The 454 and Ion PGM at the Genomics Core Facility

Dr. Deborah Grove, Director for Genetic Analysis

Genomics Core Facility Huck Institutes of the Life Sciences

Penn State University

Services•DNA Sequencing•Illumina, 454 and Ion PGM Next Gen Sequencing•Microarray•Genotyping – VNTRs, SNPs, Open Array•qPCR by Real-Time•DNA Synthesis•DNA Extraction and Storage of DNA from Buccal Swabs

Sequencing at PSU Over the Years

Method ManualGel

Bases per Day

1200

Cycle Sequencing Reaction

Sequencing at PSU Over the Years

Method ManualGel

377 Gel

Bases per Day

1200 20,000

Sequencing at PSU Over the Years

Method ManualGel

377 Gel 3100 –16Capillary

Bases per Day

1200? 20,000 100,000

Sequencing at PSU Over the Years

Method ManualGel

377 Gel 3100 –16Capillary

3730--96Capillary

Bases per Day

1200? 20,000 100,000 0.5 to 1 million

Sequencing at PSU Over the Years

Method ManualGel

377 Gel 3100 –16Capillary

3730--96Capillary

SOLiDNext-Gen

Bases per Day

1200? 20,000 100,000 0.5 to 1 million

1 to 2 Billion

Next-Generation Sequencers:Massively Parallel Platforms

• Roche 454FLX+ v2.8 – 500 million bases per run, 800 to 1000 bases

• Ion PGM 318 chip – 2 to 4 billion bases per run, 400 base length

• (Ion Proton)

Roche 454 – Next Generation Sequencer

• Pyrosequencing

• FLX+ v2.8 has 800 to 1000 bp read

• 160 million bases per

full slide

454 FLX +

454 Titanium Sequencing Applications

• Transcriptome RNA

• Whole Genome -- Paired-End (3kb, 8kb,

20kb) 15 to 30 ugs dsDNA

• Whole Genome – Shotgun

500 ngs dsDNA

• Amplicon/Metagenomics 5 ngs

DNA Fragmentation by nebulization

Fragment End Repair

AMPure Bead Clean up

Adaptor-Ligation

Small Fragment Removal

Library Quality Assessment and Quantification

Primer Sets for Metagenomics

•16s Bacteria

•ITS for Fungus

•18s set for Fungus and other Eukaryotes, targeting Protists

•Archaea targeting both Crenarchaeota and Euryarchaeota

Amplicon Preparation

27F_M6CGTATCGCCTCCCTCGCGCCATCAGATATCGCGAGAGAGTTTGATCMTGGCTCAG 907R_M6TATGCGCCTTGCCAGCCCGCTCAGCCCCGTCAATTCMTTTGAGTTT

16S Variable Regions

27F_M6CGTATCGCCTCCCTCGCGCCATCAGATATCGCGAGAGAGTTTGATCMTGGCTCAG 907R_M6TATGCGCCTTGCCAGCCCGCTCAGCCCCGTCAATTCMTTTGAGTTT

Amplicons

27F518R907R

•One Bead

•One DNA library

•NTPs, Taq etc.

Ion PGM aka Ion Torrent

314 CHIP 316 CHIP

Approximate Cost from Genome Library thru Sequencing

314 Chip 160 million bases, 400,000 reads

318 Chip 3 billion bases, 6 to 8 million reads

$1500 to $2000

Coverage

Full Plate = 1 million reads, 300 million bases

½ plate = 500,000 reads, 150 million bases

1 Quad = 200,000 reads, 60 million bases

Coverage

Full Plate = 1 million reads, 300 million bases

½ plate = 500,000 reads, 150 million bases

1 Quad = 200,000 reads, 60 million bases

http://www.youtube.com/embed/yVf2295JqUg

Coverage

Full Plate = 1 million reads, 300 million bases

½ plate = 500,000 reads, 150 million bases

1 Quad = 200,000 reads, 60 million bases

Full Plate = 1 million reads, 300 million bases

½ plate = 500,000 reads, 150 million bases

1 Quad = 200,000 reads, 60 million bases

Full Plate = 1 million reads, 300 million bases

½ plate = 500,000 reads, 150 million bases

1 Quad = 200,000 reads, 60 million bases

Applications

• Bacterial and Viral Genomes

•Amplicons

•Ampliseq Panels for SNP variants

Ampliseq Cancer Panel

•Only 10 ngs or less

•FFPE tissues

•Single Cells

•Libraries take 3.5 hours

•2800 hot spots

Ampliseq Custom Panels

Use Ion AmpliSeq Designer

P1 Chip 80 million reads, 10 to 15 billion bp

PII Chip 300 million reads, 500 to 800 billion bp

314 Chip 160 million bases, 400,000 reads

318 Chip 3 billion bases, 6 to 8 million reads

Pac Bio

•No amplification required

•Single molecule

•Several thousand base reads (4 to 20 kb)

• Least GC-biased sequencing

•Run time 30 minutes

•Genomes: Finish Genomes and improve assembly with extra long reads (4000bp average and up to 20,000)

• Genomic Complexity: Allow haplotype expansion, full length transcripts and splice variants, repeat expansions, minor variants •Epigenome: Detects base modifications using kinetics

Applications

Thanks to:

The Huck Institutes of the Life SciencesLloyd and Dorothy Huck

And the others in the lab…