ARTICLE

The GxSxG motif of Arabidopsis monoacylglycerol lipase(MAGL6 and MAGL8) is essential for their enzyme activities

Ryeo Jin Kim1 . Mi Chung Suh1

Received: 8 September 2016 / Accepted: 14 October 2016 / Published online: 25 October 2016

� The Korean Society for Applied Biological Chemistry 2016

Abstract Monoacylglycerol lipase (MAGL) catalyzes the

hydrolysis of monoacylglycerols (MAG) to free fatty acids

and glycerol, which is the last step of triacylglycerol

breakdown. Among sixteen members, Arabidopsis thaliana

MAGL6 (AtMAGL6) and AtMAGL8 showed strong lipase

activities, but several AtMAGLs including AtMAGL16

displayed very weak activities (Kim et al. in Plant. J

85:758–771, 2016). To understand the internal factors that

influence Arabidopsis MAGL activities, this study inves-

tigated the significance of ‘GxSxS motif,’ which is con-

served in MAGLs. First, we observed that the presence of a

serine protease inhibitor, phenylmethylsulfonyl fluoride,

decreased the enzyme activity of AtMAGL6 and

AtMAGL8 by IC50 values of 2.30 and 2.35, respectively.

Computational modeling showed that amino acid changes

of the GxSxG motif in AtMAGL6 and AtMAGL8 altered

the nucleophilic elbow structure, which is the active site of

MAGLs. Mutating the GxSxG motif in the recombinant

maltose binding protein (MBP):AtMAGL6 and MBP:At-

MAGL8 proteins to SxSxG, GxAxG, and GxSxS motifs

completely demolished the activities of the mutant

MAGLs. In contrast, no significant differences were

observed between the activities of AtMAGL16 wild type

form harboring the SxSxG motif, and mutant AtMAGL16

containing the GxSxG motif. These results revealed that

the glycine and serine residues of the GxSxG motif are

essential for AtMAGL6 and AtMAGL8 enzyme activities,

and that AtMAGL16 may not be involved in the hydrolysis

of lipid substrates.

Keywords Arabidopsis thaliana � GxSxG motif �Monoacylglycerol lipase (MAGL) � Storage oil �Triacylglycerol mobilization

Introduction

Triacylglycerol (TAG), a storage oil, is found in seeds, fruit

mesocarp, pollen grains, and senescing leaves (Huang

1992; Kaup et al. 2002; Kim et al. 2002). During seed and

pollen maturation, TAG synthesized on the endoplasmic

reticulum (ER) accumulates in the oil body, surrounded by

a single membrane through blebbing of the outer mem-

brane of the ER (Huang 1996; Li-Beisson et al. 2013).

When seeds and pollen grains germinate, the stored TAG is

mobilized to supply carbon and energy sources for growing

tissues (Graham 2008). In Arabidopsis thaliana, the initial

step of TAG breakdown that produces diacylglycerol

(DAG) and a free fatty acid from TAG is mediated by TAG

lipases, SUGAR-DEPENDENT1 (SDP1) or SDP1-LIKE

(SDP1L) (Eastmond 2006; Kelly et al. 2011; Theodoulou

and Eastmond 2012). DAG lipase, which catalyzes the

hydrolysis of DAG to MAG and free fatty acid, has not yet

been identified; but the molecular and biochemical char-

acterizations of MAGLs that produce the glycerol and free

fatty acid from MAG were recently reported (Kim et al.

2016). Fourteen recombinant MAGL proteins in-frame

with maltoase binding protein (MBP) were purified as a

soluble form, when 16 MAGL genes, which are present in

Arabidopsis acyl-lipid metabolism (http://aralip.plantbiol

ogy.msu.edu), were expressed in Escherichia coli. Upon

verifying lipase activities using a non-esterified fatty acid

(NEFA)-HR (2) colorimetric kit, AtMAGL6 and

AtMAGL8 exhibited nearly homologous activity to that of

& Mi Chung Suh

mcsuh@chonnam.ac.kr

1 Department of Bioenergy Science and Technology, Chonnam

National University, Gwangju 61186, Republic of Korea

123

Appl Biol Chem (2016) 59(6):833–840 Online ISSN 2468-0842

DOI 10.1007/s13765-016-0232-1 Print ISSN 2468-0834

human (Homo sapiens) MAGL (HsMAGL). Conversely,

the rest of the recombinant MAGL proteins exhibited rel-

atively low lipase activities (Kim et al. 2016). Therefore,

the internal factors that are able to affect Arabidopsis

MAGL activities should be further investigated.

