THE JOURNAL OF BIOLOGICAL CHEMISTRY @ 1993 by The American Society for Biochemistry and Molecular Biology, Inc Vol. 268, No. 32, Issue of November 15, pp. 24156-24162,1993

Printed in U. S. A.

Expression of Active Human DNA Ligase I in Escherichia coli Cells That Harbor a Full-length DNA Ligase I cDNA Construct*

(Received for publication, September 14, 1992, and in revised form, May 24, 1993)

Hirobumi TeraokaSO, Hanae MinamiS, Shigeyuki IijimaS, Kinji TsukadaS, Osamu Koiwaill, and Takayasu Date11 From the $Department of Pathological Biochemistry, Medical Research Institute, Tokyo Medical and Dental University, Tokyo 101, the TLaboratory of Biochemistry, Aichi Cancer Center Research Institute, Nagoya 464, and the [[Department of Biochemistry, Kanazawa Medical School, Ishikawa 920-02, Japan

A recombinant plasmid for expression of full-length human DNA ligase I (phLig-I) was constructed in a plasmid/phage chimeric vector, pTD-T7N, which was derived from pUCll8 by oligonucleotide-directed mu- tagenesis. The insert contained a 2757-base pair cod- ing sequence for a whole human DNA ligase I and an extra ACC codon adjacent to the ATG initiation codon. This ACC codon was required for achieving high levels of expression of full-length DNA ligase I in Escherichia coli strain BL21. The recombinant plasmid, which was designed to exploit the T7 late promoter and the ATG initiation codon for &galactosidase was transfected into E. coli BL21 cells that express T7 RNA polymer- ase. The recombinant clone produced relatively high levels of DNA ligase I with a molecular mass of 130 kDa, as estimated by SDS-polyacrylamide gel electro- phoresis. The DNA ligase was purified to near-homo- geneity by the two-step column chromatographic pro- cedure from BLphLig-I cells that had been induced with isopropyl 8-D-thiogalactoside. The specific activ- ity, chromatographic behavior, kinetic properties, mo- lecular mass, and antigenicity of the recombinant hu- man DNA ligase I were indistinguishable from those of purified mammalian DNA ligase I. Metabolically labeling experiments with s2Pi indicate that the recom- binant DNA ligase I was present as an enzyme-AMP reaction intermediate, but not as a phosphoprotein, in the E. coli cells.

Two distinct forms of DNA ligase, designated DNA ligases I and 11, have been detected in mammalian cells (1-8) and Drosophila melanogaster embryos (9, 10). Recently, a third form of DNA ligase was reported to be present in calf thymus and rat liver (11, 12). Since the activity of DNA ligase I is high in actively growing cells (13-25) and expression of the gene for this enzyme is closely correlated with the growth phase of cells (25,26), DNA ligase I is believed to be involved in DNA replication. In fact, expression of cDNA for human DNA ligase I is capable of complementing the defect in replication of temperature-sensitive mutants in DNA ligase of Saccharomyces cerevisiae (27) and Escherichia coli (28). Analysis of a cDNA clone for human DNA ligase I suggested

* This work was supported in part by Grant-in-Aid 03151031 for Cancer Research and Grant-in-Aid 05270102 for Scientific Research on Priority Areas from the Ministry of Education, Science and Culture of Japan (to H. T.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

5 To whom correspondence should be addressed.

the presence of an open reading frame that encodes 919 amino acids, and the adenylylated, immunoprecipitated polypeptide in an extracts of cdc9-7 yeast cells migrated with a molecular mass of 125 kDa during SDS-PAGE’ (27). DNA ligase I from mammalian cells is known to be composed of a single poly- peptide of 125-130 kDa in SDS-PAGE (22, 29) and the size of the mRNA for DNA ligase I in human cells is reported to be 3.1-3.5 kb (25-27). In order to examine the structure-function relationships for

human DNA ligase I, we decided to prepare large quantities of full-length human DNA ligase I from E. coli cells that harbored an expressible cDNA construct for full-length hu- man DNA ligase I. The properties of DNA ligase produced by the transfected E. coli cells were indistinguishable from those of mammalian DNA ligase I. Post-translational modifications, such as phosphorylation of the recombinant full-length DNA ligase I, were also investigated and discussed.

MATERIALS AND METHODS

Materials and Enzymes--[c~-~~P]ATP and [Y-~*P]ATP were ob- tained from DuPont NEN, and H,32P04 from ICN. Restriction en- zymes and DNA-modifying enzymes were obtained from Takara (Kyoto, Japan) and Nippon Gene (Toyama, Japan). Protein G- agarose was obtained from Oncogene Science. DNA-sequencing re- agents were from Toyobo (Osaka, Japan), Takara, and Applied Bio- systems, Inc. Oligonucleotides were synthesized by a DNA synthesizer from Applied Biosystems. All other chemicals were from commercial sources and were of the highest purity available.

E. coli Strains-The strains of E. coli used in this work were JM109 (30) and BL21 that carries a single copy of the gene for RNA polymerase from bacteriophage T7 on its chromosome under control of the lacUV5 promoter (31).

