THE OF Vol. 32, Issue pp. CHEMlSTRY in U.S.A. by Inc. · ative regulatory elements far upstream of the tran- scription start site of the human parathyroid hormone (hPTH) gene. Transfection

THE JOURNAL OF BIOLOGICAL CHEMlSTRY Vol. 266. No. 32, Issue of November 15, pp. 21903-21910,1991 (c) 1991 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.

(Received for publication, April 2, 1991)

Tomoki OkazakiSQV, Jeffrey D. ZajacSII, Tetsuya Igarashit, Etsuro Ogatat, and Henry M. Kronenberg$ From the $Endocrine Unit, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02238 and the §4th Department of Internal Medicine, University of Tokyo School of Medicine, 3-28-6 Mejirodai Bunkyo-ku, Tokyo 112, Japan

We have identified and characterized a pair of negative regulatory elements far upstream of the transcription start site of the human parathyroid hormone (hPTH) gene. Transfection of various types of cultured cells with a fusion plasmid containing 4.7 kilobase pairs of the 5”flanking portion of the hPTH gene linked to the chloramphenicol acetyltransferase (CAT)- coding sequence generated only 10% of the CAT activity of a plasmid containing 684 base pairs of the 5’- flanking region of the hPTH gene. Deletion analyses reveal that there are at least two separate upstream DNA elements in the hPTH gene responsible for the negative regulation. We find that these cultured cells possess nuclear factors which specifically bind to several short DNA sequences within these elements and that these sequences can suppress transcription of the hPTH gene.

Mammalian gene expression is largely regulated at the transcriptional level by the interaction between cis-acting DNA sequences within individual genes and trans-acting factors in the cells (1). Two classes of DNA elements outside the immediate promoter region have been characterized. En- hancers markedly stimulate transcription from various cellular or viral promoters (2), and silencers, originally reported in the yeast genome (3), inhibit transcription. Silencers have been reported in various genes, such as the rat insulin (4), a- fetoprotein ( 5 ) , growth hormone (6), the mouse renin (7), the human P-globin gene (a), and the chicken lysozyme genes (9). Like enhancers, silencers affect gene transcription independently of their position and orientation. Some of them can suppress gene transcription only in heterologous cells and may, thereby, contribute to the specificity of gene expression in differentiated cells (10). However, mechanisms of such

* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

This work was supported by Grants-In-Aid for Encouragement of Young Scientists from the Ministry of Education, Science and Culture of Japan, by grants from the Sankyo Foundation of Life Science and Toyo Jozo Co. Ltd., and by National Institute of Health Grant DK11794.

The nucleotide sequence($ reported in this paper has been submitted

090463 and 090464. to the GenBankTM/EMBL Data Bank with accession number(s)

ll To whom correspondence and reprint requests should be ad- dressed 4th Dept. of Internal Medicine, University of Tokyo School of Medicine, 3-28-6 Mejirodai Bunkyo-ku, Tokyo 112, Japan.

11 Supported by the Fogarty Foundation, National Institutes of Health. Present address: Dept. of Medicine, Royal Melbourne Hos- pital, Melbourne, Australia.

negative regulation have not been clarified. We previously studied transcription of the human parathy-

roid hormone (hPTH)l gene by transfecting the 5”flanking portion of the human parathyroid hormone (hPTH) gene fused to the neomycin resistance gene into rat pituitary GH4 cells (11). We demonstrated that the region containing 684 bp of the 5”flanking region of the hPTH gene was able to direct correct initiation of the hPTH gene’s transcript and to suppress transcription appropriately in response to adminis- tration of 1,25-dihydroxyvitamin DB (12). This cell system could not be used to analyze regulation of transcription by extracellular calcium (13), because of nonspecific effects of calcium on transcription in GH4 cells (12).

To identify other regulatory elements of the hPTH gene, we have constructed hPTH-chloramphenicol acetyltransferase (CAT) fusion genes incorporating various portions of the hPTH 5”flanking region and examined the activity of these genes, after transient transfection into various types of cultured cells. We report here the identification and character- ization of several DNA sequences between 2.4 and 3.6 kbp upstream of the human PTH gene which bind to nuclear proteins and direct transcriptional inhibition.

MATERIALS AND METHODS Synthetic Oligonucleotides-Oligonucleotides corresponding to

each strand of footprint regions were made by a DNA synthesizer (Biosearch type 8700). Synthetic complementary oligonucleotides were subsequently annealed (14) and used for the gel retardation assay or ligation to construct chimeric plasmids. Composition of each oligonucleotide is as follows. The mutated bases are underlined.

Oligo A: (TATG)CCATTTGTGTATGCAGAA(A)

Oligo A l : (TATG)CCATTCGTGCATGCAGAA(A)

Oligo B: (TATG)TTTTTGAGACAGGGTCTCACTCTG(A)

Oligo B1, (TATG)TTTTTEGCAGGGGTCACTCTG(A)

(AC)GGTAAACACATACGTCTT(TTCGA)

(AC)GGTAAgCACCTACGTCTT(TTCGA)

(AC)AAAAACTCTGTCCCAGAGTGAGAC(TTCGA)

(AC)AAAAAT&CGTCCCSAGTGAGAC(TTCGA)

Bases in the parentheses are NdeI and HindIII cohesive ends to facilitate subsequent ligations. Under “Results” and “Discussion,” only the upper strand of each oligonucleotide is shown.