The catalytic triad, which refers to three amino acid

residues, serine (S) in the GxSxG motif, aspartic acid (D),

and histidine (H), is known to act together at the active site

of hydrolase and transferase enzymes, such as proteases,

acylases, and lipases (Brumlik and Buckley 1996; Polgar

2005). The amino acid residues in the GxSxG motif of

mouse (Mus musculus) MAG lipase were reported to be

essential for their enzyme activity via site-directed muta-

genesis (Karlsson et al. 1997). Comparative analysis of

protein models of human MAG lipase to those of

chloroperoxidase F having substrate specificity for small

ions, and dog (Canis lupus) gastric and human pancreatic

lipases that utilize TAG as a specific substrate, revealed

that human MAG lipase may harbor substrate specificity

for other molecules than small ions and TAG, based on

their protein structural differences around the nucleophilic

serine residue in the GxSxG motif (Labar et al. 2010).

Although 9 of 11 Arabidopsis MAGL members harbor the

GxSxG motif, interestingly the levels of their MAG lipase

activities were very diverse (Kim et al. 2016). In particular,

AtMAGL14 and AtMAGL16, which contain the SxSxG

motif instead of the GxSxG motif, also displayed very low

lipase activities (Kim et al. 2016).

Therefore, to investigate the importance of the GxSxG

motif in Arabidopsis MAGLs, the enzyme activity of

Arabidopsis MAGLs was first measured in the presence of

a serine protease inhibitor, phenylmethylsulfonyl fluoride

(PMSF). Computational modeling of Arabidopsis MAGLs

(AtMAGL-6, -8, and -16) and their mutated proteins with

amino acid substitutions in a GxSxG motif suggested that

the GxSxG motif might be important for the enzymatic

activity of MAG lipases. More specifically, the GxSxG

motif of AtMAGL6 and AtMAGL8 was mutated to the

SxSxG, GxAxG, or GxSxS motif by PCR-based site-di-

rected mutagenesis. In addition, the first serine residue of

the SxSxG motif in AtMAGL16 was substituted by a

glycine residue, thereby creating the recombinant

AtMAGL16 protein with the GxSxG motif. As a result, we

observed that two glycine residues and one serine residue

in the GxSxG motif of AtMAGL6 and AtMAGL8 are vital

for their lipase activities. Even though the AtMAGL16 has

the GxSxG motif, no significant elevation in lipase enzyme

activity was observed, suggesting that there might be

unknown essential domains that influence the enzymatic

activity of AtMAGL16, or AtMAGL16 may act on other

substrates than lipid substrates, such as MAG. To the best

of our knowledge, this is the first report to demonstrate that

the GxSxG motif might be essential for plant MAG lipases.

Materials and methods

Site-directed mutagenesis of Arabidopsis MAGLs

We carried out a point mutation using an overlap extension

PCR to substitute the amino acid residues in the GxSxG

motif of AtMAGL6 and AtMAGL8 with SxSxG, GxAxG,

and GxSxS motifs (Ho et al. 1989). The mutagenic primers

were designed for substitution of the nucleotide sequences:

glycine to serine residues, or serine to alanine or glycine

residues (Table 1). According to Ho et al. (1989), three-step

PCR was carried out with the forward, reverse, and muta-

genic primers, and with MBP:AtMAGL6, MBP:AtMAGL8,

MBP:AtMAGL16, and MBP:HsMAGL clones as a template

(Kim et al. 2016): (1) the 50-mutated PCR fragments were

amplified with the forward and mutagenic reverse primers;

(2) the 30-mutated PCR fragments were amplified with the

mutagenic forward and reverse primers; and (3) the mutated

full-length PCR fragments were amplified with the forward

and reverse primers using the obtained 50- and 30-mutated

fragments as templates. The mutated AtMAGL6,

AtMAGL8, and AtMAGL16 PCR fragments were cloned in

the BamHI/PstI or BamHI/SalI enzyme sites of the pMAGL-

C2 vector (New England Biolabs, Hitchin, UK).

