uranyl acetate for3 min.

Immunofluorescent imaging. Female C57BL/6 mice were transure-thrally inoculated with 108 CFU of CFT073(pGENmut3.1) as describedabove. At 48 h postinoculation, the mice were euthanized, and the blad-der, kidneys, and spleen were removed from each mouse and fixed in 10%buffered formalin for 4 h. Organs were processed through a sucrose gra-dient and frozen in OCT (Andwin Scientific). Frozen sections (10 �mthick) were cut from each organ.

Tissue sections were blocked in DPBS containing 5% goat normalserum and 5% donkey normal serum for 15 min. TosA antiserum andchicken antiserum to GFP (Abcam) were each diluted 1:500 in blockingsolution and incubated for 30 min, followed by two washes in DPBS for 10min. Anti-rabbit IgG Dylight 549 and anti-chicken IgY Dylight 488 (Jack-son Immunoresearch) were diluted 1:1,000 and 1:500, respectively, inblocking solution and 1 U of Alexa Fluor 647-phalloidin conjugate wasadded. Tissue sections were incubated in this solution for 30 min and thenwashed two times in DPBS. Sections were mounted with ProLong Goldantifade solution (Invitrogen) and imaged on a Zeiss LSM-510 METAconfocal laser scanning microscope.

Vaccination model. Purified TosA was diluted with DPBS containing10% Imject Alum (Thermo Scientific) and administered via subcutaneousinjection to deliver 100 �g of protein in a 100-�l volume. Control micewere given a solution of DPBS containing 10% alum. On the same day,retro-orbital eye bleeds were collected from each animal, and the serumwas separated and stored at �20°C until further analysis. At 1 week and 2weeks after primary vaccination, the animals were boosted with 25 �g ofprotein in 100 �l of DPBS containing 5% alum. Control mice were vac-cinated with DPBS containing 5% alum. At 1 week after the second boost,3 weeks after the primary vaccination, retro-orbital eye bleeds were col-lected, and the animals were challenged with wild-type CFT073. UTI chal-lenge was performed according to the transurethral model, and bactere-mia challenge was performed according to the protocols outlined above.

Data analysis. Statistical tests were carried out in the Prism statisticalsoftware package (GraphPad Software). Cell adherence data were ana-lyzed by using a Student t test. Cochallenge data were analyzed by calcu-lating the log10 transformation of competitive index (mutant CFU/wild-

type CFU) and performing a Wilcoxon rank-sum test with a hypotheticalmedian of 0. Survival curves were analyzed by using the Mantel-Cox test.

RESULTSThe tos locus of E. coli CFT073 includes the genes for a RTXfamily member, a T1SS, and putative regulators. The gene con-tent and organization of the 15-kb region of the CFT073 genomecontaining tosA (Fig. 1A) is contained within the PAICFT073-aspV

pathogenicity-associated island (22, 23, 38). This genomic islandhad previously been implicated in enhancing the fitness of UPECin a murine model of an ascending UTI (22) by contributing sig-nificantly to the virulence of UPEC strain CFT073 in both bladderand kidney tissues of infected mice (34). The putative type 1 se-cretion system (T1SS) genes, tosCBD, were identified in a previousin silico analysis (27) as components of a conserved T1SS appara-tus predicted to mediate the export of an RTX family member(Fig. 1A). tosC is predicted to encode a homolog of the outermembrane protein TolC; TosB and TosD are predicted to formthe inner-membrane ABC transporter and the membrane fusionprotein of the T1SS, respectively (Fig. 1G). Consistent with thispredicted mode of export, TosA does not carry an identifiablecleavable leader peptide. Two additional open reading frames(ORF), designated c0364 and c0365, follow the putative RTX fam-ily member tosA in the same orientation. In addition, our analysisuncovered a previously unannotated ORF, designated tosR, di-rectly upstream of the start codon of tosC (52 nucleotides separatethe two genes) (Fig. 1A); the ORF has homology to papB, a regu-lator of the P fimbrial operon (2) (Fig. 1G). The tos locus is flankedby fragments of genes predicted to encode remnants of a trans-poson system, possibly indicating that this region was acquired byhorizontal gene transfer.

All ORFs in the tos locus are expressed at significant levels invivo (similar to gapA), whereas their expression is very low (com-pared to gapA) during in vitro culture (Fig. 1D). qPCR conductedon mRNA purified from bacteria voided in the urine of UPEC-infected mice verified that significant tosA expression was limitedto the in vivo environment (34).

