Temporal and spatial changes in GATA transcription factor expression are coincident with development of the chicken optic tectum

E L S E V I E R Molecular Brain Research 23 (1994) 100-110

MOLECULAR BRAIN

RESEARCH

Research Report

Temporal and spatial changes in GATA transcription factor expression are coincident with development of the chicken optic tectum

Jon M. Kornhauser ~, Mark W. Leonard ~, Masayuki Yamamoto b, Jennifer H. LaVail ~, Kelly E. Mayo ~, James Douglas Engel ~ ' *

" Department of Biochemistry, Molecular Biology, and Cell Biology, ,Northwestern Unit,ersity, Et,anston, IL 60208-3500, USA, t, Department of Biochemistry, Tohoku Unit~ersity School of Medicine, Sendai 981, Japan, ' Department of Anatomy, Unit'ersity of California,

San Francisco, San Francisco, CA 94143-0452, USA

(Accepted 19 October 1993)

Abstract

The molecular mechanisms specifying patterns of gene expression in the vertebrate brain, which in turn determine the developmental fates of specific neurons, are yet to be clearly defined. Individual members of a recently identified family of transcriptional regulatory proteins, the GATA factors, are required for the differentiation of certain hematopoietic cell lineages. We show here that two of the members of this gene family, GATA-2 and GATA-3, are expressed within discrete cell populations of the chicken optic tectum during embryogenesis, and that they have highly restricted patterns of expression in the developing chicken brain. Furthermore, the induction of GATA factor expression within specific cell layers parallels the well established spatial (rostral to caudal) and temporal pattern of optic tectum development. The observation that both the timing of appearance and the localization of expression of GATA-2 and GATA-3 are correlated with optic tectum development suggest that these transcription factors may be associated with the initiation of gene transcription required for the determination of specific neuronal fates within visual areas of the vertebrate brain.

Key words." GATA; Transcription factor; Neural development; Optic tectum

I. Introduction

The G A T A factors comprise a family of related DNA-binding proteins which act as powerful transcriptional activators in vivo. The ZnZ+-finger D N A binding domains of the G A T A proteins are highly conserved [23,41,42] and all of these factors bind with high affinity to the consensus D N A sequence motif W G A T A R (where W = A or T, and R = A or G [9,23,39,41]). Additionally, GATA-2 and GATA-3 bind with high affinity to the alternative consensus sequences, G A T C T and G A T T C [18]. Individual members of the G A T A factor family are differentially restricted in tissue specificity and in temporal patterns of expression during development [41]. GATA-1, the first family member to be characterized [8,38] is expressed in hematopoietic (erythroid, megakaryocytic and mast) cells in mice and

* Corresponding author. Fax: (1) (708) 467-2152.

0169-328X/94/$07.00 © 1994 Elsevier Science B.V. All rights reserved SSDI 0 1 6 9 - 3 2 8 X ( 9 3 ) E 0 1 96-7

humans [24,32,36,38] as well as in early mouse testis [15]. The GATA-2 and GATA-3 expression patterns differ from one another as well as from that of GATA- 1. GATA-3 is prominently expressed in the T lymphocyte cell lineage in chickens, mice and humans [16,17,41]. GATA-2 is expressed in a broader variety of tissues than either GATA-1 or GATA-3 [40,41], but is nonetheless restricted in tissue distribution (e.g. GATA-2 is not expressed in mature myeloid, B or T cells in chickens [41]).

GATA-1 is required for the generation a n d / o r the maintenance of the erythroid lineage in mice [29], but data regarding the involvement of other G A T A family members in developmental regulatory processes is cur- rently only inferential. Consensus G A T A binding sites are found in the regulatory regions of the T cell receptor (TcR) a, /3 and ~ gene enhancers; the TcR 6 gene enhancer G A T A sites bind a T cell-restricted transcription factor in vitro, are capable of trans-activating reporter genes and are functionally required for the in

J.M. Kornhauser et al. /Molecular Brain Research 23 (1994) 100-110 101

vivo activity of the e n h a n c e r [16,17,31]. Since G A T A - 3

is the only m e m b e r of this t ranscr ip t ion factor family

which is expressed in T cells [22,41], it has been in-

fe r red that G A T A - 3 may be a regula tory molecu le

which is r equ i r ed for T lymphocyte d e v e l o p m e n t a n d /

or d i f ferent ia t ion.

