THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1994 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 269, No. 36, Issue of September 9, pp. 22663-22671, 1994 Printed in U.S.A.

Genomic Effects of the Putative Oncogene Gas CHRONIC TRANSCRIPTIONAL ACTIVATION OF THE c-fos PROTO-ONCOGENE IN ENDOCRINE CELLS*

(Received for publication, January 25, 1994, and in revised form, May 12, 1994)

Christian GaiddonSO, Anne-Laurence BoutillierSP, Dominique MonnierSO, Luc Merckenn, and Jean-Philippe LoefflerSll From the Vnstitut de Physiologie et de Chimie Biologique, URA 1446 du CNRS, 21 Rue Rene‘ Descartes, 67084 Strasbourg, Cbdex, France and llRh8ne-Poulenc Rorer Recherche-Deueloppement, Centre de Recherche de Vitry-Alfortville, 13 Quai Jules Guesde BP 14, 94403 Vitry sur Seine, Ce‘dex, France

Somatic mutations of the a subunit of Gs (Gas) have been detected in a variety of endocrine tumors. To test whether Gas is an oncogene, we investigated the genomic effects of Gas protein in which the GTPase ac- tivity had been inactivated. Results from transient transfection studies show that such proteins increase 1) transcription of a reporter gene driven by the minimal CAMP-responsive element (TGACGTCA) and 2) c-fos transcription in several endocrine cell lines (GH3, AtT20, and PC12). By promoter deletion analyses and genetic inactivation of CAMP-dependent protein kinase, we show that this transcriptional stimulation by Gas impinges on several regulatory elements within the c-fos promoter and operates within the protein kinase A path- ways. Stable PC12 cell lines were established to analyze long-term effects of constitutively active Gas. Cell lines expressing mutated Gas have elevated CAMP levels and increased AP1 binding activity. Transcription of a vari- ety of genes, including c-fos, c-jun, and junB, is in- creased in these cells. The strong and permanent effects of Gas on early immediate genes, and c-fos in particular, may be responsible for the oncogenic potential of Gas in endocrine cells.

Hormones and growth factors act on endocrine cells by bind- ing to specific receptors to initiate a broad array of cellular events, including cell proliferation. These receptors are linked to intracellular effector systems. A large family of transduction G proteins has now been identified, and these proteins share the common feature of binding guanine nucleotides (1). The heterotrimeric G proteins and the Ras proteins belong to this large family of signaling transducers that exchange GDP for GTP after their activation. The GTP-bound form of these pro- teins regulates the activity of specific receptors. Signal trans- duction is terminated by the hydrolysis of GTP to GDP (for review, see Refs. 1 and 2). Specific mutations that abolish the intrinsic GTPase activity convert these gene products into on- cogenes responsible for abnormal cell growth. The earliest and best documented member of this family is the Ras oncogene (2). In many human tumors, point mutations of this G protein inhibit its ability to hydrolyze GTP, producing a constitutively active and highly oncogenic form of this protein. Mutations in

sur le Cancer Grant 6089 (to J. P. L.). The costs of publication of this * This work was supported in part by Association pour la Recherche

article were defrayed in part by the payment of page charges. This

with 18 U.S.C. Section 1734 solely to indicate this fact. article must therefore be hereby marked “aduertisement” in accordance

$ Supported by a grant from the Ministere de la Recherche et de la Technologie.

Fax: 33-88-61-33-47. 11 To whom correspondence should be addressed. Tel.: 33-88-41-60-02;

codon 12 or 61 are those most frequently found in mammalian tumors and also in retroviruses whose ras genes are responsi- ble for malignant transformation of fibroblasts (2). The molec- ular mechanisms by which Ras stimulates cell growth have been extensively studied, and there is now agreement that its transforming potential is dependent on the stimulation of im- mediate early genes (IEGs),’ including c-fos (3).

More recently, functional abnormalities of the adenylate cy- clase stimulatory GTP-binding protein (Gas) have been char- acterized in several human secretory tumors. Mutated Gas forms have been identified in GH-secreting pituitary adenomas (4-7) and in autonomously functioning thyroid tumors (6, 8). Mutated residues are glutamine 227 (equivalent to glutamine 61 of the rus proto-oncogene) and arginine 201, which is ADP- ribosylated by cholera toxin. Mutations at equivalent positions of Gai2 have been identified in some ovarian and adrenal cor- tical tumors (6). Both a subunits regulate the activity of ad- enylate cyclase, the CAMP-generating enzyme. By analogy with the Ras oncogene, it has been proposed that these point muta- tions can convert the a subunit gene into an oncogene, but the genetic mechanisms by which these altered gene products would act as true oncogenes are not documented. Current data indicate that CAMP-mediated gene transcription is transient, whereas if Gas were to be oncogenic, one would expect perma- nent stimulation of CAMP-dependent transcription. Indeed, in various cell types, despite prolonged activation of the CAMP pathway, subsequent gene activation through the best docu- mented CAMP target, namely the CRE (TGACGTCA), is shut off by either rapid dephosphorylation of the transcription factor CREB (9) or neosynthesis of an inhibitory factor that binds to CREB and thereby blocks its transactivation potential (10). Therefore, it was important to show that under given circum- stances, continuous CAMP formation correlates with constitu- tive elevated gene transcription and that these effects are strictly mediated by the cAMP/protein kinase A (PKA) path- way. To test these hypotheses, we used endocrine cell lines to investigate whether active Gas can exert long-term genomic effects, potentially able to induce cell proliferation.

We analyzed the effects of a series of Gas mutants on the transcriptional induction of c-fos, an early genomic marker of mitotic stimulation (11-13). This part of the study was per- formed in the pituitary somato-lactotroph cell line GH3 derived from rat pituitary since mutated Gas proteins are most fre- quently found in such endocrine cells. Then, to investigate the molecular mechanisms of early gene activation by Gas, we used

CAMP-responsive element; CREB, CRE-binding protein; PKA, protein ‘The abbreviations used are: IEGs, immediate early genes; CRE,

kinase A TRE, 12-0-tetradecanoylphorbol-13-acetate-responsive ele- ment; CAT, chloramphenicol acetyltransferase; SRE, serum response element; FAP, c-fos AP1-like element; bp, base pair(s).