GeneAmp DNA Amplification Reagent kit in a DNA Thermal Cycler Polymerase Chain Reattion-PCR was performed with the

(Perkin-Elmer Cetus) programmed for a temperature cycle of 95 “C (1 min), 55 “C (2 min), and 72 “C (3 min). This cycle was repeated 25 times. A 0.7-kb product of PCR covering the 5”terminal portion of cDNA for DNA ligase I was obtained by using a set of primers, as follows: L1 (GCAGCGAAGTATCATGTCATTT at positions 35- 55; G is an extra codon added at the 5’-end) and L2 (a comple- mentary strand of GAAGTGAAGGAAGAGGAGCC at positions 755- 774), and pUC-hLig-15’ (1.45 kb) as a template. A 2.1-kb product of PCR corresponding to the cDNA of DNA ligase I that lacked the 5’- end was amplified by use of the primers, L6 (AGAGCTCCCAA- GACGCTCAG at positions 698-717) and L7 (a complementary strand of GATACCTACTAAGCCCTCGC at positions 2780-2799), and XhLig-13’ (2.4 kb) as a template.

Cloning of cDNA for DNA Ligase I-cDNAs for human DNA ligase I were isolated from a Xgtll cDNA library of human glioma (Clontech Laboratories) with both antibodies against DNA ligase I from calf

The abbreviations used are: PAGE, polyacrylamide gel electro- phoresis; PCR, polymerase chain reaction; IPTG, isopropyl 0-D- thiogalactoside; PCR, polymerase chain reaction; FPLC, fast protein liquid chromatography; kb, kilobase(s).

24156

Expression of Active Human DNA Ligase I in E. coli Cells 24157

thymus (7, 22) and a synthetic oligonucleotide that corresponded to the complementary strand of the cDNA for human DNA ligase I at positions 2630-2659 (27). XhLig-13' (2.4 kb), having a 2.4-kb insert, was the largest, and it lacks 0.6-kb of the 5'-region of the full-length cDNA. cDNA cloning of the 5'-half of human DNA ligase I was performed as follows: cDNA of poly(A)+ RNA from NALM16 cells was prepared by use of random hexanucleotides. PCR was carried out with a 5'-end primer (GGAGAATTCTGACGCCAACATGC at posi- tions 13-35 of cDNA for human DNA ligase I) and a 3'-end primer (a complementary strand of ACCAGCCATGGTGGATGCTGGG at positions 1462-1483). The amplified fragment containing two EcoRI sites a t positions 16 and 1454 was digested with EcoRI and then ligated to pUC118 that had been digested with EcoRI. E. coli JM109 cells were transfected with the recombinant plasmids. Colony hybrid- ization was performed with PCR primers that had been end-labeled with polynucleotide kinase and [-p3'P]ATP.

Construction of Expression Plumids for the Full-length Human DNA Ligase I cDNA-Vector pTD-T7N, having a bacteriophage T7 promoter, was constructed from pTD-T7 (32) by changing one base on each side of the initiation codon of ,&galactosidase to introduce a unique NcoI site at the initiation codon (see Fig. 1). pTD-T7N was digested with NcoI, the 3'-end was filled in with Klenow fragment, and then the blunt-ended pTD-T7N was treated with alkaline phos- phatase. The products of PCR (0.7 and 2.1 kb) with cDNA for DNA ligase I were treated with Klenow fragment, phosphorylated, and then ligated to the linearized pTD-T7N by use of a Takara ligation kit (Takara, Kyoto, Japan). The recombinant plasmid was used to trans- fect E. coli JM109. The recombinant clones were analyzed by colony hybridization. The orientation of cDNA inserts was determined by digestion with SacI, and clones containing cDNA in the correct orientation were isolated. In order to construct a recombinant plasmid that contained the complete sequence for the entire polypeptide of human DNA ligase I, a 2.1-kb insert of incomplete cDNA for DNA ligase I was isolated after digestion with SacI. This fragment was ligated at the SacI site of pTD-hLig-15' (0.7 kb), and then E. coli JM109 was transfected with the plasmid. Transformants were se- lected on plates prepared with 50 pg/ml ampicillin by colony hybrid- ization with synthetic oligonucleotide probes. The orientation of cDNA inserts was determined by digestion with BamHI. Since the complete cDNA for human DNA ligase I contains a single BamHI site a t position 814, a 2.1-kb fragment should be generated from the cDNAs with the correct orientation. The recombinant plasmid con- taining 2.8 kb of cDNA (phLig-I) was isolated and was used to transfect E. coli BL21. A full-length human DNA ligase I cDNA devoid of the extra ACC codon adjacent to the ATG initiation codon (phLig-1') was also prepared by the identical strategy.

Expression of DNA Ligase I-E. coli strain BL21 harboring each expression plasmid was grown in 2 X YT medium that contained 50 pg/ml ampicillin at 37 "C. Expression of the gene for DNA ligase I was induced by addition to the medium of 1 mM IPTG with subse- quent incubation at 37 "C for 10-14 h. After SDS-PAGE, the gene products were analyzed by Western blotting/enzyme immunoassay with antibodies raised in rabbits against either DNA ligase I from calf thymus (7, 22) or a synthetic peptide that corresponded to the sequence from amino acid residue 867 to residue 882, as deduced from the nucleotide sequence of the cDNA for human DNA ligase I (27).