Purification of recombinant proteins from E. coli

MBP, MBP:HsMAGL, MBP:AtMAGL6, MBP:AtMAGL6_

G111S, MBP:AtMAGL6_S113A, MBP:AtMAGL6_G115S,

MBP:AtMAGL8, MBP:AtMAGL8_G117S, MBP:AtMAGL8_

S119A, MBP:AtMAGL8_G121S, MBP:AtMAGL16, and

MBP:AtMAGL16_S139G vectors were transformed into

E. coliBL21 (DE3)-RIL strains (Kim et al. 2016). At an OD of

0.6–0.7, theE. coli cells were induced with 0.5 mM isopropyl-

b-D-thiogalactopyranoside. After 12 h of incubation at 37 �C,

E. coli cells were harvested and resuspended in buffer

(200 mM NaCl, 20 mM Tris–HCl, pH 7.4, 10 mM b-mer-

captoethanol, and 1 mM EDTA). After the addition of 100 lg

mL-1 lysozyme (Sigma-Aldrich, St. Louis, MO, USA),

resuspended cells were incubated on ice for 30 min. Incubated

cells were lysed on ice with a Vibra-Cell sonicator (Sonics and

Materials Inc., Newtown, CT, USA). MBP and MBP:MAGL

proteins were purified using amylose resin (New England

BioLabs) and electrophoresed on 12 % SDS–polyacrylamide

gels. Proteins were visualized by staining the gel with 0.2 %

Coomassie Brilliant Blue R-250 (Bio-Rad, Hercules, CA,

USA).

Measurement of MAGL activity

The lipase assay was performed as previously described by

Kim et al. (2016). The MBP:MAGL proteins were

834 Appl Biol Chem (2016) 59(6):833–840

123

quantified using the Bradford methods (Bradford 1976).

The purified MBP:MAGL proteins (0.1 lg) were incubated

in 100 ll of 50 mM sodium phosphate buffer (pH 8.0) or

glycine–NaOH buffer (pH 9.0), 0.2 % Triton X-100, and

150 lM MAG (M7640; Sigma-Aldrich) containing an

linoleic acid at the sn-1 position for 5 min at 30 �C. The

released NEFAs were measured with the commercial

NEFA-HR kit (Wako Pure Chemicals, Osaka, Japan), using

Synergy H1 Hybrid Readers (BioTek, Winooski, USA) at

546 nm.

Inhibition assays

The MBP, MBP:HsMAGL, and MBP:AtMAGL proteins

(0.1 lg) were preincubated with a PMSF inhibitor for

10 min at 37 �C in assay buffer (50 mM sodium phosphate

buffer, pH 8.0, or glycine–NaOH buffer, pH 9.0).

Linoleoylglycerol (sn-1 MAG; M7640; Sigma-Aldrich)

substrates were emulsified at 0.2 % Triton X-100 by son-

ication for 30 s with three repeats. MAG substrates

(150 lM in final concentration) were added to the prein-

cubated samples, and the reaction mixtures were incubated

for an additional 5 min at 30�C. The released NEFA

products were measured with the NEFA-HR colorimetric

method assay kit, using Synergy H1 Hybrid Readers at

546 nm.

Prediction of 3-dimensional protein structures

The crystal structure of a human MAGL (PDB ID: 3HJU;

http://www.rcsb.org/pdb/) was used as a template for the

computational modeling. The modeling of AtMAGLs and

their mutated proteins was performed using the Protein

Homology/analogY Recognition Engine V 2.0 program

(PHYRE2; http://www.sbg.bio.ic.ac.uk/phyre2). Three-di-

mensional (3D) protein graphic images were produced

using the UCSF Chimera version 1.10.2 program (http://

www.cgl.ucsf.edu/chimera).

Results and discussion

Phylogenetic relationships of MAGLs

between Arabidopsis and other species

Given that there have been few studies on plant MAGLs,

we compared the phylogenetic relationship between Ara-

bidopsis and other species MAGLs. After obtaining the

amino acid sequences of human, mouse, rat (Rattus

norvegicus), and yeast (Saccharomyces cerevisiae) MAGL

genes from NCBI (http://www.ncbi.nlm.nih.gov), we con-

ducted multiple alignments on them with the amino acid

sequences of AtMAGL6, AtMAGL8, and AtMAGL16

using ClustalW (http://www.genome.jp/tools/clustalw/)

Table 1 List of primers used in

this studyPrimer names Sequence information (50 to 30) Tm (�C)