22663

by guest on July 26, 2019http://w

ww

.jbc.org/D

ownloaded from

22664 c-fos Recruitment

PC12 cells. Indeed, transcriptional regulation of IEGs by the prototypic G protein, the Ras oncogene, is well documented in these endocrine cells (for example, see Refs. 14 and 15), allow- ing comparisons to be made between the genomic effects of Gas and those observed using activated Ras (EJ Ras). In addition, in these cells, several genomic targets within the c-fos promoter have been shown to respond to acute CAMP stimulation (16- 19). To obtain additional information on CAMPPKA depend- ence and its relevance to the oncogenic potential of Gas, we analyzed whether long-term stimulation of the CAMP pathway via mutated Gas activates the same c-fos regulatory sequences. Using transient and stable transfection assays, we established that alteration of the Gas intrinsic GTPase activity strictly correlates with its ability to stimulate c-fos transcription. Fur- thermore, characterization of the molecular mechanisms un- derlying this induction shows that Gas and Ras stimulate c-fos by different regulatory pathways and distinct cis-acting ele- ments within the c-fos promoter region.

EXPERIMENTAL PROCEDURES Cell Culture-PC12 rat pheochromocytoma, GH3 rat somato-lac-

totroph, and AtT2O mouse corticotroph cells were propagated in Dul- becco’s modified Eagle’s medium containing fetal calf serum (lo%), glu- tamine (286 mg/liter), glucose (4.6 g), bicarbonate (2.1 g), kanamycin (50 pg/ml), streptomycin (100 pg/ml), and penicillin (100 pg/ml) and cul- tured at 37 “C under 95% 0,, 5% CO,.

Establishment of Stable Cell Lines-Cells were plated in 10-cm cul- ture dishes. When a t -80% confluency, cells were cotransfected with 5 pg of the appropriate SV2-as vector or control vector pSV2-dhfr and 200 ng of pSV2-Neo selection plasmid. After 2 days in culture, stable trans- fectants were selected in G418 (500 pg/ml for 3 weeks). G418-resistant clones (at least 50 individual clones) were pooled for further studies.

Recombinant Material-The somatostatin CRE (core sequence TGACGTCA) (20) and metallothionein IIA TRE (core sequence TGACTCA) (21) oligodeoxynucleotides linked to the thymidine kinase promoter from the herpes simplex virus and the chloramphenicol acetyltransferase (CAT) reporter gene generate CRE-tk-CAT and TRE- tk-CAT, respectively. The parental plasmid pBLCAT2 (22) served as a control. The recombinants pFC700, pFC363, pFC99, pFC72, and pFC53 or the SRE and FAP contain progressively deleted c-fos promoter se- quences or defined regulatory sequences linked to the minimal c-fos promoter (pFC53) and have been described in detail previously (16). The c j u n and stromelysin reporter constructs that contain the respec- tive full-length promoter sequences have been described previously (23, 24). ThejunB reporter gene (a generous gift from Dr. N. Kley) contains the full-length human junB promoter, subcloned from the original genomic sequence (25).

Expression Vectors-Cloning of the Chinese hamster Gas cDNA has been described (26). The HindIII and BamHI restriction sites were introduced by polymerase chain reaction at the 5‘- and 3’-ends of the

TCGCCGCCATGGGCTGCCTCGGC and GGGATCCTTCTTAGAG- cDNA, respectively, using the following oligonucleotides: AAAGCT-

CAGCTCGTATTG. The translation initiation codon and the comple- mentary sequence of the stop codon are italicized. The HindIII and BamHI restriction sites are underlined. Mutagenesis was performed as described by Zoller and Smith (27) after subcloning in M13-derived vectors (28). The following oligonucleotides were used: GGTGCTGTA- GAGTCTGGC for G49V, GGTGCTGTGGGTCTGGC for G49V/E50G, CTTCGCTGCCACGTCCTGACC for R201H, CGATGTGACCGGC- CAGC for G225T, GTGGCGCCCGCGCG for G226A, and GGGCGGC- CTGCGCGATG for Q227L. The mutations were confirmed by dideoxynucleotide sequencing. Mutation N293I was obtained serendipi- tously during the polymerase chain reaction process. The expression vectors are derived from the pSV2-dhfr vector (29). The HindIII-BglII fragment containing the dhfr gene is replaced by the HindIII-BamHI cDNA fragment that corresponds to Gas and its mutant forms.

Plasmid Mt-Rab expresses a mutant form (without CAMP-binding sites) of the regulatory subunit of type I PKA. Plasmid Mt-Rwt, which served as a control, expresses the wild-type regulatory subunit (30). Since basal expression from the metallothionein promoter was suffi- cient for our purposes, Zn” or Cd2+ treatment was avoided. pCH110, pRSV-PGal, and pSVa-dhfr, containing the coding sequence for the bac- terial @galactosidase driven by SV40 or the Rous sarcoma virus and the Gas cloning vector, respectively, were used to keep the amounts of total

by Gas Oncogenes DNA constant in cotransfection experiments.

Nuclear Extracts and Gel Mobility Shift Assay-PC12 cells were grown in 10-cm tissue cultures dishes (Falcon) until they reached 70- 80% confluency. Cells were serum-deprived for 24 h. Nuclear extracts were isolated by the technique of Dignam et al. (31). Final protein concentrations were typically 2-3 pg/pl as determined by the Bio-Rad protein assay. Equivalent amounts of protein, 1 pg of poly(d1-dC), and a 18-base pair 32P-labeled oligonucleotide containing the human metallo- thionein IIA TRE sequence (TGACTCA) or a mutated sequence (AG- GCTAA) were incubated in binding buffer (20 mM Hepes, pH 7.9, 6 mM KCl, 0.2 mM dithiothreitol, 5 mM spermidine, 2% Ficoll, and 8% glycerol) in a final volume of 20 pl. The binding reaction lasted 20 min at room temperature. The DNA-protein complexes were resolved on nondena- turing 5% polyacrylamide gels.

