The K + /H + antiporter LeNHX2 increases salt tolerance by improving K + homeostasis in transgenic tomato

The K+/H+ antiporter LeNHX2 increases salt tolerance byimproving K+ homeostasis in transgenic tomato

RAÚL HUERTAS1,*, LOURDES RUBIO2, OLIVIER CAGNAC1, MARÍA JESÚS GARCÍA-SÁNCHEZ2,JUAN DE DIOS ALCHÉ1, KEES VENEMA1, JOSÉ ANTONIO FERNÁNDEZ2 & MARÍA PILAR RODRÍGUEZ-ROSALES1

1Departamento de Bioquímica, Biología Celular y Molecular de Plantas. Estación Experimental del Zaidín, CSIC, CalleProfesor Albareda, 1, 18008 Granada, Spain and 2Departamento de Biología Vegetal. Facultad de Ciencias. Universidad deMálaga. Málaga, Spain

ABSTRACT

The endosomal LeNHX2 ion transporter exchanges H+ withK+ and, to lesser extent, Na+. Here, we investigated theresponse to NaCl supply and K+ deprivation in transgenictomato (Solanum lycopersicum L.) overexpressing LeNHX2and show that transformed tomato plants grew better insaline conditions than untransformed controls, whereasin the absence of K+ the opposite was found. Analysis ofmineral composition showed a higher K+ content in roots,shoots and xylem sap of transgenic plants and no differencesin Na+ content between transgenic and untransformed plantsgrown either in the presence or the absence of 120 mM NaCl.Transgenic plants showed higher Na+/H+ and, above all,K+/H+ transport activity in root intracellular membranevesicles. Under K+ limiting conditions, transgenic plantsenhanced root expression of the high-affinity K+ uptakesystem HAK5 compared to untransformed controls. Further-more, tomato overexpressing LeNHX2 showed twofoldhigher K+ depletion rates and half cytosolic K+ activity thanuntransformed controls. Under NaCl stress, transgenic plantsshowed higher uptake velocity for K+ and lower cytosolic K+

activity than untransformed plants. These results indicate thefundamental role of K+ homeostasis in the better perform-ance of LeNHX2 overexpressing tomato under NaCl stress.

Key-words: Solanum lycopersicum (tomato); cytosolic K+; K+

uptake; Na+ and K+ homeostasis; salinity tolerance.

INTRODUCTION

A large part of agricultural soils are salt-affected and salinityhas become a problem in modern agriculture worldwide.Much effort has been devoted in the last years to identifygenes that confer salt resistance. It is suggested that plantNa+/H+ antiporters are important factors implicated in NaCltolerance since they provide an efficient mechanism toprevent Na+ toxicity in the cytosol (Munns & Tester 2008).

The transport of Na+ into cell compartments is mediated bycation/H+ antiporters, which are driven by the electrochemi-cal H+ gradient generated by the H+ pumps, H+-ATPase andH+-PPase. Although the activity of plant cation/H+ antiport-ers was demonstrated by Blumwald & Poole (1985) morethan 25 years ago, their molecular characterization was onlypossible after the Arabidopsis genome sequencing. The firstmember of the plant cation/H+ antiporters being cloned wasAtNHX1 (Apse et al. 1999; Gaxiola et al. 1999), which wasshown to catalyze both Na+/H+ and K+/H+ exchange (Venemaet al. 2002). Since then, NHX-type ion transporters have beenfound in a number of plant species including glycophytic andhalophytic species (Rodríguez-Rosales et al. 2009 and refer-ences therein). In a recent review, Bassil, Coku & Blumwald(2012) highlight findings which demonstrate that plant intra-cellular NHX antiporters play roles in growth and develop-ment, including cell expansion, cell volume regulation, ionhomeostasis, osmotic adjustment, pH regulation, vesiculartrafficking, protein processing, flowering and cellular stressresponses.

The involvement of NHX-type transporters in theresponse to salinity has been demonstrated on the basis ofthe better growth of transgenic plants expressing these genesover control plants under salt stress (Rodríguez-Rosales et al.2009 and references therein). However, the mechanismunderlying the enhancement of salinity tolerance in thetransgenic plants is still not clear (Pardo et al. 2006; Munns& Tester 2008). Mineral analysis of plants overexpressingNHXs seems to indicate that a key feature in salinity toler-ance of the transgenic organisms is maintaining a high K+/Na+

ratio through K+ retention rather than Na+ exclusion. In thisrespect, Leidi et al. (2010) showed that salt tolerance oftomato plants expressing Arabidopsis AtNHX1 relies oncytosolic K+ homeostasis rather than on vacuolar Na+ accu-mulation, as was previously hypothesized. Furthermore,expression of AtNHX1 in transgenic tomato was shown toincrease K+ transport to vacuoles and to provoke the activa-tion of high-affinity K+ uptake systems, thus enhancing K+

uptake by roots and increasing K+ content in the plant tissuesand xylem sap (Leidi et al. 2010). More recently, quantifica-tion of vacuolar pH and intravacuolar K+ concentration inArabidopsis nhx1 nhx2 double knockout mutant has shownthat the lack of both antiporters reduces K+ accumulationinto the vacuoles which are more acidic, highlighting the roles

Correspondence: M. P. Rodríguez-Rosales. Tel: +34-958 181600 (Ext310); Fax: +34-958 129600; e-mail [email protected]

*Present address: Centro de Investigaciones Biológicas, ConsejoSuperior de Investigaciones Científicas (CSIC), C/ Ramiro deMaeztu 9, E-28040 Madrid, Spain.The authors have no conflict of interest to declare

Plant, Cell and Environment (2013) doi: 10.1111/pce.12109

bs_bs_banner

© 2013 John Wiley & Sons Ltd 1

of AtNHX1 and AtNHX2 in mediating vacuolar K+/H+

exchange (Bassil et al. 2011; Barragán et al. 2012). Similarly,Liu et al. (2008) demonstrated that the increased salt resist-ance of sugar beet expressing AtNHX3 is related to theimproved K+ homeostasis brought about by expression ofthis gene. In general, the increase of K+ content in largecell compartments such as the vacuole as a result of NHXactivity will in turn increase cell turgor, thus counteractingthe osmotic effect of the high salinity.

Contrary to class I vacuolar NHX antiporters that havesimilar Na+/H+ and K+/H+ exchange activity, the endosomalclass II isoforms studied so far catalyze specific K+/H+

exchange and only minor Na+/H+ exchange, and are thuspotentially even more important for cellular K+ homeostasis(Yokoi et al. 2002; Venema et al. 2003). Cation selectivity isprobably very critical for the NHX proteins in the endomem-brane system since excess loading of Na+ into the Golgi orother compartments may be harmful to plant cells. Theextreme salt sensitivity of the nhx5 nhx6 double mutant ofArabidopsis or mutants defective in Golgi/endosome specificV-ATPases indeed points to an important role of endomem-brane pH/cation homeostasis in salt tolerance (Krebs et al.2010; Bassil et al. 2011). In previous studies, we have identi-fied tomato LeNHX2 as an endosomal class II K+/H+ anti-porter (Venema et al. 2003; Rodríguez-Rosales et al. 2008).More recently, we studied the expression of four LeNHXsisoforms in two tomato species, the wild salt-tolerantSolanum pimpinellifolium and the cultivated salt sensitiveS. lycopersicum cv. Volgogradskij and demonstrated thatplants from both tomato species cultivated in the absence ofNaCl show comparable expression of the LeNHX2 trans-porter in roots, stems, leaves and flowers (Gálvez et al. 2012).Whereas the expression of LeNHX2 in the salt-tolerant wildtomato and the moderately sensitive cultivar Moneymakerwas induced by NaCl, no NaCl-induced changes of LeNHX2expression were observed in the highly salt sensitive cultivarVolgogradskij (Sun et al. 2010; Gálvez et al. 2012), thus sup-porting a role of this transporter as a determinant of NaCltolerance in tomato. Our previous work also indicates thatLeNHX2 affects salt tolerance through regulation of the cel-lular potassium homeostasis (Rodríguez-Rosales et al. 2008).In fact, LeNHX2 expressed in Arabidopsis increases salt tol-erance and K+ but not Na+ content, whereas it reduces plantgrowth at suboptimal K+ concentrations (Rodríguez-Rosaleset al. 2008).

To further investigate how such endosomal K+/H+ exchang-ers can regulate K+ uptake and homeostasis and salt tolerance,in this work, we used an electrophysiological approach toanalyse the effect of Na+ on K+ uptake and cytosolic K+ in rootcells of tomato (S. lycopersicum L.) overexpressing LeNHX2.The results showed that overexpression of LeNHX2 intomato enhanced K+ uptake and improved salt tolerance byincreasing K+ uptake capacity under salinity conditions. Inagreement with previous reports (Rodríguez-Rosales et al.2008; Leidi et al. 2010), results in this work indeed showthat salinity tolerance in plants overexpressing NHX-typetransporters is linked to an improvement of K+ uptake andcompartmentalization.