To extend this analysis, a third set of probes was used to assessthe transcriptional organization of the tos locus (Fig. 1A). Thesedata suggest a possible operon structure for these genes. RT-PCRon extracted RNA using primers that span the region from the 3=end of one gene to the 5= end of the adjacent gene (Fig. 1C) indi-cated that the genes tosR through tosA are transcribed as part of acontinuous transcript. Although qPCR was sufficiently sensitiveto detect expression of c0364 and c0365 in vivo (Fig. 1D), RT-PCRwas not able to detect these genes as a part of the tos transcript(data not shown). Thus, there is insufficient evidence at present toinclude c0364 and c0365 in the operon. This result is consistentwith an operon structure consisting of tosRCBDA, but additionalexperiments are required to define the full extent of the tos operon.

tosA expression is limited to the host in vivo environment. E.coli progresses through the host urinary tract in an ascendingmanner (1, 6, 11), encountering a variety of environments in theprocess. To determine whether the tosA expression observed inFig. 1D was limited to a particular site in the urinary tract, weutilized a murine model of an ascending UTI. At 48 h after trans-urethral inoculation, the bladders, kidneys, and spleens were re-moved and processed for immunofluorescence microscopy. Aplasmid that constitutively expresses GFP was utilized to markwild-type CFT073 bacteria and TosA antiserum was used to stain

TosA Mediates UPEC Adherence and Bacteremia Fitness

February 2012 Volume 80 Number 2 iai.asm.org 497

on March 9, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

bacteria expressing TosA. Tissue sections of the kidney (Fig. 2A)and spleen (Fig. 2B) demonstrated that UPEC expresses TosAprotein in each organ at 48 h postinoculation. In addition, inseparate experiments, our murine bacteremia model reveals thatTosA is expressed at 24 h postinoculation in spleen and liver tissue(Fig. 2C and D, respectively), two sites where UPEC was previ-ously determined to display enhanced fitness and survival over

nonpathogenic E. coli (31). Although the results of these two ex-periments suggest that TosA expression is important for UPECduring both ascending UTI and disseminated infections, it will beimportant to examine tissue from mice infected with the �tosAmutant.

Genetic manipulation of strain CFT073 allows in vitro ex-pression of TosA. Because significant tosA expression is primarilylimited to the in vivo environment (34), two constructs allowinginducible expression of tosA were engineered to allow additionalexperimentation. A plasmid-based system, pBAD-tosA, that car-ries the cloned tosA gene under an arabinose-inducible promoter,but which lacks the T1SS genes and accessory gene content illus-trated in Fig. 1A, allows in vitro TosA production and purification(Fig. 1E). However, the TosA produced remains primarily con-fined to the soluble cytoplasmic fraction of bacteria (see below).

To construct a strain that expresses tosA in vitro and localizesthe protein to its wild-type location, we used the Lambda Redrecombinase system and a hybrid PCR product containing anarabinose-inducible promoter to recombine into the chromo-some of CFT073, placing the araB promoter sequence upstream ofthe start codon of tosC (Fig. 1A). Upon arabinose induction, thisaraBP-tosC construct produces TosA protein that is detectable us-ing polyclonal TosA-antiserum (Fig. 1B and F). In contrast, wild-type CFT073 cultured under identical conditions does not pro-duce detectable levels of TosA (Fig. 1F).

TosA protein localizes to the outer surface of E. coli. Immu-nogold labeling of arabinose-induced CFT073araBP-tosC bacteriaexpressing TosA, imaged by transmission electron microscopy,localizes TosA to the outer surface of the bacterium. When wild-type CFT073 (Fig. 3A) and CFT073araBP-tosC (Fig. 3B) werecultured in vitro under arabinose-inducing conditions, onlyCFT073araBP-tosC bacteria expressing TosA were marked withimmunogold particles (�35 beads visible), while wild-typeCFT073 remained unlabeled (no beads visible). Negative stainingof these bacteria revealed that the immunogold particles markingTosA localize to the surface of the bacterium (data not shown).Finally, pBAD-tosA bacteria cultured under inducing conditionsshowed no immunogold staining (no beads visible) (Fig. 3C),confirming that TosA requires a specific transport mechanism,which is not found in the E. coli TOP10 strain that carries thepBAD-tosA plasmid, to be exported out of the cytoplasm. Whilethe specific transport system is believed to be encoded by tosCBD,additional experiments will be required to confirm this.

When arabinose-induced E. coli CFT073 araBP-tosC, which ex-presses the entire tos operon, was subjected to cell fractionationinto cytosol, inner-membrane, outer-membrane, and superna-tant fractions, TosA localized to the outer-membrane fraction(Fig. 4A). TosA was not observed in uninduced bacterial fractions.When TosA was arabinose-induced from pBAD-tosA, the solublefraction contained the majority of the detectable TosA. An equiv-alent volume of concentrated, filtered culture supernatant fromboth cultures indicated that, in contrast to the majority of knownRTX family members (21), TosA is not secreted extracellularly insignificant amounts from the bacterium (Fig. 4A). Surface-expressed TosA from arabinose-induced E. coli CFT073 araBP-tosC was susceptible to proteinase K digestion, whereas cytoplas-mic TosA from arabinose-induced E. coli TOP10(pBAD-tosA)was not degraded by the protease treatment (Fig. 4B).

tosA expression enhances adherence to the epithelial cellsthat line the urinary tract. Given the surface localization of TosA,

FIG 2 TosA is expressed in infected bladder, kidney, spleen, and liver. FemaleC57/Bl6 mice inoculated transurethrally (A and B) or via tail vein injection (Cand D) with CFT073(pGENmut3.1). At 48 h postinoculation, the kidneys (A)and spleens (B) and at 24 h postinfection the spleens (C) and livers (D) wereremoved and processed for immunofluorescence microscopy. GFP antiserumstaining is shown in green, TosA antiserum in red, phalloidin staining in white,and DAPI in blue. Measurements of individual bacteria are denoted by scalebars.

