THE JOURNAL BIOLOGICAL CHEMISTRY OF 86244631, No. of 1993 12, 25

THE JOURNAL OF BIOLOGICAL CHEMISTRY Q 1993 by The American Society for Biochemistry and Molecullu Biology, Inc.

Vol. 268, No. 12, Issue of April 25, pp. 86244631, 1993 Printed in U.S.A.

The Respiratory Burst Oxidase of Human Neutrophils GUANINE NUCLEOTIDES AND ARACHIDONATE REGULATE THE ASSEMBLY OF A MULTICOMPONENT COMPLEX IN A SEMIRECOMBINANT CELL-FREE SYSTEM*

(Received for publication, November 9, 1992)

David J. Uhlinger, Shiv Raj Tyagi, K. Leigh Inge, and J. David LambethS From the Department of Biochemistry, Emory University Medical School, Atlanta, Georgia 30322

We recently characterized a “semirecombinant“ cell- free NADPH-oxidase system, comprised of plasma membrane plus the recombinant cytosolic proteins p47-phox and p67-phox, wherein superoxide generation was activated by an anionic amphiphile plus guanosine 5‘-0-(2-thiotriphosphate) (GTP-yS) (Uhlinger, D. J., Inge, K. L., Kreck, M. L., Tyagi, S. R., Neckelmann, N., and Lambeth, J. D. (1992) Biochem. Biophys. Res. Commun. 186,609-516). Based on preincubation with guanine nucleotides, we show that plasma membrane contains G protein(s) that support oxidase activation at submaximal rates. By varying p47-phox and p67- phox concentrations, kinetic parameters (ECao and Vmm) for each were determined. For both, GTP-yS increased the V,, and decreased the whereas guanosine 5’-0-(2-thiodiphosphate) (GDPDS) pro- duced the opposite effect, consistent with the partici- pation of a G protein in an activation complex containing p47-phox and p67-phox. Using [S6S]methionine- labeled p47-phox and p67-phox, we investigated the association of these components with both normal plasma membranes and chronic granulomatous disease membranes lacking cytochrome base. p47-phox translocation was stimulated by arachidonate but not GTP-yS, was about 60% cytochrome-dependent, and occurred independently of p67-phox. Arachidonate- stimulated translocation of p67-phox required both cytochrome and p47-phox and was enhanced by GTP-yS. The mass of p47-phox and p67-phox which assembled with cytochrome baas indicated a ternary complex with a 1:l:l stoichiometry.

The neutrophil provides the first line of defense against microbial infection. Upon phagocytosis of a microbe, a respiratory burst occurs, initially reducing oxygen to form superoxide, with secondary formation of Hz02, OH’, and other oxygen-derived molecules; together these participate in microbial killing. The superoxide generation is catalyzed by the NADPH oxidase (respiratory burst oxidase). In intact cells, the oxidase activity is latent but can be activated using a variety of stimuli. The biological importance of the NADPH oxidase is emphasized by the genetic condition chronic gran-

* This work was supported by National Institutes of Health Grants AI 22809 and CA 46508. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$To whom correspondence should be addressed. Tel.: 404-727- 5875; Fax: 404-727-2738.

ulatomas disease (CGD),’ wherein victims suffer severe and recurrent infections because of a functionally defective NADPH oxidase.

The NADPH oxidase is a multicomponent enzyme consisting of a plasma membrane-associated b-type cytochrome (cytochrome bSS8) and two cytosolic components, p47-phx and p67-phx. The cytochrome is comprised of two subunits, a 23- kDa protein and a 91-kDa glycoprotein. Both subunits of the cytochrome as well as both of the cytosolic factors have been cloned and sequenced (1-6). The impairment of oxidase function in CGD can be attributed in most or all cases to the absence of one of these four proteins (7), most commonly an X-linked form in which the gene encoding the large cytochrome subunit is absent. A rare autosomal recessive variant lacks the gene encoding the small cytochrome subunit. Both genetic variants result in the same phenotype since in the absence of either subunit, the other is apparently lost (2). In addition, augmentation of superoxide generation by guanine nucleotides (8-10) has suggested a role for a guanine nucleotide regulatory protein (G protein). Several candidate small G proteins (raplA, racl, and rac2), have recently been implicated as oxidase components or as participants in its activation (11-13). raplA (Krev-1) is membrane-bound via a carboxyl-terminal isoprenyl group (14) and has been found in association with isolated cytochrome bSm where it co-migrates on SDS gels with the small cytochrome subunit (15). The cDNAs for racl and rac2 have been recently cloned (16), and the rac proteins have been found in cytosol, apparently in association with rho GDP dissociation inhibitor protein (12, 13). Whether these proteins are also present in membranes remains unclear. The mechanism by which one or more of these G proteins participate in oxidase activation remains unknown.

In addition to these known or suspected components, the oxidase must contain an NADPH binding component/site. This component may be one and the same as a putative FAD- containing component for which there is indirect evidence (for review see Ref. 17). Several candidates for an NADPH binding site/flavoenzyme component have been put forward, but data on this point have been inconclusive. Two recent studies (18, 19) have provided evidence that the cytochrome itself may contain FAD and the NADPH binding site, but another recent study (20) points to a distinct protein that catalyzes the reduction of nitro blue tetrazolium. Whatever the identity, it now seems clear that the NADPH binding site/FAD protein is localized in the plasma membrane and is unlikely to be a cytosolic component (21).

The abbreviations used are: CGD, chronic granulomatous disease; G protein, guanine nucleotide regulatory protein; GTP-& guanosine 5’-0-(3-thiotriphosphate): GDPBS, guanosine 5’-0-(2-thiodiphosphate); PIPES, 1,4-piperazinediethanesulfonic acid.