Preparation of Cell-free Extracts and Purification of Recombinant DNA Ligase I-The gene for the full-length human DNA ligase I in phLig-I was expressed in E. coli BL21 cells that were cultured in 300 ml of 2 X YT medium supplemented with 1 mM IPTG. After 10-14 h of incubation, the cells were harvested and the cell pellet was washed once with PBS and frozen at -80 "C. All procedures for purification of the enzyme were carried out at 0-5 "C unless otherwise specified. The pellet was suspended in 20 ml of lysis buffer (20 mM KPi, pH 7.5, 5 mM EDTA, 1 mM dithiothreitol, 10% glycerol, 0.25 mg/ml lysozyme, 1 pg/ml each of aprotinin, leupeptin, and pepstatin) and the mixture was allowed to sit on ice for 10 min. After addition of Nonidet P-40 to a final concentration of 1% (v/v), the suspension was sonicated 5 times for 1 min each with a Branson sonifier, and then the sonicate was centrifuged at 25,000 X g for 30 min at 2 "c to generate a cell-free extract. In the absence of Nonidet P-40, almost all of the recombinant human DNA ligase I was recovered in the precipitable fraction of the lysate of E. coli cells. The extract was applied to a column of DEAE-cellulose (1.4 X 10 cm) that had been equilibrated with 50 mM KPi buffer (50 mM K P , pH 7.5, 0.1 mM EDTA, 1 mM dithiothreitol, and the mixture of proteinase inhibitors described above). After washing the column, proteins were eluted with a linear gradient of KC1 (0-0.6 M) in 50 mM KPi buffer (40 ml).

Active fractions containing a 130-kDa polypeptide, as determined by SDS-PAGE, were pooled and dialyzed against 150 ml of 50 mM KPi buffer. The dialysate was applied to a column of phosphocellulose (1 X 8 cm) that had been equilibrated with 50 mM KPi buffer. After washing the column, proteins were eluted with a linear gradient of KC1 (0-0.6 M) in 50 mM KPi buffer (40 ml). Active fractions contain- ing a 130-kDa polypeptide, as determined by SDS-PAGE, were com- bined and condensed by use of Centricon 30 (Amicon). For further purification and characterization of DNA ligase I, an FPLC Superose 12 column that had been equilibrated with 20 mM KPi, pH 7.5, 0.1 mM EDTA, 0.5 mM dithiothreitol, 0.5 M NaCl was employed (25). External marker proteins used were @-galactosidase (Mr 520,000), catalase (M, 240,000), aldolase ( M , 150,000), and cytochrome c (Mr 13,000). The purification of recombinant DNA ligase I from BLphLig- I' was carried out as described above.

N-terminal Amino Acid Sequencing-The purified recombinant full-length human DNA ligase I (200 pg) was dialyzed against Hz0 and then lyophilized. NHz-terminal amino acid sequence of the en- zyme was determined with a protein sequenator AB1 473A (Applied Biosystems).

Deletion and Sequencing of cDNA Clones-Deletion clones with various lengths of cDNAs were constructed from phLig-I (2.8 kb) with a Takara kilo-sequence deletion kit and a set of restriction enzymes (XbaI and SphI) according to the manufacturer's protocol. DNA sequence of the deletion clones with appropriate sizes were determined by an Applied Biosystems automatic DNA Sequencer model 373A with a dye primer (-21M13). Resulting ambiguous and undetermined portions of the cDNA were sequenced by the dideoxy- nucleotide chain termination method with 5'-32P-synthetic primers and a 7-deaza sequencing kit version 2 from Takara.

SDS-PAGE and Western BlotlEnzyme Immunoassay-Electro- phoresis in a 0.1% SDS-7.5% polyacrylamide gel and Western blot/ enzyme immunoassay were carried out as described previously (6,22).

Assay for DNA Ligase-DNA ligase activity was determined as described previously (25, 33). In brief, the reaction mixture (200 pl), which contained 75 mM Tris-HC1, pH 7.8, 10 mM MgSO4, 0.2 mM ATP, 0.1 mg/ml bovine serum albumin, 2.5 mM dithiothreitol, 0.3 p~ [5'-3zP]dT20dA. (20,000-45,000 cpm), and enzyme solution, was in- cubated at 30 "C for 10-20 min. After incubation with calf intestine alkaline phosphatase at 37 "C for 30 min, radioactivity on a DE81 paper (2.4-cm square) was counted. One unit of the enzyme was defined as the amount that converted 1 nmol of [ 5 ' - 3 2 P ] p h ~ ~ p h ~ - monoester to an alkaline phosphatase-resistant form per min under the standard assay conditions. Protein was quantitated by the method of Bradford (34).

Ligation of pUC119 that had been linearized with Hind111 was carried out as described previously (35) in a reaction mixture of 20 pl containing 10% (v/v) poly(ethy1ene glycol). Treatment of purified recombinant human DNA ligase I with PPi (0.2 mM) was carried out as described previously (22). The treated DNA ligase I was subjected to gel filtration on a Sephadex G-50 column.

Adenylylation of recombinant DNA ligase I was carried out as described previously (22) in a 20-pl reaction mixture containing 0.1 p M PPi and 3 pCi of [cx-~'P]ATP (800 Ci/mmol) instead of [3H]ATP. The resulting DNA ligase I-[32P]AMP was analyzed by SDS-PAGE.

Metabolic Labeling of Recombinant E. coli Cells with 32P,-Recom- binant E. coli BLphLig-I cells were grown at 37 "C in 10 ml of 2 X YT medium supplemented with 50 pg/ml ampicillin until Am of the culture reached approximately 0.2. The cells were collected, washed once with a low phosphate medium, and then incubated in 7 ml of low phosphate medium supplemented with 0.1% casamino acid, 10 mM MgS04, and 50 pg/ml ampicillin. To the culture, 1 mM IPTG and 3 mCi of 32Pi were added 20 and 40 min later, respectively. After a further 4.5-h incubation, the labeled cells were collected, washed once with PBS and frozen at -80 "C. The cell pellet was treated with 0.5 ml of lysis buffer and the lysate was centrifuged as described above. The resulting supernatant was divided into 0.15-ml portions and incubated with either rabbit antibodies against calf thymus DNA ligase I (7, 22) or non-immune IgG at 0 "C overnight. The immune complex was collected with protein G-agarose. After the agarose was washed five times with RIPA buffer, the pellet was heated at 95 'C for 3 min in SDS sample buffer. The solubilized materials were analyzed by SDS-PAGE and autoradiography. The band of 32P- labeled DNA ligase was sliced from the gel, and incubated in 500 pl of 50 mM (NH&C03, pH 7.4,0.1% SDS, 0.5% 2-mercaptoethanol at 37 "C for 6 h. To the cleared supernatant, 20 pg of bovine serum albumin and trichloroacetic acid (15%) was added. The resulting precipitate was heated either in 1 M HCl or in 5.7 M HCl at 110 "C