AtMAGL6_BamH1_F GGAGGATCCATGGTTATGTATGAAGAGGATTTTGTGTTG 58

AtMAGL6_Pst1_R GCCCTGCAGTTATTTATGCTTCAAGAATCCATCATG 58

AtMAGL6_SxSxG_F AGGTTCCTACTTTCTGAATCCATGGGA 58

AtMAGL6_SxSxG_R TCCCATGGATTCAGAAAGTAGGAACCT 58

AtMAGL6_GxAxG_F CTACTTGGAGAAGCAATGGGAGGAGCA 58

AtMAGL6_GxAxG_R TGCTCCTCCCATTGCTTCTCCAAGTAG 58

AtMAGL6_GxSxS_F GGAGAATCCATGTCAGGAGCAGTTGTG 58

AtMAGL6_GxSxS_R CACAACTGCTCCTGACATGGATTCTCC 58

AtMAGL8_BamH1_F GGAGGATCCATGGCAAGTGAAACAGAGAACATCAAG 58

AtMAGL8_Pst1_R GCCCTGCAGCTACCCTTTCAAAGGAATACCATCATTTTTA 58

AtMAGL8_SxSxG_F AGGTTCTTGTTATCTGAATCAATGGGA 58

AtMAGL8_SxSxG_R TCCCATTGATTCAGATAACAAGAACCT 58

AtMAGL8_GxAxG_F TTGTTAGGAGAAGCAATGGGAGGAGCA 58

AtMAGL8_GxAxG_R TGCTCCTCCCATTGCTTCTCCTAACAA 58

AtMAGL8_GxSxS_F GGAGAATCAATGTCAGGAGCAGTGCTT 58

AtMAGL8_GxSxS_R AAGCACTGCTCCTGACATTGATTCTCC 58

AtMAGL16_BamH1_F GGAGGATCCATGGGGTTGCATCCAATTTCC 58

AtMAGL16_Sal1_R CCGGTCGACCTAAGCTGCTCCTCCATCAACG 58

AtMAGL16_Sal1_R CCGGTCGACCTAAGCTGCTCCTCCATCAACG 58

AtMAGL16_GxSxG_F TGTTTTCTCTACGGTGAATCCCTAGGC 58

AtMAGL16_GxSxG_R GCCTAGGGATTCACCGTAGAGAAAACA 58

Appl Biol Chem (2016) 59(6):833–840 835

123

and subsequently generated their phylogenetic tree using

MEGA5.2 (Tamura et al. 2011). In Fig. 1A, the catalytic

triad was conserved in MAGLs from all species tested,

while the GxSxG lipase motif was shown in every MAGL

except AtMAGL16. In addition, the phylogenetic tree in

Fig. 1B showed that yeast MAGL branched into mam-

malian and plant MAGLs. The amino acid sequences of

mouse and rat MAGLs have approximately 92 % identity,

while the former and the latter have approximately 84 and

84 % identity with human MAGL, respectively. Ara-

bidopsis MAGL6 and MAGL8 have approximately 74 %

identity with each other, whereas they showed relatively

low identity (34–35 %) with AtMAGL16.

Computational modeling of Arabidopsis MAGLs

and their mutated proteins

To investigate the tertiary structure of the narrow region sur-

rounding the GxSxG motif in Arabidopsis MAGLs, compu-

tational modeling of Arabidopsis MAGL and their mutated

proteins was carried out using HsMAGL protein structure

(Labar et al. 2010) as a template and the PHYRE2 program.

The tertiary protein structure images were visualized by the

UCSF Chimera program. Figure 2A and B show the ribbon

structures of HsMAGL and AtMAGL8 proteins harboring the

GxSxG motif and Asp (D) and His (H) residues. Through a

cross-section of 3-dimensional AtMAGL6 and AtMAGL8

structures, a U-shaped nucleophilic elbow structure around

the nucleophilic serine residue in the GxSxG motif is high-

lighted (Fig. 2C, G). When the GxSxG motif in AtMAGL6

and AtMAGL8 proteins was replaced with the SxSxG,

GxAxG, or GxSxS motif, the shape of the nucleophilic elbow

around the nucleophilic serine changed to a wider W shape

(Fig. 2D–F, H–J). In addition, when the SxSxG motif of

AtMAGL16 was substituted with the GxSxG motif, the size of

the wide nucleophilic elbow reduced, but did not completely

recover to the U-shaped nucleophilic elbow structure

(Fig. 2K, L). Therefore, the computational modeling of Ara-

bidopsis MAGLs and their mutated proteins also indicates that

the GxSxG motif might exert effects on the enzymatic activity

of Arabidopsis MAGLs.

Inhibition of enzyme activities of AtMAGL6 and 8

in the presence of PMSF, which is a serine protease

inhibitor

To understand the role of the GxSxG motif in the activities of

Arabidopsis MAGLs, we investigated the effect of a serine

protease inhibitor, PMSF, on the lipase activities of

AtMAGL6 and AtMAGL8 (Muccioli et al. 2008). Figure 3A

shows that PMSF is able to produce an irreversible MAGL–

PMSF adduct and hydrofluoric acid (HF), by specifically

* (A)