Dansfection and Chloramphenicol Acetyltransferase Measurements- Transfection of PC12 cells was carried out with a lipopolyamine-based method as described previously (32). Briefly, cells were grown to 7680% confluency and serum-deprived for 12 h. DNA (3 or 4 pg/well) in 50 pl of 150 mM NaCl was mixed with 6 or 8 pl, respectively, of a 2 mM ethanolic solution of dioctadecylaminoglycylspermine (TransfectamTM) in 50 pl of 150 mM NaCl. After 10 min, the mixture was brought to a 1 x final concentration of Dulbecco’s modified Eagle’s medium, and the transfec- tant solution was applied overnight to the cells. Cells were rinsed, cul- tured in Dulbecco’s modified Eagle’s medium for 12 h, and then treated or not for another 12 h. CAT measurements were performed either with a sandwich-enzyme immunoassay kit (Boehringer Mannheim) according to the manufacturer’s instructions or according to Gorman et al. (33). It was found that transfection efficiency, at a constant DNA concentration, varied < E % within a given experiment. Total protein content in each reaction was measured using a Bio-Rad kit.

CAMP Measurements-Cells were cultured and serum-deprived as described above. After treatment, the medium was aspirated, and cells were lysed with 500 p1 of 0.1 N ice-cold HCl. CAMP levels were measured as described (34) with an antibody developed and kindly provided by Drs. B. Koch and L. Bucher (Institut de Physiologie et de Chimie Biologique, Strasbourg, France).

RESULTS

Gas Stimulation of Gene Transcription Is Mediated by CAMP in Endocrine Cells-A series of biochemical variants of Gas, de- ficient or not in GTPase activity, was generated by oligonucle- otide-directed mutagenesis of the wild-type Chinese hamster Gas cDNA (Fig. lA) (26). Positions 201 and 227 were mutated to histidine and leucine, respectively, as found in the pituitary tumors (5-7). Positions 49,50,225, and 226 were mutated as for the ras proto-oncogene (for a review, see Ref. 2), where they correspond to residues 12,13,59, and 60, respectively. Transient transfection assays were performed to determine the response of a heterologous promoter construct bearing the somatostatin CRE (CRE-tk-CAT core sequence TGACGTCA) (35). This re- porter construct was transiently cotransfected into PC12 cells along with the various Gas expression vectors. Whereas over- expression of wild-type Gas moderately increased CRE-depend- ent transcription, the GTPase-deficient mutants, G49V, R201H, Q227L, and N2931, strongly increased CRE-driven transcrip- tion (Fig. 1B). The parental plasmid of CRE-tk-CAT (pBLCAT2) (22) served as a control and was not significantly modulated by any expression construct. These results show that Gas proteins stimulate CAMP-mediated gene transcription, and effects are most marked with mutations that have been shown previously to decrease GTPase activity (5, 36, 37). As overexpression of wild-type Gas in itself induced transcription from a CRE; for the rest of the experiments, we chose to consider as controls either cells transfected with plasmid containing no Gas expression se- quence or cells transfected with a plasmid expressing an inac- tive Gas mutant, G226T (38).

Since a central problem to understanding the possible onco- genic effects of Gas is the persistence of the CAMP signal, we measured CAMP levels in stable PC12 cell lines expressing some of the Gas variants. We chose to compare the two mu- tants, 201 and 227, that are the most frequently found in sev- eral secretory tumors; the wild-type form of Gas and mutant

by guest on July 26, 2019http://w

ww

.jbc.org/D

ownloaded from

e-fos Recruitment by Gas Oncogenes 22665

binding sequences

Clusters of effector- = activating residues

I Attenuator domain

lo domain 1 Receptor interaction

1 394

227

T *

* T

* T

* T

tk ”

CRE-tk-CAT

tk CAT+

I CRE TGACGTCA

Ct Gas

Wt 49 49/50 201 225 226 227 293

wild-type Chinese hamster cDNA as described under “Experimental Procedures.” All mutations (mutants 49, 50, 201, 225, 226, 227, and 293) are FIG. 1. A, diagram of the G protein a subunit polypeptide and its different mutations. The mutants were generated by point mutation of the

in the guanine nucleotide-binding domain (solid boxes). The changes in amino acids are indicated. CTX, cholera toxin. B , screening of the activities of the Gas mutants on CRE-driven transcription. PC12 cells were cotransfected with the somatostatin CRE-CAT reporter gene (CRE-tk-CAT) or the parental tk-CAT reporter gene (pBLCAT2) along with the variants of Gas (see above). Ct, control; Wt, wild-type form of the G protein a subunit. Briefly, cells were serum-starved for 24 h and transfected overnight, and the expression step was performed for 24 h in serum-free medium (see “Experimental Procedures”). CAT production was quantified with a CAT enzyme-linked immunosorbent assay kit (Boehringer Mannheim). A

by mutants 201 and 227. typical experiment is shown. Means f S.D. are given (n = 3; *, p < 0.01). Note the 7-&fold transcriptional induction of the CRE-tk-CAT construct

226, previously shown to encode an inactive Gas protein (381, were chosen as controls for possible unspecific effects of protein overexpression. Another control cell line was established by stable transfections of pSV-Neo (see “Experimental Proce- dures”). In this cell line, CAMP levels were typically 15 pmol/mg of protein (data not shown). As seen in Fig. 2, basal CAMP levels were increased up to 7-fold in cell lines stably expressing mu- tants 201 and 227, whereas the wild-type cell line displayed a moderately higher CAMP level (1.8-fold) relative to the controls (pSV2-dhfr alone or inactive mutant 226). This experiment shows that the CAMP levels generated by Gas proteins, mu- tated in their GTPase activity, are not down-regulated over the long run in these persistently transformed cell lines.