24158 Expression of Active Human DNA Ligase I in E. coli Cells for 1 h. The resulting materials were analyzed by two-dimensional phosphoamino acid analysis as described previously (36). Analysis of recombinant DNA ligase I labeled in vitro with [w3’P]ATP was carried out as described above.

RESULTS

Construction of the Expression Vector phLig-I-We have cloned the gene for human DNA ligase I in a specially con- structed expression vector, pTD-T7N (Fig. 1). This vector is a derivative of pUC118, having a T7 promoter, a Shine- Dalgarno sequence, NcoI site at the initiation codon of lacZ, multiple cloning sites, and a signal for termination of tran- scription (32). pTD-T7N was treated with NcoI, and the 3’- end was filled in with Klenow fragment, with subsequent

K o R I ( 1 6 ) k c 1 ( 6 9 9 1 W R I (1454)

I I 1. I ? 3 kb -I I ( A I n CDNA

0 L1 L2 0

$ pUC-hLig-I5’(1.45 kb)

, O L 6 L7 a (2.4 kb)

AhLig-13’

initiation codon O f &CZ

. . ‘ C A G C T A T G A C C A T G ‘ . pTD-T7

~n vltrO mutagenesis

. . . C A G C C A T G G C C A T G ” PTD-T~N

Klenowlphosphatase

M T Q R S I

FIG. 1. Procedure for construction of expression plasmids for human DNA ligase I. A cDNA for full-length DNA ligase I was covered by XhLig-13’ (2.4 kb) and pUC-hLig-15’ (1.45 kb). The first nucleotide of the initiation codon ATG corresponds to the 32nd nucleotide, according to the numbering of Barnes et al. (27). The expression vector pTD-T7, derived from pUC118, contains an ampi- cillin-resistance gene (Amp), a T7 late promoter (P), a multiple cloning site ( M C S ) , a transcription termination signal (TTS) , the replication origin of the plasmid (ori), and the origin of replication of M13 phage DNA (MI3 ori). 2.1- and 0.7-kb fragments, generated by PCR with XhLig-13’ (2.4 kb) and pUC-hLig-15’ (1.45 kb), respec- tively, were subcloned into pTD-T7N, which was derived from pTD- T7 by in vitro mutagenesis. The Sac1 site at position 699 in the cDNA for human DNA ligase I was used to generate a full-length cDNA construct. Since the 5’-end of primer L1 contains an extra ACC codon, the N-terminal amino acid sequence of the recombinant hu- man DNA ligase is predicted to be Met-Thr-Gln-Arg-Ser-Ile (M-T- Q-R-S-I). Details are described under “Materials and Methods.” Construction for an expression plasmid devoid of an extra ACC (phLig-1’) was carried out with a primer L1 lacking an extra ACC at the 5‘-end.

treatment with alkaline phosphatase. Products of PCR, namely, the N-terminal region (0.7 kb) and the C-terminal region (2.1 kb), were separately ligated to linearized pTD- T7N. Using the Sac1 site at position 699 that was common to both of these PCR fragments, we constructed a full-length cDNA for human DNA ligase I. The constructed cDNA con- tained an ATG initiation codon for @-galactosidase, an extra ACC, and then the entire coding sequence for human DNA ligase I. The ACC codon next to the initiation codon ATG has been shown empirically to be useful for high-level expres- sion of recombinant proteins in E. coli (32). We also con- structed a full-length DNA ligase I cDNA devoid of an extra ACC codon (phLig-1’) using primer L1 lacking an extra ACC at the 5‘-end. The recombinant plasmids, namely, that encoded the full-length human DNA ligase I (phLig-I and phLig-1’) and pTD-hLig-13’ (2.1 kb) that lacked 666 nucleo- tides of 5”coding region of the cDNA, were used to transfect E. coli BL21.

The sequence of 2.8-kb cDNA in phLig-I was found to be identical to that originally published by Lindahl’s group (27). In addition, there was no difference in the sequence of the 3‘- noncoding region in XhLig-13‘ as well. In a 3.0-kb DNA ligase I cDNA from human tonsillar Xgtll library, two silent nu- cleotide substitutions have been reported (26).