Plasmid Constructions (Figs. 1, 3, and 9)”To make pc301, an upstream 770-bp BglII fragment in the genomic hPTH plasmid, g108 (11, 12), containing the promoter region as well as the first 86-bp untranslated exon I of the hPTH gene, was cloned to a HindIII site of pSVOCAT (15) by blunt-end ligation using the Klenow fragment of DNA polymerase I and T4 DNA ligase. A plasmid, pc303, was made by ligating the 4.0-kbp HindIII fragment of the 5”flanking region to the unique HindIII site in pc301 using T4 DNA ligase. As a

The abbreviations used are: (h)PTH, (human) parathyroid hormone; CAT, chloramphenicol acetyltransferase; BHK cells, baby hamster kidney cells; tk, thymidine kinase; bp, base pair(s); khp, kilobase pair(s).

21903

21904 Negative Regulatory Elements in the hPTH Gene result, pc303 contains an intact 4.7-kbp upstream portion of the hPTH gene linked to the CAT gene. A HindIII-digested pBR322 (4363 bp) was inserted into the HindIII site of pc301 to make pcpBR4k as a control plasmid of similar size. Another control plasmid was generated by insertion of the 4.0-kbp HindIII fragment from the hPTH gene into the BamHI site of pUTKATl (16), a plasmid in which CAT gene expression is driven by the herpes viral kinase (tk) gene promoter.

The above 4.0-kbp HindIII fragment upstream of the hPTH gene was cleaved with AuaII, and a 1.2-kbp AuaII fragment (A3 to A2 in Fig. 3) was cloned into the larger NdeI-Hind111 fragment of pc301 using the corresponding linkers. The resultant plasmids contain the fragment in either the normal orientation (pcR1) or in the opposite orientation (pcW1). The other three fragments (800 bp, 1500 bp, and 500 bp) generated by Am11 cleavage of the 4.0-kbp HindIII fragment were similarly cloned into the same site in pc301. To localize the negative regulatory elements in the A3 to A2 AuaII fragment, progressively larger deletions were generated by Bal-31 digestion. These fragments were similarly ligated to the NdeI-Hind111 fragment of pc301 to make the pcW and pcR series plasmids. The synthesized oligonucleotides were also inserted into the same sites of pc301. The size of each fragment was determined by agarose gel electrophoresis and, in some cases, by sequence analysis. Three competitor plasmids which do not contain CAT coding sequence were constructed and used in the CAT assay (Fig. 4). The first one was made by cloning the 250-bp insert in pcR9 (Fig. 3) into the unique EcoRV site of pBR322 (pBRR9). The second one was similarly made using the 450- bp insert in pcW9 (pBRW9) (Fig. 3). The last one (pBRNS), a nonspecific competitor, was a pBR322-based plasmid containing the 500-bp AuaII (AB)-HindIII hPTH gene fragment (Fig. 3). The plasmid for making an RNA probe in the RNase protection assay, pSPPTHCAT, was constructed by cloning the EcoRI-Hind111 fragment of pc301 containing the hPTH promoter along with a part of the CAT coding sequence (Fig. 1) into the EcoRI-Hind111 pGEM2 larger fragment (Promega, Madison, WI).

Transfection and CAT Assay-Baby hamster kidney (BHK), Afri- can Green Monkey CV1, and NIH 3T3 cells were grown in Dulbecco’s modified Eagle’s media supplemented with 10% fetal calf serum. 8- 24 pg of each CAT plasmid was introduced into BHK cells which were 70% confluent on the 100-mm2 dish by the calcium phosphate or DEAE-dextran methods (15). Cells were incubated for 16 h, washed, and then further incubated for a total of 40-48 h. The amount of acetylated chloramphenicol (15) was determined to be linearly dependent on the amount of the cellular protein and incubation time. In the CAT assay, 300 pg of protein measured by Bradford’s method (17) were used in each experiment except for the assay in Fig. IA, where 150 pg of protein were used. The reaction was carried out at 37 “C for 2 h. In the case shown in Fig. 3, A or B, average CAT activity was measured by densitometric scanning of the spot for 1- acetyl chloramphenicol after 12 different dishes (100-cm‘) were independently transfected for assessment of each plasmid. In other CAT assay experiments, transfections and CAT assays were repeated three to four times, and typical results are shown in the figures. Competition experiments were carried out by co-transfection of 10 pg of pcR9 (or pcW9) and a 20-fold molar excess of the above- described competitions.

RNase Protection Assay-Total RNA from BHK cells transfected with the hPTH-CAT plasmids was extracted using the guanidinium cesium chloride method (18). 60 pg of total RNA were hybridized with an RNA probe generated by transcription from the SP6 promoter in the plasmid, pSPPTHCAT. Hybridization and RNase digestion were carried out according to the procedures of Melton et al. (19). Digested samples were electrophoresed through an 8 M urea, 6% polyacrylamide gel, and autoradiography was performed.