MATERIAL AND METHODS

Transformation and molecular characterizationof transgenic plants

For stable expression of the LeNHX2 protein in tomato(S. lycopersicum L. cv. MicroTom), the LeNHX2 codingsequence to which the sequence for a C-terminal RGS(H)10tag was added (Venema et al. 2003), was cloned under controlof the 35S promoter in the pCAMBIA1303 plant expressionvector as described (Rodríguez-Rosales et al. 2008). Theplasmid pCAMBIA 1303 carrying the LeNHX2-RGS(H)10fragment was transferred in the LB4404 Agrobacterium tume-faciens strain (Hoekema et al. 1983) and used for tomato coty-ledon transformation as has been described (Ellul et al. 2003).

The presence of the LeNHX2-RGS(H)10 construction inselected tomato transgenic lines was assessed by polymerasechain reaction (PCR) analysis using specific primers toamplify a 468 bp fragment of the hygromicin resistance geneharboured in the plant expression cassette (Forward: 5′-GATGTTGGCGACCTCGTATT -3′, Reverse: 5′- GTGCTTGACATTGGGGAGTT -3′) and DNA obtained fromtomato leaves following a method by Edwards, Johnstone &Thompson (1991). T3 plants homozygous and with a singleinsertion of the transgene were selected on the basis ofSouthern blot and hygromicin resistance segregation analysisof T1, T2 and T3 plants (Supporting Information Fig. S1). ForSouthern blot, 15 mg of total genomic DNA was digested withEcoRI and HindIII (Roche, San Cugat del Valles, Spain),separated by electrophoresis in a 0.8% agarose gel, trans-ferred to a nylon membrane (Hybond-N+, Amersham Bio-sciences, Bath, UK) and hybridized with a radioactive probelabelled with [32P]dCTP using the RediprimeTMII kit (Amer-sham Pharmacia Biotech, Cerdanyola del Valles, Spain)(Sambrook, Fritsch & Maniatis 1989). The DNA probe wasobtained by PCR amplification with the same primers usedfor the PCR analysis.

The levels of LeNHX2 and HAK5 expression were deter-mined by real-time (RT)-PCR. This analysis was performedusing Quantimix Easy Syg Kit (Biotools, Madrid, Spain) andSYBR-Green as fluorescent reporter in a Biorad iCycler.RNA was isolated from roots using the TRI® RNA IsolationReagent (Sigma-Aldrich, St Louis, MO, USA) and thentreated with RNAse-free DNase (Qiagen, Barcelona, Spain),according to the manufacturer’s protocol. First strand cDNAwas synthesized using the transcriptor first strand cDNA syn-thesis kit (Roche). The absence of genomic DNA contami-nation was checked by direct PCR on the isolated RNA.Gene specific primers were designed for a 173 bp fragment ofLeNHX2 (Forward 5′-CCTTTGAGGGGAACAATGG-3′,Reverse 5′-CATCTTCATCTTCGTCTCC-3′) and for a 120bp fragment of LeHAK5 (Forward 5′- GTATGATGTGACCGTGTTACG -3, Reverse 5′- TCAGATCCTGTGATGCAAAGG -3′). The identity of the amplified fragments wasconfirmed by gel electrophoresis and by melting curve analy-sis. Serial dilutions of the cDNA from every sample wereprepared to check the efficiency of the reactions (around95 � 5%). Control reactions without cDNA were done inevery run to check that no unspecific amplification occurred.

2 R. Huertas et al.

© 2013 John Wiley & Sons Ltd, Plant, Cell and Environment

All reactions were performed in triplicate with three differ-ent RNA extracts for each sample. Melt curves of the reac-tion products were generated and fluorescence data werecollected at a temperature above the melting temperature ofnon-specific products. Relative expression data were calcu-lated from the difference in threshold cycle (DCt) betweenthe studied gene (LeNHX2, HAK5) and DNA amplified byprimers specific for a 119 bp fragment of the elongationfactor 1a from tomato: LeEF1a (Forward 5′- GACAGGCGTTCAGGTAAGGA -3′, Reverse 5′- GGGTATTCAGCAAAGGTCTC -3′). The expression level was calculatedfrom 2EXP[DCt (control)- DCt (sample)].

Plant growth conditions and phenotypicevaluation of transgenic plants

Phenotypic analysis of tomato plants overexpressingLeNHX2 was performed in T3 plants from lines L-452 toL-932. Seeds of these plants were germinated on Petri dishesfor 3–4 d over a moisten sterile filter paper, then transferred topolystyrene boxes containing quartz sand, watered for a weekwith one-tenth Hoagland nutrient solution (Hoagland &Arnon 1950) and for the following 2 weeks with a one-fourthdilution of the same solution. These seedlings were finallytransferred to pots for hydroponic cultivation. Typically, eachplant was cultivated in a 3 l pot containing an aerated one-fourth Hoagland nutrient solution for 3 d. For salt treatment120 mm NaCl was added to the nutrient solution for 3 or 40additional days. For K+ starvation, after the initial 3 d ofcultivation in hydroponics, plant roots were rinsed for 20 minin 0.2 mm CaSO4 and then plants were transferred to a nutri-ent solution deprived of K+ for 40 additional days. For thispurpose, the macronutrient composition of the solution wasmodified as follows (mm): 0.26 NaH2PO4, 1.7 Ca(NO3)2, 0.27MgSO4 and 0.28 Mg(NO3)2. Cultivation media was renewedevery 4 d to avoid contamination. Plants were cultivated in agreenhouse with supplemental lighting of 120 mmol s-1 m-2,16 h light per day and temperature controlled to 26 °C. Phe-notypes of transgenic tomato plants were evaluated on fiverandomly selected plants per treatment in terms of freshweight of roots and shoots at the end of the experiment.

Immunocytochemical detection of LeNHX2 intransgenic plants

Roots of L-452 transgenic plants grown hydroponically in120 mm NaCl supplemented solution for 3 d were fixed over-night at 4 °C in a mix of 4% paraformaldehyde and 0.2%glutaraldehyde in 0.1 m phosphate buffer (pH 7.4) and thensubjected to a progressive lowering of temperature (PLT)processing which included dehydration in a graded ethanolseries and embedding in Unicryl (BBInternational Ltd,Cardiff, UK) resin. Polymerization was carried out at -20 °Cunder ultraviolet irradiation for 2 d. Sections (1 mm thick)obtained in a Reichert ultramicrotome were attached toTESPA (3-triethoxysilylpropylamine)-coated slides and usedfor immunohistochemical detection of the His-tag present inthe overexpressed LeNHX2 (Rodríguez-Rosales et al. 2008).

Slides were treated with a blocking solution (1% BSAin phosphate buffered saline; PBS) for 1 h and then incu-bated with a mouse monoclonal antibody raised againstthe RGSH4 epitope (Qiagen) 1:100 in blocking solutionovernight at 4 °C. After extensive washing, sections weretreated in the dark with a goat anti-mouse IgG (H&L),DyLight™ 488 conjugate secondary antibody (Agrisera,Vännäs, Sweden), diluted 1:500 in PBS for 1 h. Slides weremounted using citifluor/glycerol (Agar Scientific, Essex,UK) and observed in a Leica inverted epifluorescencemicroscope DMI600B using the I3 filter set. Images wereobtained with a Leica DFC420C camera.

Negative controls included root sections of the untrans-formed plants treated identically and slides where the incuba-tion with the primary antibody was omitted. For structuralreference,some of the sections were stained with toluidine blueand mounted with MerckoglasTM (Merck, Madrid, Spain).

Determination of ion content

Ion content was measured in roots, shoots and xylem sap ofplants grown in hydroponics for 3 d and treated or not with120 mm NaCl for 3 additional days. Plant roots and shootswere dried for 48 h at 80 °C, milled to powder and digested ina concentrated HNO3:HClO4 (2:1, v/v) solution. The xylemsap was collected as root exudates after decapitation ofshoots of the hydroponically cultivated plants (Navarro et al.2003). Briefly, the plants were decapitated above the roots,leaving the base of the stem, which was sealed with siliconegrease inserted into a tapered plastic tube. The first exudedxylem sap, 10 min after decapitation, was discarded in orderto prevent contamination of xylem sap with content fromdamaged cells or phloem sap. Xylem sap volume thatemerged afterwards was collected during the next 5 min. K+

and Na+ concentrations in digested plant tissues and xylemsap were determined by inductively coupled plasma spec-trometry (Varian ICP 720-ES) at the Instrumentation Serv-ices of EEZ-CSIC.