Gas Proteins Stimulate e-fos Expression in Several Endo- crine-derived Cell Lines-& c-fos expression is an early re- sponse to mitogenic signals and a CAMP-dependent IEG, we tested whether Gas could act on the expression of this proto- oncogene in different endocrine cell lines. This time, using tran- sient cotransfection assays, we employed Gas expression vec- tors and a reporter gene containing 700 bp of the c-fos promoter

8 1 * L ”

C t I GUS

226 Wt 201 227 FIG. 2. CAMP measurements in PC12 cells expressing Gas vari-

ants. Stable PC12 cell lines were produced for different Gas variants (the wild-type ( W t ) form and mutants 226,201, and 227) as described under “Experimental Procedures.” The control PC12 cell line (ct) con- tains only the pSV-Neo vector. Mutants 201 and 227 constitutively enhance basal CAMP levels. Data are represented as basal CAMP levels relative to those obtained in control cells (typically 15 pmol of cAMP/mg of protein). Means f S.D. (n = 6) are given. Asterisks indicatep 5 0.01.

by guest on July 26, 2019http://w

ww

.jbc.org/D

ownloaded from

22666 c-fos Recruitment by Gas Oncogenes

SRE FAP CRE

-53 C-fos -CAT

-53 i-42

CAT

For B, C and D;

Upper histograms: -700 C-fos -CAT

Lower histograms: - -53 c-fos -CAT

C) AtT20

"1 PC12

30 *

l o 1 0-

ct Gas Wt 201 227 226

l o 1 0-

I ct I CU*

Wt 201 W 226

FIG. 3. Transcriptional activation of c-fos by Gas mutants in GH3,AtT2O, and PC12 cells. A, diagram of the reporter genes. The Fos-CAT fusion genes used contain 700 and 53 bp prior to the transcription start site of the rat c-fos promoter. The main regulatory sequences in the c-fos promoter are boxed. DR, direct repeat. Three cell lines, GH3 ( B ) , AtT20 (C), and PC12 (D), were used to determine the effects of Gas mutants on c-fos-CAT transcription in transient transfection assays. In each case, after a 24-h period of serum starvation, cells were transfected with the -700 c-fos-CAT (upper histograms) or -53 c-fos-CAT (lower histograms) reporter gene for 12 h and switched to fresh serum-free medium for 20 h. CAT

enzyme-linked immunosorbent assay kit (Boehringer Mannheim). The results were converted to -fold induction relative to the control (Ct; activity was determined by enzymatic assay as described under "Experimental Procedures," except for D, where CAT was quantified with a CAT

pSV2-dhfr). Data represent the means 2 S.E. of at least three individual experiments, each performed in triplicate. Asterisks indicatep 5 0.05 (by Student's t test). The -53 c-fos-CAT construct is unresponsive to the different treatments and serves as a control. Wt, wild-type Gas.

linked to the CAT sequence. We show that these tumoral vari- ants of Gas strongly stimulated c-fos transcription in the so- mato-lactotroph cell line GH3 (Fig. 3B), the corticotroph cell lineAtT2O (Fig. 3C), and PC12 cells (Fig. 3 0 ) . In all cell types, not only was c-fos-CAT transcription increased 25-fold, but we also found that these levels of transcription were in the same order of magnitude as those produced following direct stimu- lation of CAMP levels by forskolin. Indeed, 8 h of treatment with forskolin (5 x M) increased c-fos-CAT transcription >30-fold in each cell type (data not shown).

Gas-responsive Elements-We next investigated the molecu- lar mechanisms by which altered forms of Gas induce gene transcription by comparing the effects of Gas and Ras on tran- scription from a TRE (21). To this end, we used a reporter construct in which the mouse metallothionein I1 gene TRE was cloned in front of the tk-CAT gene, having verified that both the PKA and protein kinase C systems activated this construct in

our system by stimulating transcription with forskolin (5 x 1O" j M) and 12-0-tetradecanoylphorbol-13-acetate (1 M) directly (Fig. 4). As shown in Fig. 4, both Gas and Ras transactivated this construct in a transient transfection assay. These stimu- latory effects on the TRE do not result from a general increase in gene transcription since Gas and Ras exert different effects on the closely related CRE sequence, which is not stimulated by Ras (Fig. 4). These results suggest distinct regulatory path- ways for the two oncoproteins, and this point was further in- vestigated at the level of c-fos regulation.

Multiple Regulatory Elements Are Responsible for Strong Danscriptional Stimulation of c-fos by Gas-We next com- pared the transcriptional control of c-fos by Gas and Ras. To this end, reporter constructs containing progressively deleted promoter sequences of the c-fos gene (16) were transiently ex- pressed in PC12 cells (Fig. 5). As already shown above (Fig. 31, the full-length promoter sequence was efficiently stimulated by

by guest on July 26, 2019http://w

ww

.jbc.org/D

ownloaded from

= 1

c-fos Recruitment

20 CRE

10 TGRCGTCR A? 8 O

* T

tk 0 4 CRT E

Ct Fk TPA Ct I G u lras Wt 226 201 227

somatostatin CRE-CAT (CRE-tk-CAT), the metallothionein TRE-CAT FIG. 4. Gas oncoproteins act on several nuclear targets. The

(TRE-tk-CAT), and the parental tk-CAT (pBLCAT2) reporter genes (see

treatment with forskolin (Fk; 5 x M) or 12-0-tetradecanoylphorbol- diagrams on the right) were tested for transcriptional activation by

13-acetate (TPA; M) or by overexpression of Gas or E J Ras (ras) oncoproteins in a transient transfection assay as described (see legend to Fig. 1). Gas mutants induce transcription through both the CRE and TRE, whereas Ras activates only the TRE, showing distinct regulatory pathways for these two oncoproteins. Results from three experiments, each performed in triplicate, are given as means * S.E. Asterisks indi- catep 5 0.01 relative to untreated control cells (by Student's t test). ct, control; Wt, wild-type Gas.

Gas and Ras. We used various reporter constructs. The first group contained progressively deleted sequences from the rat c-fos promoter (the -700, -363, -72, and -53 sequences prior to the transcription start site), and two others had either the c-fos SRE or FAP fused to the -53 sequence. The -700 and -363 constructs differ only by the absence of 337 bp 5' to the SRE.FAP complexes. No known regulatory sequences have been identified in this region. -72 c-fos-CAT lacks both the SRE and FAP sites, but retains the CRE between bp -57 and -63. -53 c-fos-CAT is the minimal promoter with no regulatory se- quences. I t is this minimal promoter that was used to generate SRE -53 c-fos-CAT and FAP -53 c-fos-CAT by inserting the c-fos SRE or FAP upstream of bp -53. Deletion beyond the SRE and FAP located at positions -317 to -290 prior to the tran- scription initiation site abolishes the effect of Ras, but c-fos stimulation by Gas persists until the promoter is deleted down to bp -53. This experiment highlights a first regulatory se- quence by which Gas regulates c-fos, namely the CRE centered at bp -60 (17). To determine whether additional sequences respond to Gas, vectors containing the SRE or FAP sequences fused to the minimal unresponsive c-fos promoter region were tested. As shown in Fig. 5 , both sequences were induced by Gas, whereas only the SRE was responsive to Ras. In summary, Gas proteins stimulate c-fos transcription by multiple elements in- cluding the CRE, the FAP element, and the SRE region. How- ever, only this latter element can mediate the stimulation evoked by two separate regulatory pathways initiated by both Gas and Ras oncogenes.