A l though the tissue t ropism of G A T A - 1 and

G A T A - 3 suggest specific roles for these factors within

par t icular cell l ineages, the role of G A T A - 2 in such

processes, because of its b roade r tissue distr ibution, is

not yet clear. The observat ions that G A T A - 2 and

G A T A - 3 are both abundant ly expressed in the brain

[17,41] initially sugges ted that these two factors might

par t ic ipa te in def in ing specific pa t te rns of gene expres-

sion in the ve r t eb ra t e centra l nervous system (CNS). In

o rde r to invest igate this possibility, we have under -

taken a de ta i led charac te r iza t ion of the pa t te rns of

expression of G A T A - 2 and G A T A - 3 m R N A s in the

chicken CNS dur ing deve lopment . W e show here that

these two t ranscr ip t ion factors are expressed in specific

cells in the brain early in embryonic deve lopment , and

that they are p redominan t ly local ized in p r e s u m e d

neurona l cells in layers of the opt ic tec tum. The ex-

press ion levels of both t ranscr ip t ion factors increase

abrupt ly dur ing a pe r iod in embryogenes is which corre-

sponds to the t ime when the opt ic t e c tum is undergo-

ing prol i fera t ive expansion and d i f fe ren t ia t ion to gen-

e ra te the ma tu re s tructure. Fu r the rmore , the spatial

pa t t e rn of the onset of G A T A - 2 and -3 expression

precisely matches the pa t t e rn (in a rostral to caudal

d i rect ion) of d i f fe ren t ia t ion of tectal neurons and sub-

sequen t synaptogenesis by ret inal project ions. These

data suggest that , dur ing ma tu ra t i on of the opt ic tec-

tum, G A T A factors may play a role in the e labora t ion

of a deve lopmen ta l gene t ic p rog ram leading to visual

function.

2. Materials and methods

2.1. In situ hybridization

Chicken embryos or brains were frozen and stored at -80°C until sectioning. 20-~m-thick coronal or sagittal sections were cut and mounted on gelatin/poly-L-lysine coated slides, cDNA clones encoding cGATA-2 or cGATA-3 (p8a or p31a, respectively [41] in pGEM-7; Promega) were digested with restriction enzymes prior to in vitro transcription using either SP6 or T7 RNA polymerase, to generate mRNA-sense or -antisense 35S-labeled RNA probes, respectively. These probes did not contain the sequences encoding the DNA binding domain (which is highly conserved between the GATA factors [41]) to ensure that the hybridization was factor-specific. Parallel experiments employing sense strand transcripts of the factors hybridized to adjacent sections failed to define specific labeling patterns.

In situ hybridization was performed essentially as described [35]. Briefly, sections were air dried, fixed in 5% paraformaldehyde and hybridized for 18 h at 47°C in a solution of 50% formamide, 300 mM NaCI, 10 mM Tris-HCI (pH 8.0), 1 mM EDTA, 1 x Denhardt's

solution, 10% dextran sulfate, 10 mM DTT, 0.5 /zg/ml tRNA, 0.5 /zg/ml poly(A), and 2X 107 cpm/ml of probe. Following treatment with 20 ~g/ml RNase A in 2x SSC at 37°C for 30 min, slides were washed successively in 2 × SSC, 1 x SSC, 0.5 x SSC and 0.1 x SSC for 30 min each at 47°C and were then dehydrated through an ethanol series. Dried slides were first exposed to X-ray film (Kodak XAR-5), and then to autoradiographic emulsion (Kodak NTB-2) for 2 weeks. After developing, sections were stained with Cresyl Violet.