8624

GTP and Assembly of the Respiratory Burst Oxidase 8625

Evidence for assembly as a mechanism for activation of the oxidase originated from studies in whole cells. Using immunochemical methods, it was shown that a small amount of both p47-phox and p67-phox becomes associated with the plasma membrane upon cellular activation with phorbol esters and that the “translocation” fails to occur when cytochrome b5%-deficient CGD cells are used (22, 23). Using cells from patients with a rare form of CGD lacking p47-phox, p67-phox also fails to become membrane-associated upon cell activation (23). Kinetic approaches have also implicated p47-phox as an early reactant in oxidase activation (24). Results from these studies have led to a model in which p47-phox binds to the cytochrome, and p67-phox becomes associated through its interactions with p47-phox. The precise roles of these proteins in such an activation complex remain unclear, since neither appears to contain a redox-active center.

Cell-free oxidase systems have permitted more extensive characterization of the biochemistry of the oxidase. The orig- inal cell-free systems, reported in the mid 1980s by several groups (25-27), consisted of cytosol and plasma membranes, and activation was achieved with an anionic amphiphile such as arachidonate or SDS. Recombinant forms of both p47- phox and p67-phox have been expressed in bacteria and in a baculovirus/insect cell system (21, 28), and these proteins expressed in the latter system have been shown to be highly active. Two groups recently reported (18, 29) reconstitution of activity using a completely solubilized system consisting of isolated components (recombinant p47-phox, recombinant p67-phox, isolated cytochrome b558, and an isolated fraction containing either rac G protein) in the presence of added FAD. In addition, we have recently reported reconstitution of activity using a “semireconstituted system” using purified recombinant p47-phox and p67-phox plus plasma membrane (21). Although the membrane components in this system are less well defined than in the completely soluble system, this system avoids potential artifactual electron transfers (e.g. see Ref. 30), which reportedly occur with added FAD, and also permits investigations of the assembly mechanism, since the plasma membrane can readily be separated from soluble components. In the present studies utilizing this semirecombinant cell-free system, we investigate the role of the activating factors arachidonate and GTP-yS in regulating the assembly and kinetic properties of the oxidase and provide evidence that an oxidase-associated G protein regulates aspects of oxidase assembly.

EXPERIMENTAL PROCEDURES

Materials-Hespan (6.2% hetastarch in 0.9% NaCl) was obtained from American Hospital Supply Corp. Lymphocyte separation me- dium (6.2% Ficoll, 9.4% sodium diatrizoate) was purchased from Bionetics Laboratory Products. NADPH, cytochrome c (type IV; horse heart), CM-Sepharose (fast-flow), and diisopropylfluorophosphate were obtained from Sigma. The Mono Q cartridge was from Bio-Rad. GDPPS and GTPyS were purchased from Boehringer Mannheim.

Isolation of Human Neutrophils and Preparation of Plasma Mem- branes-Human neutrophils were isolated from peripheral blood from healthy adult donors as described previously (31). Informed consent was obtained from all subjects. Isolated cells were treated with 4 mM diisopropylfluorophosphate, disrupted by nitrogen cavitation, and subjected to centrifugation through sucrose step gradients as described previously (32). The plasma membrane was recovered from the interface between the sucrose layers and was pelleted by centri- fuging at 400,000 X g for 90 min, using a Beckman TL-100 ultracentrifuge. The pellet was resuspended in 50 mM KCI, 1.5 mM NaCl, 5 mM PIPES (pH 7.0), 2.0 mM MgClz, 0.34 M sucrose, and 1 mM EGTA to a concentration of 3-5 mg/ml. These fractions were frozen and stored at -80 ‘C until use. Plasma membranes from individuals with chronic granulomatous disease were the kind gift of Dr. John Cur- nutte, Scripps Research Institute.

Cytochrome bssa Content of Plasma Membrane-The cytochrome content of neutrophil plasma membranes (1.9 mg/ml) was deter-

mined from the oxidized minus dithionite-reduced difference spec- trum utilizing an Aminco DW2000 spectrophotometer using a difference extinction coefficient of 21.6 mM” cm” for 558 minus 540 nm (33). Plasma membranes were found to contain about 0.8 nmol of heme/mg of protein, in the same range as previous reports (0.4-1.4 nmol of heme/mg of protein (33,34)).

Construction of the pCITE Recornbinant Plasmids-The pCITE vector containing the full-length cDNA for p47-phox was described by us previously (35). The cDNA clone that encodes the full-length human p67-phox protein (pBluescript SKp67-phor) was a gift from Drs. Harry L. Malech and Thomas L. Let0 (National Institute of Allergy and Infectious Disease). The pCITE-p67 plasmid was con- structed by ligating the large NcoI-XbaI fragment from the pCITE-1 vector (Novagen, Madison, WI) with a segment of the p67-phox cDNA obtained by polymerase chain reaction. The amino-terminal ampli- mer (CCACJCATGGCCCTGGTGGAGGCCATCAGCCTC) - was designed to anneal to the p67-phox sequence and to introduce an NcoI site (bold with (J) designating the cleavage site of NcoI which contains the ATG initiation codon (underlined). The carboxyl-terminal am- plimer (GACTJCTAGATAGGGCTTCATTTTCTTCAGCTTTG) was designed to anneal to the p67-phox sequence and to introduce an XbaI site (bold, with J designating the XbaI cleavage site).

The polymerase chain reactions were carried out using reagents from an AmpliTaq kit (Perkin-Elmer Cetus Instruments), Taq polymerase (Stratagene, La Jolla, CA) and a Thermal Cycler (Perkin- Elmer Cetus Instruments); the incubation temperatures and times were 94 “C for 1 min, 65 “C for 1 min, and 72 “C for 2.5 min, repeated for 30 cycles. The products from three separate 100-pl reactions were pooled and fractionated by agarose gel electrophoresis. The predom- inant 1.3- and 2.1-kilobase fragments were excised from the gel and electroeluted, and blunt ends were generated using T4 DNA polymerase and dNTP. Because XbaI fails to cleave restriction sites located at the ends of DNA (51, the blunt-ended fragments were self-ligated using ATP and T4 DNA ligase to generate concatamers, which were then cleaved using NcoI and XbaI. The resulting 1.3- and 2.1-kb fragments were gel purified, ligated with the gel-purified NcoI-XbaI fragment of the pCITE vector, and cloned in Escherichia coli DH5a F’ cells (Bethesda Research Laboratories). The recombinant pCITE- p47 and pCITE-P67 clones were identified by colony hybridization and restriction analysis of DNA from minilysates (36,37).