Expression of Human DNA Ligase I-Western blot/enzyme immunoassay of cell lysates from E. coli BL21 that harbored phLig-I, phLig-I*, or phLig-13’ (2.1 kb) was carried out with rabbit antibodies against calf thymus DNA ligase I (Fig. 2), as well as with rabbit antiserum raised against a synthetic peptide that corresponds to a portion of human DNA ligase I (data not shown). The cell lysates of BLphLig-13’ (2.1 kb) and BLphLig-I exhibited the immunoreactive band corre- sponding to molecular mass of 90 and 130 kDa, respectively (Fig. 2, lanes 1 and 2 ) . The amount of 130-kDa protein was roughly severalfold higher than that of 90-kDa protein. In the cell lysate of BLphLig-I, a dye-stained band that migrated more slowly than @-galactosidase (116 kDa), a marker poly- peptide, was observed. This immunoreactive band, corre- sponding to a 130-kDa polypeptide, was absent in a lysate of host BL21 cells that contained no plasmid (Fig. 2, lane 3 ) . Although the yield of the 130-kDa polypeptide fluctuated from experiment to experiment, the polypeptide accounted for sev- eral percent of the total protein in the E. coli cells. These results indicate that the recombinant E. coli BLphLig-I cells synthesized relatively large amounts of full-length human DNA ligase I in the presence of IPTG. In contrast, the expression of phLig-I devoid of an extra ACC codon adjacent to the ATG initiation codon was quite different from that of phLig-I. Western blot/enzyme immunoassay of cell lysates from BLphLig-I’ revealed the production of relatively small amounts of DNA ligase I with 75-85-kDa molecular masses (Fig. 2, lane 4 ) . In the case of human DNA ligase I, addition of an extra ACC codon adjacent to the ATG initiation codon seems to be critical for expression of the full-length active enzyme in BL21 cells.

Purification of Recombinant Human DNA Ligase I-DNA ligase was purified from the extract of IPTG-induced BLphLig-I cells by column chromatography on DEAE-cellu- lose and phosphocellulose, as described under “Materials and Methods” (Fig. 3). In addition, gel filtration on a column of FPLC Superose 12 was performed occasionally. During the column chromatographic procedures, DNA ligase activity was associated with a polypeptide of 130 kDa in SDS-PAGE, the size of mammalian DNA ligase I. After only two steps of purification, an apparently pure DNA ligase was obtained (Fig. 4). Since no NAD-dependent DNA ligase activity was

Expression of Active Human DNA Ligase I in E. coli Cells 24159

200 - kDa

116 - 94 -

67 -

43 -

30 -

1 2

- 130

- 90

kDa

2 3 2 3 4 - top-

116- kDa

94 - . ,,, ,

67-

EIA CBB EIA EIA FIG. 2. SDS-PAGE of polypeptides in extracts of the expression recombinants BLphLig-I, phLig-I;, and BLpTD-hLig-13’

(2.1 kb). E. coli cells cultured in duplicate in the presence of 1 mM IPTG for 10 h were lyzed in 0.1% SDS and extracts were obtained by brief centrifugation. After removal of pellet by a toothpick, the extracts in duplicate were treated with SDS sample buffer and then loaded on the gel. After SDS-PAGE, the gel was subjected either to staining with Coomassie Brilliant Blue (CBB) or to Western blot/enzyme immunoassay ( E I A ) . Lane I, recombinant BLpTD-hLig-13’ (2.1 kb); lane 2, recombinant BLphLig-I; lane 3, BL21 cells; lane 4, recombinant BLphLig-1’. The polypeptide markers run in parallel were myosin (200 kDa), p-galactosidase (116 kDa), phosphorylase b (94 kDa), bovine serum albumin (67 kDa), ovalbumin (43 kDa), and carbonic anhydrase (30 kDa).

130kDa- Y kDa - 116

-cM - 67

-43

Fraction number ( 2 ml/fractionl - 30

Fraction number (2 ml/fractlon) FIG. 3. Purification of recombinant human DNA ligase I by

chromatography on DEAE-cellulose and phosphocellulose. The cell-free extract from BLphLig-I was applied to a column of DEAE-cellulose ( A ) . The active fractions containing the 130-kDa polypeptide, as estimated by SDS-PAGE, were combined, dialyzed, and then applied to a column of phosphocellulose ( B ) . 0, DNA ligase activity; - - - -, protein concentration; -, KC1 concentration.

observed in the purified preparations (Fig. 5A), contamination by DNA ligase from E. coli seemed to be negligible. The specific activity of DNA ligase was estimated to be about 130 units/mg protein, which is 2- to 3-fold higher than that of purified DNA ligase I from calf thymus (22, 25).

Although we performed purification of DNA ligase I from the extract of BLphLig-I’ by the two-step chromatographic procedures as described above, highly purified preparations of the enzyme were not obtained.

Properties of Recombimnt DNA Ligase I-K,,, values of 130-

FIG. 4. SDS-PAGE of purified human DNA ligase I. The purified recombinant human DNA ligase I (0.5 pg) was subjected to SDS-PAGE and the gel was stained with Coomassie Brilliant Blue. The polypeptide markers were as described in the legend to Fig. 2.

FIG. 5. Catalytic properties of recombinant human DNA ligase I. A, DNA ligase activity was determined in the absence (0) and in the presence of either ATP (0.2 mM) (0) or NAD (0.2 mM) (A). B, DNA ligase activity as a function of ATP and [5’-32P]dTdA.. K,,, values for ATP and [5’-3ZP]dT20dA. were determined from double- reciprocal plots.

kDa DNA ligase I for ATP and [5’-32P]dT20dA, were obtained to be 5 and 0.08 PM, respectively (Fig. 5B). In the case of 75- 85-kDa recombinant DNA ligase I, K,,, values for ATP and [5’-32P]dT20dA,, were 3 and 0.24 PM, respectively. These values are similar to those of mammalian DNA ligase I (22, 37). Although the recombinant full-length human DNA ligase I

24160 Expression of Active Human DNA Ligase I in E. coli Cells

absolutely required ATP as a cofactor for the ligation reaction (Fig. 5), a relatively high amount of the enzyme was capable of catalyzing ligation reaction with linearized plasmid DNA in the absence of ATP (Fig. 6A, lane 2). By use of the reduced amount of the enzyme (Fig. 6A, lanes 5-11 ) as well as by treatment with PPi (Fig. 6 B ) , the requirement of ATP for the ligation reaction appeared. These results imply that the re- combinant human DNA ligase I was present as an enzyme- AMP reaction intermediate in E. coli BL2lphLig-I cells. In fact, metabolically labeling experiments with 32Pi indicated that DNA ligase I-[32P]AMP complex exists in the E. coli cells (see below).