2.2. Quantitative reverse transcription-PCR assay

RT-PCR analysis performed essentially as described [2,10] was used for quantitative evaluation of mRNA expression between different stages of dissected CNS tissues. Total cellular RNA was isolated from intact or dissected organs obtained from staged chicken embryos or post-hatch birds using standard protocols [3]. Approximately 2.5 /zg of RNA was denatured (65°C, 5 min) prior to use as a template in a 20 p.1 cDNA synthesis reaction containing: 1 x RT-PCR buffer (50 mM KCI, 20 mM tris.HCl, pH 8.4 at 23°C, 2.5 mM MgC12, 100 /xg/ml BSA, 2.5 mM DTT, 1 mM each dNTP), 17.5 units RNasin ribonuclease inhibitor (Promega), 100 pmol random d(N) 6 primers (Pharmacia) and 8 units AMV reverse transcriptase (Pro- mega). The reaction was incubated for 10 min at 22°C followed by 90 min at 42°C. Aliquots of the cDNA reaction were analyzed for cGATA-2 and cGATA-3 in a 100 pA PCR reaction containing: 1 x Taq DNA polymerase buffer (Promega), 0.2 mM each dNTP, 25 pmol of each primer (see below), 0.2 /zl [a-32p]dCTP (3,000 Ci/ mmol; ICN) and 2.5 units Taq DNA polymerase (Promega). PCR conditions were 94°C, 2.5 min followed by 21 cycles at 94°C for 1 min; 66°C for 1 min; 72°C for 1 min. Control reactions using cloned cGATA-2 and cGATA-3 cDNAs as templates were performed in parallel to ensure that the conditions used were within the geometric amplification range of the PCR reactions (not shown). The following primers were used for PCR: S17 ribosomal protein sense (5')TACACCCGTCTGGGCAACGAC (3') and antisense (5') CCGCTGGATGCGCTTCATCAG (3') oligonucleotides (nucleotides 61-81 and 189-169 of the S17 sequence, respectively [37]); cGATA-2 sense (5') CTTACGTGCCGGCTGCCCATG (3') and anti-sense (5') CCGGTGCCGTCTCTTCTCCAG (3') oligonucleotides (nucleotides 1122-1142 and 1302-1282 of the sequence, respectively [41]); cGATA-3 sense (5') CCACCTCCTCCGCTCAT- CACC (3') and anti-sense (5') GCCCGGTGCCGTCTCTTCTCC (3') oligonucleotides (nucleotides 818-838 and 1030-1010 of the sequence, respectively [41]). Samples were analyzed on 6% polyacryl- amide gels and exposed to autoradiographic film or quantitated directly on a Molecular Dynamics Phosphorlmager (data not shown). After amplification, initial aliquots containing an identical volume of each reaction were electrophoresed; after quantitation of the individual bands on the Phosphorimager a second aliquot of the same samples was electrophoresed on an identical gel, this time adjusted for identical quantities of the internal control primer (S17) product (e.g. see Fig. 6). All amplification primers were chosen from the published sequences from within two separate exons to distinguish appropriately spliced mRNA from potential contamination by ge- nomic DNA or unspliced nuclear RNA.

3. Results

Previous R N A blot analysis indica ted that both

G A T A - 2 and G A T A - 3 m R N A s were expressed rela-

tively abundant ly in both the chicken and mur ine em-

bryonic brain [17,41]. We have invest igated w he the r or

not the G A T A factors might be res t r ic ted to expres-

102 J.M. Kornhauser et al. / Molecular Brain Research 23 (1994) 100-110

Fig. 1. In situ hybridization of cGATA-2 mRNA in the E4 chicken embryo. A,B: sagittal section through an E4 embryo hybridized to the cGATA-2 probe (8 x magnification). C,D: higher (20 x ) magnification view, showing cGATA-2 hybridization in the mesencephalon and the caudal diencephalon. E,F: a different sagittal section, showing cGATA-2 mRNA in the mesencephalon and rostral metencephalon (20 x magnification). G,H: GATA-2 hybridization in the rostral optic tectum (500 X magnification). Bright-field photomicrographs in A, C, E, and G show the morphology of the tissue, which was stained with Cresyl Violet; the same fields are visualized by dark-field microscopy in B, D, F, and H to show the autoradiographic silver grains indicating hybridization. The pattern of cGATA-3 hybridization (not shown) appeared identical to cGATA-2. In this and all following figures, sections hybridized to cGATA-2 and -3 sense RNA probes used as a control showed no specific hybridization, di, diencephalon; rues, mesencephalon; met, metencephalon; NE, neural epithelium; P, pial layer.

J.M. Kornhauser et al. / Molecular Brain Research 23 (1994) 100-110 103

F_

iiiii ¸ i ¸¸¸¸ i i

G

Fig. 2. In situ hybridization of cGATA mRNAs in the E6 chicken embryo brain. A,B: sagittal section of an E6 embryo hybridized to an antisense cGATA-3 probe (10 x magnification). C-E: coronal sections of an E6 embryo hybridized to cGATA-2 (D) and cGATA-3 (E) probes (12 x magnification). F-H: higher (100 x ) magnification views of coronal sections of an E6 brain hybridized with the cGATA-2 (G) and cGATA-3 (H) probes. Bright-field photomicrographs are shown in A, C, and F; the same fields are visualized by dark-field microscopy in B, D, F, and H to show the autoradiographic silver grains indicating hybridization, di, diencephalon; mes, mesencephalon; met, metencephalon; tec, optic tectum; III, third ventricle; ret, retina; NE, neural epithelium; P, pial layer.

104 J.M. Kornhauser et aL / Molecular Brain Research 23 (1994) 100-110

sion only in specific regions of the developing chicken brain by in situ hybridization studies using 35S-labeled complementary RNA probes for chicken GATA-2 (cGATA-2) and cGATA-3.

3.1. GATA-2 and GATA-3 mRNAs in the E3.5 to E4 chicken embryo

At embryonic day 3.5 (E3.5) and E4, the earliest embryonic stages examined here, high levels of specific hybridization to both cGATA-2 and -3 mRNAs are detected in the developing brain; within the brain, the strongest hybridization is located at the rostro-ventral boundary of the mesencephalon, in the region of con- striction between the mesencephalon (the developing optic lobe) and the diencephalon (Fig. 1A-D). Both cGATA mRNAs are also expressed along the ventral surface of the metencephalon (Fig. 1E,F).