Vigil et al.

498 iai.asm.org Infection and Immunity

on March 9, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

we reasoned that this protein might mediate adherence to epithe-lial cells that line the host urinary tract. When wild-type CFT073and araBP-tosC bacteria, both cultured in arabinose, were incu-bated with a murine kidney epithelial cell line MM55.K in vitro,

5.4% of wild-type CFT073 bacteria in the inoculum adhered to theepithelial cells after a wash with PBS. Bacteria expressing TosA,however, adhered under these conditions at nearly three times thislevel (15.4% of the inoculum) (Fig. 5A, white bars), suggestingthat this novel RTX family member mediates adherence to epithe-lial cells that line the host urinary tract. No cytopathic effects wereobserved for these cultured cells or any other cell line in the pres-ent study exposed to TosA-expressing bacteria.

The adherence assay was repeated with wild-type and TosA-expressing bacteria that had been preincubated for 5 min withTosA antiserum. The results of the adherence assay showed anablation of the TosA-mediated increase in adherence back to wild-type levels but had little impact on wild-type bacteria treated withthe same antiserum (Fig. 5A, black bars). Given the lack of reac-tivity against wild-type bacteria cultured under identical condi-tions (Fig. 1F), we expected that only bacteria expressing TosAwould be impacted by the TosA antiserum pretreatment. To con-firm that bacteria treated with TosA antiserum were viable andthat this result was not the result of complement-mediated lysis ofTosA-producing bacteria, bacterial suspensions were treated withTosA antiserum and plated to assess viability. No significant dif-ference was observed in viability between the number of wild-typebacteria (91% � 3% of cells viable) and bacteria expressing TosA(89% � 2% of cells viable). This result confirmed that the increasein adhesion was specific to the production of TosA protein.

The adherence assay described above was repeated with differ-ent cell lines that together represent the epithelial cell types thatline the entire host urinary tract. UPEC adhered strongly to celllines derived from a human transitional cell carcinoma of theurethra (Hs 769.T) and at lower levels in two cell lines derivedfrom a human transitional cell carcinoma and a transitional cellpapilloma of the bladder (UM-UC-3 and RT4, respectively).However, no differences were observed in adherence levels be-tween wild-type CFT073 and CFT073 araBP-tosC cells expressingTosA (Fig. 5B). Thus, wild-type CFT073, a prototypical human

FIG 3 TosA localizes to the outer membrane. (A to C) Immunogold-TEMmicrographs of TosA antiserum-stained bacteria. Bacteria were cultured un-der arabinose-inducing conditions. (A) CFT073 �tosA show no immunogoldparticles. (B) CFT073 araBP-tosC marked with numerous immunogold parti-cles. (C) TOP10(pBAD-tosA) cells show no immunogold staining. All imageswere acquired at �64,000 magnification; scale bars denote 100 nm.

FIG 4 Cellular localization and protease susceptibility of TosA. (A) The indi-cated bacterial constructs were induced or not with arabinose and fractionatedas described in Materials and Methods. Samples were subjected to SDS-PAGEand Western blotting with TosA antiserum. Fractions: Cyt, cytosol; IM, innermembrane; OM, outer membrane; Sup, supernatant. (B) The indicated con-structs were induced with arabinose as described in Materials and Methods.Whole bacterial cells in suspension were incubated for 1 h with the indicatedamount of proteinase K (Protease). Bacteria were treated with SDS-gel samplebuffer, electrophoresed, and subjected to Western blotting with TosA antise-rum. Blank lanes in the lower right panel contained no sample.

TosA Mediates UPEC Adherence and Bacteremia Fitness

February 2012 Volume 80 Number 2 iai.asm.org 499

on March 9, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

pyelonephritis/urosepsis isolate (38), adhered to cells derivedfrom the epithelial lining of the lower urinary tract efficientlywithout the need for TosA.

In contrast, bacteria expressing TosA adhered in significantlyhigher numbers than wild-type CFT073 to all tested cell lines de-rived from the upper urinary tract. A transformed transitional cellepithelial line derived from a normal adult human specimen (SVHuc1) allowed wild-type bacteria to adhere in high numbers, buta significant increase in adherence was observed when TosA wasexpressed. Epithelial cells derived from embryonic human kidneytissue (HEK293) showed a modest but significant increase of ad-hesion with TosA expression, and an even greater increase wasobserved for a transformed adult primate kidney epithelial cellline (Vero) (Fig. 5B).