Homo sapiens

AtMAGL8 AtMAGL6

AtMAGL16 Saccharomyces cerevisiae

Mus musculus Rattus norvegicus

: 128 : 128 : 138 : 119 : 125 : 147 : 129

: 273 : 273 : 283 : 267 : 273 : 296 : 285

* *

(B) Mus musculus Rattus norvegicus

Homo sapiens AtMAGL6

AtMAGL8 AtMAGL16

Saccharomyces cerevisiae

100

98

100 100

0.2

Fig. 1 Amino acid sequence alignment and phylogenetic relationship

of MAGLs from Arabidopsis and other species. The deduced amino

acid sequences of seven MAGL genes were aligned by CLUSTALX

version 2.1. The accession numbers of the aligned MAG lipases in

Arabidopsis database (http://www.arabidopsis.org) or GenBank

(http://www.ncbi.nlm.nih.gov/) are as follows: AtMAGL6;

At2g39400, AtMAGL8; At2g39420, AtMAGL16; At5g19290, human

(Homo sapiens) MAGL; AAH06230.1, mouse (Mus musculus)

MAGL; CAC69874.1, rat (Rattus norvegicus) MAGL; ALL87453.1

and yeast (Saccharomyces cerevisiae) MAGL; CAA81932.1. The

conserved and identical amino acid residues are shaded in gray and

black, respectively. (A) The GxSxG and SxSxG motifs are shown in

red box. The amino acid residues of the catalytic triad, Ser, Asp, and

His, are marked by asterisks. (B) The phylogenetic tree was generated

from alignments of deduced amino acid sequences of MAGLs from

Arabidopsis and other species, using the maximum likelihood method

based on the WAG model, and gamma distributed with invariant sites

(I) in the MEGA program (version 5.2; Tamura et al. 2011). The

bootstrap value percentages of 500 replicates are shown at the

branching points (Felsenstein 1985). The scale bar represents the

distance unit between sequence pairs

836 Appl Biol Chem (2016) 59(6):833–840

123

binding to the hydroxyl group of the serine residue in the

active site of the serine protease, thereby inhibiting its enzy-

matic activity (Han et al. 2012). MBP, MBP:AtMAGL6,

MBP:AtMAGL8, and MBP:HsMAGL proteins were

expressed in E. coli and purified using amylose resin. Each

purified protein was incubated at different concentrations of

PMSF and further incubated in the reaction buffer with MAG

substrates. Finally, the amount of non-esterified fatty acid

(NEFA) products was measured using the NEFA assay kit. As

a result, the half maximal inhibitory concentration (IC50)

values for MBP:HsMAGL, MBP:AtMAGL6, and MBP:At-

MAGL8 proteins in response to PMSF were calculated to be

3.30, 2.30, and 2.35, respectively, indicating that Arabidopsis

MAGLs have a similar inhibition rate to that of human MAGL

at 10 times higher PMSF concentration (Fig. 3B). These

results suggest that the serine residue present in the active site

of Arabidopsis and human MAGLs is important for MAGL

lipase activity.

With respect to the activity of recombinant HsMAGL

proteins, the IC50 values in response to PMSF were 3.30

and 3.20, when 7-HCA (7-hydroxycoumarinyl arachido-

nate) and 4-NPA (4-nitrophenylacetate) substrates,

respectively, were used (Muccioli et al. 2008; Savinainen

et al. 2010). Rat MAG lipase had an IC50 value of 3.81 in

Fig. 2 Comparison of three-dimensional protein models between

Arabidopsis MAGLs and their mutated forms. (A, B) Three-dimen-

sional protein models of (A) HsMAGL, and (B) AtMAGL proteins,

which are represented by the catalytic triad, the Ser (S) in the GxSxG

motif, His (H), and Asp (D). (C–L) Transverse sections for

environments near the nucleophilic elbow serine residue in the

catalytic triad of Arabidopsis MAGLs and their mutated proteins. The

U- or W-shaped lines along the nucleophilic serine residues are

shown in red. (C) AtMAGL8 having the GxSxG motif, and mutated

AtMAGL8 containing (D) G117S, (E) S119A, or (F) G121S in the

GxSxG motif. (G) AtMAGL6 harboring the GxSxG motif, and

mutated AtMAGL6 having (H) G111S, (I) S113A, or (J) G115S in

the GxSxG motif. (K) AtMAGL16 having the SxSxG motif, and

(L) mutated AtMAGL16 containing S139G in the SxSxG motif

Appl Biol Chem (2016) 59(6):833–840 837

123

response to PMSF, when 2-arachidonoylglycerol (2-AG)

was used as a substrate (Saario et al. 2004). The present

study also confirmed that even though a MAG substrate

was utilized, the IC50 value of MBP:HsMAGL in response

to PMSF was similar to the existing values.