In Vitro Transcription and Translation-Recombinant pCITE-p47 and p67 plasmid DNA were isolated from bacteria grown in a 1-liter culture. The plasmids were purified by CsCl density gradient centrifugation, dialysis against Tris-EDTA buffer, pheno1:chloroform ex- traction, and ethanol precipitation as described (37, 38). Residual RNA was removed by digestion with DNase-free RNase (Boehringer Mannheim). The pCITE-p47 and p67 plasmid DNA was linearized with XbaI, extracted with phenokchloroform, precipitated with ethanol, and resuspended in RNase-free water. These DNA templates were then transcribed in uitro using T7 RNA polymerase (Stratagene) according to the manufacturers’ instructions (Novagen and Strata- gene); the RNase inhibitor RNasin (Promega, Madison, WI) was included. Initially 2 pg of linearized DNA template was employed in 40-pl transcription reactions and diluted 5-fold to 200 pl with RNase- free water. Diluted transcription reactions were either stored at -70 “C in 10-30-pl aliquots or used immediately to program in vitro translation reactions employing 10-pl rabbit reticulocyte lysates (Novagen) and [36S]methionine (15-20 pCi, Du Pont-New England Nuclear) per incubation reaction (25 pl) following the protocol provided by Novagen. The radioactive proteins generated in the in vitro translation reaction were analyzed by SDS-polyacrylamide gel electrophoresis (39) followed by autoradiography of the dried gels and showed a single major radioactive band comprising greater than 90% of the activity. Unincorporated [36S]methionine was removed from the translated p47-phox and p67-phox proteins by fast protein liquid chromatography gel filtration using a Superose 12 HR column (Phar- macia LKB Biotechnology Inc.).

Production of Recombinant Baculouiruses and Purification of Re- combinuntp47-phox andp67-phox-Recombinant baculoviruses containing the cDNAs for human p47-phox and p67-phox were con- structed with the transfer vector pVL1393, and proteins were expressed, identified, and purified as described previously (21). Briefly, column fractions were assayed by dot blots that were probed with rabbit polyclonal antibodies against the cytosolic factors. The purity of immunoreactive fractions was assessed by SDS-polyacrylamide gel electrophoresis and Western blotting. Biological activity of the pro-

8626 GTP and Assembly of the Respiratory Burst Oxidase teins was confirmed by the ability of the purified recombinant p47- p h x to reconstitute oxidase activity in p47-phox-deficient CGD cytosol (a gift of Dr. John Curnutte) and recombinant p67-phz in heat- inactivated normal cytosol (40).

Incubations-Reaction mixtures typically contained 10 pg of plasma membrane, 3 wg of p47-phx, 4 pg of p67-phox, and varying amounts of agonists (e.g. arachidonate, GTPyS, GDPBS) in a total volume of 50 pl. Three 10-111 aliquots of each reaction mixture were transferred to 96-well assay plates (Corning) and preincubated for 5 min at 25 “C. At the end of the preincubation period, NADPH (200 pM), cytochrome c (80 pM), and 240 pl of buffer A (100 mM KCl, 3 mM NaCl, 4 mM M&l2, 1 mM EGTA, and 10 D M PIPES (pH 7.0)) were added to initiate superoxide generation. Superoxide was quan- tified spectrophotometrically at 550 nm by measuring cytochrome e reduction using a thermostatted Molecular Devices Thermomax Ki- netic microplate reader as described previously (32). In parallel sam- ples superoxide dismutase (10 pg) was added to inhibit superoxide- dependent cytochrome c reduction. A difference extinction coefficient a t 550 nm of 21 mM” cm” was used (41). The rate of cytochrome c reduction in the presence of superoxide dismutase was subtracted from that in its absence to calculate superoxide-mediated cytochrome c reduction. For each preparation of plasma membranes, the optimal concentration of arachidonate for activation was determined prior to carrying out experiments.

Translocation of Cytosolic Factors-For our purposes, translocation is operationally defined as stable assocation with the plasma membrane that survives plasma membrane reisolation. Except where indicated otherwise, a 5O-pl incubation mixture included 10 pg of plasma membrane, 3 pg (1.3 p ~ ) of recombinant (baculovirus) p47- phon, 4 pg (1.3 p ~ ) of recombinant (baculovirus) p67-phx, and 2,000- 3,000 cpm of the recombinant [“Slmethionine-labeled p47-phox or p67-phr protein prepared as described (35) and above. The mass of the radiolabeled proteins was negligible compared with the added baculoviral expressed proteins. These components were combined at 4 “C in Beckman microcentrifuge polycarbonate tubes before adding 200-250 p~ arachidonate. The reaction mixtures were incubated at 25 “C for 5 min and layered onto sucrose step gradients (lower 60% and upper 20% (w/v) in buffer A, 0.5 ml each). The reactions were then centrifuged for 15 min at 55,000 rpm (259,000 X g ) in a swinging bucket rotor (TLS-55). The centrifugation was performed at 4 “C using a Beckman TL-100 ultracentrifuge. Immediately following centrifugation approximately 400 p1 was removed from the upper phase, and an equal volume (containing the plasma membrane) was removed from the interface. The remaining lower phase of the gradient was also recovered, and cpm in each fraction were determined by liquid scintillation counting. The data are presented as percent translocation, which is defined as (counts at the gradient interface divided by the sum of the counts in the all phases) X 100. Since the specific activities of the labeled proteins are known, it is straightforward to convert from percent translocation to pmol p47-phon or p67-phx.

Data Analysis-For each rate determination on a given incubation mixture, values for a minimum of three kinetic plots were averaged. A minimum of three separate incubations were then averaged to provide the reported standard errors. Michaelis-Menten kinetic parameters were determined using a nonlinear least squares regression fit of the data, as described previously (42).