To confirm that the result obtained in cell lines derived from

the lower urinary tract under in vitro conditions (no contributionof TosA to adherence) was relevant during the course of infection,a similar adherence assay was developed by modifying an estab-lished murine model of ascending UTI (14). At 30 min after trans-urethral inoculation of either 108 CFU wild-type or araBP-tosCbacteria induced with arabinose, the mice were euthanized, andthe bladders were removed, cut in half, and weighed. The bladdertissue was subjected to a PBS washing in a fashion similar to the invitro adherence assays to remove nonadherent bacteria. The num-ber of bacteria that remained adherent demonstrated no signifi-cant difference between adherence levels of wild-type (0.24% ofthe inoculum) and TosA-producing (0.17% of the inoculum) bac-teria (P � 0.1). Taken together with the previous results, this in-dicates that TosA can mediate adherence to the epithelial cell lin-ing of the upper urinary tract but does not contribute significantlyto the adherence of UPEC in the urethra or bladders of infectedhosts.

tosA enhances fitness in two animal models of bacteremiaand sepsis. Due to the fact that tosA was discovered in an urosepsisisolate and is expressed in the liver and spleen during bacteremia(Fig. 2C and D), the possibility that the protein has a secondaryrole during bacteremia and sepsis was investigated using two dif-ferent animal models of extraintestinal pathogenic E. coli (ExPEC)pathogenesis. First, a �tosA strain that had been previously dem-onstrated to have reduced fitness in the murine model of ascend-ing UTI during cochallenge (22) and during independent chal-lenge (34) was tested in our recently developed murine model ofbacteremia (31). Our group developed this model to assess theimpact of known and putative UPEC virulence factors in the suc-cess of bacteria that spread from the kidneys to distant organ sites.We found that many genes that confer an advantage in the urinarytract also confer a fitness advantage in this model. Using thismodel, CFT073 �tosA was recovered in significantly lower CFU inboth liver (8 of 8 mice) and spleen (6 of 8 mice) tissue at 24 hpostinfection with competitive indices of 0.17 (P � 0.008) and0.28 (P � 0.023), respectively (Fig. 6), suggesting a secondary rolefor this gene during bacteremia.

A second animal model using zebrafish to study ExPEC patho-genesis during sepsis (39) was also used to study the same �tosAstrain. In the zebrafish model, wild-type bacteria were recoveredin numbers equal to those for �tosA bacteria during cochallengein the bloodstream and when injected into the pericardial cavity

FIG 5 TosA mediates adherence to epithelial cells of the upper urinary tract.Wild-type CFT073 (WT) and CFT073 araBP-tosC (TosA), cultured underarabinose-inducing conditions, were used to test adherence to confluentmonolayers of epithelial cells in vitro at an MOI averaging 0.6. After incubationand washing, the cells were lifted off and plated for CFU determination. Thedata are expressed as the percentage of the inoculum that was adherent to themonolayer. (A) MM55.K cell adherence assay conducted with wild type (WT)and TosA (white bars) and repeated after cells were pretreated for 5 min withTosA antiserum (black bars). (B) Adherence assay conducted with seven dis-tinct cell lines derived from throughout the urinary tract and expressed as thepercentage of inoculum that was adherent to the monolayer. Raw data aresupplied in Table S1 in the supplemental material.�, P 0.05 as calculated bya Student t test.

FIG 6 TosA enhances fitness during bacteremia. A murine model of bactere-mia was used to compete wild-type CFT073 against CFT073 �tosA. An equalmixture of both strains was diluted to deliver 106 CFU in 100 �l, which wasinjected in the tail vein of female C57BL/6 mice. At 24 h postinoculation, liverand spleen tissue was removed, and the CFU of each strain were determined.The log10 competitive index (mutant CFU/wild-type CFU) is shown, with linesrepresenting median values. P values are indicated on the graph.

Vigil et al.

500 iai.asm.org Infection and Immunity

on March 9, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

(Fig. 7A). During independent challenge in the bloodstream,identical survival curves were obtained for the two strains (Fig.7B), indicating that in this model system tosA does not confer anadvantage to bacterial survival.

The discrepancy between the two animal models was resolvedby staining zebrafish infected with wild-type CFT073 for TosAand imaging by immunofluorescence microscopy. In mice, thisstrain expresses TosA in the spleen following transurethral inoc-ulation and in the spleen and liver following intravenous injection(Fig. 2), but no detectable TosA protein was observed on bacteriaeither in the pericardial space of the fish (Fig. 7C, upper left panel)or on bacteria that had disseminated through the circulatory sys-tem (Fig. 7C, lower left panel).

In fish that had been infected with the araBP-tosC strain, thebacteria produced TosA protein if the fish were maintained inwater supplemented with arabinose (Fig. 7C, right panels) andallowed this model system to be utilized with this construct ofCFT073. When arabinose-induced araBP-tosC bacteria were in-oculated directly into the pericardial cavity (Fig. 7C, PC) or circu-lation valley (Fig. 7C, blood) of zebrafish that were maintained inwater supplemented with arabinose, TosA-expressing bacteriawere uniformly observed (Fig. 7C, right panels) and nearly 80% ofinfected fish died by 18 h postinoculation (Fig. 7D). Fish infectedwith the wild-type strain showed E. coli bacteria but no TosA ex-pression (Fig. 7C, left panels) and took nearly 36 h to reach thislevel of mortality (P 0.01) (Fig. 7D). When zebrafish were main-tained in arabinose-supplemented water and mock infected withPBS supplemented with arabinose, �80% of the fish survived to48 h (Fig. 7D), indicating that the arabinose treatment per se didnot contribute to the enhanced killing kinetics observed withTosA expression.