Effect of amino acid substitutions on Arabidopsis

MAG lipase activity

The computational modeling of Arabidopsis MAGLs and

the inhibition of enzymatic activity of Arabidopsis MAGLs

in response to PMSF strongly prompted us to examine the

significance of each amino acid residue in the GxSxG motif

of Arabidopsis MAGLs in their enzymatic activity. Thus,

the GxSxG motif of AtMAGL6 and 8 was replaced with

the SxSxG, GxAxG, or GxSxS motif. In addition, the first

serine residue in the SxSxG motif of AtMAGL16 was

substituted with a glycine residue to investigate if very low

lipase activities of AtMAGL16 are caused by the presence

of the SxSxG motif instead of the GxSxG motif (Fig. 4).

After the transformation of all recombinant vectors in

E. coli, the induced proteins were purified and elec-

trophoresed on 12 % SDS-PAGE. Approximately 43 kDa

of MBP and approximately 72 kDa of MBP:AtMAGL6,

MBP:AtMAGL6_G111S, MBP:AtMAGL6_S113A, MBP:

AtMAGL6_G115S, MBP:AtMAGL8, MBP:AtMAGL8_

G117S, MBP: AtMAGL8_S119A, MBP: AtMAGL8_

G121S, MBP:AtMAGL16, and MBP: AtMAGL16_S139G

were identified (Fig. 5). Lipase activities of the purified

proteins were measured using the NEFA assay kit, when

the MAG substrates containing 18:2 fatty acids at the sn-1

position were supplemented.

In agreement with the findings of Kim et al. (2016), the

lipase activities of AtMAGL6 and AtMAGL8 were

observed to be 21.8 and 19.3 lmol mg-1 min-1, respec-

tively, but no lipase activity was observed in six types of

log[PMSF]

MBP HsMAGL

AtMAGL6

+

Ser

Ser HO

PMSF MAGL

MAGL-PMSF adduct

+ HF

AtMAGL8

0

20

40

60

80

100

-7 -6 -5 -4 -3 -2 -1 0

MA

GL

activ

ity

(% c

ontro

l)

(A)

(B)

Fig. 3 Effect of a serine protease inhibitor, PMSF on the activities of

maltose-binding protein (MBP) and the recombinant MBP:HsMAGL,

MBP:AtMAGL6, and MBP:AtMAGL8 proteins. (A) A proposed

mechanism for covalent inactivation of a MAGL protein by a PMSF

inhibitor. HF Hydrofluoric acid. (B) Dose-dependent inhibition of

MAGLs by a PMSF inhibitor. MBP, MBP:HsMAGL, MBP:At-

MAGL6, and MBP:AtMAGL8 proteins (0.1 lg) were preincubated

with a PMSF inhibitor (10-7–10-1 mM) for 10 min at 25 �C in lipase

assay buffer (Kim et al. 2016). Following preincubation, emulsified

MAG substrates containing an 18:2 fatty acid at the sn-1 position

were added, and incubated for an additional 5 min at 30 �C. The

values for MAGL activity are an average of three independent

experiments ± standard errors

malE

BamH1 Pst1

G117xS119xG121

AtMAGL8

MBP:AtMAGL8

malE

BamH1 Pst1

G117xS119xS121

AtMAGL8

MBP:AtMAGL8_G121S

malE

BamH1 Pst1

G117xA119xG121

AtMAGL8

MBP:AtMAGL8_S119A

malE AtMAGL16

BamH1 Sal1

S139xS141xG143

MBP:AtMAGL16

malE

BamH1 Sal1

G139xS141xG143

AtMAGL16

MBP:AtMAGL16_S139G

Tac_P

malE lacZα

rrnB_TBamH1 Pst1

G111xS113xG115

AtMAGL6

MBP:AtMAGL6

malE

BamH1 Pst1

G111xS113xS115

AtMAGL6

MBP:AtMAGL6_G115S

malEBamH1 Pst1

G111xA113xG115

AtMAGL6

MBP:AtMAGL6_S113A

malE

BamH1 Pst1

S111xS113xG115

AtMAGL6

MBP:AtMAGL6_G111S

malE

BamH1 Pst1

S117xS119xG121

AtMAGL8

MBP:AtMAGL8_G117S

Fig. 4 Schematic diagrams of expression vectors harboring the

recombinant MBP:MAGLs and their mutated proteins

838 Appl Biol Chem (2016) 59(6):833–840

123

mutated proteins (Table 2). This result indicates that two

glycine residues and a serine residue in the GxSxG motif

present in AtMAGL6 and AtMAGL8 are integral to the

lipase activity. Although in the case of AtMAGL16 the

SxSxG motif was changed into the GxSxG, no significant

changes in the lipase activity were observed (Table 2),

suggesting that AtMAGL16 may be an enzyme that

degrades other substrates, not MAG.