RESULTS

GTP+ Can Act at the Level of the Plasma Membrane to Augment Superoxide Generation-Fig. 1 shows the effect of preincubation of either the plasma membranes or the recombinant cytosolic factors with GTPyS prior to initiation of superoxide generation. As can be seen, with increasing incubation times, preincubation of plasma membranes with GTPyS results in increasing levels of activation (upper panel). In contrast, preincubation of the recombinant cytosolic factors with GTPyS prior to the addition of plasma membranes and subsequent activation by arachidonate fails to show significant augmentation of activity. (The small degree of stimulation seen at both 5 and 10 min is that which is expected for exposure of plasma membranes t o the G T P y S during the approximately 30 s of the experimental manipu- lations before measurements can commence).

Preincubation of Plasma Membrane with GDPPS Abolishes

0.1 25 1 1 1 I I I PLASMA MEMBRANES I 0.1 00 t 0.075

0.050

n 5 0.025 0 Y) v) v 0.000 y 0.125 I I I

m Q: er - - g 0.100

p47-phox + p67-phox

rn 4 Q

0.075 - -

TIME (seconds) FIG. 1. Time course of GTP-yS augmentation of superoxide

generation in a semirecombinant cell-free system consisting of plasma membrane and recombinant cytosolic factors. In the upper panel, plasma membrane (10 pg) was preincubated at 25 “C with 10 p~ GTPrS for 0 min (filled circles), 5 min (open circles), or 10 min (open trkngles). In the fatoer panel, recombinant p47-phox (3 pg) plus recombinant p67-phox (4 pg) were preincubated with GTP+ in the same manner. At zero time the remaining components (either recombinant factors or plasma membrane) were added, the reaction was initiated with 200 p~ arachidonate, 200 p~ NADPH, and 80 p~ cytochrome c, as described under “Experimental Procedures,” and superoxide-mediated cytochrome c reduction was monitored at 550 nm. Results shown are representative of four separate experiments done with three separate plasma membrane preparations.