Gene Regulation by Gas Is Dependent on PKA-Gas stimu- lates adenylate cyclase, and we have shown above that stable

by Gas Oncogenes 22667

expression of Gas mutants increases CAMP levels (Fig. 2). Thus, it is likely, since c-fos is responsive to CAMP in many cells, that the genomic effects of Gas are mediated by CAMP and subsequent activation of PKA. However, we cannot for- mally exclude that following overexpression, Gas and particu- larly its mutant forms also couple to other effectors systems. Direct coupling of Gas to other effectors, mainly ionic channels, has been reported (for review, see Refs. 39 and 40). To analyze the role of PKA, we inactivated this enzyme by using a domi- nant inhibitory mutant. McKnight et al. (30) have previously shown that regulatory subunits of PKA lacking CAMP-binding sites can inhibit CAMP-mediated effects in a highly specific manner. As already shown in pituitary endocrine cells (411, we show here that transient expression of this mutant can be used to study CAMP-mediated gene regulation in PC12 cells. As shown in Fig. 6 A , transcriptional stimulation of the CRE by activation of adenylate cyclase with forskolin (5 x M) or cholera toxin (100 ng/ml) was completely abolished by the mu- tated regulatory subunit of PKA. Fig. 6B shows the same effect on the c-fos gene and, in addition, shows the specificity of this inhibition. Indeed, c-fos stimulation via the protein kinase C pathway initiated by the phorbol ester phorbol 12-myristate 13-acetate (low7 M) was not affected by PKA inactivation. Ge- netic inactivation of PKA was next used to investigate the mechanisms of Gas-mediated gene regulation. As shown in Fig. 6C, stimulation of CRE-tk-CAT by Gas was fully inhibited by PKA mutants. Similarly, the stimulation of c-fos by Gas, but not by Ras, was blocked by genetic inactivation of PKA (Fig. 6D). This series of experiments shows that the transcriptional effects of Gas and its activated variants are mediated by PKA. They further confirm that the oncogenes Gas and Ras stimu- late IEGs by separate pathways.

Gcvs Proteins Exert Long-term Danscriptional Effects-To ex- amine the long-term transcriptional effects of Gas, we went back to the permanently transformed cell lines. To verify whether Gas-induced c-fos transcription results in the appear- ance of functional AP1 binding activity, we examined the po- tential of nuclear protein extracts from the cell lines stably expressing the Gas variants (LGas) to bind the metallothionein I1 gene TRE (core sequence TGACTCA) (21) or the somatosta- tin CRE (core sequence TGACGTCA) (35) (Fig. 7). The DNA- protein complex revealed with the CRE probe remained un- changed in the different cell lines (Fig. 7A, left), whereas LGas 201 and LGas 227 displayed a strongly enhanced AP1 binding activity (Fig. 7A, right, third and fourth lanes). A smaller in- crease in AP1 binding activity was detected in LGas Wt (Fig. 7A, right, second lane). Thus, AP1 binding activity correlates with the CAMP levels maintained in each cell line (Fig. 2).

Then we analyzed whether mutated Gas proteins perma- nently retain their ability to stimulate transcription or whether cellular compensation mechanisms come into play to correct and eventually to suppress this stimulation. To this end, re- porter constructs bearing promoter sequences of various genes were transiently transfected into the cell lines stably express- ing the different Gas mutants. Fig. 7B shows that transcription from a CRE reporter gene was enhanced 30-36-fold in LGas 201 and LGas 227 relative to the neomycin-selected control cell line expressing no additional Gas variant (LCt), giving about the same steady-state transcriptional levels as observed in transient cotransfection assays. In contrast, these mutant cell lines displayed but a 5-&fold induction of TRE-tk-CAT and c-fos-CAT activities, whereas in transient cotransfection stud- ies, induction was 25-30-fold (Fig. 4, middle). This suggests that although CAMP-dependent transcription is significantly enhanced over time, c-fos gene transcription is down-regulated, an observation in agreement with the well known negative

by guest on July 26, 2019http://w

ww

.jbc.org/D

ownloaded from

22668 c-fos Recruitment by Gas Oncogenes 30 1

FIG. 5. Delineation of Gas-respon-

PC12 cells were transiently cotransfected sive elements within c-fos promoter.

as described (see legend to Fig. 1). The reporter constructs used were several constructs containing the rat c-fos pro- moter, progressively deleted (the -700, -363, -72, and -53 sequences prior to the transcription start site), or those with the SRE or FAP regulatory sequences in- serted in front of the c-fos minimal pro- moter (SRE: bp -319/-297; FAP: bp -3031 -281) (see diagrams on the right). Expression vectors coded for different Gas mutants (226, wild-type (tot), 201, and 227) or EJ Ras (rus). Distinct target sequences within the c-fos promoter for

Results are represented as -fold induction Gas and Ras oncoproteins are evidenced.

relative to control cells transfected with pSV2-dhfr. Means ? S.D. are given (n = 3; *, p 5 0.01 relative to untreated control cells by Student’s t test). ct, control; DR, direct repeat.

ct 226 wt 201 7.27 N

ct 226 .r)( 201 227 N

301

SRE FAP CRE

-363 C-fOS -CAT

-363

SRE FAP CRE

-72 C-fOS -CAT

CRE ct 226 w i 201 7.27 N

301 -53 C-fOS -CAT

-53 +42

CAT

ct 226 w i 201 227 N

30 1

ct 226 wt 201 227 N

SRE -53 C-fOS -CAT -319 -297

FAP -53 C-fOs -CAT

-303 -281 +42

CAT FAP

autoregulation of the c-fos gene (42,43). In addition, the tran- scription from other IEGs like c jun (23) or junB (25) is also significantly increased. Again, LGas Wt displayed only modest effects on long-term transcriptional levels when compared with LCt or LGas 226. Interestingly, the stromelysin gene that en- codes a protein implicated in cell transformation (44-46) and whose transcriptional activity is strongly stimulated by Fos and Jun proteins (24) was also significantly increased in LGas Wt, LGas 201, and LGas 227. No increase was seen in LGas 226, expressing the inactive control.