Gel Retardation Assay-Nuclear extracts were prepared from BHK, CV1, or HeLa cells in the presence of 40 mM KC1 and 5 mM MgCL, according to Dignam et al. (20). The 113-bp probe DNA containing negative regulatory element 2 was obtained from pcR9 by isolating the 250-bp NdeI-Hind111 insert followed by digestion with RsaI and Hinfl (see Fig. 3). The 110-bp probe DNA for negative regulatory element 1 was isolated from pcWl0 by double digestion with NdeI and HindIII. These probe DNAs were end-labeled with [w3’P]dCTP by the Klenow fragment of DNA polymerase I or with [y-32P]ATP by T4 polynucleotide kinase. In each reaction mixture, 6-15 pg of nuclear extract and lo* cpm of each probe (0.5 ng) were incubated in the presence of 2-4 pg of poly(d1-dC). A 20- to 40-fold molar excess of either corresponding nonradiolabeled probe DNA and an unrelated 120-bp Sau3AI DNA fragment from pcR8 (Fig. 3) was added as a

competitor where indicated. After incubation at room temperature for 30 min, the reaction mixtures were directly loaded onto a 4% nondenaturing polyacrylamide gel. The gel was run at 4 V/cm at room temperature, followed by autoradiography at -70 “C (20). When the oligonucleotides were used, they were labeled with T4 polynucleotide kinase and [-y-32P]ATP. A 10-250-fold molar excess of corresponding nonradiolabeled oligonucleotide was used as a competitor.

DNase I Footprinting Assay-The gel retardation assays were carried out as described above except that only one strand of the probe DNA was end-labeled and that the amounts of the probe, nuclear extract, and poly(d1-dC) were increased up to &fold. Specific probes used are indicated in the legend to Fig. 6. Samples were loaded onto the gel after 4 pg/ml of DNase I was included in the reaction mixture for the last 2 min of incubation at room temperature; after electrophoresis, the gel was exposed to x-ray film for 1 h. Both bound and free DNAs were cut and extracted from the wet gel using 10 mM Tris-C1 (pH 7.6), 1 mM EDTA, 300 mM NaCl, and 1% sodium dodecyl sulfate. Then, the supernatant was treated with phenol/chloroform, and DNA was precipitated with ethanol. These samples were subsequently loaded onto 8 M urea, 8% polyacrylamide gel, followed by autoradiography after gel electrophoresis (21, 22).

DNA Sequence Analysis-DNA sequence analyses were carried out by the Maxam-Gilbert method (23).

RESULTS

To explore the function of sequences upstream from the hPTH gene, two plasmids containing such sequences were constructed and transfected into baby hamster kidney (BHK) cells. As shown in Fig. 1, a fusion gene containing 684 bp of the hPTH gene’s 5”flanking region linked to the CAT-coding region (plasmid pc301) directed the production of detectable CAT activity in these cells. However, the inclusion of the additional 4.0-kbp upstream sequence into the plasmid (pc303) substantially decreased CAT activity. Similar results were observed when we used CV1 cells or NIH 3T3 cells (data not shown). Moreover, several different doses of the two plasmids showed less CAT activity generated by use of pc303, even when used in a 1.5-fold molar excess over pc301. To rule out the possibility that larger plasmids are less efficiently expressed in the cells for nonspecific reasons, we inserted the 4363-bp linear pBR322 into the HindIII site of pc301; CAT expression was not inhibited (pcpBR4k, Fig. 1). Furthermore, insertion of the 4.0-kbp fragment into the upstream portion of the herpes thymidine kinase (tk) gene promoter in pUTKATl (14) did not elicit decreased CAT activity (data not shown). This result emphasizes the specificity of the effect seen in pc303 and suggests that the effect requires elements found in the 684-bp region adjacent to the start site of hPTH gene transcription.

A ribonuclease protection assay was then used to characterize the start site of gene transcription. Total RNA from BHK cells transfected with pc301 was extracted and hybridized with an SP6 promoter-driven, radiolabeled RNA probe spanning the expected transcription start site. As shown in Fig. 2, in pc301-transfected BHK cells, CAT gene transcription started at the authentic upstream start sites in the hPTH gene (11, 12). In contrast, RNA from BHK cells transfected by pc303 gave no detectable bands in this assay.

In order to isolate the specific negative regulatory element(s) far upstream of the hPTH gene, we carried out the deletion analyses shown in Fig. 3. We found that the 1.2-kbp AuaII fragment between -2.4 kbp and -3.6 kbp inhibited CAT activity to 16%, when inserted in front of the transcription unit (Fig. 3B, pcRl ) , while the other three products of AuaII/HindIII digestion in the 5”flanking region (Fig. 3) did not shown significant suppression (data not shown). A similar degree of suppression was also seen when the same fragment was inserted in the reverse orientation (Fig. 3A, pc Wl 1. The magnitude of this effect was comparable with that of the plasmid, pc303, containing the 4.0-kbp upstream region.

Negative Regulatory Elements in the hPTH Gene 21905

PC301

pSVOCAT ECORI

/ I I ,

; i /' : hPTR gene

A3"--;:" A 1 A PC303 4700bp

I u r n il B

" - " - - ""._ - - -

8~ 1611g 2411g 8~ 16pg 2 4 ~ - P C 3 O l L " P C 3 0 3 -

FIG. 1. Expression of PTH gene constructs in BHK cells. The upper panel shows the map of two CAT plasmids, pc301 and pc303. The middle panel represents CAT expression in BHK cells transfected with 8, 16, and 24 pg of pc301 (left) and pc303 (right). 150 pg of cellular protein were used in each assay. The lower panel indicates that 20 pg of pcpBR4k, where the 4363-bp pBR322 sequence, instead of the 4.0-kbp upstream sequence of the hPTH gene, was inserted into the pc301, produces similar, or somewhat stronger CAT activity compared to that produced by 10 pg of the pc301; 300 pg of cellular protein were used. In both experiments, three different dishes were independently transfected to perform the CAT assay for each amount of the plasmid. Boxes represent exons I, 11, and 111 of the hPTH gene. H and B denote Hind111 and BglII, respectively. AI , A2, and A3 represent three AuaII sites in the upstream region of the hPTH gene.