Membrane isolation and determination of iontransport activities

Endomembrane enriched vesicles were prepared from rootsof tomato plants according to Cheng et al. (2003). For thispurpose, plants were grown in hydroponics for 3 d andtreated or not with 120 mm NaCl for 3 additional days. K+/H+

and Na+/H+ antiporter activity was assayed by monitoring therelaxation of a pre-established DpH gradient created by theaction of the V-ATPase in membrane vesicles after adding tothe assay medium K2SO4 or Na2SO4 to a concentration of50 mm (Rodríguez-Rosales et al. 2008).

K+ depletion experiments

Assays were performed in tomato plants grown for 20 d in aone-fourth Hoagland nutrient solution, as described above.For K+ starvation, plant roots were rinsed for 20 min in 2 mm

LeNHX2 improves K+ homeostasis 3


CaCl2 and then kept in fresh 2 mm CaCl2 solution for 3 d.Untransformed and L-452 transgenic plants were then trans-ferred in groups of three plants (approximately 10 g) to potscontaining 140 mL of a 2 mm CaCl2 solution supplementedwith 500 mm KCl and buffered to pH 6 (10 mm Mes-Bis TrisPropane). Samples of 1 mL were taken from the medium andK+ content in solution was determined by atomic emissionspectrometry in a Perkin-Elmer Analyst 800 spectrometer(Perkin-Elmer, Waltham, MA, USA). K+ depletion rateswere calculated from the reduction in K+ in the solution perg of root fresh weight.

Electrophysiology experiments

Tomato seeds were surface sterilized in 10% commercialbleach and washed several times with distilled water. Steri-lized seeds were transferred to Petri dishes and germinatedover moisten filter paper for 3–4 d. Then, seedlings weregrown hydroponically for 3 d in 2 mm CaCl2; after that, seed-lings were maintained in this medium or transferred to 2 mmCaCl2 supplemented with 50 or 120 mm NaCl for 3 additionaldays. Membrane potentials (Em) were measured in epidermalroot cells of tomato seedlings using microelectrodes asdescribed by Rubio et al. (2004). Cells were impaled in thesame solutions used for growth but buffered at pH 6 with10 mm Mes-Bis Tris Propane. Increasing K+ concentrations(5–1000 mm K+) were added to the assay medium as chloridesalt. Potassium uptake was estimated on the basis of mem-brane potential depolarization in response to the addition ofK+. Depolarization values were fitted to the Michaelis-Menten equation by using a non-linear regression computerprogramme (KaleidaGraph, Synergy Software; http://www.synergy.com).

Cytosolic K+ activities were measured in epidermal rootcells of untransformed and L-452 transformed tomato bydouble-barrelled K+-selective microelectrodes. To avoid theeffect of K+ starvation on cytosolic K+ concentration, aftergermination, seedlings were grown for 3 d in a solution con-taining 2 mm CaCl2 and 0.1 mm KCl and then maintained inthis solution or transferred to the same solution supple-mented with 120 mm NaCl for 3 additional days. The micro-electrodes were filled with a K+-sensor cocktail containingpotassium ionophore I (cocktail B, cat. no. 60398; Fluka,Sigma-Aldrich, http://www.sigmaaldrich.com) dissolved in amixture of polyvinylchloride/tetrahydrofuran (40 mg mL-1)at a ratio 30/70 (v/v) (Mithöfer, Ebel & Felle 2005; Leidi et al.2010). The signals from the K+-selective and voltage barrelswere recorded and simultaneously subtracted by a high-impedance differential amplifier (FD223; World PrecisionInstruments, http://www.wpiinc.com). The difference wascalibrated before and after the experiments with differentKCl solutions (from 1 to 500 mm KCl) maintained at a con-stant ionic strength by the addition of MgCl2 (Walker, Smith& Miller 1995; Carden et al. 2003). K+ activities were calcu-lated using the activity coefficient obtained from Debeye-Hückel equation (Dean 1973). Calibration curves showedslopes around 48 mV/pK.The impalements were stable for atleast 20 min.

Protein quantification

Protein content was determined by the method of Bradford(1976) using 0.1% (v/v) Triton X-100 (Gogstad & Krutsnes1982) and with bovine serum albumin as standard.

Statistics

All data in this report were obtained from at least three inde-pendent experiments with two or three replicates each. For dataanalysed with Student’s t-test the differences between treat-ments were considered as significant when P < 0.05.A two-wayanalysis of variance (ANOVA) analysis was used to comparedifferences between membrane potentials and K+ uptake kinet-ics parameters (Km and Dmax) of untransformed and trans-formed plants in different NaCl treatments.When the treatmentshowed a significant effect, the Tukey (honestly significant dif-ference) test was applied to set all pairwise comparisons

RESULTS

Molecular and phenotypic characterization oftransgenic lines

The cDNA corresponding to LeNHX2 gene (Venema et al.2003) was expressed under the cauliflower mosaic virus 35Sgene promoter in tomato (S. lycopersicum L. cv MicroTom).T3 homozygous plants with a single insertion of the trans-gene were selected on the basis of the hygromicin resistancesegregation and Southern blot analysis (Supporting Informa-tion Fig. S1). From these plants, two independent lines, L-452and L-932, were further characterized. PCR and Southernblot analysis confirmed the presence of one copy of the trans-gene in the two selected lines (Supporting Information Fig.S1). For plants grown under control conditions (one-fourthHoagland nutrient solution), real-time RT-PCR analysisshowed a higher expression level of LeNHX2 in roots of thetwo selected transgenic lines than in those of untransformedcontrols (Fig. 1). Treatment with 120 mm NaCl for 3 dincreased the expression level of LeNHX2 in roots of allplants (Fig. 1). No significant differences in LeNHX2 expres-sion were found between wild type and untransformed plantsused as controls in this study (not shown). Even though thetransgene was constitutively expressed, LeNHX2 transcriptsaccumulated to a much higher level when transgenic lineswere salt stressed, suggesting some kind of transcriptionalcontrol over the transgene in unstressed conditions as previ-ously reported for AtSOS1 (Shi et al. 2002; Chung et al. 2008)and SlSOS2 (Huertas et al. 2012). These results show thatLeNHX2 transcript levels in roots were higher in the selectedtransgenic lines than in untransformed controls both inNaCl-treated and untreated plants.

Plants of lines L-452 and L-932 were used to further char-acterize their phenotypes in response to NaCl stress and K+

deprivation using hydroponic growth-systems, in which themineral composition could be efficiently controlled and theion content of roots could be examined. Tomato plants over-expressing LeNHX2 grew better in the presence of 120 mmNaCl than untransformed controls, as they showed higher

4 R. Huertas et al.


shoot fresh weight (Fig. 2a,b). Under K+ starvation whereasno significant differences were observed in root fresh weight,shoot fresh weight significantly decreased, above all, in thetransformed lines (Fig. 2c,d).

No significant differences in Na+ content between trans-genic and untransformed plants when cultivated either in thepresence or the absence of NaCl were detected (Fig. 3a). Onthe contrary, K+ content was significantly higher in roots andshoots of transgenic plants grown in media with or withoutNaCl (Fig. 3b). In accordance with these results, K+/Na+ ratiowas higher in transgenic than in non-transformed plantsunder all tested experimental conditions (Fig. 3c,d). Further-more, compared to control plants, K+ content was higher inxylem sap of L-452 and L-932 transgenic lines (Fig. 3e).

Cation/proton antiporter activity inendosomal membranes

(K+,Na+)/H+ antiporter activity was assayed in internal mem-brane fractions of untransformed and transgenic plants byfollowing the relaxation of the pH gradient created by theV-type H+-ATPase (Fig. 4). Whereas all plants exhibitedsimilar rates of ATP-dependent H+ transport, calculationsof initial rates of fluorescence relaxation after addition ofK2SO4 or Na2SO4 showed a higher K+/H+ and Na+/H+

exchange activity in plants overexpressing LeNHX2. Treat-ment of plants with 120 mm NaCl for 3 d increased Na+ andK+ transport in the endosomes of control and, above all,transgenic plants (Fig. 4c,d).

K+ uptake

Since L-452 and L-932 plants showed similar phenotypesunder NaCl stress or K+ deficiency, as well as similar ion

contents and K+ transport activity, to further study K+ uptakekinetics only line L-452 was used. Untransformed and L-452transgenic plants grown for 20 d in hydroponic one-fourthHoagland nutrient solution were K+-starved for 3 d in 2 mmCaCl2. K+ uptake was assayed in the same simplified solutioncontaining 500 mm KCl and buffered to pH 6 (10 mm Mes-BisTris Propane) (Fig. 5). Untransformed and transgenic plantsused for these assays showed no differences in root size bothunder K+ sufficient and deficient growth conditions. After 6 hof incubation, external K+ concentration reached much lowervalues in pots containing transgenic plants than in those con-taining untransformed controls (Fig. 5). Therefore, depletionrates calculated within the first 2 h of the experiment weretwofold higher in plants overexpressing LeNHX2 than inuntransformed plants (1.86 � 0.13 vs. 0.89 � 0.06 mmol K+ groot FW-1 h-1; P < 0.05 Student t-test).