DISCUSSION Mutant forms of Gas have been found in various human

secretory tumors. However, to date, there has been no demon- stration of their oncogenic potential in cell lines (47). Our aim in these experiments was to determine whether mutated Gas could have persistent genomic effects, which in turn could be related to the oncogenic process. The active Gas protein couples

positively activating receptors to CAMP, and CAMP stimulates the production of c-Fos protein, associated with entry into the GI phase of the cell cycle (48). Thus, it seemed logical for us to analyze how Gas mutants affect CAMP-dependent transcrip- tional regulation of c-fos. We used several experimental ap- proaches to analyze their transcriptional effects and the path- ways implicated. We also addressed the problem of whether compensatory mechanisms down-regulate these transcrip- tional effects in the long run.

Our first step was to analyze, by transient cotransfection assays, the effects of different Gas constructs on c-fos and CAMP-dependent transcription. We show that both wild-type Gas and the GTPase-deficient Gas mutants enhance transcrip- tion both from a CRE and from the c-fos promoter in several cell lines. Interestingly, the two mutants identified in human pitu- itary tumors had the most marked effects in these assays.

To investigate further the mechanism by which Gas proteins enhance transcription, we analyzed the regulatory pathway(s)

by guest on July 26, 2019http://w

ww

.jbc.org/D

ownloaded from

e-fos Recruitment by Gas Oncogenes 22669

CRE-tk- CAT -700 c foS-CAT

C) D)

ct 226 wt 201 227 ct 226 Wt 201 227 ct 226 wt 201 227 Ran C t 226 wt 201 227 b s

" 700 c fos -CU

FIG. 6. Gas proteins stimulate transcription through PKA. A and B , PC12 cells were transiently cotransfected with reporter genes and expression vectors coding for wild-type (Rh) and mutated (Rab) regulatory subunits of PKA. Twenty-four hours post-transfection, cells were stimulated for 6 h, and CAT activity was determined. A shows the complete suppression of CAMP-induced transcription by forskolin (Fk; 5 x 1O"j M) or cholera toxin (CTX, 100 ng/ml) through the somatostatin CRE gene. The specificity of this inhibition is shown in B , where c-fos transcription is stimulated through the cAMP (forskolin or cholera toxin) or the protein kinase C (12-0-tetradecanoylphorbol-13-acetate (TPA); M) pathways. Only the cAMP-mediated stimulation of c-fos transcription is abolished by the dominant inhibitory subunit of PKA. C and D, cells were first transfected with PKA expression vectors, and 12 h later, a second transfection with the CAT reporter genes and the different Gas or EJ Ras (Ras) expression vectors was performed. Twelve hours later, CAT production was determined. C shows the complete inhibition by mutated PKA subunits of Gas-induced transcription through the somatostatin CRE. A similar inhibition of Gas-induced c-fos transcription is seen in D. In contrast, Ras-induced stimulation of c-fos transcription is not sensitive to PKA inhibition. In each case, a typical experiment is shown; experiments were repeated at least four times. Histograms show means f S.D., where n = 3. Asterisks indicate p 5 0.01 when compared with untreated controls (Student's t test). ct , control; wt, wild-type Gas.

and the genomic targets leading to increased c-fos transcription and compared them with the well documented Ras oncogene. Two lines of evidence clearly show that these two oncogenes operate through distinct regulatory pathways. First, in con- trast to Gas, Ras does not transactivate a CRE-driven reporter gene (Fig, 41, suggesting that only Gas operates through the PKA pathway and the trans-acting factor CREB that binds to this regulatory element (20).

Second, we show that the regulatory pathways of Gas and Ras can be distinguished with dominant inhibitory mutants of PKA. Indeed, as shown in Fig. 6, Gas-mediated c-fos transcrip- tion is abolished by overexpression of regulatory subunits of PKA lacking CAMP-binding sites (30). This corroborates the hypothesis that the transcriptional stimulation of the c-fos pro- moter by GTPase-deficient Gas subunits is primarily depend- ent on PKA activation.

Only one element in the c-fos promoter, namely the SRE (12, 13), is shared by the regulatory pathway initiated by Ras and Gas oncogenes. The presence of multiple Gas-responsive ele- ments might explain the strong transcriptional response of the c-fos gene to Gas as compared with Ras. However, whether the three different Gas-responsive elements are functional in se- cretory human tumors remains to be determined. CAMP-de- pendent regulation through the trans-acting factor CREB ap- pears to be a general mechanism in all cells (for example, see Ref. 9). Thus, it is likely that the -60 CRE is also functional in endocrine human tumors. In contrast, the FAP element (18) and a short sequence within the SRE (19) appear to be more

tissue-specific CAMP-responsive elements. We reported re- cently that a sequence spanning these two elements (SRE and FAP) confers CAMP responsiveness in the corticotroph-derived cell line AtT20 (49). Furthermore, preliminary data from our laboratory indicate that the SRE and FAP sequences are induc- ible by activated Gas in the somato-lactotroph cell line GH3.' Although more data are needed, it seems likely that all three elements could be functional in human pituitary tumors.