To characterize this region further, progressively larger deletions from each end of the region were produced, starting with the two plasmids, pcWl and pcRl (Fig. 3). Fig. 3A shows the results of transfections using deletion plasmids based on pcW1, which contains the inverted insert. These results reveal that sequences within the 110-bp fragment (in pcW10) close to the promoter-proximal AuaII site (A2), designated as element 1, can function as a negative transcriptional element in the opposite orientation. This element also functions in its normal orientation (see the effects of pcR2-R5, Fig. 3B; these plasmids contain element 1 in normal orientation and demonstrate suppression of CAT activity).

The properties of the negative regulation by the upstream

622 527

4 0 4

309

1 2 M FIG. 2. RNase protection assay. Lane I , 60 pg of total cellular

RNA from BHK cells transfected with 10 pg of pc301. Lane 2, 60 pg of total cellular RNA from BHK cells transfected with 20 pg of pc303. Lane M, HpaII-digested pBR322. The size of each fragment is shown on the right side. The arrow indicates a band corresponding to the authentic upstream start site (11, 12).

region of the hPTH gene cannot simply be explained by the presence of this one negative regulator element, however. Fig. 3B shows the effects of several deletions from the A2 site or the promoter-distal AuaII site (A3) in pcR1, in which the 1.2- kbp AuaII fragment was inserted in the normal orientation. The suppression of CAT activity was abolished when deletion, starting at A2, went beyond 1.0 kbp, leaving only the 152-bp fragment from the A3 site (pcR10). These results suggest that there is at least one other negative regulatory element in the 1.2-kbp fragment and that this element, unlike element 1, does not function efficiently in the opposite orientation (see the effects of pcW2-W6, which contain the second element in inverted orientation and do not decrease CAT activity). This hypothesis is supported by the observation that the CAT signal was substantially increased when this negative regulatory fragment in pcR9 was inserted in the opposite orientation (pcRW9, Fig. 3B). A plasmid containing only the 113-bp HinfI -RsaI fragment within pcR9 suppressed CAT expression to 15% in its normal orientation (pcR11); this fragment will be called element 2.

To demonstrate that saturable cellular factors in these cells specifically interact with the negative regulatory elements within the hPTH gene to suppress transcription, competition experiments using excess DNA containing these negative regulatory elements, not linked to the CAT gene, were performed. Fig. 4A demonstrates that the inhibitory activity of element 1 within a 450-bp sequence in the plasmid pcW9 was diminished by a 20-fold molar excess of a pBR322-based competitor plasmid containing the identical 450-bp fragment (pBRW9). Fig. 4C shows the activity of pc301, which contains no negative element, for comparison. The relief of suppression

21906 Negative Regulatory Elements in the hPTH Gene

(A) H A3 A2 A1 H

pcwz

pcw3

pcw4 pcw5

pcW6

pcw7

pcwa

pcw9

pcw10 pcw11

p c 3 0 1

CAT Activity(\) 24 f 4

100 2 6 9 6 * 2

104 f 5

94 f 1

7 5 k 6

21 k 7

20 k 7

1 6 * 2 22 t 3

9 6 I 5 100 2 4

0 EL 1

( 8 ) H A3 A2 A1

I “. I -. -

A3 pcRl 6 c 16 f 3

PCR2 7 20 * 1 pcR3 - 17 * 2

pcR4 - 25 I 4

pcR5 w 25 * 4

1200bp I

pcR6 I 6 l a f 5

PCR7 a 24 k 2 H f A R S DS

pcR8 * * ” I 21 _t 5

pcR9 I-!!@ 2 0 f 4

pcRlO 4 95 f 5

p c R l l “en 15 f 5

pcRW9 ( 8 4 L 2 )

pc301 100 t 4

0 0 EL 2 EL1

FIG. 3. Deletion mapping of negative regulatory elements in the hPTH gene 5’-flanking region. A, inserts in reverse orientation. B, inserts in correct orientation. Each of the deleted fragments shown here was ligated to the larger fragment of NdeI- HindIII-cut pSVOCAT (15, and see “Materials and Methods”). CAT activities, obtained by densitometric scanning of autoradiography, are the means & S.E. of 12 determinations. Results are expressed as a percentage of the CAT expression directed by pc301. Oual shaded area indicates element 1 (ELI) ; diamond-shaded area indicates element 2 (EL2). These experiments were repeated three times, and results similar to those shown here were observed. The human PTH gene is indicated at the top of each deletion series; heavy line is the 5”flanking region with indicated cleavage sites, exons are boxed Roman numerals, introns are thin lines, R, Hf, and D denote one of the RsaI, HinB, and DdeI sites within the inserted sequences. S in pcR8 designates two of the Sau3AI sites in the 1.2-kbp fragment. This 120-bp Sau3AI fragment was used as a control in the gel retardation assay shown in Fig. 5.

was not seen when three control plasmids were used as competitors: pBR322, pBR322 containing element 2 within a 250-bp sequence (pBRRS), or pBR322 containing a 500-bp insert (the HindIII-AuaII fragment from H to A3 at the top of Fig. 3A) (pBRNS). Moreover, the suppression of CAT activity directed by pcR9, which contains element 2 within a 250-bp sequence, was also partially reversed by a 20-fold molar excess of a competitor containing the identical 250-bp fragment (pBRR9, Fig. 4B), but not by the other competitors. In this experiment, we found that even 200 pg of the introduced

DNA did not impair transfection efficiency: co-transfection of CAT plasmids with pBRW9 (Fig. 4A) or with pBRR9 (Fig. 4B) elevated CAT activity driven by pcW9 (Fig. 44) or driven by pcR9 (Fig. 4B), respectively. The resultant CAT activity roughly equaled the CAT activity produced after transfection with 10 pg of the parental pc301 (Fig. 4C). These results suggest that saturable cellular factors bind to elements 1 or 2 to suppress transcription from the hPTH gene promoter.