GTPyS Stimulation of Superoxide Generation-The effect of preincubation of plasma membrane with increasing concentrations of GDPpS on superoxide generation in the cell-free system is examined in Fig. 2. The arachidonate-stimulated activity in the absence of guanine nucleotides is shown by the filled square on the ordinate. Plasma membranes were pre- treated with the indicated concentration of GDPpS prior to combining with cytosolic factors, arachidonate, and 10 pM GTPyS; the incubation was then continued for another 5 min prior to initiation of superoxide generation. As shown, pre- treatment with GDPpS inhibits the ability of G T P y S t o augment activity. In the absence of added GTPyS, GDPpS further inhibited the arachidonate-activated superoxide generation (see below), presumably because the observed “basal” activity actually reflects partial activation of the system by endogenous bound GTP. This interpretation is consistent with recent studies showing that the basal activity could be lowered or eliminated by treatments that remove endogenous nucleoside triphosphates (43,44).


- ~~~~

0 ~~ ~~

4 8 12

[GDPPS] rnM FIG. 2. Inhibition of GTP-yS-stimulated superoxide gener-

ation in the cell-free system by GDPBS. Plasma membranes were preincubated at 0 “C with the indicated concentrations of GDPBS for 10 min prior to the assays. Plasma membranes, recombinant cytosolic proteins, and 10 p~ GTPyS were then combined, and the preincubation was continued for an additional 5 min at 25 “C prior to initiating the assay by the addition of NADPH and cytochrome c. The filled circles denote the activities observed in response to increasing concentrations of GDPBS, and the filled square represents the activity observed with arachidonate alone. The results shown are representative of three separate experiments done with two different plasma membrane preparations.

Effects of Guanine Nucleotides on the Kinetic Parameters of the Respiratory Burst Oxidase-We reported previously (21) that with a fixed concentration of the partner protein and using both arachidonate and GTPyS in the superoxide generation assay, p47-phox and p67-phox both exhibit saturation behavior consistent with a high affinity activation complex. In the present studies, we have investigated the roles of added guanine nucleotides on the saturation kinetics of both p47- phox and p67-phox. Fig. 3 shows the effect of varying the concentration of recombinant p47-phox while holding p67- phox constant in the presence of GTPyS, GDPPS, or no added nucleotide. Lines shown are theoretical fits of the Michaelis-Menten equation from which EC, (or K,) and V,, values are obtained; values are summarized at the right side of the figure. In each case, simple saturation behavior is observed. GTP+ lowered and GDPBS increased the ECso value over that seen with no additions, and values spanned a 9-fold range. Vmax values were similarly stimulated by GTPyS and inhibited by GDPPS, spanning a 6-fold range. We pre- sume that the intermediate value seen with no additions reflects a partial activation by endogenous GTP. The effect of varying the concentration of p67-phox while holding p47- phox constant is examined in Fig. 4. The results are qualita- tively the same as when p47-phox was varied. GTPyS versus GDPPS caused a roughly 6-fold change in both ECso and Vmax values. A likely interpretation for the data in Figs. 3 and 4 is that an endogenous G protein is associated with the oxidase and that guanine nucleotide-induced conformational changes affect molecular interactions of p47-phox and p67-phox with or within an activation complex.

Regulation of p47-phox and p67-phox Translocation by Gua- nine Nucleotides and Arachidonute-The interpretation of kinetic parameters in a multicomponent system can be com-

plex, potentially reflecting protein-protein or protein-membrane interactions among multiple components and at any of several steps in a catalytic or regulatory cycle. To determine directly whether guanine nucleotides or arachidonate alters the physical association of p47-phox or p67-phox with the cytochrome, we investigated the interaction of these soluble factors with the plasma membrane. We reported previously the use of a pCITE vector system to express 35S-radiolabeled p47-phox in a rabbit reticulocyte lysate system (35; see “Dis- cussion’’). In these earlier studies, 35S-radiolabeled p47-phox was first added to cytosol. The anionic amphiphile SDS as well as other activating factors were found to increase the association of p47-phox with the plasma membrane, but a high background of nonspecific associations and/or aggrega- tion complicated the demonstration of specific binding of this protein to cytochrome bsS8. The present studies differ in several technical aspects from these earlier studies. First, the present studies did not contain cytosol. In addition, arachidonate rather than SDS has been used as an agonist, and a discontinuous sucrose gradient has been used to separate the plasma membrane from any nonspecific soluble aggregates that may be formed. As shown below, these changes now permit the demonstration of specific associations with the membrane. By including known mass of baculoviral expressed (unlabeled) carrier protein with the labeled protein to give a known specific activity, it becomes straightforward to convert from percent translocation into mass.

Table I shows translocation data for p47-phon. Assembly occurred in response to arachidonate, but there was little or no effect of added GDPBS or GTPyS, either in the presence or absence of arachidonate. Arachidonate alone elicits translocation of about 20% of the labeled p47-phox corresponding to about 14 pmol. Surprisingly, this was almost twice the heme content of cytochrome bssS in these membranes (8.6 pmol).

Data for translocation of p67-phox are shown in Table 11. As with p47-phox, maximal translocation was observed in the presence of arachidonate, and little or no significant translocation was observed in its absence. Unlike p47-phox, however, p67-phox translocation responded to guanine nucleotides, with GTPyS stimulating and GDPpS inhibiting the protein- membrane interaction. The maximal translocation with both activators present was 6.2 pmol, nearly the same as the cytochrome bS58 content in the membranes.

Dependence of p67-phox Translocation on p47-phox-

TABLE I Effect of guanine nucleotides and arachidonic acid on the

translocation of recombinant p47-phox to neutrophil plasma membranes

Translocation experiments were carried out as described under “Experimental Procedures” in a total volume of 50 p1 containing 10 pg of plasma membrane (8.6 pmol of cytochrome bES8) and 1.3 a WM concentration each of recombinant p47-phox and p67-phox. Concen- trations of agonists were: 250 pM arachidonate, 10 p~ GTPyS, 1 mM GDPBS. Basal translocation in the absence of agonist ranged from 14 to 17% in various experiments and in each case was subtracted from translocation in the presence of agonists. Values shown are the average and standard error or range of two to four replicate incubations in an experiment that is representative of three.