Vaccination against TosA confers protection against urosep-sis caused by a human pyelonephritis UPEC isolate. In the finalset of experiments, we determined that TosA protein contributesto the ability of UPEC to spread from the kidneys to distant organsites. TosA was purified from the pBAD-tosA system, mixed withalum as adjuvant and administered to mice by subcutaneous in-jections following the vaccination schedule outlined in Fig. 8A.Vaccinated mice were transurethrally inoculated with wild-typeCFT073, and the CFU in the bladder, kidney, and spleen werequantified and compared to the CFU of mock-vaccinated micethat only received PBS-alum injections. Vaccination had no im-pact on bacterial survival in the urinary tract, but a significantdecrease in CFU/g of spleen tissue was observed at 48 h postinfec-tion (P � 0.004) (Fig. 8B). The vaccination protocol was repeated,and mice were challenged by intravenous injection; the CFU levelsin the spleen and liver were determined at 24 h postinoculation(Fig. 8C). In this model, no protection was observed among vac-cinated mice (data not shown), suggesting that the protection ob-served in the previous vaccination was specific to bacteria thatascended the urinary tract and later disseminated into the blood-stream.

DISCUSSION

The gene sequence of tosA had previously been annotated as aputative RTX family exoprotein based on its association with theconserved T1SS (27) and the presence of characteristic glycine-and aspartate-rich repeats in the C terminus of the protein (21).Our group has independently identified nine repeats (Fig. 9) thatmatch closely to the GGXGXD consensus RTX sequence (21) in

the C terminus of the protein. In addition, a novel repeat wasdiscovered in tosA consisting of five large tandem repeats �1 kb inlength (Fig. 9).

The strict regulation of tosA expression (only in vivo induction)appears to be unique among RTX family members. Little is knownabout the regulation of RTX operons beyond the regulatory mech-anisms defined for alpha-hemolysin (8, 15, 19). CFT073 displayshemolytic activity during in vitro growth (25) but does not expressdetectable levels of TosA (Fig. 1 and 4). This suggests that differentregulation mechanisms operate on the two RTX systems presentin this strain. Furthermore, the well-defined RTX operons, con-ferring diverse functions ranging from the pore-forming toxins tosecreted proteases, do not appear to contain genes that potentiallyregulate gene expression (21). The presence of tosR, a gene withhomology to the papB family of fimbrial gene expression regula-tors (17, 41), which is immediately upstream of a novel UPECadherence factor gene, remains unexplained. Attempts to deletetosR met with no recombinants, however, and a definitive func-tion for this gene has yet to be elucidated. One attractive hypoth-esis is that the UPEC, which is known to utilize papB family mem-bers to coordinate expression of the multitude of fimbriaeencoded in the genomes of UPEC (16, 20, 42), adapted the samenetwork of regulators to allow tosA expression to respond in con-cert with changes in expression of other adherence factors. Fur-ther work will be required to determine whether TosR is a PapBfamily member and determine its effects on the expression ofother adherence factors. In addition, while RNA transcripts cor-responding to ORFs c0364 and c0365 were detected, no functionhas yet been assigned to these sequences.

Surface localization of TosA also sets this RTX family memberapart from other RTX proteins. Only the RTX members that com-prise the S layer of certain bacteria, notably the motility-associatedRTX of Cyanobacteria (3) and the RTX surface coat of Campylo-bacter spp., which protects against immune system attack (26), areknown to remain associated with the bacterium. All other knownRTX members are fully secreted into the external milieu. How-ever, many RTX proteins can bind to host cell membranes, somewith selectivity (33). The only adaptation that would be requiredto convert such a receptor-specific RTX into an adherence factorwould be the incorporation of the protein into the outer mem-brane. Previous in silico analysis identified a putative transmem-brane spanning region in the N terminus of TosA (27). However,additional study is required to determine whether this region al-lows TosA to embed in the outer membrane.

Three lines of additional evidence also support a possible sec-ondary role for TosA, which is to mediate survival during bacte-remia and urosepsis. First, a �tosA strain of CFT073 demonstratedreduced fitness when competed against wild-type bacteria in ourmurine model of bacteremia (Fig. 6). This model has determinedthat many UPEC virulence factors, including many nontoxins,enhance fitness in the host (31). Second, the protection observedin TosA-vaccinated mice from the final stage of an ascending UTI(Fig. 8B), urosepsis, may indicate that TosA plays a role or, at least,is expressed during the transition from the urinary tract to thebloodstream. Finally, the enhanced lethality of TosA-expressingbacteria in the zebrafish sepsis model (Fig. 7D) argues for an im-portant role during disseminated infections. However, these datado not specifically address whether the protein has a direct role inhost toxicity. Several attempts have been made to observe such arole, including incubating TosA-expressing bacteria or purified