To identify proteins that bind to elements 1 and 2, we performed gel retardation experiments with nuclear extract from BHK or CV1 cells and either element 1 or 2 as a probe. We found that three retarded bands, B1, B2, and B3, were formed when element 1 (110 bp) was used as a probe (Fig. 5, lunes 1 4 ) , and that three retarded bands, B4, B5 and B6, were formed when element 2 (113 bp) was used as a probe (Fig. 5, lanes 5-8). In each case, the retarded bands were competed out almost completely by a 20-fold molar excess of the corresponding non-radiolabeled probe DNA (Fig. 5, lunes 2 and 6), but not by a 40-fold molar excess of an unrelated DNA fragment (lunes 4 and 8). These results strongly support the hypothesis that saturable nuclear factors in these cells specifically bind to element 1 and element 2.

To determine the DNA sequences responsible for the binding of the nuclear proteins, we exposed the DNA-protein mixtures briefly to DNase I and analyzed the footprints of the retarded bands after electrophoresis (21, 22). We found that several regions in element 1 (Fig. 6A) and one region in element 2 (Fig. 6B) are protected from DNase I digestion. The precise borders of the binding regions are hard to define, because many sites in the free DNA were extremely resistant to DNase I cleavage. These sites were in AT-rich regions of element 1 and in a cluster of 17 thymidines in element 2. The sequence of the most clearly delineated footprint on element 1 is indicated in Fig. 6. The protected region in element 2 consists of 12 palindromic bases in a 15-residue sequence, TGAGA$(AGG)GTCTCA; the three bases in the parentheses were not protecte<d from DNase I digestion.

To identify proteins that bind to the regions in elements 1 and 2 defined by the DNase footprints, we then synthesized the two protected DNA sequences and used each of them as a probe in the gel retardation assay. Crude nuclear extracts were prepared from BHK, CV1, or HeLa cells; use of each extract yielded similar results. Fig. 7 shows that nuclear proteins are capable of binding in a sequence-specific manner to a short DNA fragment (oligo A) containing the protected sequence, TTGTGTATGC, in element 1 as well as to a short DNA fragment (oligo B) containing the sequence, TGAGAYAGG$TCTCA, in element 2. When 12 pg of the nuclear extract were used with the radiolabeled probes, oligo A and B, we found three protein-DNA complexes similar to those in Fig. 5 (Fig. 7A). Again, use of each probe generated similar migration patterns. However, use of 6 pg of the nuclear extract yielded only one band, corresponding to the middle one in Fig. 7A (Fig. 7, B and C, and see “Discussion”). We employed the latter condition in subsequent experiments. With both probes, the protein-DNA binding is sequence- specific: a change of two thymidines in oligo A to two cytosines (oligo AI) or a 5-base change in the palindromic portion of oligo B (oligo B1) yielded oligonucleotides that failed to compete with the parent probes for binding (Fig. 7B).

The similar migration patterns of the oligo A-protein complex and of the oligo B-protein complex suggested that the same proteins might bind each sequence, even though the DNA sequences of oligo A and B are completely different. TO support this hypothesis, we performed cross-competition experiments shown in Fig. 8. Interestingly, not only oligo A but

Negative Regulatory Elements in the hPTH Gene 21907

A ) pcW9 ~ . . . . . - -rT?

C)PC301

FIG. 4. Competition experiments. Ten micrograms of CAT plasmids, pcW9 ( A ) , and pcR9 ( B ) were used as the reporter genes. A 20-fold molar excess of pBR322-based competitor plasmids (pBRW9, pBRR9, and pBRNS), as well as pBR322, were co-transfected as indicated. In C, CAT activities by pc301 are shown as controls. All CAT assays are the results of triplicate transfections.

B3+

B2*

B1*

N u c l e a r Extract " B H K ( 6 w)-

P r o b e L e l e m e n t l -

1 2 3 4

Competitor none

B ) pCR!