To determine K+ uptake kinetics, an electrophysiologicalapproach was also used in K+-starved seedlings grown in2 mm CaCl2. Epidermal root cells of untransformed andL-452 transgenic lines showed similar membrane potentials(Em, Table 1) and the addition of micromolar K+ concentra-tions (5–1000 mm KCl) evoked rapid membrane depolariza-tions in both lines. K+-induced depolarization values showedsaturation kinetics and were fitted to the Michaelis-Mentenmodel (Fig. 6). In the absence of Na+, similar semisaturationconstants (Km around 6 mm K+) were obtained in all plantsanalysed (Table 1). However, a significantly higher value formaximum depolarization (Dmax) was obtained for the trans-genic line, in agreement with the higher K+-depletion ratedetected in this line (Table 1).

Induction of HAK5 expression in plantsoverexpressing LeNHX2

A HAK1 homolog, LeHAK5, has been detected in tomatoand most probably functions as a high-affinity K+ transporter(Nieves-Cordones et al. 2007). LeHAK5 is induced underK+-starvation and its expression pattern parallels the presenceof high-affinity K+ uptake suggesting an important role of thistransporter in K+ acquisition in the micromolar range intomato roots (Nieves-Cordones et al. 2007, 2008). Levels ofLeHAK5 expression were analysed by real-time RT-PCR inroots of LeNHX2 transgenic and untransformed plants. Asshown in Fig. 7, LeHAK5 expression was very low, but detect-able, in roots of tomato plants grown under K+ sufficientconditions, although no differences were observed betweentransformed and untransformed plants. As expected, inK+-starved plants expression of LeHAK5 in roots wasinduced, but especially in plants overexpressing LeNHX2(Fig. 7).The strongest induction was observed in L-452 trans-genic plants, where the relative expression of LeHAK5 wastwofold higher than in untransformed controls (Fig. 7).

Effect of sodium on K+ uptake kinetics in tomatoplants overexpressing LeNHX2

To further investigate the mechanisms underlying theincreased salt tolerance of tomato plants overexpressing

Figure 1. Expression levels of LeNHX2 in roots ofuntransformed (C) and transgenic (L-452 and L-932) tomato.Plants were grown in hydroponics in a one-fourth Hoaglandnutrient solution for 3 d and treated or not with 120 mm NaCl for3 additional days. Data are referred to LeNHX2 transcript level inroots of non-treated untransformed plants, which was designatedas 1. Different letters on top of the bars indicate statisticallydifferent values according to Student’s t-test (P < 0.05).



LeNHX2, electrophysiological experiments were conductedto analyse the effect of Na+ on K+ uptake by root cells.Assayswere performed in K+-starved untransformed and L-452transgenic seedlings grown in hydroponics at different NaClconcentrations (50 and 120 mm NaCl). Membrane potentialsof epidermal root cells were recorded in the same mediumas used for growth buffered to pH 6 (10 mm Mes-Bis TrisPropane). To determine K+ uptake, increasing K+ concentra-tions were added to the assay media. The depolarization ofthe membrane in the presence of Na+ is a feature describedpreviously in some species (Shabala, Shabala & Volkenburgh2003; Shabala et al. 2005). In our case, membrane potentials

showed also more positive values when plants were grownin the presence of 50 mm (around + 20 mV) or 120 mm(between +30 and +40 mV) NaCl, as compared with thevalues obtained in the absence of Na+, but again no significantdifferences were found between membrane potentials fromuntransformed and transgenic lines (Table 1).As observed inthe absence of Na+, at 50 and 120 mm NaCl, micromolar K+

concentrations evoked rapid membrane depolarizations inepidermal root cells from both untransformed and L-452transgenic plants.The depolarizations also showed saturationkinetics and were fitted to the Michaelis-Menten equation(Fig. 8). Contrary to what was observed in the absence of

Figure 2. Effect of NaCl and K+ deprivation on growth of tomato plants overexpressing LeNHX2. (a) Representative image ofuntransformed, L-452 and L-932 plants grown in hydroponics in a one-fourth Hoagland nutrient solution for 3 d and treated or not with120 mm NaCl for 40 additional days. (b) Root and shoot fresh weight of plants grown as indicated in a. (c) Representative image ofuntransformed, L-452 and L-932 plants grown in hydroponics in a one-fourth Hoagland nutrient solution for 3 d followed by 40 additionaldays in the same solution (non-treated) or in a one-fourth modified Hoagland solution without potassium (K+ starvation). (d) Root andshoot fresh weight of plants grown as indicated in c. Different letters on top of the bars indicate statistically different values according toStudent t-test (P < 0.05).

6 R. Huertas et al.


Na+, significant differences in Km and/or maximum depolari-zation values were found between lines when grown undersalinity (Table 1). K+-induced depolarizations were lower inseedlings grown in the presence of NaCl as compared tothose grown in the absence of NaCl. Interestingly, in both 50and 120 mm NaCl treatments, K+-induced depolarizationswere higher in L-452 transgenic than in untransformed plants(Fig. 8a,b), which is coherent with a greater K+ uptake intransgenic root cells. Maximum depolarizations were 2.25-fold higher in L-452 than in untransformed seedlings in the

presence of 50 mm NaCl (Table 1), and this differenceincreased by fourfold in the presence of 120 mm NaCl. Theaffinity for K+ decreased at increasing Na+ concentrations(Table 1). However, K+ affinity was higher in transgenic thanin untransformed seedlings in the presence of 50 mm NaCl,although no significant differences were found at 120 mmNaCl.Together, these results show that the overexpression ofthe LeNHX2 antiporter improves the high-affinity K+ uptakecapacity of epidermal root cells in plants grown in media withNaCl.

Figure 3. Effect of NaCl on Na+ and K+ concentrations of tomato plants overexpressing LeNHX2. Sodium (a) and potassium(b) concentration (mmol g-1 dry weight) in roots and shoots of untransformed, L-452 and L-932 plants grown in hydroponics for 3 d in aone-fourth Hoagland nutrient solution and treated or not with 120 mm NaCl for 3 additional days. K+/Na+ ratio in roots and shoots of plantsgrown in hydroponics in a one-fourth Hoagland nutrient solution for 6 d (c) or for 3 d followed by 3 additional days in the same solutionsupplemented with 120 mm NaCl (d). (e) Potassium concentration (mm) in the xylem sap of control, L-452 and L-932 plants cultivated inhydroponics as in c. Different letters on top of the bars indicate statistically different values according to t-student test (P < 0.05).



Cytosolic K+ activity in NaCl –treated plants

The enhanced K+/H+ antiport activity in endosomes oftomato plants overexpressing LeNHX2 (Fig. 4) could havean effect on the cytosolic K+ pool due to its compartmentali-zation, as has been previously reported in transgenic tomatooverexpressing AtNHX1 (Leidi et al. 2010). To test thishypothesis, double-barrelled K+ -selective microelectrodes

were used to impale epidermal root cells of control and trans-formed plants grown in the absence or in the presence of120 mm NaCl. In both cases, 0.1 mm KCl was added to thegrowth medium to avoid the effects of K+-starvation oncytosolic K+. Cytosolic K+ activities were calculated frommicroelectrode calibration curves (slopes were close to 48mV/pK+). As expected, membrane potential values weremore positive in control and L-452 plant lines grown at

Figure 4. Na+/H+ and K+/H+ antiport activities in root membranes. Na+/H+ (a,c,e) and K+/H+ (b,d,f) exchange in root endosomes ofuntransformed, L-452 and L-932 plants grown in hydroponics in a one-fourth Hoagland nutrient solution for 6 d (a,b) or for 3 d followed by3 additional days in the same solution supplemented with 120 mm NaCl (c,d). One representative experiment of three replicates is shown ina,b,c and d. In (e) and (f) different letters on top of the bars indicate statistically different values according to Student’s t-test (P < 0.05).

8 R. Huertas et al.


0.1 mm KCl (around -150 mV, Fig. 9) than in those grown inthe absence of K+ (Table 1). As described above, no differ-ences were found between the membrane potentials of bothlines in the absence or in the presence of 120 mm NaCl whenusing double-barrelled microelectrodes. In contrast, cytosolic

Figure 5. Time course of K+ withdrawal from hydroponicsolution. Control and L-452 plants grown in a one-fourthHoagland nutrient solution for 20 d were K+ starved for 3 d in asimplified solution containing 2 mm CaCl2. Then, depletionexperiments were performed in the simplified solution containing500 mm KCl and buffered to pH 6 (10 mm Mes-Bis tris propane).K+ concentration in solution was measured in samples taken atdifferent times from pots containing control (•) and L-452transgenic (�) plants. Data are mean � standard deviation (n = 3).