The recombinant human DNA ligase I exhibited a molec- ular mass of 130 kDa, as judged by SDS-PAGE (Fig. 4). DNA ligase I purified from mammalian cells has been shown to be composed of a single polypeptide with a molecular mass of 120-130 kDa in SDS-PAGE (7, 22, 29, 38, 39). When the recombinant DNA ligase I was subjected to gel filtration on an FPLC Superose 12 column, it was eluted at the position corresponding to M, 240,000-280,000, which seems to be similar to an apparent M, of calf thymus DNA ligase I (7).

Analysis of the N-terminal amino acid sequence of the recombinant 130-kDa human DNA ligase I revealed that the first amino acid residue is Thr, which corresponds to the extra ACC codon. Thr is followed by Gln-Arg-Ser-Ile, and this sequence is identical to the deduced amino acid sequence of human DNA ligase I (see Fig. 1).

Metabolic Labeling of Full-length DNA Ligase I with 3zPi-

A

Lane: 1 2 3 4 5 6 7 8 9 10 11

ATP: - - + + - - - + + + + Ligase: 0 5 0 0 5 0 1 2 4 0 1 2 4

(ng)

B

well -

LM - I Lane: 1 2 3 ATP: - + +

Ligase: 40 40 0 (ng)

FIG. 6. Ligation of linearized pUC119 DNA. A, the reaction mixture containing recombinant nontreated DNA ligase I and 0.2 mM ATP when indicated was incubated at 30 “C for 20 min. B, PPi- treated DNA ligase I was incubated in the presence and absence of 0.2 mM ATP. LM, linear monomers of HindIII-treated pUC119.

In order to determine whether full-length human DNA ligase I expressed in BLphLig-I cells is phosphorylated, adenyly- lated, or both, we carried out metabolic labeling experiments with 32Pi. The 32P-labeled cell lysate was treated with the antibody against DNA ligase I and then with protein G- agarose. The precipitate was subjected to SDS-PAGE and autoradiography. Fig. 7A shows 130-kDa 32P-labeled band specific to antibodies against calf thymus DNA ligase I. The band was hydrolyzed with 1 M HC1 and the hydrolysate was subjected to two-dimensional phosphoamino acid analysis. On the autoradiogram there appeared a spot corresponding to ribose 5-phosphate (Fig. 7B). No spot of phosphoamino acids was observed after hydrolysis in 1 M HCl (Fig. 7B) and in 5.7 M HCl (data not shown). Similarily, a spot of ribose 5- phosphate was detected in the 1 M HC1 hydrolysate of DNA ligase I-[“PIAMP complex formed i n vitro (Fig. 7C). In 5.7 M HCl hydrolysates of 32P-ligase labeled in vivo and i n vitro, only a spot of Pi was observed (data not shown). These results indicate that the recombinant human DNA ligase I exists as an enzyme-AMP reaction intermediate, but not as a phospho- protein, in the E. coli cells.

DISCUSSION

When the recombinant DNA ligase I was expressed in E. coli cells harboring a cDNA construct containing an extra ACC codon adjacent to the ATG initiation codon, the catalytic and molecular properties of the purified DNA ligase I are indistinguishable from those of DNA ligase I from calf thy- mus. The molecular mass of the recombinant DNA ligase I, as estimated by SDS-PAGE, is quite similar to that of mam- malian DNA ligase I. A minor difference between the recom- binant and the natural DNA ligase I is found in the NHz- terminal region. Since, in the case of DNA ligase I purified from calf thymus and having a molecular mass of 125-130 kDa by SDS-PAGE, no amino acid was recovered by N- terminal amino acid sequencing, the N terminus of DNA ligase I from calf thymus is probably blocked (29).2 The N- terminal sequencing of the recombinant human DNA ligase I indicated that Thr is present at the N terminus, and this residue corresponds to the extra ACC codon. It is followed by 4 amino acids that are identical to those deduced from the cDNA of the human DNA ligase I (see Fig. 1). The (for- my1)Met residue seems to have been removed from the poly- peptide in the E. coli cells.

For construction of phLig-I, the high level expression plas- mid that contained cDNA for the full-length human DNA ligase I, an ACC codon was added immediately after the initiation codon ATG (see Fig. 1 and “Materials and Meth- ods”). The recombinant human DNA ligase I purified from BLphLig-I cells contained Thr at the N terminus, suggesting that the (formy1)Met residue is removed in BL21 cells. pTD- hLig-13’ (2.lkb) lacking 666 nucleotides of the 5“coding sequence of the full-length cDNA, produced active DNA ligase with an apparent molecular mass of 90 kDa (see Fig. lA). If (formy1)Met is also removed from the recombinant product of BL2lpTD-hLig-I3’(2.1 kb), the N-terminal amino acid would be expected to be Arg. The yield of the 130-kDa DNA ligase I from BLphLig-I is severalfold higher than that of the 90-kDa ligase I from BLpTD-hLig-13’ (2.1 kb). This differ- ence may reflect the difference between the stabilities of the enzyme proteins produced in these recombinant BL21 cells. Recently, an “N-end rule,” relating the half-life i n vivo of a protein to the nature of its N-terminal residue, was reviewed by Varshavsky (40). In the N-end rule for E. coli, Thr is a

* H. Teraoka, unpublished results.