Within the E4 mesencephalon, specific expression of cGATA-2 and -3 is highest in the rostral portion of the optic tectum (Fig. 1C-F). During development, neuronal cell differentiation and formation of the optic tectal layers proceeds in a rostro-ventro-lateral to caudo-dorso-medial direction [20], and so this rostral

portion of the tectum (which shows more intense labeling) is more mature. The predominant cell layer of the E4 tectum is the thick neural epithelium (NE), and most of the cGATA hybridization in the rostral tectum is localized to the outermost lamina of this NE (Fig. 1G,H; see below). The patterns of expression of GATA-2 and GATA-3 mRNAs are indistinguishable from one another at this stage.

3.2. GATA-2 and GATA-3 mRNAs in the E6 brain

By day E6, cGATA mRNA expression is more prominent within the optic tectum (Fig. 2), although intense labeling is still visible in the developing diencephalon (Fig. 2C-E). At E6, the optic tectum is composed of the innermost proliferative NE and two layers positioned more superficially to it, designated layers i and ii [20] (Fig. 2F). The NE is composed of dividing progenitor cells which will cease mitosis before migrating outward to their final positions in the mature tectum; the outermost half of the NE consists primarily of cells in G1 to S phases of mitosis [11,33]. Hybridiza- tion to cGATA-2 and -3 mRNAs is observed in this outermost half of the NE, but not in the innermost

Fig. 3. In situ hybridization of GATA-2 m R N A in the E7 chicken embryo brain. Coronal sections through the E7 optic tectum hybridized to a cGATA-2 probe (100 x magnification). A and C show bright-field photomicrographs; B and D are dark-field views. NE, neural epithelium: P, pial layer.

J.M. Kornhauser et al. / Molecular Brain Research 23 (1994) 100-110 105

portion that borders the ventricle (Fig. 2F-H) . Layers i and ii also show significant levels of c G A T A m R N A expression, as does the overlying pial layer (Fig. 1F-H) . As at the earlier stage (E4), no difference is observed between the patterns of GATA-2 and GATA-3 expression.

3.3. GATA-2 and GATA-3 mRNAs in the E7 brain

In the day E7 chicken brain, four layers superficial to the NE have developed in the optic tectum (Fig. 3A, C). The outermost half of the NE continues to show high specific expression of both c G A T A mRNAs (Fig. 3). Layer ii, which is the most cell-dense lamina at this stage, also contains high levels of GATA-2 and -3 mRNAs. Less expression is seen in layers i and iii, and very little G A T A expression is detected in layer iv (Fig. 3). Overall, GATA-2 and -3 m R N A levels appear to be increased at E7 relative to E6.

These in situ hybridization results indicate that, at E7, there are subtle differences in the regulation of

GATA-2 and GATA-3 m R N A levels. Although the two genes are expressed in identical cell layers, the relative levels of the two mRNAs are not always coordi- nated. Thus, at E7, both genes are strongly expressed in the NE and in layer ii. However, GATA-2 m R N A levels appear to be approximately equivalent between layer ii and the NE, whereas GATA-3 m R N A is seen to be relatively more abundant in layer ii than in the NE. These differences in relative levels of GATA-2 and -3 will be discussed below.

3.4. GATA-2 and GATA-3 mRNAs in the E l 2 brain

In the brain at day E12, the regions of strongest expression of GATA-2 and -3 mRNAs continue to be the optic tectum and areas of the diencephalon (Fig. 4A,B). Twelve distinct cell layers have been described in the E l2 optic tectum [20] (Fig. 4C). GATA-2 and -3 mRNAs are found mainly in layers vi through ix, with the highest expression in layers vi and viii (Fig. 4C-E) . At this stage, the NE has shrunk, and many neuronal

Fig. 4. In situ hybridization of cGATA mRNAs in the El2 chicken embryo brain. A,B: coronal section of an El2 brain hybridized to a cGATA-2 probe (8 × magnification). C-E: higher (40 × ) magnification view of coronal sections hybridized to cGATA-2 (D) and cGATA-3 (E) probes. A and C show bright-field photomicrographs; B, D, and E show dark-field microscopy to visualize autoradiographic silver grains indicating regions of hybridization. OL, optic lobe; tec, optic tectum; cer, cerebellum; V, ventricle; NE, neural epithelium; P, pial layer.