Table 1. Membrane potentials (Em, in mV) and K+ uptakekinetics parameters (Km, in mm; Dmax, maximum depolarization,in mV) of epidermal root cells of untransformed (control) andL-452 transgenic tomato seedlings grown at different NaClconcentrations. Epidermal root cells were impaled in 2 mm CaCl2,10 mm Mes-Bis tris propane, pH 6, plus NaCl as indicated, andsubmitted to increasing micromolar K+ concentrations. K+-inducedmembrane depolarizations were fitted to the Michaelis-Mentenmodel. Values were obtained from five independent experiments.Different letters indicate significant differences for each variable(Two-way analysis of variance, P < 0.05)

Control L-452

- NaCl Em = -208 � 25 mV (a) Em = -202 � 36 mV (a)Km = 6.4 � 0.3 mm (a) Km = 6.2 � 0.3 mm (a)Dmax = 132 � 1.3 mV (a) Dmax = 143 � 2.4 mV(b)

+50 mmNaCl

Em = -173 � 10 mV (a,b) Em = -180 � 15 mV (a,b)Km = 86.9 � 9.7 mm (b) Km = 26.2 � 2.2 mm (c)Dmax= 20 � 0.7 mV (c) Dmax = 45 � 0.9 mV (d)

+120 mmNaCl

Em = -155 � 16 mV (b) Em = -175 � 7 mV (b)Km = 121.3 � 30 mm (d) Km = 135 � 15 mm (d)Dmax = 11 � 0.8 mV (e) Dmax = 40 � 1.3 mV (d)

Figure 6. Membrane potential depolarizations induced byincreasing K+ concentrations in epidermal root cells of control (•)and L-452 transgenic (�) seedlings grown for 6 d in 2 mm CaCl2.Assay solutions consisted of 2 mm CaCl2, pH 6 (10 mm Mes-Bis trispropane). K+ was added as chloride salt. Values were fitted to theMichaelis-Menten model and the calculated kinetics parametersare shown in Table 1. Data are means� standard deviation (n = 5).

Figure 7. Expression levels of HAK5 in roots of control (C) andtransgenic (L-452 and L-932) tomato. Plants were grown inhydroponics for 3 d in a one-fourth Hoagland nutrient solutionand for 10 additional days in the same solution (non-treated) or ina one-fourth modified Hoagland solution without potassium (K+

starvation). Data are referred to HAK5 transcript level in roots ofnon-treated control plants, which was designated as 1. Differentletters on top of the bars indicate statistically different valuesaccording to Student’s t- test (P < 0.05).



K+ was significantly lower in L-452 line than in untrans-formed plants in both treatments (Fig. 9). In fact, in theabsence of sodium, the cytosolic K+ measured in L-452 trans-formed line was 43 � 11 mm K+, around one-half of thatmeasured in untransformed plants (75 � 5 mm K+). Whenboth plant lines were grown in the presence of 120 mm NaCl

the cytosolic K+ activities were slightly lower than in theabsence of sodium. But, again, the cytosolic K+ measured inL-452 transformed plants, 36 � 7 mm K+, was only one-half ofthat detected in control plants, 68 � 7 mm K+. In summary,these results indicate that overexpression of LeNHX2reduces cytosolic K+ in transformed plants under low exter-nal K+ (0.1 mm) both in the absence and in the presence ofsodium.

Cellular location of LeNHX2

Immunolocalization experiments were performed to knowthe cellular location of LeNHX2 in the transgenic plants.Figure 10 shows that His tagged LeNHX2 is localized inparenchymatous cortex cells of the L-452 roots, mainly in theform of discrete fluorescent spots, thus indicating a likelyendosomal location of LeNHX2.Vacuolar localization of thisantiporter was not observed in the transgenic tomato plantsoverexpressing LeNHX2.

DISCUSSION

The endosomal LeNHX2 antiporter is importantfor cellular K+ homeostasis

It was shown, based on analysis of T-DNA mutants, thatvacuolar NHX transporters play a fundamental role in intra-cellular K+ compartmentalization and consequently, in thecellular functions related to this cation (Bassil et al. 2011;Barragán et al. 2012). Despite the possible involvement ofNHX-type transporters in K+ cellular functions, only fewworks have focused on K+ homeostasis in transgenic plantsoverexpressing NHX proteins (Rodríguez-Rosales et al.2008; Leidi et al. 2010). The work by Leidi et al. (2010) dem-onstrated that the class I vacuolar antiporter AtNHX1 over-expressed in tomato regulates K+ concentration in the cytosoland vacuolar compartments. Class II NHX antiporters likeLeNHX2 are more specific K+/H+ antiporters, but based ontheir endosomal localization would not be expected to havethe same impact on Na+ or K+ concentrations. Surprisinglyhowever, we have found that overexpression of the tomatoantiporter LeNHX2 in Arabidopsis also affects K+ contentof the transgenic plants (Rodríguez-Rosales et al. 2008).We have now extended these observations to tomato plantsoverexpressing the LeNHX2 gene, and analysed in moredetail the underlying mechanism by an electrophysiologicalapproach. In the present work, we demonstrate that over-expression of LeNHX2 results in tomato plants that aremore sensitive to K+ deficiency as shown by their shootgrowth compared with untransformed plants cultivated inthe same conditions (Fig. 2). The high sensitivity to K+ defi-ciency observed in Arabidopsis overexpressing LeNHX2(Rodríguez-Rosales et al. 2008), and tomato overexpressingAtNHX1 (Leidi et al. 2010) has been explained on the basisof an increased intracellular K+ compartmentalization at theexpense of cytosolic K+, leading to a severe drop in cytosolicK+ in plants starved from this macronutrient. Indeed, thehigher K+/H+ antiport activity in root endosomes and the

Figure 8. Membrane potential depolarizations induced byincreasing K+ concentrations in epidermal root cells of control (•)and L-452 transgenic (�) seedlings. Plants were grown for 3 d in2 mm CaCl2 and 3 additional days in the presence of 50 mm NaCl(a) or 120 mm NaCl (b). Assay solutions consisted of 2 mm CaCl2,pH 6 (10 mm Mes-Bis tris propane) supplemented with 50 mmNaCl (a) or 120 mm NaCl (b), K+ was added as chloride salt.Values were fitted to Michaelis-Menten model and the calculatedkinetics parameters are shown in Table 1. Data aremeans� standard deviation (n = 5).

10 R. Huertas et al.


lower cytosolic K+ in epidermal root cells of L-452 tomatorelative to control plants (Figs 4 & 9), demonstrates thatK+/H+ exchange activity of LeNHX2 at intracellular mem-branes can affect cytosolic K+. In fact, the decrease incytosolic K+ activity detected in tomato overexpressing the

endosomal LeNHX2 is similar to that observed in tomatooverexpressing the vacuolar AtNHX1, around 50% (Leidiet al. 2010). For this reason, we have cheeked the possibilitythat LeNHX2 overexpression in tomato results in proteinmislocalization to the tonoplast. Immunolocalization experi-ments show that the fluorescence patterns shown byLeNHX2 overexpressing tomato (Fig. 10) are quite similar tothose previously observed in onion epidermis cells tran-siently expressing the transporter (Rodríguez-Rosales et al.2008) and both indicate an endosomal location of theLeNHX2 protein.

It was reported that growth of tomato plants under K+

deficiency provokes an induction of the high-affinity K+

uptake transporter HAK5, promoting K+ uptake by roots torestore cellular K+ homeostasis (Nieves-Cordones et al. 2007;Leidi et al. 2010). In accordance, we found that K+ starvationinduces LeHAK5 expression in roots of tomato, especially inLeNHX2 overexpressing plants (Fig. 7). Under low externalK+ availability, the decrease of cytosolic K+ caused byLeNHX2 overexpression (Fig. 9) could lead to the higherLeHAK5 expression in the transgenic plants relative tountransformed controls (Fig. 7). Interestingly, the enhancedLeHAK5 expression of LeNHX2 overexpressing plantsgrown under K+ limiting conditions is in agreement with theincreased root K+ uptake of the transgenic plants cultivatedunder these conditions (Fig. 5). All these results indicate thatthe activity of LeNHX2 (alone or together with the activityof LeHAK5 under conditions of low external K+) is respon-sible for the higher K+ content found in the plant tissues andxylem sap of the transgenic plants as compared to untrans-formed controls (Fig. 3b,e). Similar results were reported intomato overexpressing AtNHX1 by Leidi et al. (2010), whodemonstrated that transgenic plants accumulate K+ in vacu-oles as a result of AtNHX1 activity. All these results suggestthat both LeNHX2 and AtNHX1 are important for K+ par-tition within the whole plant.