A

Expression of Active Human DNA

130kDa- - kDa Pi -116 -94

- 67 R-P * ..,. . . .. . P-s

P-T ::I:: p-y

R-P * ..,. . . .. . P-s - 67

P-T ::I:: p-y

- -front pH 1.9 -

Ligase I in E. coli Cells 24161

C

I pH 1.9

FIG. 7. Analysis of DNA ligase I immunoprecipitated from '*P-labeled BLphLig-I cells and recombinant DNA ligase I labeled in vitro with [a-32P]ATP. A , the cell lysate was treated either with anti-(calf thymus DNA ligase 1)IgG (lam 1 ) or with nonimmune IgG ( l a n e 2). The immunocomplex was subjected to SDS-PAGE and autoradiography. B, the "P-labeled 130-kDa band was excised from the gel and hydrolyzed in 1 M HC1 at 110 "C for 1 h. The acid-hydrolysate was separated by two-dimensional high voltage electrophoresis a t pH 1.9 and 3.5 on a cellulose thin-layer plate with subsequent autoradiography. C, purified recombinant DNA ligase I labeled in uitro with [a-"P] ATP was analyzed as described above. Authentic DhosDhoserine (P-S) , phosphothreonine ( P - T ) , and phosphotyrosine ( P - Y ) were visualized by ninhydrin staining. R-P, ribose 5-phosphate; x , sample origin.'

* .

stabilizing residue, whereas Arg is a destabilizing residue. We also prepared a full-length human DNA ligase I cDNA

construct lacking an extra ACC codon (phLig-1'). Surpris- ingly, the recombinant DNA ligase I exhibited a lower molec- ular mass of 75-85 kDa in Western blot/enzyme immunoassay as well as a low recovery of the enzyme protein. In the absence of an extra Thr residue at the N terminus of the recombinant DNA ligase I, the protein would be processed by nonrestricted proteolysis in the E. coli cells. These observations imply that an extra ACC codon adjacent to the ATG initiation codon is important for expression of active, full-length human DNA ligase I in BL21 cells.

In ATP-dependent DNA ligases from eukaryotic and pro- karyotic organisms, the Lys residues of the active sites are located from 320 to 350 amino acids away from the C termini, and these C-terminal portions are highly conserved (41). In addition, T 7 DNA ligase, having the lowest molecular weight of these DNA ligases, is composed of only 350 amino acids. These results suggest that the long N-terminal regions in mammalian and yeast DNA ligases function to regulate the activity of the enzyme. Post-translational modifications, such as phosphorylation and poly ADP-ribosylation, may be pres- ent. Recently, Prigent et al. (42) reported that dephosphoryl- ation of purified DNA ligase I from calf thymus caused its inactivation. Furthermore, they found that the full-length human DNA ligase I in a crude extract of E. coli cells was not able to form ligase-AMP complex and that incubation with casein kinase I1 resulted in formation of an ligase-AMP reaction intermediate. In contrast to their results, our recom- binant full-length DNA ligase I has typical catalytic and molecular properties indistinguishable from those of natural mammalian DNA ligase I. Since there was no change in the coding sequence of DNA ligase I cDNA, only a difference between two recombinant DNA ligase I seems to be present in the N-terminal amino acid sequence. In our full-length recombinant DNA ligase I, a Thr residue was found at the N terminus, which is derived from an extra ACC codon adjacent to the ATG initiation codon. We could not obtain a full- length recombinant DNA ligase I containing no extra N- terminal amino acid (see Fig. 2, lune 4 ) . Since Lindahl's group constructed a full-length DNA ligase I cDNA in pBluescript SK- containing a lacZ gene fragment corresponding to the N- terminal 23-amino acid sequence, the recombinant DNA li- gase I has been expressed as a lacZ fusion protein in the E. coli lig-251 temperature-sensitive mutant (28, 42). Compared

with natural DNA ligase I with blocked N terminus, both recombinant DNA ligases containing the extra N-terminal amino acid(s) are considered to be artifact. I t is very interest- ing, however, that the marked difference in catalytic activity of the two recombinant ligases may be due to the difference in the N terminus.

As already pointed out by Lindahl's group (42), there are multiple phosphorylation sites for casein kinase I1 in human DNA ligase I, especially in the N-terminal region. In fact, casein kinase I1 catalyzed the incorporation of a few mole of phosphate/mol of protein of our recombinant full-length DNA ligase I concomitant with a slight decrease in the enzyme activity? In addition, the ligase I was also phosphorylated to a lesser extent by double-stranded DNA-dependent protein kinase (43) and cdc2 kinase without any significant effect on the ligation activity? Since the recombinant DNA ligase I might be phosphorylated in BLphLig-I cells, we carried out two-dimensional phosphoamino acid analysis of recombinant human DNA ligase I immunoprecipitated from the crude extract of 32P-labeled BLphLig-I cells (Fig. 7). The main phosphorylated product was ribose 5-phosphate derived from DNA ligase I-[32P]AMP, and phosphoamino acids were not detected. A similar autoradiogram was obtained from DNA ligase I labeled in vitro with [a-"P]ATP. We concluded that full-length human DNA ligase I is present in BLphLig-I cells as a ligase-AMP reaction intermediate without phosphoryl- ated amino acid residues.