Agonist added Translocation

76 pmol None GDPBS

0 0

GTPyS 2.1 It 2.0 1.3

ArachidonatelGDPPS 3.8 * 0.9 2.5

20.1 * 0.2 13.5 Arachidonate ArachidonatelGTPyS

21.5 It 1.2 14.4 20.5 & 0.6 13.7

8628 GTP and Assembly of the Respiratory Burst Oxidase

NUCLEO- TlDE ECw hM1 Vmax

0 + GTPys 1.1 371

8 NONE 6.3 251

A + GDPpS 9.9 66 L

I I I 0 5 10 15 20 25 30

[p47-ph0~] pM FIG. 3. Effects of guanine nucleotides on the kinetic parameters of the respiratory burst oxidase with respect to p47-phox.

The reaction mixtures consisted of 10 pg of plasma membrane, 4 pg (1.3 pM) of p67-phor, and varying amounts of p47-phor ranging from 0.2 to 48 pg. Guanine nucleotide and arachidonate were added 5 min prior to initiating the assay with NADPH and cytochrome c. GTPrS, GDPPS, or no nucleotide were included as indicated. Data points represent the mean of three determinations obtained in one experiment. Similar results were obtained in four separate experiments using two different plasma membrane preparations.

- c E 3 300 z h

K

t

01 I

NUCLEO-

x + GTPys 0.7 322 0

flDE - 0

NONE 2.9 271

- A + GDPpS 4.4 a

I I I I I I

2 4 6 8 10 12 14 16

[p67”phox] pM

60

FIG. 4. Effects of guanine nucleotides on the kinetic parameters of the respiratory burst oxidase with respect to p67-phox. The reaction mixtures consisted of 10 pg of plasma membrane, 3 pg (1.3 p ~ ) of p47-phox, and varying amounts of p67-phow ranging from 0.2 to 62 pg. Guanine nucleotide and arachidonate were added 5 min prior to initiating the assay with NADPH and cytochrome c. GTPyS, GDPpS, or no nucleotide were included as indicated. Data points represent mean of three determinations obtained in one experiment. Similar results were obtained in four separate experiments using two different plasma membrane preparations.

Translocation experiments for each cytosolic factor were carried out in the presence and absence of the other soluble factor (Table 111). As shown, p47-phox translocation occurred equally well whether or not p67-phox was present. In contrast, p67-phox translocation was a t least partially dependent upon the presence of p47-phox. One interpretation for these data is that p47-phox associates directly or indirectly with the cytochrome and that p67-phox then binds to a region on the p47- phox. This does not eliminate the possibility that other binding determinants are provided by the cytochrome or the putative G protein, as is consistent with the small degree of translocation seen in the absence of p47-phox.

Cytochrome b5% Requirements for p47-phox and p67-phon Translocation-To test whether cytochrome b5% was required

for membrane association of the cytosolic factors in the cell- free system, plasma membranes from normal uersus cytochrome-deficient CGD cells were used as shown in Table IV. In the case of p67-phox, most if not all of the translocation required the cytochrome. In contrast, only about half of the p47-phox translocation was found to be cytochrome-specific. In this experiment, out of a total of 15-16 pmol of p47-phox which became membrane-associated, about 9 pmol were found to require the cytochrome, a value that was similar to the quantity of p67-phox translocated. Since in this experiment, 8.6 pmol of cytochrome b558 heme was present (see “Experi- mental Procedures”), these data support a model in which an activation complex complex contains cytochrome, p47-phox and p67-phox in a molar ratio of 1:l:l.


TABLE I1 Effect of guanine nucleotides and arachidonic acid on the

translocation of recombinant p67-phox to neutrophil plasma membranes

Translocation experiments were carried out as described in Table I. Values shown are the average and standard error or range of two to four replicate incubations in an experiment that was representative of three.

Aeonist added Translocation % P m l

None 0 0 GDPPS 2.0 f 0.3 1.3 GTPyS 2.8 f 0.5 1.9 ArachidonatelGDPPS 4.5 f 0.4 3.0 Arachidonate 7.8 f 0.7 5.2 Arachidonate/GTP& 9.3 -t 0.5 6.2

~~ ~~ ~

TABLE 111 Dependence of p67-phox cell-free translocation to the plasma

membrane on the presence of p47-phox Translocation experiments were carried out as described in Table

I except that GTPyS plus arachidonate were used in all groups. Values shown are the average and standard error of four determinations.

Cytosolic protein

D47-DhOX D 6 7 - D h x Translocation

% P m l

+ - 21.6 f 1.9 14.4 + + 20.3 f 1.2 13.6

of p67-pho~ + 3.2 0.2 2.1

+ + 8.4 -t 0.8 5.6

of p47-phox

-

TABLE IV Dependence of p67-phox and p47-phox cell-free translocation on

cytochrome bm Translocation experiments were carried out as described in Table

I except that GTPyS plus arachidonate were used in all groups. Values shown are the average and standard error of four determinations. The plasma membrane from normals was prepared in the laboratory of J. D. L. (*) or John Curnutte (**) in whose laboratory the CGD plasma membranes were prepared to control for any differ- ences in preparation in the two laboratories. The experiment shown is representative of three.

Plasma Membrane Source Translocation % P m l

Normal* 23.5 -t 1.1 15.7 Normal** 24.7 f 0.4 16.5

of p47-phox

CGD (-p22-phox) 9.6 f 0.5 6.4 CGD (-m91-phx) 9.1 k 0.3 6.1

Normal* Normal**

of p67-pho~ 9.3 k 0.5 6.2

13.6 f 0.3 CGD (-p22-pho~)

9.1 3.3 f 1.0 2.2

CGD ("~p91-pho~) 1.1 f 0.2 0.7

DISCUSSION

The activation by and specificity for guanine nucleotides seen in earlier studies has implicated a functional role for a G protein in the function of the oxidase. Several groups reported ATPIATPyS-and GTPIGTPyS-dependent stimulation of superoxide generation in both permeabilized cells (45) and in cell-free systems comprised of cytosol plus plasma membrane (8-10). Recent studies (43, 44) focusing on the question of nucleoside triphosphate specificity have shown that the activation by ATP and ATPyS can be attributed to

nucleoside diphosphate kinase-catalyzed transfer of the y- (thio)phosphoryl group to endogenous GDP to form GTP or GTPyS. At least in the cell-free system, ATP-dependent protein phosphorylation is not critical, despite the fact that p47-phox becomes heavily phosphorylated upon in vivo activation and under some conditions in the cell-free system. By extensively depleting endogenous nucleotides, an absolute or near absolute dependence on guanine nucleoside triphosphates was seen. As outlined in the Introduction, there is now general agreement that a small GTP regulatory protein' (racl, rac2, and/or raplA) mediates the guanine nucleotide effects, but the precise mechanism by which such a G protein regulates activity has been unclear.