All of the above results were obtained in transiently trans- fected cell lines. To determine whether activated Gas mutants permanently retain their ability to stimulate CAMP levels and IEG transcription, we again used transient transfection analy- ses, but this time in the established cell lines stably expressing wild-type or mutated Gas. Having first checked that CAMP levels were persistently raised in these cell lines, we looked at transcription from reporter genes driven by promoters of dif- ferent IEGs (c-fos, cjun, andjunB). All were transcribed more efflciently in cell lines expressing GTPase-deficient Gas mu- tants than in cell line expressing wild-type Gas (Fig. 7 B ) . In- terestingly, in these cell lines, the corresponding gene products that compose the AP1 transcription complex are clearly more abundant (Fig. 7A). Furthermore, this increase in AP1 binding activity is functional since target genes whose transcription is driven by APl are constitutively stimulated. This is shown here by using a minimal TRE-tk-CAT reporter construct (21) and by analyzing the transcription of stromelysin (Fig. 7 B ) , a TRE-

C. Gaiddon and J. P. Loeffler, unpublished data.

by guest on July 26, 2019http://w

ww

.jbc.org/D

ownloaded from

22670 c-fos Recruitment by Gas Oncogenes

FIG. 7. Oncogenic Gas proteins ex- ert long-term transcriptional effects. A, oncogenic G<rs proteins maintain in- creased AP1 binding activity. Gel shift as- says were performed using a somatostatin CRE ( / e f t ) or a metallothionein TRE ( r igh t ) oligonucleotide as a probe. The same amount of nuclear extract (10 pg) was used for each binding assay. The dif- ferent cell lines expressed pSV-Neo and pSV-dhfr, pSV-Neo and wild-type Gas ( W t ) , pSV-Nro and Gas R201H. pSV-Neo and Gns Q227L. or pSV-Neo and Ga8 G226A. Cells were grown to 70% conflu- ency and serum-deprived for 48 h, and nuclear extracts were prepared as de- scribed under "Experimental Proce- dures..' The nucleoprotein complexes gen- erated by the CRE were not significantly modified ( f r f l ) . In contrast, AI'l binding activity ( r igh t ) is strongly increased in cells expressing oncogenic Gas (mutanb 201 and 2271.13, cell lines stably express- ing oncogenic Gns display permanently increased CRE- and TRE-driven tran- scription. Transient transfections into PC12 cell lines stably expressing various Grrs proteins ( L G m lines) were performed with a series of CAT reporter genes con- taining dimrrent regulatory sequences (somatostatin CRE (Ik-CRR-) and metal- lothionein TRE Ifk-TRIS- ) ) or promoters (human c-fos lrfos- ), rat cjun (rjctn- I , hu-

(strorn- )). RSV-CAT (RSV-) and pRLCAT2 man junR ( j u n h " , ) or rat stromelysin

( t K - ) served as controls. LGns 227 and LGns 201 evoke sustained transcriptional activities. These values me the average of three experiments, where each transfec- tion was performed in triplicate. Means 2 S.E. (n = 9) are given in parenthrses. As- trrisks indicate p 5 0.05 when compared with LCt I by Student's f test 1. To pool data

the data ohtainrd for each construct from the three independent experiment,

were normalized relative to CAT activity values ohtained in the control cell line (pSV-Neo).

A Som C R E probe Met T R E probe

LCt LCus LC1 LGus

Wt 201 227 226 W t 201 227 226 I I I I 1 I I I I I I I

LGas

LGW 226

B

RSV- strom- jun R- cjun- cfos- tk-777E- tk-CRE- tK-

1 1 1 1

driven gene whose product is believed to be involved in the development and progression of human cancer (44-46). Taken together, these data suggest one possible mechanism by which active Gns may stimulate cell proliferation: namely chronic stimulation of IEGs.

I t would be interesting now to examine the relationship be- tween Gns and the tissue-specific transcription factor Pit-l (for review, see Ref. 50). This latter factor, responsible for the cor- rect expression of a subset of pituitary hormones (51), displays growth promoting activity (52), and moreover, its gene is CAMP-inducible (53). Since most of the human secretory tumors found in the pituitary do express Pit-1, it is likely that Pit-1 is also a target of Gas and thus contributes to cell proliferation.

In summary, we have shown that GTPase-deficient forms of Gns found in human secretory tumors constitutively stimulate

IEGs in endocrine cells, thus supporting their oncogenic poten- tial. These effects are clearly mediated by the cAMI'PKA path- way and are therefore distinct from those exerted by the Ras oncogene.

Arknowledpnents-We are indebtrd to Drs. G. S. McKnight. K. C,. Roeder, R. Prywes, N. Klry. W. Kruijrr. and P. Sassonr-rnrsl for thr generous gifts of recomhinant material.

REFERENCES

2. Hnrhncid. M. f 19x71 Annu. R v c R~~rh~rn. 5fi. ii!l-H27 1. Gi1mnn.A. C . f19R71Annu. Rev. R ~ ~ r h m l . 56, 615-649

3 . IRdwith. R . J . . Mnnnm. S.. Krnvnnk. A . It.. Slchols. \V. W.. and llrndl-y. \f 0

4. Vallnr. I,.. Spndn. A,. nnd (hnnnn t tns~n . C . ( l9R71 Nn'nrrrrr 3.10. 56fL56iH 5 . Lnndis. C.A.. Mnstcrs. S. 13.. S p r ~ f h . A . Pnrr.A, M.. llournr. I 1 It.. find Vnllnr.

6. I,von.s,.J.. Landis C .A. . (hf l i th . I I , Vnllnr. I. .. Crunrwnld. K.. F'rlrhtlnprr. 11 , I,. 119R9)I Nnfurv 340. 692-G)fi

Duh. Q . Y.. (' lnrk. 0. 11.. K n w m n k l . K. Ro~r rn r . 11. I < . , nnd \ f d ' w r n x k . F

1 1 w n l ,w0/. c , ~ / / . nro/. IO. I W - I T , . ~

by guest on July 26, 2019http://w

ww

.jbc.org/D

ownloaded from

c-fos Recruitment by Gas Oncogenes 22671

7. Clementi, E., Malgaretti, N., Meldolesi, J., and Taramelli, R. (1990) Oncogene (1990) Science 249,655-659

8. Suarez, H. G., du Villard, J. A., Caillou, B., Schlumberger, M., Parmentier, C., 5,1059-1061

9. Hagiwara, M., Alberts, A., Brindle, P., Meinkoth, J., Feramisco, J., Deng, T., and Monier, R. (1991) Oncogene 6,677479

Karin, M., Shenolikar, S., and Montminy, M. (1992) Cell 70, 105-113, and references therein

10. Foulkes, N. S., Borrelli, E., and Sassone-Corsi, P. (1991) Cell 64, 739-749 11. Holt, J. T., Gopal, T. V., Moulton, A. D., and Nienhuis, A. W. (1986) Proc. Natl.