3.5. G A T A - 2 and G A T A - 3 m R N A s in the adult brain progen i to r cells have migra ted per iphera l ly . No G A T A m R N A is de t ec t ed in the N E at E l 2 , suggest ing that the cells express ing G A T A - 2 and -3 have i ndeed mi- g ra t ed out of this layer by this t ime (Fig. 4 C - E ) . Both c G A T A - 2 and c G A T A - 3 are expressed in the same tectal cell layers, and, unl ike the E7 tectum, no obvious d i f ferences in relat ive levels of G A T A - 2 vs. G A T A - 3 in specific cell layers are observed.


c G A T A - 2 and -3 m R N A s cont inue to be expressed in the adu l t opt ic tec tum (Fig. 5). The ma tu re tec tum conta ins a total of 15 dist inct laminae , consis t ing of a l t e rna t ing cel lu lar and plexiform layers (Fig. 5E). G A T A hybr id iza t ion is p r o m i n e n t t h roughou t the layers of the s t ra tum gr i seum et f ibrosum superf ic ia le

F

Fig. 5. In situ hybridization of cGATA mRNAs in the adult chicken brain. A,B: coronal section through an adult (post-hatch day 21) brain hybridized to a cGATA-3 probe (6 x magnification). C,D: coronal section hybridized to a cGATA-3 probe, showing the optic lobe (15 × magnification). E-G: higher (40 x ) magnification showing hybridization to cGATA-2 (F) and cGATA-3 (G) probes in the optic tectum. A, C, and E are bright-field photomicrographs; B, D, F, and G are dark-field photomicrographs, tec, optic tectum; cer, cerebellum; V, ventricle; SFP, stratum fibrosum periventriculare; SGP, stratum griseum periventriculare; SAC, stratum album centrale; SGC, stratum griseum centrale; SGFS, stratum griseum et fibrosum superficiale; SO, stratum opticum; a-j, layers of the SGFS.


(SGFS; Fig. 5C-G; Table 1). Layer b of the SGFS, a plexiform layer, and layer c, its adjacent cellular layer, both exhibit high specific labeling for both mRNAs (Fig. 5E-G). Layers g and h (two adjacent cellular layers) also show high levels of specific GATA signal. Lower levels of hybridization are observed in other SGFS laminae (layers a, i, and j).

In the adult tectum, although expression of the GATA-2 and -3 genes are again strictly co-localized, the two genes exhibit differences in relative abundance in some cell layers of the SGFS. In layers b, g and h, levels of GATA-2 mRNA appear higher than GATA-3 mRNA levels; however, in other tectal layers, the relative signals with the two probes are approximately equivalent (Table 1; Fig. 5E-G).

Among the deeper laminae of the adult tectum, high levels of GATA-2 and -3 mRNA are detected in the stratum griseum centrale (SGC), and moderate levels in the stratum griseum periventriculare (SGP); the other two layers, stratum album centrale (SAC) and stratum fibrosum periventriculare (SFP), show little or no specific hybridization (Fig. 5E-G; Table 1). The SGC contains large neurons with distinctive morpholo- gies; within this layer, it is apparent that GATA-2 and -3 expression is localized to neuronal cell bodies.

Throughout development the highest levels of cGATA mRNAs are in the mesencephalic region and the developing optic tectum. However, in the adult, as at earlier stages, significant levels of GATA expression are also observed in other regions of the brain. Specific nuclei in the adult diencephalon display strong GATA expression (Fig. 5A,B). Within the cerebellum, de-

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11.

t e r n a l

r)

Fig. 6. Quantitative analysis of cGATA-2 and cGATA-3 m R N A s in the brain during neural development. Total R N A isolated from the individual dissected tissues and organs indicated (below) was analyzed for cGATA-2 and cGATA-3 expression by RT-PCR ([2]). Lane 1: no RNA; lane 2 : M S B - 1 cell line (Marek's virus-transformed chicken T-lymphoma cells [1]); lane 3 :E2.5 chicken (embryo) head; lane 4: E 3.5 head; lane 5 : E 5 brain; lane 6 : E 7 brain minus optic lobes; lane 7 :E7 optic lobes; lane 8 :E9 brain minus optic lobes; lane 9 : E 9 optic lobes; lane 10: adult (A21) brain minus optic lobes; and lane 11: adult optic lobes. As an internal control to allow quantitative assessment of expression levels of mRNA, all reactions con- tained primers to specifically amplify chicken S17 ribosomal protein m R N A [37].