Competitor .._..-

5 6 7 8 L B H K ( 6 ug )A

L e l e m e n t 2 - J

FIG. 5. Gel retardation assay demonstrating the presence of nuclear factors that bind to the negative regulatory elements in the hPTH gene. Nuclear extract was prepared from BHK cells according to the method by Dignam et al. (20) in the presence of 40 mM KC1 and 5 mM MgCI2. 10" cpm (0.5 ng) of either a '"P-labeled (with [a-"'P]dCTP by the Klenow fragment of DNA polymerase I) 110-bp NdeI-Hind111 fragment in the proximal element 1 obtained from pcWl0 ( A ) , or a "'P-labeled (with [-p:'2P]ATP by T4 polynucleotide kinase) 113-bp HinfI-RsaI fragment in the distal element 2 obtained from pcR9 ( B ) were used as probes. As competitors, a 20- and 40-fold molar excess of the corresponding non-radiolabeled probes were added to the reaction (lanes 2, 3, 6, and 7). As a nonspecific competitor, a 40-fold molar excess of a 120-bp Sau3AI fragment adjacent to element 2 (see Fig. 3B) was added in lanes 4 and 8. In each reaction, 6 pg of the nuclear extract and 2 pg of poly(d1- dC) were added. The DNA-protein complexes are designated as B1- B3 ( A ) and B4-B6 ( B ) . F indicates free probe.

also oligo B was able to abolish the binding of oligo A to the protein(s) (Fig. 8A). Similarly, oligo A as well as oligo B could compete out the binding of oligo B to the protein(s) (Fig. 8B). These results suggest that the same protein(s) binds oligo A and oligo B.

To examine whether this protein binding is relevant to

transcriptional suppression of the hPTH gene, we transfected CV1 or BHK cells with plasmids containing the hPTH gene promoter fused to the CAT gene in the presence or absence of oligo A and oligo B. Both oligo A (Fig. 9A) and oligo B (Fig. 9B) suppressed CAT expression from the hPTH 684-bp promoter region. However, oligo A1 or B1 (Fig. 7) could not suppress CAT expression (data not shown).

Fig. 10 demonstrates the DNA sequences of element 1 (Fig. 1OA) and 2 (Fig. 10B). Each sequence is presented in the normal orientation found in the hPTH gene. The protected sequences are shown (see the legend).

DISCUSSION

In this study, we have defined two cis-acting negative transcriptional elements between 2.4 and 3.6 kb upstream of the hPTH gene. One region (element 1) functions in both orien- tations, while the other (element 2) functions only in the native orientation. Competition and gel retardation experiments suggest that saturable nuclear factors in BHK, CV1, and HeLa cells interact specifically with these negative regulatory elements in the hPTH gene.

Many groups have identified cis-acting, negative transcriptional elements in mammals (see review, Ref. 10). These have been called silencers when they act in either orientation and at various distances from the transcription start site. Silencer elements in the rat a-fetoprotein, growth hormone, and the mouse T cell receptor genes are reported to suppress promoter-driven transcription of inserted genes only in cells in which the endogenous genes are normally not expressed (5,6, 24). In this regard, the negative regulatory elements we found in the hPTH genomic upstream region suppressed hPTH gene promoter-driven transcription in the non-parathyroid cells used in this study. Our ability to determine the activity of the negative regulatory regions of the hPTH gene in well differentiated parathyroid cells expressing high levels of PTH is limited because of the absence of suitable model systems.

The negative regulatory elements in the hPTH gene share


FIG. 6. DNase I footpr in t ing analysis. DNase I footprints of element 1 ( A ) and element 2 ( E l ) are shown. R1, 19.2, R4, and R5 denote the bound DNA obtained from the gel retardation assay shown in Fig. 5. A minus strand of element 1 labeled at the Hind111 site with [e-'"P]dCTP by the Klenow fragment and a plus strand of element 2 are shown. A Hin f f site in the plus strand of element 2 was labeled with [y-:"P]ATP by T4 polynucleotide kinase. Footprints obtained from bound (represented as RI , R2, R4, and R5) as well as from free DNA are shown. DNA sequences protected from DNase I digestion are indicated on the right side of each gel. A protected sequence shown by thick side- lines in R indicates a palindromic sequence in element 2.

110- y@ ,"

I' c - "

f <' @oligoA

r A

76- E

67-

34-

e l e m e n t 1 ( -1 s t r a n d e l emen t2 ( + ) s t r a n d

oligoA (B)

oligoB (C) FIG. 7. Gel retardation assay with

the synthetic oligonucleotides. A, oligo A from element 1 (left) and B from element 2 (right) were synthesized and used as probes. 12 pg of nuclear extracts obtained from CV 1 cells were used. Oligo A ( R ) and oligo B ( C ) were used as probes. 6 pg of crude nuclear extracts from CV1 cells were used. In both B and C, 10- (lanes 2 and 5 ) , 50- (lanes 3 and 6) and 250-fold (lanes 4 and 7) molar excesses of the corresponding competitors were used. Retarded bands are indicated by arrows.

oligoA oligoB 1 1 1 2 3 4 5 6 7 - "... " -,? 1 2 3 4 5 6 7

(A) oligoA (B) oligoB 1 2 3 4 5 6 7 1 2 3 4 5 6 7

- ; w v -." -w""-P

PC301

FIG. 9. CAT assays using oligo A- and B-derived plasmids. The synthetic oligonucleotides A and R with linkers were inserted in front of the hPTH transcription unit in pc301 (see "Materials and Methods"). These oligonucleotide-inserted PTH-CAT plasmids as well as pc301 were introduced into BHK cells, and CAT assays were carried out. A, transfection with pc301 and oligo A-derived plasmid. R, transfection with pc301 and oligo B-derived plasmid. Typical results after six independent transfections are shown.