Tomato plants overexpressing LeNHX2 are moretolerant to salinity and accumulate K+

The capacity of plant roots and shoots to retain K+ is knownto affect salinity tolerance (Carden et al. 2003; Chen et al.2005, 2007; Shabala et al. 2006; Shabala & Cuin 2007). In

−200

−150

−100

−50

0

50

0 1 2 3 4

Ele

ctro

de s

igna

l (m

V)

pK

Slope= 47 mV/pK

0

50

100

non-treated

Em ControlEm L-452

aK+c

c

Control

aK+ L-452

−200

−150

−100

−50

0

Mem

brane potential (mV

)

5 min

Cyt

osol

ic K

+ (m

M)

0

50

100

NaCl-treated

Em Control

Em L-452

aK+c Control

aK+c L-452

−200

−150

−100

−50

0

Mem

brane potential (mV

)

5 min

Cyt

osol

ic K

+ (m

M)

Figure 9. Cytosolic K+ activity (mm) of epidermal root cells oftomato. Membrane potentials (Em, mV) and cytosolic K+ activities(aK+c, mm) were simultaneously measured with K+-selectivemicroelectrodes. Arrows indicate the onset of the impalements,solid and doted lines are single (simultaneous) measurements fromuntransformed (control) and L-452 transgenic epidermal root cells,respectively. Control and L-452 transgenic seedlings were grownhydroponically in 2 mm CaCl2 and 0.1 mm KCl (non-treated) or inthe same solution supplemented with 120 mm NaCl for 3 d(NaCl-treated). Assay media were the growth solutions buffered topH 6 (10 mm Mes-Bis tris propane). K+ activities (mm) werecalculated from microelectrodes calibration curves. Traces arerepresentative records of at least three equivalent experiments.A representative calibration curve is also included.



Figure 10. Fluorescence immunolocalization of the histagged LeNHX2 in roots. Transverse sections of Unicryl-embedded roots of theL-452 transgenic (a-e) and the untransformed (control, f) plant lines, grown hydroponically in 120 mm NaCl-supplemented solution for 3 d. aand b: Toluidine blue stained sections at different magnifications. c and d: high magnification images of two seriate sections corresponding toa cortex cell showing intensely labelled spots after immunocytochemistry. e and f: negative controls (primary antibody omitted anduntransformed plant, respectively). Arrows, expression spots; Asterisk, autofluorescence; C, cortex; Cy, cytoplasm; End, endodermis; Exd,exodermis (limits marked by solid blue line); Rd, rhizodermis; VB, vascular bundle (limits marked by dotted white line).



barley (Hordeum vulgare), Carden et al. (2003) found that amore salt-tolerant variety was better at maintaining rootcytosolic K+ in 200 mm NaCl than was the sensitive variety. Inaddition, the more tolerant variety also showed a highervacuolar K+ accumulation by 8-d salt treatment, suggestingthat K+ compartmentalization could be related to salinitytolerance. In Thellungiella salsuginea, a salt-tolerant relativeof Arabidopsis, the ability to retain, or even to increase, shootK+ content under salt stress was found to improve salinitytolerance (Volkov et al. 2004; Wang et al. 2006; Alemán et al.2009). In this work, we show that in tomato, overexpressionof LeNHX2 enhances K+ content and K+/Na+ ratio in rootsand shoots of the transgenic plants as compared to controlplants (Fig. 3b,c,d), which is in agreement with our previousresults in Arabidopsis shoots (Rodríguez-Rosales et al. 2008).This effect of LeNHX2 overexpression on K+ content is likelyrelated to the K+ uptake capacity of the transgenic plants.Salt-treated LeNHX2 overexpressing plants showed no dif-ferences in Na+ content in roots (Arabidopsis and tomato),but decreases (Arabidopsis) or no changes (tomato) of Na+

content in shoots (Rodríguez-Rosales et al. 2008 and Fig. 3a).These results seem to indicate that overexpression ofLeNHX2 in Arabidopsis might be involved in intracellularcompartmentalization of K+ over Na+ in aerial parts of plantswhile in tomato the gene might be involved in the intracel-lular compartmentalization of K+ in all plant organs, thussuggesting a different behaviour of LeNHX2 when it is over-expressed in tomato or Arabidopsis.

Transgenic tomato overexpressing LeNHX2shows more efficient K+ uptake

One unavoidable consequence for plants growing in highconcentration of NaCl is that some Na+ and Cl- ions willenter root cells while some of the root cellular K+ will belost to the external medium. Indeed, the cytosolic K+/Na+

ratio has been repeatedly named as a key determinant ofplant salt tolerance (Shabala & Cuin 2007). Overexpressionof LeNHX2 in tomato results in a significant reduction ofcytosolic K+ in plants grown both in the presence and theabsence of NaCl (Fig. 9). Nevertheless, in contrast to whathas been reported in the literature, that is salt tolerance isnormally associated with higher cytosolic K+, tomato plantsoverexpressing either LeNHX2 (this work) or AtNHX1(Leidi et al. 2010) are more salt tolerant than the untrans-formed plants. In agreement with these results, Barragánet al. (2012) demonstrated that the reduced K+ transportactivity at the tonoplast of Arabidopsis nhx1 nhx2 doublemutants provoked greater K+ retention in the cytosol,which in turn impaired osmoregulation, increased sensi-tivity to NaCl and compromised turgor generation for cellexpansion. All these findings suggest that the role ofNHX transporters on plant salt tolerance could not be asso-ciated to a better regulation of cytosolic K+ concentration.In this sense, our results in tomato plants overexpressingLeNHX2 suggest that salt tolerance is more likely relatedto a higher K+ uptake by roots than to a better cytosolic K+

homeostasis.

Analysis of K+ uptake by electrophysiology showed nodifferences in affinity between transgenic (L-452) anduntransformed plants grown in the absence of Na+ (Table 1,Fig. 6), as indicated by the Km value (around 6 mm), whichwas similar and quite close to that reported previously forthe high-affinity K+ uptake in this tomato cultivar (Km =10.5 � 1.1 mm; Nieves-Cordones et al. 2007). In agreementwith our results, no differences in Km for Rb+ (used as atracer of K+) were reported between wild type and transgenictomato plants overexpressing AtNHX1 (Leidi et al. 2010),although Vmax in AtNHX1 overexpressing tomato was twicethe value of control plants. The electrophysiology experi-ments performed in transgenic L-452 plants showed howevera small, but significant increase in Dmax (Table 1, Fig. 6),which is in agreement with the results of K+ depletion experi-ments (Fig. 5) and confirms a higher K+ uptake capacityof these plants in relation to untransformed controls. Alltogether, our results suggest that plants overexpressingLeNHX2 have more active root high-affinity K+ transportersthan untransformed plants.

LeNHX2 overexpressing plants maintain higherK+ uptake rates in saline conditions

Under NaCl stress cytosolic K+, homeostasis could beachieved by keeping high the K+ uptake capacity of the roots.Our results demonstrate that K+-induced membrane depo-larizations were lower in the presence of Na+ (Fig. 8) both inL-452 and untransformed plants, suggesting a reduced K+

uptake capacity in these conditions, as shown previously indepletion experiments at 50 mm NaCl using the same tomatocultivar (Nieves-Cordones et al. 2007). Interestingly, at50 mm NaCl L-452 plants showed higher affinity for K+ andhigher maximum depolarization than untransformed plants(Table 1), which indicates a higher K+ uptake capacity intransgenic than in untransformed plants. At 120 mm NaCl,both transgenic and untransformed plants showed a similarlow affinity for K+, but maximum depolarization was fourfoldhigher in L-452 transgenic plants (Table 1), indicating again ahigher K+ uptake capacity in the LeNHX2 overexpressingline.

Which transporters are responsible forthe enhanced K+ uptake in LeNHX2overexpressing plants?

Our results show that K+ uptake kinetics are quite different inuntreated and NaCl-treated plants. In tomato plants grown inthe absence of NaCl, LeHAK5 seems to be the transporterresponsible for the higher K+ uptake and content in LeNHX2overexpressing plants. However, since the LeHAK5 K+

transporter is not expressed in tomato plants grown ateither 50 mm NaCl (Nieves-Cordones et al. 2007) or 150 mmNa2SO4 (Leidi et al. 2010), the enhanced potassium uptakecapacity of LeNHX2 transgenic tomato grown in the pres-ence of sodium might depend on transporters other thanLeHAK5, whose activity could also be affected by LeNHX2overexpression. It is possible that the mechanism mediating



K+ uptake at high NaCl could be LKT1, a K+ transport systemrelated to the AKT family expressed in tomato root hairs(Hartje et al. 2000).AKT1 from Arabidopsis was shown to beposttranslational activated by the CBL1/9-CIPK23 complexat low K+ availability (Li et al. 2006; Xu et al. 2006; Cheonget al. 2007). Related to this, the lower cytosolic K+ concentra-tion found in LeNHX2 overexpressing than in untrans-formed plants (Fig. 9) could mean that also in tomato LKT1is responsible for the enhanced K+ uptake of NaCl treatedtransgenic plants through a CBL-CIPK complex homologousto that reported in Arabidopsis.