Table 1 Localization and relative expression of GATA-2 and GATA-3 transcripts in the adult optic tectum

Layers GATA-2 GATA-3

SO SGFS:

SGC SAC SGP SFP

m m

a + + + +

b + + + + c + + + + + + d + + e + + + + f - _ g + + + + + + +

h + + + + i + + + + + + j ++ +

+ + + + + + + + + + + + + +

+ , specific hybridization; (number of + indicates the relative amount of hybridization to cells within the layer); - , no specific hybridization. SO, s tratum opticum; SGFS, s t ra tum griseum et fibrosum superficiale; SGC, s t ra tum griseum centrale; SAC, s t ra tum album centrale; SGP, s t ra tum griseum periventriculare; SFP, s t ratum fibrosum periventriculare [20,21].

tectable expression is restricted to Purkinje ceils and basket ceils (data not shown); these adult structures are potentially derived from cells in the ventral metencephalon that expressed GATA-2 and -3 at earlier stages. These data suggest that GATA mRNA expression is restricted to a limited number of cell lineages within the brain, specifically those arising from the mesencephalon, the mesencephalon-diencephalon junction region, and the ventral metencephalon.

3.6. Reverse transcription-PCR determination of GATA mRNAs in the brain during development

The levels of cGATA-2 and cGATA-3 mRNAs expressed in the brain during development were mea- sured using a quantitative reaction in which reverse transcription of mRNA was coupled to PCR amplification (RT-PCR; Fig. 6). cGATA-2 mRNA is present in the head at day E2.5, the earliest stage examined here, and its level remains constant from E2.5 to about E5. Amounts of cGATA-2 mRNA in the brain rise by E7,


and this elevated expression persists through adulthood. When analyzed in the same samples, cGATA-3 mRNA shows a temporal pattern of expression which is distinct from that of cGATA-2:cGATA-3 mRNA is also detected at E2.5, then increases steadily from E2.5 to E5. cGATA-3 expression rises markedly by E7, is higher still at E9, and continues to be expressed (at a modestly reduced relative level) in adults. Dissection of the brain into portions consisting of either the optic lobes or all other CNS tissues shows that both cGATA- 2 and cGATA-3 mRNAs are expressed far more abundantly in the optic lobes than in other brain regions from E7 through adulthood (Fig. 6). Although the earliest stage represented here is E2.5 (stage 17 [13]), related studies have detected the expression of both GATA-2 and GATA-3 mRNAs at much earlier developmental stages, (i.e., stage 2, initial streak [22]).

4. Discussion

The avian optic tectum has long been recognized as a model of neural patterning which affords a great number of advantages for the study of a variety of developmental processes. The morphology and embry- ology of the tectum have been extensively characterized. The unique highly ordered, laminated structure of the tectum has proven especially suitable for cytoarchitectonic studies [14,20,30], and for examining the processes of cell proliferation, differentiation and migration [11,12,19,21,34]. In addition, the precise spatial representation of the retina upon the surface of the tectum [5,6,27] has made this system particularly useful for studying the patterning of neural connections during embryonic development. Thus, an impressive amount of information about tectal development has accumulated. Even so, the gene regulatory processes that control and coordinate cell development and differentiation in the tecturn are not yet known. The identification of the transcriptional regulatory proteins GATA-2 and GATA-3 as factors which are expressed in presumed tectal neurons in a tissue-, cell type-, and temporally-specified pattern is therefore significant, since it should facilitate further studies defining the early transcriptional events which underlie the specification of cell identity during brain development.

GATA-2 and -3 are among the first examples of transcription factors which are specifically expressed in the developing optic tectum (see below). The expression patterns of the GATA-2 and GATA-3 transcription factors are similar and are correlated with tectal development in several respects. First, we have shown by in situ hybridization that the expression of cGATA-2 and cGATA-3 is most prominent within, and is precisely localized to, discrete groups of cells in the developing optic tectum, cells that are generated during

days 6 to 9 of embryogenesis [21]. Quantitative analysis by RT-PCR provides compatible data that within the brain expression of these two transcription factor mR- NAs is highest in the optic lobes, precedes stage E6 of development, and peaks between 7 to 9 days of embryogenesis. Thus, these two GATA genes become activated in similar populations of cells generated during this well defined period of major neural and morphological embryonic organization of the mature brain. It appears that the GATA genes continue to be expressed in the same cells thereafter, insofar as the identity of individual cell types in the early tectum can be followed during cell migration and establishment of the mature tectal laminae [21].

Second, the onset of expression of GATA factors in the optic lobes parallels the spatial and temporal pattern of differentiation of the tectum. Several developmental events in the tectum occur sequentially in a rostro-caudal gradient, and this rostro-caudal polarity is also reflected in the timing and position of GATA gene activation. The tectal cells that express GATA mRNAs appear on morphological grounds to be neuronal (clearly seen in the case of the neurons of the SGC layer), although we cannot presently exclude the possibility that these transcription factors may also be expressed in non-neuronal cells.