TosA Mediates UPEC Adherence and Bacteremia Fitness

February 2012 Volume 80 Number 2 iai.asm.org 501

on March 9, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

FIG 7 TosAenhanceslethalityinazebrafishmodelofExPECpathogenesis.At48hpostfertilizationzebrafishembryosweremicroinjectedwithbacteriaintoeitherthepericardialcavity around the developing heart or into the circulation valley to initiate bacteremia and sepsis. (A) Wild-type (WT) CFT073 and CFT073 �tosA were mixed in equalproportionsandinoculated intothepericardial cavity(PC)or thecirculationvalley(blood)with1,000CFUin1nl.At16hpostinoculation,embryoswerehomogenized,andtheCFU load of each strain was determined. The data are expressed as competitive indexes (mutant CFU/wild-type CFU), which were not significantly different. (B) Survival curveofzebrafishembryosinjectedinthecirculationvalleywith1,000CFUofeitherwild-typeCFT073orCFT073�tosA. (C)Immunofluorescencemicroscopyofthepericardialcavity(PC) or tails (blood) of embryos injected with wild-type CFT073 or araBP-tosC bacteria cultured under arabinose-inducing conditions. Fish were maintained in water supple-mented with arabinose and, 16 h postinoculation, fixed and processed for imaging. Anti-E. coli antibody staining marks bacteria red and TosA antiserum staining is displayed ingreen. The merged files in the right panels appear green (and not yellow) due to the far more intense anti-TosA staining than the anti-E. coli staining. Scale bars, 100 �m. (D)Survival curves of fish infected with CFT073 araBP-tosC, incubated with or without arabinose induction. Mock-infected embryos were incubated in the presence of arabinose.n � 40 embryos for each survival curve.

502 iai.asm.org Infection and Immunity

on March 9, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

TosA with kidney epithelial cells or sheep erythrocytes in vitro,have failed to provide evidence for a direct role in cytotoxicity(data not shown). Given the results at hand, TosA may only beenhancing host damage and survival indirectly by allowing bacte-ria expressing the protein to bind to target cells, enhancing deliv-ery of other secreted products including alpha-hemolysin and theautotransporter proteases.

A limitation of our virulence studies has been the lack of com-plementation. We speculate that difficulties arise because of thelarge size of tosA (8 kb) and the presence of multiple tandemrepeat-in-toxin sequences within tosA, possibly leading to dele-tions during cloning. However, we have constructed independentdeletion mutants that consistently demonstrate severe attenua-tion in the murine model.

The experimental vaccination results (Fig. 8) raise the possibil-ity that a novel therapeutic agent could be developed to targetTosA during urosepsis. This model utilizes an earlier endpointthan the bacteremia UTI model (24 versus 48 h). It is possible that

the host immune system has not had sufficient time to mount aneffective response in the short time frame. It is also possible thatthe difference in results between the two models was due to themanner in which bacteria entered the bloodstream. For the bac-teremia model, bacteria were cultured in vitro, a condition where

FIG 8 TosA vaccination protects against urosepsis. (A) Purified TosA wasutilized in an experimental vaccine model according to the depicted schedule:female C57/Bl6 mice were vaccinated with 100 �g of protein and then boostedone and 2 weeks later with 25 �g. Three weeks after primary vaccination themice were challenged with wild-type CFT073 via transurethral infection (B) ortail vein injection (C). The CFU/g of tissue was determined for each organ siteat 48 h postinfection (B) or 24 h postinfection (C) and compared to micemock-vaccinated with PBS. �, P � 0.004.

FIG 9 TosA contains characteristic RTX repeats and a novel repeat structure.(A) DNA sequences of hlyA and tosA from the CFT073 genome were searchedfor the RTX repeat structure GGXGXD using PATTINPROT software pro-gram set to find regions with 75% identity to the consensus RTX sequence. Therepeats were aligned and used to create sequence logos using WebLogo soft-ware (http://weblogo.berkeley.edu/logo.cgi). The height of the letters at eachposition indicates the level of conservation at that amino acid position (http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page�npsa_pattinprot.html). HlyA,top panel; TosA, bottom panel. Twelve repeats were found for hlyA, and ninewere found for tosA. (B) The CFT073 genome annotation originally describedtosA (first annotated as upxA) as a 5,325-nucleotide ORF encoding a putativeprotein 1610 amino acids long (predicted molecular mass, 163,819 Da). Se-quence analysis identified two tandem repeats in the nucleotide sequence,depicted in panel as gray bars underneath a schematic of tosA, which shows therepeats relative location proximal to the 5= of the gene and N terminus of thepredicted protein. (C) Cloning and expression of tosA indicate the gene isactually �8,000 nucleotides in length and encodes a protein slightly larger than250,000 Da (see Fig. 1A). Restriction enzyme mapping of full tosA PCR prod-ucts is consistent with the presence of five of these repeats in a tandem array(data not shown). (D) Amino acid sequence of the tandem repeats is 335residues long.

TosA Mediates UPEC Adherence and Bacteremia Fitness

February 2012 Volume 80 Number 2 iai.asm.org 503

on March 9, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

tosA is not expressed (34), and injected all at once. In contrast, it isexpected that movement from the urinary tract into the blood-stream occurred throughout the course of the infection and, giventhe results of the present study, the bacteria in this model werealready expressing TosA. This may have presented the immunesystem of vaccinated animals with two very different challenges(TosA-expressing and TosA-nonexpressing bacteria) and couldexplain the difference in the two vaccination experiments.