In roots of Arabidopsis, AKT1 seems to contribute to K+

uptake at intermediate to low apparent affinities (Gierth,Mäser & Schroeder 2005), which are in the same range asthose observed in this study for K+ uptake kinetics in thepresence of NaCl (Fig. 8). In addition, it has been suggestedthat this transport system could provide a backup mechanismfor K+-uptake from micromolar external K+ concentrations,particularly when other depolarizing high-affinity transport-ers are blocked or impaired (Hirsch et al. 1998; Alemán et al.2011). Whereas the presence of high NaCl concentrationstrongly decreases LeHAK5 expression, inhibiting high-affinity K+ uptake by tomato roots (Nieves-Cordones et al.2007; Leidi et al. 2010); the remaining K+ uptake, relatedto inward-rectifier K+ channels is not suppressed by Na+

(Nieves-Cordones et al. 2007), although it seems to exhibit agradual inhibition by increasing Na+ concentrations(Golldack et al. 2003; Zhu 2003). This is similar to our resultsshowing that K+ uptake by roots of salt treated LeNHX2overexpressing tomato is gradually reduced, but not sup-pressed, by increasing NaCl in the growth medium (Fig. 8).Therefore, it is likely that under salinity conditions the higherK+ uptake capacity of tomato overexpressing LeNHX2 rela-tive to untransformed controls (Fig. 8) could rely on a moreactive AKT transporter.

Conclusions

Together, results in this study indicate that increased activityof LeNHX2 in transgenic plants provokes a decrease ofcytosolic K+, which induces K+ uptake by roots, thus explain-ing the higher K+ content in transgenic than in control plantsin all experimental conditions tested. Moreover, overexpres-sion of LeNHX2 inhibits plant growth under K+ deficiencyand modifies K+ uptake kinetics which gives rise to plantswith improved salt tolerance. Our results suggest thatLeNHX2, an endosomal class II NHX transporter, improvesNaCl tolerance by regulating the activities of K+ transportsystems possibly through modulation of cytosolic K+ levels,similar to the situation shown for the vacuolar class I NHXtransporter, AtNHX1 (Leidi et al. 2010).

ACKNOWLEDGMENTS

We thank Dr. José Manuel Pardo for critically reading themanuscript, Mrs María Isabel Gaspar Vidal and ElenaSánchez Romero for technical assistance and the ScientificServices at EEZ-CSIC for plant growth facilities, DNA

sequencing, microscopy use and ICP-OES mineral analysis.This work was supported by ERDF-cofinanced grantsAGR2005-436 from the Consejería de Innovación, Ciencia yEmpresa, Junta de Andalucía, Spain (to JA Fernández andMP Rodríguez-Rosales), BIO2008-01691 and BFU2011-22779 from the Spanish Ministerio de Ciencia e Innovación(to M.P.R-R. and J.D.D.A). R.H. was supported by grantAGR2005-436 and O.C. by Program JAE-Doc from CSICand by grant BIO2008-01691.

REFERENCES

Alemán F., Nieves-Cordones M., Martínez V. & Rubio F. (2009) Differentialregulation of the HAK5 genes encoding the high-affinity K+ transportersof Thellungiella halophila and Arabidopsis thaliana. Environmental andExperimental Botany 65, 263–269.

Alemán F., Nieves-Cordones M., Martínez V. & Rubio F. (2011) Root K+

acquisition in plants: the Arabidopsis thaliana model. Plant and Cell Physi-ology 52, 1603–1612.

Apse M.P., Aharon G.S., Sneddon W.A. & Blumwald E. (1999) Salt toleranceconferred by overexpression of a vacuolar Na+/H+ antiport in Arabidopsis.Science 285, 1256–1258.

Barragán V., Leidi E.O., Andrés Z., Rubio L., De Luca A., Fernández J.A.,Cubero B. & Pardo J.M. (2012) Ion exchangers NHX1 and NHX2 mediateactive potassium uptake into vacuoles to regulate cell turgor and stomatalfunction in Arabidopsis. The Plant Cell 24, 1127–1142.

Bassil E., Tajima H., Liang Y.C., Ohto M.A., Ushijima K., Nakano R., Esumi T.,Coku A., Belmonte M. & Blumwald E. (2011) The Arabidopsis Na+/H+

antiporters NHX1 and NHX2 control vacuolar pH and K+ homeostasis toregulate growth, flower development, and reproduction. The Plant Cell 23,3482–3497.

Bassil E., Coku A. & Blumwald E. (2012) Cellular ion homeostasis: emergingroles of intracellular NHX Na+/H+ antiporters in plant growth and develop-ment. Journal of Experimental Botany 63, 5727–5740.

Blumwald E. & Poole R.J. (1985) Na+/H+ antiport in isolated tonoplast vesiclesfrom storage tissue of Beta vulgaris. Plant Physiology 178, 163–167.

Bradford M.M. (1976) A rapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principle of protein-dyebinding. Analytical Biochemistry 72, 248–254.

Carden D.E., Walker D.J., Flowers T.J. & Miller A.J. (2003) Single-cellmeasurements of the contributions of cytosolic Na+ and K+ to salt tolerance.Plant Physiology 131, 676–683.

Chen Z., Newman I., Zhou M., Mendham N., Zhang G. & Shabala S. (2005)Screening plants for salt tolerance by measuring K+ flux: a case study forbarley. Plant, Cell & Environment 28, 1230–1246.

Chen Z., Zhou M., Newman I., Mendham N., Zhang G. & Shabala S. (2007)Potassium and sodium relations in salinised barley tissues as a basis ofdifferential salt tolerance. Functional Plant Biology 34, 150–162.

Cheng N.H., Pittman J.K., Barkla B.J., Shigaki T. & Hirschi K.D. (2003) TheArabidopsis cax1 mutant exhibits impaired ion homeostasis, development,and hormonal responses and reveals interplay among vacuolar transporters.The Plant Cell 15, 347–364.

Cheong Y.H., Pandey G.K., Grant J.J., Batistic O., Kim B.G., Lee S.C., Kudla J.& Luan S. (2007) Two calcineurin B-like calcium sensors, interacting withprotein kinase CIPK23, regulate leaf transpiration and root potassiumuptake in Arabidopsis. The Plant Journal 52, 223–239.

Chung J.S., Zhu J.K., Bressan R.A., Hasegawa P.M. & Shi H. (2008) Reactiveoxygen species mediate Na+ induced SOS1 mRNA stability in Arabidopsis.The Plant Journal 53, 554–565.

Dean J.A. (1973) Lange’s Handbook of Chemistry. McGraw-Hill BookCompany, New York.

Edwards K., Johnstone C. & Thompson C. (1991) A simple and rapid methodfor the preparation of plant genomic DNA for PCR analysis. Nucleic AcidResearch 19, 1349.

Ellul P., García-Sogo B., Pineda B., Ríos G., Roig L.A. & Moreno V. (2003) Theploidy level of transgenic plants in Agrobacterium-mediated transformationof tomato cotyledons (Lycopersicum esculentum Mill.) is genotype and pro-cedure dependent. Theoretical and Applied Genetics 106, 231–238.

Gálvez F.J., Baghour M., Hao G., Cagnac O., Rodríguez-Rosales M.P. &Venema K. (2012) Expression of LeNHX isoforms in response to salt stress



in salt-sensitive and salt-tolerant tomato species. Plant Physiology and Bio-chemistry 51, 109–115.

Gaxiola R.A., Rao R., Sherman A., Grisafi P., Alper S.L. & Fink G.R. (1999)The Arabidopsis thaliana proton transporters, AtNhx1 and Avp1, can func-tion in cation detoxification in yeast. Proceedings of the National Academy ofSciences of the United States of America 96, 1480–1485.

Gierth M., Mäser P. & Schroeder J.I. (2005) The potassium transporterAtHAK5 functions in K+ deprivation-induced high-affinity K+ uptake andAKT1 K+ channel contribution to K+ uptake kinetics in Arabidopsis roots.Plant Physiology 137, 1105–1114.

Gogstad O.G. & Krutsnes M.G. (1982) Measurements of protein in cellsuspension using the coomassie brilliant blue binding assay. AnalyticalBiochemistry 126, 355–359.

Golldack D., Quigley F., Michalowski C.B., Kamasani U.R. & Bohnert H.J.(2003) Salinity stress-tolerant and -sensitive rice (Oryza sativa L.) regulateAKT1-type potassium channel transcripts differently. Plant MolecularBiology 51, 71–81.