The present studies utilizing a semirecombinant cell-free system have not attempted to identify the G protein involved but do indicate that one or more activating G proteins are present to some extent in the plasma membrane, since preincubation of plasma membrane but not recombinant p47-phox and p67-phox with GTPyS results in a time-dependent increase in activity. The G protein must be stably associated with the plasma membrane, since repeated washing of the membranes fails to affect activation (21), but it is unclear whether it is normally present in the membrane of resting cells or whether it becomes associated during isolation. The activating G protein is probably present in less than an optimal amount, since addition of either excess cytosol (21) or recombinant rac13 results significantly higher rates of superoxide generation, even when p47-phox and p67-phox are present at saturating levels. Alternatively, the plasma membrane may contain one or more distinct G proteins (e.g. raplA) which function with a suboptimal catalytic efficiency. Regardless of its origin, the presence of GTP regulatory proteins in plasma membrane provide a convenient preparation for investigating the influence of the G protein on the assembly and properties of the NADPH oxidase.

The regulation by GTPyS/GDPPS of the NADPH oxidase may be an example of a more general function of G proteins in regulating macromolecular assemblies through guanine nucleotide-induced conformational changes. For example, in well studied examples of heterotrimeric G proteins, the GTP/ GDP-induced conformational changes regulate the protein- protein interactions that comprise transmembrane signaling (i.e. interactions with receptor, /3r subunits, and effector enzyme). For the small G proteins, a great deal of sequence and structural information is available, and much has been learned regarding accessory proteins that regulate their GTP binding state (e.g, GTPase-activating protein and GDP dissociation stimulator). Nevertheless, unlike the heterotrimeric G proteins for which the effector enzymes are known, there is little or no information on the direct targets of small G protein action (46). In this regard, the NADPH oxidase represents a unique opportunity to investigate a direct target of a small GTP regulatory protein. In the present studies, GTP- induced alterations in the kinetic constants for p67-phox and p47-phox provide evidence that the oxidase-associated GTP regulatory protein is likely to participate in a complex with these oxidase components. In addition, although guanine nucleotide did not affect directly the binding of p47-phox to the cytochrome, the guanine nucleotides directly modulated the

In our own laboratory, we find that the GTPyS-hound form of recombinant racl added to plasma membranes along with p47-phox and p67-phox results in very high levels of superoxide generation, equivalent or higher than those seen with a high concentration of cytosol (M. Kreck, unpublished observations).

M. Kreck, unpublished data.

8630 GTP and Assembly of the Respiratory Burst Oxidase

association of p67-phox with the cytochrome. Thus, the oxidase-related G protein appears to play a critical role as part of an oxidase complex, and its GTP binding state regulates the association with one or more oxidase component(s).

The present studies enlarge on previous studies in cell-free systems aimed at elucidating molecular details of the oxidase assembly. Several earlier studies investigated cell-free translocation of specific components from cytosol, either using immunochemical methods (47, 48) or by adding a tracer quantity of 35S-labeled p47-phox to cytosol (35). In the latter studies, we demonstrated translocation in response to SDS, with enhancement of translocation by diacylglycerol and GTPyS. Park et al. (47) recently characterized a large molecular weight (- 240,000) cytosolic complex containing both p47-phox and p67-phox and reported that SDS caused the two proteins to translocate in a cytochrome-dependent manner, apparently as part of a the larger complex. Interestingly, Curnutte and colleague^,^ using cytosols from CGD patients lacking either p47-phox or p67-phox, developed evidence that the complex contains 1 mol of each of these proteins, along with other unknown proteins. Park and Babior (48) very recently reported using immunochemical methods that both diacylglycerol and GTPyS synergize with SDS to enhance the cytochrome-dependent translocation of both p47-phox and p67-phox, extending what we had observed for p47-phox. Both proteins appeared to respond identically with regard to their translocation in response to various agonists and combina- tions of agonists (SDS, GTPyS, and diacylglycerol), suggesting that they translocate en bloc as part of a larger complex.

The methodology that we have developed provides unique advantages with which to investigate the oxidase assembly and molecular interactions. First, the use of [35S]methionine- labeled proteins is highly accurate and permits us to determine for the first time the stoichiometry of association of p47-phon and p67-phox with cytochrome b558. Immunochemical methods, although they have provided important qualitative information, are difficult to quantitate and are somewhat cumber- some. Using translocation of the radiolabeled recombinant protein, we see that under optimal conditions, the cytochrome-specific portion of the association with the plasma membrane reflects a stoichiometry of approximately (l:l:l, p47-phox:p67-phox:cytochrome bsSs heme). If we assume that the cytochrome contains a single heme, then the actual stoichiometry is close to 1:l:l. Nevertheless, it should be pointed out that heme contents of two or even three hemes/cytochrome have been suggested (49). Such a heme content would indicate the association of multimeric species of of cytosolic components with the cytochrome, a result that would not be consistent with a simple association model.

The present studies have also revealed partially independ- ent behavior of p47-phox uersus p67-phox with respect to translocation. For p47-phox translocation, arachidonate alone provided the major stimulus for assembly. Our data are consistent with a complex between p47-phox and cytochrome b55s.

Such an interpretation has recently been supported by studies showing that carboxyl-terminal peptides from the small and large subunits of the cytochrome can inhibit superoxide generation (24, 35), translocation (47), and can be cross-linked to p47-phox (30). Although p67-phox translocation also occurred in response to arachidonate, its translocation occurred only to a small degree when p47-phox was absent, suggesting that these two components participate in a complex and that the p67-phox translocation seen with arachidonate may have been secondary to its assocation with p47-phox. Similar results have been observed in whole cell activation studies,

' J. Curnutte, personal communication.