Regardless of the differences observed in the two vaccinationmodels, two additional observations suggest that further develop-ment of anti-TosA therapeutics may prove beneficial. In a previ-ous study, our group identified that bacteria flushed from theurinary tract in voided urine from women with UTI show detect-able transcript levels of tosA (13), indicating that the restrictedexpression of tosA may include the human urinary tract. Finally,in a recent survey conducted by our group of urinary tract andfecal isolates of E. coli, we discovered that tosA is present in �25%of uncomplicated UTI isolates, but rare in fecal isolates. A total of98% of strains that carry tosA were part of the B2 phylogeneticlineage of E. coli, and most belonged to a subgroup that wereenriched for highly pathogenic E. coli (35). Thus, while not allUPEC express this protein, TosA may still be an attractive targetfor the development of multivalent vaccines to combat the devel-opment of dissemination to the bloodstream secondary to un-complicated UTIs.

ACKNOWLEDGMENTS

This study supported in part by Public Health Service grants AI43363 andAI059722.

We thank Sara Smith for expert assistance with animal studies.

REFERENCES1. Al-Hasan MN, Eckel-Passow JE, Baddour LM. 2010. Bacteremia com-

plicating gram-negative urinary tract infections: a population-basedstudy. J. Infect. 60:278 –285.

2. Baga M, Goransson M, Normark S, Uhlin BE. 1985. Transcriptionalactivation of a pap pilus virulence operon from uropathogenic Escherichiacoli. EMBO J. 4:3887–3893.

3. Brahamsha B. 1996. An abundant cell-surface polypeptide is required forswimming by the nonflagellated marine cyanobacterium Synechococcus.Proc. Natl. Acad. Sci. U. S. A. 93:6504 – 6509.

4. Brooks HJ, O’Grady F, McSherry MA, Cattell WR. 1980. Uropathogenicproperties of Escherichia coli in recurrent urinary-tract infection. J. Med.Microbiol. 13:57– 68.

5. Brzuszkiewicz E, et al. 2006. How to become a uropathogen: comparativegenomic analysis of extraintestinal pathogenic Escherichia coli strains.Proc. Natl. Acad. Sci. U. S. A. 103:12879 –12884.

6. Chin BS, et al. 2011. Risk factors of all-cause in-hospital mortality amongKorean elderly bacteremic urinary tract infection (UTI) patients. Arch.Gerontol. Geriatr. 52:e50 – e55.

7. Datsenko KA, Wanner BL. 2000. One-step inactivation of chromosomalgenes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci.U. S. A. 97:6640 – 6645.

8. Dobrindt U, Emody L, Gentschev I, Goebel W, Hacker J. 2002. Efficientexpression of the alpha-haemolysin determinant in the uropathogenicEscherichia coli strain 536 requires the leuX-encoded tRNA(5)(Leu). Mol.Genet. Genomics 267:370 –379.

9. Duong F, Soscia C, Lazdunski A, Murgier M. 1994. The Pseudomonasfluorescens lipase has a C-terminal secretion signal and is secreted by athree-component bacterial ABC-exporter system. Mol. Microbiol. 11:1117–1126.

10. Gaynes R, Edwards JR. 2005. Overview of nosocomial infections causedby gram-negative bacilli. Clin. Infect. Dis. 41:848 – 854.

11. Gransden WR, Eykyn SJ, Phillips I, Rowe B. 1990. Bacteremia due toEscherichia coli: a study of 861 episodes. Rev. Infect. Dis. 12:1008 –1018.

12. Hacker J, Hughes C, Hof H, Goebel W. 1983. Cloned hemolysin genes

from Escherichia coli that cause urinary tract infection determine differentlevels of toxicity in mice. Infect. Immun. 42:57– 63.

13. Hagan EC, Lloyd AL, Rasko DA, Faerber GJ, Mobley HL. 2010. Esch-erichia coli global gene expression in urine from women with urinary tractinfection. PLoS Pathog. 6:e1001187.

14. Hagberg L, et al. 1983. Ascending, unobstructed urinary tract infection inmice caused by pyelonephritogenic Escherichia coli of human origin.Infect. Immun. 40:273–283.

15. Haugen BJ, et al. 2007. In vivo gene expression analysis identifies genes requiredfor enhanced colonization of the mouse urinary tract by uropathogenic Esche-richia coli strain CFT073 dsdA. Infect. Immun. 75:278–289.

16. Holden NJ, Uhlin BE, Gally DL. 2001. PapB paralogues and their effecton the phase variation of type 1 fimbriae in Escherichia coli. Mol. Micro-biol. 42:319 –330.

17. Hultdin UW, et al. 2010. Structure of FocB: a member of a family oftranscription factors regulating fimbrial adhesin expression in uropatho-genic Escherichia coli. FEBS J. 277:3368 –3381.

18. Ikaheimo R, Siitonen A, Karkkainen U, Kuosmanen P, Makela PH.1993. Characteristics of Escherichia coli in acute community-acquired cys-titis of adult women. Scand. J. Infect. Dis. 25:705–712.

19. Juarez A, et al. 2000. Interaction of the nucleoid-associated proteins Hhaand H-NS to modulate expression of the hemolysin operon in Escherichiacoli. Adv. Exp. Med. Biol. 485:127–131.

20. Lindberg S, et al. 2008. Regulatory Interactions among adhesin genesystems of uropathogenic Escherichia coli. Infect. Immun. 76:771–780.