REFERENCES

1. Soderhall, S., and Lindahl, T. (1973) Biochem. Biophys. Res. Commun. 53,

2. Soderhall, S., and Lindahl, T. (1975) J. Biof. Chem. 250,8438-8444 3. Teraoka, H., Shimoyachi, M., and Tsukada, K. (1975) FEBS Lett. 54,217-

4. Teraoka, H., Shimoyachi, M., and Tsukada, K. (1977) J. Biochem. (Tokyo)

5. Arrand, J. E., Willis, A. E., Goldsmith, I., and Lindahl, T. (1986) J. Biof.

6. Teraoka, H., Sumikawa, T., and Tsukada, K. (1986) J. Bid. Chem. 261,

8. Higashitani, A., Tabata, S., Endo, H., and Hotta, Y. (1990) Cell St ru t . 7. Teraoka, H., and Tsukada, K. (1986) Biochim. Bthphys. Acta 873,297-303

9. Takahashi, M., and Senshu, M. (1987) FEBS Lett. 213,345-352

910-916

220

81, 1253-1260

Chem. 261,9079-9082

6888-6892

Funct. 15,67-72

10. Takahashi, M., and Tomizawa, K. (1990) Eur. J . Biochem. 192,735-740 11. Tomkinson, A. E., Roberts, E., Daly, G., Totty, N. F., and Lindahl, T.

12. Elder, R. H:, Montecucco, A., Ciarrocchi, G., and Rossignol, J.-M. (1992)

13. Tsukada, K., and Ichimura, M. (1971) Biochem. Biophys. Res. Commun.

(1991) J. B~ol. Chem. 266,21728-21735

Eur. J. Btochem. 203,53-58

42, 1156-1161

H. Teraoka, F. Watanabe, and H. Minami, unpublished data.

24162 ~xpresswn of Active an DNA Ligase I in E. coli Cells 14. Tsukada, K., and Ito, N. (1972) J. Bkhem. (Tokyo) 72,1299-1305 15. Tsukada, K., Hokari, S., Hayasaki, N., and Ito, N. (1972) Cancer Res. 32,

886-iUR 16. 17. 18. 19.

20.

21.

22. 23.

24. 25.

Tsukada, K. (1974) Bkhem. Bwphys. Res. Commun. 67,758-762 Soderhall, S. (1976) Nature 260,640-642 Soderhall, S., and Lindahl, T. (1976) FEES Lett. 67, 1-8 Nakaya, N., Sawasaki, Y., Teraoka, H., Nakajima, H., and Tsukada, K.

Teraoka, H., Tamura, S., and Tsukada, K. (1979) Biochim. Biophys. Acta

Teraoka, H., Okamoto, N., Tamura, S., and Tsukada, K. (1981) Biochim.

". "_

(1977) J. Biochem. (Tokyo) 81,1575-1577

663,535-539

Teraoka, H., and Tsukada, K. (1982) J. Bioi. Chem. 257,475-763 Mezzina. M.. Suarez. H. C.. Cassineena. R.. and Sarasin. A. (19822) Nucleic

Bwphys. Acta 663,408-411

AcidsRes.'lO, 5073-5OG ~ ' ~ ~~~

. ~~~~ ,~ ~

Chan, J. Y. H., and Becker, F. F. (1985) Carcinogenesis 6.1275-1277 Teraoka. H.. Sawai. M.. Yamamoto. K.. and Tsukada. K. (1992) Biochem.

26. Petrini, J. H. J., Huwiler, K. G., and Wever, D. T. (1991) Proc. Natt. Acad. Sei. U. S. A. 88.7615-7619

27. Barnes, D. E., Johnston, L. H., Kodama, K., Tomkinson, A. E., Lasko, D. D., and Lindahl, T. (1990) Pm. Nuti. Acad. Sci. U. S. A. 87,6679-6683

28. Kodama, K., Barnes, D. E., and Lindahl. T. (1991) Nuclerc Ac& Res. 19, 6093-6099

29. Tomkinson, A. E., Lasko, D. D., Daly, G., and Lindahl, T. (1990) J. Biol.

30. Yanisch-Perron, C., Vieira, J., and Messing, J. (1985) Gene (Amst.) 33, Chem. 265,12611-12617

103-119 31. Studier, F., and Moffatt, A. B. (1986) J. Mol. Biol. 189,141-144

33. Kurihara, T., Teraoka, H., Inoue, M., Takebe, H., and Tatsumi, K, (1991) 32. Date, T., Tanihara, K., and Nomura, N. (1990) Gene (Amst.) 90, 141-144

34. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254 35. Teraoka, H., and Tsukada, K. (1987) J. B k h e m . (Tokyo) 101,225-231 36. Teraoka, H., Ohmura, N., and Tsukada, K. (1989) Biochem. Intern. 18,

37. Teraoka, H., Sawai, M., and Tsukada, K. (1983) Biochim Siophys. Acta

38. Teraoka, H., Sawai, M., and Tsukada, K. (1984) J. Biochem. (Tokyo) 96,

39. Elder, R. H., and Rossi 01, J.". (1990) Biochemistry 29,6009-6017 40. Varshavsky, A. (1992) 8% 69, 725-735 41. Tomkinson, A. E., Totty, N. F., Ginsburg, M., and Lindahl, T. (1991) Pm.

Natl. Acad. Sei. U. S. A. 88,400-404 42. Prigent, C., Lasko, D. D., Kodama, K., Woodgett, J. R., and Lindahl, T.

43. Iijima, S., Teraoka, H., Date, T., and Tsukada, K. (1992) Eur. J. Bwchem.

Jpn. J. Cancer Res. 82,51-57

1203-1210

747,117-122

1529-1532

(1992) EMBO J. 11,2925-2933

206,595-603