At all developmental stages examined, the spatial localization of cGATA-2 expression within the brain appears to be identical to that of cGATA-3. It is intriguing that two different transcription factors, each having similar trans-activation potential (in cotransfec- tion assays) and DNA binding properties [18,41] are expressed in identical sets of tectal cells. As noted in the E7 and the adult tectum, however, the relative levels of GATA-2 compared to GATA-3 differ in specific cell layers at particular times of development (Table 1). (At day El2, however, intermediate between these two stages, no differences between GATA-2 and GATA-3 levels were detected.) This observation, to- gether with the quantitative differences in the temporal expression profiles of GATA-2 and GATA-3 mRNA in the chicken brain during development (Fig. 6), suggests subtle differences in the regulation of these two genes within cells which express both factors. Such cell- specific differences in relative amounts of GATA-2 versus GATA-3 might be significant; it has been suggested that the trans-activation properties or DNA- binding specificities of individual GATA family members may exhibit functionally important differences when assayed in the context of a typical gene regulatory module [7], which normally is comprised of multiple transcription factor binding sites in an enhancer or promoter.

The functions of individual cell types of the optic tectum in visual physiology are not well understood. The more superficial layers of the SGFS (a-f ) directly


receive processes of retinal ganglion cells [20]; neurons in the deeper laminae of the SGFS (g-j) are also likely to receive visual input from second order retinal projections. The majority of GATA-2 and -3 mRNA expression in the tectum is within the SGFS, and thus these transcription factors are found in cells that are likely activated by visual stimuli. Significant levels of expression are also detected in the SGC, however, a cell layer consisting mainly of tectal efferent neurons which may be involved in motor function. It is therefore difficult to surmise an obvious functional com- monality among all GATA-expressing tectal cell populations at the present time.

The spatial and temporal patterns of GATA gene expression suggest possible transcriptional regulatory roles for GATA-2 and -3 in visual development. Posi- tional information specifying cell identity appears to be important in the establishment of topographically ordered connections of retinal axons to the optic tectum. It has been suggested that tectal cells are positionally specified before retinal innervation occurs [4]. In the E4 embryo, the strongest GATA expression is observed at the rostral boundary of the developing optic lobe, and appears in a rostral to caudal gradient. At this stage of development, expression of the chicken en gene, a homologue of the Drosophila engrailed homeobox gene, is localized to the region of the mesencephalon-metencephalon junction; a decreasing gradient of en expression from caudal to rostral is observed [28]. We have confirmed, using an anti-en antibody for immunocytochemical localization, that the distribution of chicken en protein is essentially the inverse of the gradient of cGATA mRNAs in the mesencephalon at this time (unpublished results). It has been suggested on the basis of transplantation studies that en may play an important role in positional specification in the developing chick brain, and in the determination of cells to both mesencephalic and metencephalic fates [25,26]. Based upon the early embryonic expression patterns of GATA-2 and GATA-3, it may be that the GATA factors play an analogous role in mesencephalic and diencephalic neuronal determination. Alterna- tively, since GATA expression appears later throughout the rostral-caudal extent of the optic tectum coincident with maturation of the tectum, the appearance of GATA gene expression could reflect the differentiation of tectal neurons, rather than being a causal event in tectal cell determination. Further insight into the functional roles of GATA factors in the nervous system will be necessary to distinguish between these possibili- ties. Regardless, however, of whether GATA factors prove to be required for the determination of tectal neuronal fates or are, instead, regulated in a cell- specific manner secondary to differentiation, their highly restricted localization suggests roles for GATA-2 and -3 in the regulation of genes which are of key

importance for the specialized functions of a small subset of cells in the brain.

The results presented here imply roles for the cGATA-2 and cGATA-3 transcription factors in the regulated expression of specific genes in the developing chicken visual system. The identification of such cellular targets is, therefore, an immediate goal to confirm this prediction. Furthermore, the developmental expression pattern of individual members of the GATA gene family appears to be highly conserved among vertebrate species, including Xenopus, chicken, mouse and human [16,17,36,38,40,42]. If the conservation of tissue specificity of this family of factors is confirmed with respect to expression of these regulatory molecules in the brain, the GATA factors may prove to be important for the activation of neuronal genes involved in the function of the visual system in other verte- brates. Preliminary results analyzing G A T A factor expression in the murine brain (K. George and J.D.E., unpublished) support this speculation.

Acknowledgments. We thank L.J. Ko for kindly providing the sub- clones used in these studies, K. George and J.S. Takahashi for help and suggestions with some of the experiments, and C. Goodman (University of California) for the anti-engrailed 4D9 monoclonal antibody. This work was supported by research grants from the NIH (GM 28896, J.D.E.; EY 08733, J.H.L.; HD 27491, K.E.M.) and a postdoctoral fellowship from the Leukemia Society of America (M.W.L.).

5. References

[1] Akiyama, Y. and Kato, S., Two cell lines from lymphomas of Marek's disease, Biken J., 17 (1974) 105-116.