To date, little is known about alterations in enzyme

activities by a point mutation of the amino acid residues in

the GxSxG motif present in the MAG lipases. However, the

essential role of GxSxG motif existing in various types of

lipases has been reported (Kurat et al. 2006; Rabin and

Hauser 2005; Wada et al. 2009). As evidenced, the com-

plete deletion of the GxSxG motif in mouse phospholipase

A2 (PLA2) almost eliminated its enzymatic activity (Wada

et al. 2009). Also, mutating the serine residue in the GxSxG

motif of Pseudomonas aeruginosa patatin-like phospholi-

pase and yeast triglyceride lipase 4 with an alanine residue

almost demolished their lipase activities (Rabin and Hauser

2005; Kurat et al. 2006).

In conclusion, very few studies have been reported

about plant MAG lipases, because their functions could

not be inferred from amino acid sequence similarity. In

the current study, we revealed that glycine residues, as

well as a serine residue within the GxSxG motif in

Arabidopsis MAGL6 and MAGL8, are critical for MAG

lipase activity. Although AtMAGL16 was mutated to

contain the GxSxG motif in its active site, its MAG lipase

activity was not significantly increased, suggesting that

AtMAGL16 may not be a MAG lipase. Taken together,

this study provides information about the essential motif

of plant MAGLs, which among the genes involved in

plant lipid metabolism have been least studied (McGlew

et al. 2015).

Table 2 Effect of amino acid

substitutions on MAG lipase

activity

Proteins Motifs Activity

(lmol mg-1 min-1)

Mutated motifs Activity

(lmol mg-1 min-1)

MBP – ND – ND

AtMAGL6 GxSxG 21.8 ± 0.98 SxSxG ND

GxAxG ND

GxSxS ND

AtMAGL8 GxSxG 19.3 ± 0.60 SxSxG ND

GxAxG ND

GxSxS ND

AtMAGL16 SxSxG 0.13 ± 0.00 GxSxG 0.20 ± 0.00

ND Non-detected

The recombinant AtMAGLs, mutated AtMAGLs by point mutations, and MBP were incubated with lipid

substrate containing 18:2 fatty acids at the sn-1 MAG at 30 �C for 5 min, and the released non-esterified

fatty acid products were measured using the NEFA assay kit (Wako Pure Chemicals)

Lipid substrate was emulsified with 0.2 % Triton X-100 by sonication. The values (lmol mg-1 min-1) are

an average of three independent experiments ± standard errors

M MBP 1 2 3 4 5 6 7 8 9 10 KDa

10

72

34

130

Fig. 5 SDS-polyacrylamide gel electrophoresis of the purified MBP,

MBP:MAGLs, and mutated MBP:MAGLs. MBP and MBP:MAGLs

were purified from E. coli, electrophoresed on a 12 % SDS-PAGE

gel, and stained with Coomassie blue R-250. MBP and MBP:MAGLs

are indicated by black arrowheads. M Molecular weight standard

[Fermentas, kilodalton (kDa)]; MBP *43 kDa; 1 MBP:AtMAGL6; 2

MBP:AtMAGL6_G111S; 3 MBP:AtMAGL6_S113A; 4 MBP:At-

MAGL6_G115S; 5 MBP:AtMAGL8; 6 MBP:AtMAGL8_G117S; 7

MBP: AtMAGL8_S119A; 8 MBP: AtMAGL8_G121S; 9 MBP:At-

MAGL16; 10 MBP: AtMAGL16_S139G

Appl Biol Chem (2016) 59(6):833–840 839

123

Acknowledgments This work was supported by grants from the

National Research Foundation (NRF-2016R1A2B2010068) of Korea

and the Next-Generation BioGreen 21 Program (No. PJ011052) of the

Rural Development Administration, Republic of Korea.

References

Bradford MM (1976) A rapid and sensitive method for the

quantitation of microgram quantities of protein utilizing the

principle of protein-dye binding. Anal Biochem 72:248–254

Brumlik MJ, Buckley JT (1996) Identification of the catalytic triad of

the lipase/acyltransferase from Aeromonas hydrophila. J Bacte-

riol 178:2060–2064

Eastmond PJ (2006) SUGAR-DEPENDENT1 encodes a patatin

domain triacylglycerol lipase that initiates storage oil breakdown

in germinating Arabidopsis seeds. Plant cell 18:665–675

Felsenstein J (1985) Confidence limits on phylogenies: an approach

using the bootstrap. Evolution 39:783–791

Graham IA (2008) Seed storage oil mobilization. Annu Rev Plant

Biol 59:115–142

Han Q, Robinson H, Li J (2012) Biochemical identification and

crystal structure of kynurenine formamidase from Drosophila

melanogaster. Biochem J 446:253–260

Ho SN, Hunt HD, Horton RM, Pullen JK, Peasea LR (1989) Site-

directed mutagenesis by overlap extension using the polymerase

chain reaction. Gene 77:51–59

Huang AH (1992) Oil bodies and oleosins in seeds. Annu Rev Plant

Physiol Plant Mol Biol 43:177–200

Huang AH (1996) Oleosins and oil bodies in seeds and other organs.