wherein p67-phox translocation fails to occur in CGD cells lacking p47-phox. (23). The suggestion of a complex between p47-phox and p67-phox is also consistent with several earlier reports showing co-chromatography of these two proteins from cytosol, as discussed above. Despite evidence for a complex, the present studies indicate that the assembly of p67- phox but not p47-phox responds to guanine nucleotides. This result differs from results seen using cytosol, perhaps because when p47-phox and p67-phox are associated in a complex with other proteins including probably a G protein, they respond as a complex rather than as individual components. Thus, any factor enhancing the association with any one protein enhances the association with all. In the present studies using individual recombinant proteins and membrane-associated G protein, we suggest that it becomes possible to investigate individual molecular interactions. The enhancement of p67- phox binding by GTPyS suggests that p67-phox interacts directly with the G protein in the membrane and raises the interesting possibility that this protein may bind to "switch" regions (50) in the G protein which undergo conformational changes depending upon the binding of GTP or GDP. Thus, we suggest a model in which p47-phox binds directly to cytochrome bsss, and p67-phox interacts with both p47-phox and a small GTP regulatory protein.

Acknowledgments-We thank Dr. John Curnutte for helpful discussions and for providing membrane and cytosol fractions obtained from patients with chronic granulomatous disease. We also thank Drs. Thomas Leto, Harry Malech, and colleagues for providing the pBluescript plasmids containing the p47-phox and p67-phox cDNA inserts. We are also grateful to Dr. Nicolas Neckelmann for helpful discussions and expert advice on recombinant DNA methodology, and to Linda Jones and Jan Pohl (Microchemical facility at Emory University) for providing synthetic oligonucleotides.

REFERENCES 1.

2.

3.

4.

5.

6.

7. 8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

Royer-Pokora, B., Kunkel, L. M., Monaco, A. P., Goff, S. C., Newburger, P. E., Baehner, R. L., Cole, F. S., Curnutte, J. T., and Orkin, S. H. (1986)

Parkos, C. A,, Dinauer, M. C., Walker, L. E., Rodger, A. A., Jesaitis, A. J., Nature 322,32-38

Lomax, K. J., Leto, T. L., Nunoi, H., Gallin, J. I., and Malech, H. L. (1989) and Orkin, S. H. (1988) Proc. Natl. Acad. Sci. U. S. A. 86,3319-3323

Lomax, K. J., Leto, T. L., Nunoi, H., Gallin, J. I., and Malech, H. L. (1989) Science 246,987

Leto, T. L., Lomax, K. J., Volpp, B. D., Nunoi, N., Sechler, J. M. G., Science 246,409-412

Volpp, B. D., Nauseef, W. M., Donelson, J. E., Moser, D. R., and Clark, R. Nauseef, W. M., and Clark, R. A. (1990) Sctence 248,727-730

Smith, R. M., and Curnutte, J. T. (1991) Blood 77,673-683 A. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 7195-7199

Ligeti, E., Tardif, M., and Vignais, P. V. (1989) Biochemistry 28, 7116- 7123

Seifert, R., and Schultz, G. (1987) Biochem. Bwphys. Res. Commun. 146,

Gabie. T. G.. Enelish. D.. Akard. L. P.. and Schell. M. J. (1987) J. Bid. 1296-1302

C&m. 262, 16%5-1690' Eklund, E. A,, Marshall, M., Gibbs, J. B., Crean, C. D., and Gabig, T. G.

Abo, A., Pick, E., Hall, A,, Totty, N., Teahan, C. G., and Segal, A. W. (1991) J. Bbl. Chem. 266,13964-13970

Knaus, U. G., Heyworth, P. G., Evans, T., Curnutte, J. T., and Bokoch, G. (1991) Nature 363,668-670

Buss, J. E., Quilliam, L. A,, Kato, K., Casey, P. J., Solski, P. A., Wong, G., M. (1991) Science 264,1512-1515

Biochem. 11,1523-1530 Clark, R., McCormick, F., Bokoch, G. M., and Der, C. J. (1991) Mol. Cell.

Quinn, M. T., Parkos, C. A,, Walker, L., Orkin, S. H., Dinauer, M. C., and Jesaitis, A. (1989) Nature 342, 198-200

Didsbury, J., Weber, R. F., Bokoch, G. M., Evans, T., and Snyderman, R. (1989) J. Biol. Chem. 264, 16378-16382

Parkinson, J. F., and Gabig, T. G. (1988) J. Bwenerg. Bwmembr. 20,653-

. .

C'??

Rotrosen, D., Yeung, C. L., Leto, T. L., Malech, H. L., and Kwong, C. H.

Segal, A. W., West, I., Wientjes, F., Nugent, J. H. A., Chavan, A. J., Haley, (1992) Science 266,1459-1462

B., Garcia, R. C., Rosen, H., and Scrace, G. (1992) Biochem. J. 284, 781-788

Miura, Y., Kaibuchi, K., Itoh, T., Corbin, J. D., Francis, S. H., and Takai,

Uhlinger, D. J., Inge, K. L., Kreck, M. L., Tyagi, S. R., Neckelmann, N., and Lambeth, J. D. (1992) Biochem. Biophys. Res. Commun. 186,509-

"I I

Y. (1992) FEBS Lett. 297,171-174

K t fi Cli;;, R. A., Volpp, B. D., Leidal, K. G., and Nauseef, W. M. (1990) J.

Heyworth, P. G., Curnutte, J. T., Nauseef, W. M., Volpp, B. D., Pearson, Clin. Inuest. 86, 714-721

GTP and Assembly of the Respiratory Burst Oxidase 863 1

24. Kleinberg, M. E., Malech, H. L., and Rotrosen, D. (1990) J. Biol. Chem. D. W., Roaen, H., and Clark, R. A. (1991) J. Clin. Invest. 87,352-356 37. (1987) Current Protocols in Molecuhr Biology, John Wiley & Sons, New

266,15577-15583 38. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular C h i A York

25. Curnutte, J. T. (1985) J. Clin. Invest. 76,1740-1743 26. Bromberg, Y., and Pick, E. (1984) Cell. Immuml. 88,213-221

Laboratory Manual, 2nd. ed., Cold Spring Harbor Laboratory, Told

27. McPhaiI, L. C., Shirley, P. S., Clayton, C. C., and Snyderman, R. (1985) J. 39. Laemmli, U. K. (1970) Nature 227,680-685 Spring Harbor, NY

28. Leto, T. L., Garrett, M. C., Fujii, H., and Nunoi, H. (1991) J. Biol. Chem. T. L. and Cuinutte, J. T. (1992) J. Clin. Invest. 89,1587-1595

29. Abo, A,, Boyhan, A., West, I., Thrasher, A. J., and Segal, A. W. (1992) J. 263,3818-3822

30. Nakanishi, A., Imajoh-Ohmi, S., Fujinawa,T., Kikuchi, H., and Kanegasaki, 43. Uhlinger, D. J., Burnham, D. N., and Lambeth, J. D. (1991) J. Biol. Chem.

31. Pember, S. O., Shapira, R., and Kinkade, J. M., Jr. (1983) Arch. Biochem. 44. Peveri, P., Heyworth, P. G., and Curnutte, J. T. (1992) Proc. Natl. Acad.

32. Burnham, D. N., Uhlinger, D. J., and Lambeth, J. D. (1990) J. Biol. Chem. 45. Lu, D. J., and Grinstein, S. (1990) J. Biol. Chem. 266,13721-13729

33. Cross, A. R., Higson, F. K., and Jones, 0. T. G. (1982) Biochem. J. 204, 47. Park, J:, Ma, M., Rue%, d. M., Smith, R. M., and Babior, B. M. (1992) J.

34. Ohno, Y., Buescher, E. S., Roberts, R., Metcalf, J. A., and Gallin, J. I., 48. Park, J., and Babior, B. M. (1992) J. Biol. Chem. 267,19901-19906

35. Tyagi, S. R., Neckelmann, N., Uhlinger, D. J., Burnham, D. N., and 7303-7309

36. Grunstein, M., and Hogness, D. (1975) Proc. Natl. Acad. Sci. U. S. A. 72, 50. Brunger, A. T., Milburn, M. V., Tong, L., DeVos, A. M., Jancarik, J.,

Yamaizumi, Z., Nishimura, S., Ohtsuka, E., and Kim, S. (1990) Proc.

Clin. Invest. 76, 1735-1739 40. Erickson, R. W. Malawista, S. E., Garrett, M. C., Van Blaricom, G., Leto,

266,19812-19818 41. Lambeih, J. D., Burnham, D. N., and Tyagi, S. R. (1988) J. Biol. Chem.

BioL Chem. 267,16767-16770

S. (1992) J. Biol. Chem. 267,19072-19074

Biophys. 221,391-403 Sci. U. S. A. 89,2494-2498

266,17550-17559

42. Duggleby, R. G. (1981) A d . Biochem. 110,9-18

266,20990-20997

46. Bourne H. R., and St er L (1992) Nature 368,541-543

479-485 BWL Chem. 267,17327-17332

(1986) Blood 67,1132-1138 49. Quinn, M. T., Mullen, M. L., and Jesaitis, A. J. (1992) J. Biol. Chem. 267,

Lambeth, J. D. (1992) Biochemistry 31,2765-2774

3961-3965 N a b Acad. Sci. U. S. A. 87,4849-4853

Documents

THE JOURNAL BIOLOGICAL CHEMISTRY OF 86244631, No. of 1993 12, 25