"npetitOrS U "oligoA--IL oligoB--] 0 LoligoBJLoligoAJ

FIG. 8. Cross-competition in gel shift assay. Nuclear extract lrom BHK cells was used. In A, oligo A, and in B, oligo B was used as a probe, respectively. In both A and R, 10- (lanes 2 and 51, 50- (lanes 3 and 6 ) , and 250-fold (lanes 4 and 7) molar excesses of the indicated competitors were used. Retarded bands are indicated by arrows.

some characteristics with the reported silencers; they lie far upstream from the start site of the transcript and they function at various positions. On the other hand, unlike other silencers, the negative regulatory elements in the hPTH gene do not function when placed upstream of the heterologous

herpes viral tk gene promoter. One explanation for this phe- nomenon is that the nuclear proteins which bind to the negative regulatory elements in these cells subsequently interact with other proteins bound to the promoter region in the hPTH gene in a cooperative manner to negatively affect


( A ) Element I. normal orientation

6 1 8 1 4

AATCTCTTTA TAAAACCATT TCTCTATCCA

TTACACAAAT ATTTTCCTAA ACACATACGT

101 Ndel (linker st A2 site)

(6) Element 2. normal orientation

H i n f l 2 1 I

4 1

S'CACTCATCAT CCATTTCCCA TTTTCCCTCT CCATCCACAA CCATATACTC AATATTCACT

S'CTCACTACTA CCTAAACCCT AAAACCCACA CGTACGTCTT CCTATATGAC TTATAACTCA

61 81

CTTTTTTTTT TTTTTTTT-ACCCLC

101 Rsa I I

TCACTCTCTC GCCCACCCTC CACTAC 3' - C A A A A A A A A A AAAAAAAAAC TCTCTCCCAC ACTCACACAC CCCCTCCCAC CTCATC 5 '

FIG. 10. DNA sequences of the negative regulatory elements in the hPTH gene. The sequences of two probes used in the gel retardation assay (Fig. 5) are shown. In A, the sequence of the HindIII-NdeI (originally A2 site) fragment in pcW10, containing the proximal element 1, is shown. In B, the sequence of the HinfI -RsaI fragment in pcR9, containing the distal element 2, is shown. In A , the sequence of oligo A is indicated by a solid underline. The 5' end point of the hPTH gene sequence in pcW11, which, unlike pcW10, does not inhibit transcription, is indicated as a vertical arrow (see text). In B , a palindromic sequence shown in the mouse renin negative regulatory region (CGAGAECTGTGTCTCA) (7).

transcription. Another possibility is that the tk gene promoter, which, in these transient transfection systems, is more active than the hPTH gene promoter (not shown), over- whelms the limited number of the nuclear proteins involved in the negative gene regulation described here (25).

Proteins binding to the negative regulatory elements of the hPTH gene were identified in several cell lines by using gel retardation and subsequent DNase I footprinting assays. One of the protected DNA sequences, oligo A, which has not previously been reported as a cis-acting transcriptional regulatory element, was shown to bind to nuclear proteins specifically and to inhibit transcription from the hPTH gene promoter by itself (Fig. 8A). Also, a protected sequence in element 2, oligo B, specifically binds to nuclear proteins and suppresses transcription from the hPTH gene promoter.

This second oligonucleotide is composed of a palindromic sequence, TGAGACAGGGTCTCA, and may, therefore, bind a dimeric nuclear protein (26). The possible binding of multiple proteins is also suggested by the gel retardation assays (Figs. 5 and 7), which revealed several shifted bands. Separate

bands revealed identical protein contact points (BI and B2; B4 and B5, Fig. 6). These results suggest that DNA binding proteins can also contact other proteins to generate multiple bands. Alternatively, protein degradation in the nuclear extracts could generate multiple bands with similar DNA binding properties.

Surprisingly, competition experiments show that oligo A and oligo B bind to the same protein(s). This competition is shown best in Figs. 7B, 7C, and 8, in which only one shifted band is analyzed. When more protein extract is used, however, competition studies show that the upper band in Fig. 7A binds both oligonucleotides as well (data not shown). Competition studies of the lowest band in Fig. 7A are difficult to interpret, because the band migrates too close to the free probe. The ability of one protein complex to bind to two unrelated DNA sequences resembles that of HAP 1 in yeast (27), some of the homeobox-binding proteins in Drosophila (28), and the human @-globin silencing protein (8).

It is somewhat surprising that the palindromic sequence in oligo B does not work as a negative regulatory element when it is placed in the wrong orientation. When 4 thymidines preceding the palindrome in oligo B are removed, this oligonucleotide does not bind to the protein (pcRlO in Fig. 3),* however. It is likely, then, that not only the palindrome but also these thymidine-rich sequences play important roles in negative gene regulation. Analysis of the interaction between the proteins bound to these sequences as well as characteriza- tion of these proteins are now in progress in our laboratory.

Interestingly, the sequence in element 2 (Fig. 10) from 25- 33 and, in the opposite orientation, from 90-82 (overlapping oligo B) resemble the box 1 silencer in the chicken lysozyme gene (ACCCTCTCT) (9, 24) and sequences in the human t- globin silencer region (ACCCTCTTC) (29). Further, a sequence almost identical with the palindromic sequence in oligo B is found within the reported negative regulatory sequences in the mouse renin gene (7). Moreover, the region containing the oligo B-like sequence in the mouse renin gene, like element 2 (containing oligo B) in the hPTH gene, is reported to be functional only in its normal orientation (7). The possible functional relevance of these motifs in the con- text of the PTH gene needs further analysis.