Plant Physiol 110:1055–1061

Karlsson M, Contreras JA, Hellman U, Tornqvist H, Holm C (1997)

cDNA Cloning, tissue distribution, and identification of the

catalytic triad of monoglyceride lipase. J Biol Chem

272:27218–27223

Kaup MT, Froese CD, Thompson JE (2002) A role for diacylglycerol

acyltransferase during leaf senescence. Plant Physiol

129:1616–1626

Kelly AA, Quettier AL, Shaw E, Eastmond PJ (2011) Seed storage oil

mobilization is important but not essential for germination or

seedling establishment in Arabidopsis. Plant Physiol

157:866–875

Kim HU, Hsieh K, Ratnayake C, Huang AH (2002) A novel group of

oleosins is present inside the pollen of Arabidopsis. J Biol Chem

277:22677–22684

Kim RJ, Kim HJ, Shim D, Suh MC (2016) Molecular and

biochemical characterizations of the monoacylglycerol lipase

gene family of Arabidopsis thaliana. Plant J 85:758–771

Kurat CF, Natter K, Petschnigg J, Wolinski H, Scheuringer K, Scholz

H, Zimmermann R, Leber R, Zechner R, Kohlwein SD (2006)

Obese yeast: triglyceride lipolysis is functionally conserved from

mammals to yeast. J Biol Chem 281:491–500

Labar G, Bauvois C, Borel F, Ferrer JL, Wouters J, Lambert DM (2010)

Crystal structure of the human monoacylglycerol lipase, a key

actor in endocannabinoid signaling. ChemBioChem 11:218–227

Li-Beisson Y, Shorrosh B, Beisson F, Andersson MX, Arondel V,

Bates PD, Baud S, Bird D, Debono A, Durrett TP, Franke RB,

Graham IA, Katayama K, Kelly AA, Larson T, Markham JE,

Miquel M, Molina I, Nishida I, Rowland O, Samuels L, Schmid

KM, Wada H, Welti R, Xu C, Zallot R, Ohlrogge J (2013) Acyl-

lipid metabolism. Arabidopsis Book 11:e0161

McGlew K, Shaw V, Zhang M, Kim RJ, Yang W, Shorrosh B, Suh

MC, Ohlrogge J (2015) An annotated database of Arabidopsis

mutants of acyl lipid metabolism. Plant Cell Rep 34:519–532

Muccioli GG, Labar G, Lambert DM (2008) CAY10499, a novel

monoglyceride lipase inhibitor evidenced by an expeditious

MGL assay. ChemBioChem 9:2704–2710

Polgar L (2005) The catalytic triad of serine peptidases. Cell Mol Life

Sci 62:2161–2172

Rabin SD, Hauser AR (2005) Functional regions of the Pseudomonas

aeruginosa cytotoxin ExoU. Infect Immun 73:573–582

Saario SM, Savinainen JR, Laitinen JT, Jarvinen T, Niemi R (2004)

Monoglyceride lipase-like enzymatic activity is responsible for

hydrolysis of 2-arachidonoylglycerol in rat cerebellar mem-

branes. Biochem Pharmacol 67:1381–1387

Savinainen JR, Yoshino M, Minkkila A, Nevalainen T, Laitinen JT

(2010) Characterization of binding properties of monoglyceride

lipase inhibitors by a versatile fluorescence-based technique.

Anal Biochem 399:132–134

Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S

(2011) MEGA5: molecular evolutionary genetic analysis using

maximum likelihood, evolutionary distance, and maximum

parsimony methods. Mol Biol Evol 28:2731–2739

Theodoulou FL, Eastmond PJ (2012) Seed storage oil catabolism: a

story of give and take. Curr Opin Plant Biol 15:322–328

Wada H, Yasuda T, Miura I, Watabe K, Sawa C, Kamijuku H, Kojo

S, Taniguchi M, Nishino I, Wakana S, Yoshida H, Seino K

(2009) Establishment of an improved mouse model for infantile

neuroaxonal dystrophy that shows early disease onset and bears a

point mutation in Pla2g6. Am J Pathol 175:2257–2263

840 Appl Biol Chem (2016) 59(6):833–840

123