12. Rivera, K. M., and Greenberg, M. E. (1990) New Biol. 2, 751-758 Acad. Sci. U . S. A. 83,47944798

13. Treisman, R. (1990) Semin. Cancer Biol. 1,47-58 14. Szeberhyi, J., Cai, H., and Cooper, G. M. (1990) Mol. Cell. Biol. 10, 5324-

15. Sassone-Corsi, P., Der, C. J., and Verma, I. M. (1989) Mol. Cell. Biol. 9,3174-

16. Fisch, T. M., Prywes, R., Simon, M. C., and Roeder, R. G. (1989) Genes & Deu.

17. Sassone-Corsi, P., Visvader, J., Ferland, L., Mellon, P. L., and Verma, I. (1988)

19. Metz, R., and Ziff, E. (1991) Genes & Dew 5, 1754-1766 18. Velcich, A,, and Ziff, E. B. (1990) Mol. Cell. Biol. 10, 62734282

21. Angel, P., Imagawa, M., Chiu, R., Stein, B., Imbra, R. J., Rahmsdorf, H. J., 20. Montminy, M. R., and Bilezikjian, L. M. (1987) Nature 328, 175-178

22. Luckow, B., and Schiitz, G. (1987) Nucleic Acids Res. 15, 5490 23. De Groot, R. P., Pals, C., and Kruijer, W. (1991) Nucleic Acids Res. 19, 1585-

24. Kerr, L. D., Holt, J. T., and Matrisian, L. M. (1988) Science 242, 1424-1427 25. Schutte, J., Viallet, J., Nau, M., Segal, S., Fedorko, J., and Minna, J. (1989)

26. Mercken, L., Moras, V., Tocque, B., and Mayaw, J. F. (1990) Nucleic Acids Res.

27. Zoller, M. J., and Smith, M. (1983) Methods Enzymol. 100, 468-500 28. Yanish-Perron, C., Vieira, J., and Messing, J. (1985) Gene (Amst.) 33,103-119 29. Subrami, S., Mulligan, R., and Berg, P. (1981) Mol. Cell. Biol. 1, 854-864 30. McKnight, G. S., Cadd, G. G., Clegg, C. H., Otten, A. D., and Correll, L. A.

5332, and references therein

3183, and references therein

3,198-211

Genes & Deu. 2, 1529-1538

Jonat, C., Herrlich, P., and Karin, M. (1987) Cell 49, 729-739

1591

Cell 59,987-997

18,662

31. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G . (1983) Nucleic Acids Res. 11,

33. Gorman, C. M., Moffat, L. E , and Howard, B. H. (1982) Mol. Cell. Biol. 9, 32. Loefler, J. P., and Behr, J. P. (1993) Methods Enzymol. 217,599418

34. Cailla, H. L., Racine-Weibuch, M. S., and Delaage, M. A. (1973)Anak Biochem.

35. Montminy, M. R., Sevarino, K. A., Wagner, J. A,, Mandel, G., and Goodman, R.

36. Graziano, M. P., and Gilman, A. G. (1989) J. Biol. Chem. 264, 15475-15482 37. Masters, S. B., Miller, R. T., Chi, M. H., Chang, F. H., Beiderman, B., Lopez, N.

38. Lee, E., Taussig, R., and Gilman, A. G. (1992) J. Biol. Chem. 267,1212-1218 39. Freissmuth, M., Casey, P. J., and Gilman, A. G. (1989) FASEB J. 3,2125-2131 40. Brown, A. M., and Birnbaumer, L. (1990) Annu. Reu. Physiol. 52, 197-213 41. Boutillier,A. L., Sassone-Corsi, P., and Loefler, J. P. (1991)Mol. Endocrinol. 5,

43. Schonthal, A., Buscher, M., Angel, P., Rahmsdorf, H. J., Ponta, H., Hattori, K., 42. Sassone-Corsi, P., Sisson, J. C., and Verma, I. M. (1988) Nature 334, 314-319

44. Ostrowski, L. E., Finch, J., and Bowden, G. T. (1988) Mol. Carcinog. 1, 13-19 45. McDonnell, S. E., Kerr, L. D., and Matrisian, L. M. (1990) Mol. Cell. Biol. 10,

4284-4293 46. Matrisian, L. M., Bowden, G. T., Krieg, P., Furstenberger, G., Briand, J. P.,

Leroy, P., and Breathnach, R. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 9413-9417

(1988) Cold Spring Harbor Symp. Quant. Biol. 63,111-119

1475-1489

1044-1051

56,394407

H. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 66824686

G., and Bourne, H. R. (1989) J. Biol. Chem. 264, 15467-15474

1301-1310

Chiu, R., Karin, M., and Herrlich, P. (1989) Oncogene 4, 629-636

47. McCormick, F. (1989) Nature 340, 678-679 48. Herschman, H. R. (1991) Annu. Reu. Biochem. 60, 281-319 49. Boutillier, A. L., Barthel, F., Roberts, J. L., and Loefler, J. P. (1992) J. Biol.

50. Rosenfeld, M. G. (1991) Genes & Deu. 6,897-907 51. Mangalam, H. J., Albert, V. R., Ingraham, H. A., Kapiloff, M., Wilson, L.,

Nelson, C., Elsholtz, H., and Rosenfeld, M. G. (1989) Genes & Deu. 3, 946958

Chem. 267,23520-23526

52. Castrillo, J. L., Theill, L. E., and Karin, M. (1991) Science 253, 197-199 53. McCormick, A,, Brady, H., Theill, L. E., and Karin, M. (1990) Nature 345,

829-832

by guest on July 26, 2019http://w

ww

.jbc.org/D

ownloaded from

C Gaiddon, A L Boutillier, D Monnier, L Mercken and J P Loeffleractivation of the c-fos proto-oncogene in endocrine cells.

Genomic effects of the putative oncogene G alpha s. Chronic transcriptional

1994, 269:22663-22671.J. Biol. Chem. 

  http://www.jbc.org/content/269/36/22663Access the most updated version of this article at

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/269/36/22663.full.html#ref-list-1

This article cites 0 references, 0 of which can be accessed free at

by guest on July 26, 2019http://w

ww

.jbc.org/D

ownloaded from