The negative regulatory elements have a number of possible functions. They might provide tissue-specific regulation of the hPTH gene. However, our recent observation that parathyroid nuclear extract possesses similar proteid does not support this hypothesis. Another possibility is that they may be active in all cells; tissue specificity might be conferred only in the presence of other, unidentified cis-acting elements in the hPTH gene. Further, they may play important roles in some regulatory function in parathyroid cells. Parathyroid cells are unusual in their secretory responses to changes in extracellular calcium. In contrast to almost all other cell types, changes in extracellular calcium lead to changes in intracel- lular calcium in parathyroid cells (30, 31). Perhaps, the negative regulatory elements in the hPTH gene are responsible for modulation of transcriptional suppression of the hPTH gene by extracellular calcium (13). Transfection experiments in BHK cells are consistent with such a

in the DDBJ, EMBL, and GenBank Nucleotide Sequence Databases Addendum-The nucleotide sequence data in this paper will appear

under the accession number D90463 for element 1 and D90464 for element 2.

T. Okazaki, J. D. Zajac, T. Igarashi, E. Ogata, and H. M. Kronen-

T. Okazaki, T. Igarashi, and E. Ogata, manuscript submitted for berg, unpublished observations.

publication.


REFERENCES 3.16.11. John Wilev and Sons. New York 1. Mitchell, P. J., and Tjian, R. (1989) Science 2 4 5 , 371-378 2. Maniatis, T., Goodbourn, S., and Fisher, J. A. (1987) Science

3. Brand, A. H., Breeden, L., Abraham, J., Sternglanz, R., and Nasmyth, K. (1985) Cell 41,41-48

4. Laimins, L., Holmgren-Konig, M., and Khoury, G. (1986) Proc. Natl. Acad. Sci. U. S. A. 83,3151-3155

5. Muglia, L., and Rothman-Denes, L. B. (1986) Proc. Natl. Acad. Sci. U. S. A. 83,7653-7657

6. Larsen, P. R., Harney, J. W., and Moore, D. D. (1986) Proc. Natl. Acad. Sci. U. S. A. 83.8283-8287

7. Nakamura, N., Burt, D. W., Paul M., and Dzau, V. J. (1989) Proc. Natl. Acad. Sci. U. S. A. 8 6 , 56-59

8. Berg, P. E., Williams, D. M., Qian, R. L., Cohen, R. B., Cao, S. X., Mittelman, M., and Schechter, R. N. (1989) Nucleic Acids Res. 17,8833-8852

9. Baniahmad, A., Muller, M., Steiner, C., and Renkawitz, R. (1987)

236 , 1237-1244

EMBO J. 6, 2297-2303 10. Levine, M., and Manley, J. (1989) Cell 59,405-408 11. Igarashi, T., Okazaki, T., Potter, H., Gatz, R., and Kronenberg,

H. M. (1986) Mol. Cell Biol. 6 , 1830-1833 12. Okazaki, T., Igarashi, T., and Kronenberg, H. M. (1988) J. Biol.

Chem. 263,2203-2208 13. Yamamoto, M., Igarashi, T., Muramatsu, M. et al. (1989) J. Clin.

Znuest. 8 3 , 1053-1056 14. Struhl, K. (1989) in Current Protocols in Molecular Biology (Au-

subel, F. M., Brent, R., Kingston, R. E., et al. eds) pp. 3.16.1-

15. Gorman,' C. (1985) "in DNA Cloning. A Practical Approach, (Glover, D. M., ed) Vol. 11, pp. 143-190, IRL Press, Washington D. C.

16. Prost, E., and Moore, D. D. (1986) Gene (Amst.) 45, 107-111 17. Bradford, M. (1976) Anal. Biochem. 7 2 , 248-254 18. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter,

W. J. (1979) Biochemistry 18,5294-5299 19. Melton, D. A., Krieg, P. A., Rebagliati, M. R., Maniatis, T., Zinn,

K., and Green, M. R. (1984) Nucleic Acids Res. 12 , 7035-7056 20. Dignam, J., Lebowitz, R., and Roeder, R. (1983) Nucleic Acids

Res. 11, 1475-1488 21. Baniahmad, A,, Steiner, C., Kohne, A. C., and Renkawitz, R.

(1990) Cell 6 1 , 505-514 22. Piette, J., and Yaniv, M. (1986) Nucleic Acids Res. 14,9595-9611 23. Maxam, A. M., and Gilbert, W. (1980) Methods Enzymol. 6 5 ,

24. Winoto, A., and Baltimore, D. (1989) Cell 59, 649-655 25. Kakkis, E., Riggs, K. J., Gillespie, W., and Calame, K. (1989)

Nature 339 , 718-721 26. Jones, N. (1990) Cell 6 1 , 9-11 27. Pfeifer, K., Prezant, T., and Guarente, L. (1987) Cell 49 , 19-27 28. Hayashi, S., and Scott, M. P. (1990) Cell 63,883-894 29. Cao, S. X., Gutman, P. D., Harish, P., Dave, G., and Schechter,

30. Nemeth, E. F., Wallace, J., and Scarpa, A. (1986) J. Biol. Chem.

31. Shoback, D. M., Thatcher, J., Leombruno, R., and Brown, E. M.

499-560

A. N. (1989) Proc. Natl. Acad. Sci. U. S. A. 86,5306-5309

261,2668-2674

(1984) Proc. Natl. Acad. Sci. U. S. A. 81, 3113-3117

Documents

THE OF Vol. 32, Issue pp. CHEMlSTRY in U.S.A. by Inc. · ative regulatory elements far upstream of the tran- scription start site of the human parathyroid hormone (hPTH) gene. Transfection