21. Linhartova I, et al. 2010. RTX proteins: a highly diverse family secreted bya common mechanism. FEMS Microbiol. Rev. 34:1076 –1112.

22. Lloyd AL, Henderson TA, Vigil PD, Mobley HL. 2009. Genomic islandsof uropathogenic Escherichia coli contribute to virulence. J. Bacteriol. 191:3469 –3481.

23. Lloyd AL, Rasko DA, Mobley HL. 2007. Defining genomic islands anduropathogen-specific genes in uropathogenic Escherichia coli. J. Bacteriol.189:3532–3546.

24. Loomes LM, Kerr MA, Senior BW. 1993. The cleavage of immunoglob-ulin G in vitro and in vivo by a proteinase secreted by the urinary tractpathogen Proteus mirabilis. J. Med. Microbiol. 39:225–232.

25. Mobley H, et al. 1990. Pyelonephritogenic Escherichia coli and killing ofcultured human renal proximal tubular epithelial cells: role of hemolysinin some strains. Infect. Immun. 58:1281–1289.

26. Okuda K, et al. 1997. Role for the S-layer of Campylobacter rectus ATCC33238 in complement mediated killing and phagocytic killing by leuko-cytes from guinea pig and human peripheral blood. Oral Dis. 3:113–120.

27. Parham NJ, et al. 2005. Prevalence of pathogenicity island IICFT073genes among extraintestinal clinical isolates of Escherichia coli. J. Clin.Microbiol. 43:2425–2434.

28. Satchell K. 2007. MARTX, multifunctional autoprocessing repeats-in-toxin toxins. Infect. Immun. 75:5079 –5084.

29. Shibuya Y, et al. 1991. Pseudomonas aeruginosa alkaline proteinase mightshare a biological function with plasmin. Biochim. Biophys. Acta 1077:316 –324.

30. Sleytr UB, Beveridge TJ. 1999. Bacterial S-layers. Trends Microbiol.7:253–260.

31. Smith SN, Hagan EC, Lane MC, Mobley HLT. 2010. Dissemination andsystemic colonization of uropathogenic Escherichia coli in a murine modelof bacteremia. mBio 1(5):e00262-10. doi:10.1128/mBio.00262-10.

32. Smith YC, Rasmussen SB, Grande KK, Conran RM, O’Brien AD. 2008.Hemolysin of uropathogenic Escherichia coli evokes extensive shedding ofthe uroepithelium and hemorrhage in bladder tissue within the first 24 hafter intraurethral inoculation of mice. Infect. Immun. 76:2978 –2990.

33. Taichman NS, et al. 1987. Comparative studies on the biology of Actino-bacillus actinomycetemcomitans leukotoxin in primates. Oral Microbiol.Immunol. 2:97–104.

34. Vigil PD, Alteri CJ, Mobley HL. 2011. Identification of in vivo-inducedantigens including an RTX family exoprotein required for uropathogenicEscherichia coli virulence. Infect. Immun. 79:2335–2344.

35. Vigil PD, et al. 2011. Presence of putative repeat-in-toxin gene tosA in Escherichiacoli predicts successful colonization of the urinary tract. mBio 2(3):00066-11. doi:10.1128/mBio.00066-11.

36. Warren J, et al. 1983. A randomized, controlled trial of cefoperazoneversus cefamandole-tobramycin in the treatment of putative, severeinfections with gram-negative bacilli. Rev. Infect. Dis. 5(Suppl. 1):S173–S180.

Vigil et al.

504 iai.asm.org Infection and Immunity

on March 9, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

37. Welch RA. 1991. Pore-forming cytolysins of gram-negative bacteria. Mol.Microbiol. 5:521–528.

38. Welch RA, et al. 2002. Extensive mosaic structure revealed by the com-plete genome sequence of uropathogenic Escherichia coli. Proc. Natl. Acad.Sci. U. S. A. 99:17020 –17024.

39. Wiles TJ, Bower JM, Redd MJ, Mulvey MA. 2009. Use of zebrafish toprobe the divergent virulence potentials and toxin requirements of ex-traintestinal pathogenic Escherichia coli. PLoS Pathog. 5:e1000697.

40. Woods RG, Burger M, Beven CA, Beacham IR. 2001. The aprX-lipA

operon of Pseudomonas fluorescens B52: a molecular analysis of metallo-protease and lipase production. Microbiology 147:345–354.

41. Xia Y, Forsman K, Jass J, Uhlin BE. 1998. Oligomeric interaction ofthe PapB transcriptional regulator with the upstream activating regionof pili adhesin gene promoters in Escherichia coli. Mol. Microbiol.30:513–523.

42. Xia Y, Gally D, Forsman-Semb K, Uhlin BE. 2000. Regulatory cross-talkbetween adhesin operons in Escherichia coli: inhibition of type 1 fimbriaeexpression by the PapB protein. EMBO J. 19:1450 –1457.

TosA Mediates UPEC Adherence and Bacteremia Fitness

February 2012 Volume 80 Number 2 iai.asm.org 505

on March 9, 2020 by guest

http://iai.asm.org/

Dow

nloaded from