Hartje S., Zimmermann S., Klonus D. & Mueller-Roeber B. (2000) Functionalcharacterisation of LKT1, a K+ uptake channel from tomato root hairs, andcomparison with the closely related potato inwardly rectifying K+ channelSKT1 after expression in Xenopus oocytes. Planta 210, 723–731.

Hirsch R.E., Lewis B.D., Spalding E.P. & Sussman M.R. (1998) A role for theAKT1 potassium channel in plant nutrition. Science 280, 918–921.

Hoagland D.R. & Arnon D.I. (1950) The water culture method for growingplants without soil. California Agricultural Experiment Station Circular 347,1–39.

Hoekema A., Hirsch P.R., Hooykaas P.J.J. & Schilperoort R.A. (1983) Binaryvector strategy based on separation of vir- and T-region of the Agrobacte-rium tumefaciens Ti-plasmid. Nature 303, 179–180.

Huertas R., Olías R., Eljakaoui Z., Gálvez F.J., Li J., Alvarez de Morales P.,Belver A. & Rodríguez-Rosales M.P. (2012) Overexpression of SlSOS2(SlCIPK24) confers salt tolerance to transgenic tomato. Plant, Cell & Envi-ronment 35, 1467–1482.

Krebs M., Beyhl D., Görlich E., Al-Rasheid K.A.S., Marten I., Stierhof Y.-D.,Hedrich R. & Schumacher K. (2010) Arabidopsis V-ATPase activity at thetonoplast is required for efficient nutrient storage but not for sodium accu-mulation. Proceedings of the National Academy of Sciences of the UnitedStates of America 107, 3251–3256.

Leidi E.O., Barragán V., Rubio L., et al. (2010) The AtNHX1 exchanger medi-ates potassium compartmentation in vacuoles of transgenic tomato. ThePlant Journal 61, 495–506.

Li L., Kim B.G., Cheong Y.H., Pandey G.K. & Luan S. (2006) A Ca2+ signallingpathway regulates a K+ channel for low-K response in Arabidopsis. Proceed-ings of the National Academy of Sciences of the United States of America 103,12625–12630.

Liu H., Wang Q.Q., Yu M.M., Zhang Y.Y., Wu Y.B. & Zhang H.X. (2008)Transgenic salt-tolerant sugar beet (Beta vulgaris L.) constitutively express-ing an Arabidopsis thaliana vacuolar Na+/H+ antiporter gene, AtNHX3, accu-mulate more soluble sugar but less salt in storage roots. Plant, Cell &Environment 31, 1325–1334.

Mithöfer A., Ebel J. & Felle H.H. (2005) Cation fluxes cause plasma membranedepolarization involved in beta-glucan elicitor-signaling in soybean roots.Molecular Plant Microbe Interaction 18, 983–990.

Munns R. & Tester M. (2008) Mechanisms of salinity tolerance. Annual Reviewof Plant Biology 59, 651–681.

Navarro J.M., Garrido C., Martínez V. & Carvajal M. (2003) Water relationsand xylem transport of nutrients in pepper plants grown under two differentsalt stress regimes. Plant Growth Regulation 41, 237–245.

Nieves-Cordones M., Martinez-Cordero M.A., Martinez V. & Rubio F. (2007)An NH4+ -sensitive component dominates high-affinity K+ uptake in tomatoplants. Plant Science 172, 273–280.

Nieves-Cordones M., Miller A., Alemán F., Martínez V. & Rubio F. (2008) Aputative role for the plasma membrane potential in the control of theexpression of the gene encoding the tomato high-affinity potassium trans-porter HAK5. Plant Molecular Biology 68, 521–532.

Pardo J.M., Cubero B., Leidi E.O. & Quintero F.J. (2006) Alkali cationexchangers: roles in cellular homeostasis and stress tolerance. Journal ofExperimental Botany 57, 1181–1199.

Rodríguez-Rosales M.P., Jiang X., Gálvez F.J., Aranda M.N., Cubero B. &Venema K. (2008) Overexpression of the tomato K+/H+ antiporter LeNHX2

confers salt tolerance by improving potassium compartmentalization. NewPhytologist 179, 366–377.

Rodríguez-Rosales M.P., Gálvez F.J., Huertas R., Aranda M.N., Baghour M.,Cagnac O. & Venema K. (2009) Plant NHX cation/proton antiporters. PlantSignaling and Behavior 4, 265–276.

Rubio L., Rosado A., Linares-Rueda A., Borsani O., García-Sánchez M.J.,Valpuesta V., Fernández J.A. & Botella M.A. (2004) Regulation of K+ trans-port in tomato roots by the TSS1 locus. Implications in salt tolerance. PlantPhysiology 134, 452–459.

Sambrook J., Fritsch E.F. & Maniatis T. (1989) Molecular Cloning: A Labora-tory Manual 2nd edn, Cold Spring Harbor Laboratory, Cold Spring Harbor,NY.

Shabala L., Cuin T.A., Newman I. & Shabala S. (2005) Salinity-induced ion fluxpatterns from the excised roots of Arabidopsis sos mutants. Planta 222,1041–1050.

Shabala S. & Cuin T.A. (2007) Potassium transport and plant salt tolerance.Physiologia Plantarum 133, 651–669.

Shabala S., Shabala L. & Volkenburgh E. (2003) Effect of calcium on rootdevelopment and root ion fluxes in salinized barley seedlings. FunctionalPlant Biology 30, 507–514.

Shabala S., Demidchik V., Shabala L., Cuin T.A., Smith S.J., Miller A.J., DaviesJ.M. & Newman I.A. (2006) Extracellular Ca2+ ameliorates NaCl-induced K+

loss from Arabidopsis root and leaf cells by controlling plasma membraneK+-permeable channels. Plant Physiology 141, 1653–1665.

Shi H., Quintero F.J., Pardo J.M. & Zhu J.K. (2002) The putative plasmamembrane Na+/H+ antiporter SOS1 controls long-distance Na+ transport inplants. The Plant Cell 14, 465–477.

Sun W., Xu X., Zhu H., Liu A., Liu L., Li J. & Xuejun H. (2010) Comparativetranscriptomic profiling of a salt-tolerant wild tomato species and a salt-sensitive tomato cultivar. Plant and Cell Physiology 51, 997–1006.

Venema K., Quintero F.J., Pardo J.M. & Donaire J.P. (2002) The ArabidopsisNa+/H+ exchanger AtNHX1 catalyzes low affinity Na+ and K+ transport inreconstituted liposomes. Journal of Biological Chemistry 277, 2413–2418.

Venema K., Belver A., Marín-Manzano M.C., Rodríguez-Rosales M.P. &Donaire J.P. (2003) A novel intracellular K+/H+ antiporter related to Na+/H+

antiporters is important for K+ ion homeostasis in plants. Journal of Biologi-cal Chemistry 278, 22453–22459.

Volkov V., Wang B., Dominy P.J., Fricke W. & Amtmann A. (2004) Thel-lungiella halophila, a salt-tolerant relative of Arabidopsis thaliana, possesseseffective mechanisms to discriminate between potassium and sodium. Plant,Cell & Environment 27, 1–14.

Walker D.J., Smith S.J. & Miller A.J. (1995) Simultaneous measurement ofintracellular pH and K+ or NO3- in barley root-cells using triple-barreled,ion-selective microelectrodes. Plant Physiology 108, 743–751.

Wang B., Davenport R.J., Volvok V. & Amtmann A. (2006) Low unidirectionalsodium influx into root cells restricts net sodium accumulation in Thel-lungiella halophila, a salt-tolerant relative of Arabidopsis thaliana. Journal ofExperimental Botany 57, 1161–1170.

Xu J., Li H.D., Chen L.Q., Wang Y., Liu L.L., He L. & Wu W.H. (2006) Aprotein kinase, interacting with two calcineurin B-like proteins, regulates K+

transporter AKT1 in Arabidopsis. Cell 125, 1347–1360.Yokoi S., Quintero F.J., Cubero B., Ruiz M.T., Bressan R.A., Hasegawa P.M. &

Pardo J.M. (2002) Differential expression and function of Arabidopsis thal-iana NHX Na+/H+ antiporters in the salt stress response. The Plant Journal30, 529–539.

Zhu J.-K. (2003) Regulation of ion homeostasis under salt stress. CurrentOpinion in Plant Biology 6, 441–445.

Received 22 August 2012; received in revised form 22 March 2013;accepted for publication 25 March 2013

SUPPORTING INFORMATION

Additional Supporting Information may be found in theonline version of this article at the publisher’s web-site:

Figure S1. Molecular characterization tomato plants overex-pressing LeNHX2.



Documents

The K + /H + antiporter LeNHX2 increases salt tolerance by improving K + homeostasis in transgenic tomato