[2] Camp, T.A., Rahal, J.O. and Mayo, K.E., Cellular localization and hormonal regulation of follicle-stimulating hormone and luteinizing hormone receptor messenger RNAs in the rat ovary. Mol. Endocrinol., 5 (1991) 1405-1417.

[3] Chomczynski, P. and Sacchi, N., Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction, Anal, Biochem., 162 (1987) 156-159.

[4] Cowan, W.M. and Hunt, R.K., In G.M. Edelman, W.B. Gall and W.M. Cowan (Eds.), The Molecular Basis of Neural DeL~elopment, Wiley, New York, 1985, pp. 389-428.

[5] Crossland, W.J., Cowan, W.M. and Rogers, L.A., Studies on the development of the chick optic tectum. IV. An autoradiographic study of the development of retino-tectal connections, Brain Res., 91 (1975) 1-23.

[6] Crossland, W.J. and Uchwat, C.J., Topographic projections of the retina and optic tectum upon the ventral lateral geniculate nucleus in the chick, J. Comp. Neurol., 185 (1979) 87-106.

[7] Engel, J.D., George, K.M., Ko, L.J., Kornhauser, J.M., Leonard, M.W., Ting, P. and Yamamoto, M., Transcription factor regulation of hematopoietic lineage cells, Sem. Hemat., 28 (1991) 158-169.

[8] Evans, T. and Felsenfeld, G., The erythroid-specific transcription factor Eryfl: A new finger protein, Cell, 58 (1989) 877-885.

[9] Evans, T., Reitman, M. and Felsenfeld, G., An erythrocyte- specific DNA-binding factor recognizes a regulatory sequence common to all chicken globin genes, Proc. Natl. Acad. Sci. USA, 85 (1988) 5976-5980.

110 J.M. Kornhauser et al. /Molecular Brain Research 23 (1994) lO0-110

[10] Foley, K.P. and Engel, J.D., Individual stage selector element mutations lead to reciprocal changes in /3- vs. E-globin gene transcription: genetic confirmation of promoter competition during globin gene switching, Genes Det,., 6 (1992) 730-744.

[11] Fujita, S., Analysis of neuron differentiation in the central nervous system by tritiated thymidine autoradiograpby, J. Comp. Neurol., 122 (1964) 311-328.

[12] Gray, G.E., Glover, J.C., Majors, J. and Sanes, J.R., Radial arrangement of clonally related cells in the chick optic tectum: lineage analysis with a recombinant virus, Proc. Nat. Acad. Sci. USA, 85 (1988) 7356-7360.

[13] Hamburger, V. and Hamilton, H.L., A series of normal stages in the development of the chick embryo, J. Morphol., 88 (19511 49-92.

[14] Hunt, S.P. and Brecha, N., In H. Vanegas (Ed.), Comparatil~e Neurology of the Optic Tectum, Plenum, New York, 1984, pp. 619-648.

[15] Ito, E., Toki, T., Ishihara, H., Ohtani, H., Gu, L., Yokoyama, M., Engel, J.D. and Yamamoto, M., Erythroid transcription factor GATA-1 is abundantly transcribed in mouse testis, Na- ture, 362 (19931 466-469.

[16] Joulin, V., Bories, D., Eleouet, J.-F., Labastie, M.-C., Chretien. S., Mattei, M.-G. and Romeo, P.-H., A T-cell specific TCR 6 DNA binding protein is a member of the human GATA family, EMBO J., 10 (1991) 1809-1816.

[17] Ko, L.J., Yamamoto, M., Leonard, M.W., George, K.M., Ting, P. and Engel, J.D., Murine and human T lymphocyte GATA-3 factors mediate transcription through a cis-regulatory element within the human T cell receptor 6 gene enhancer, Mot. Cell. Biol., 11 (1991) 2778-2784.

[18] Ko, L.J. and Engel, J.D., DNA binding specificities of the GATA transcription factor family, Mol. Cell. Biol., 13 (1993) 41111-4022.

[19] Kroger, S. and Walter, J., Molecular mechanisms separating two axonal pathways during embryonic development of the avian optic rectum, Neuron, 6 (1991) 291-303.

[20] LaVail, J.H. and Cowan, W.M., The development of the chick optic tectum. I. Normal morphology and cytoarchitectonic development, Brain Res., 28 (1971) 391-419.

[21] LaVail, J.H. and Cowan, W.M., The development of the chick optic tectum. II. Autoradiograpbic studies, Brain Res., 28 (1971) 421-441.

[22] Leonard, M.W., Lim, K.-C. and Engel, J.D., GATA factor family transcription during early erythroid development and differentiation, DeL,elopment, 119 (1993) 519-531.

[23] Martin, D.I.K. and Orkin, S.H., Transcriptional activation and DNA-binding by the erythroid factor GF-1/NF-EI /Eryf l , Genes De~,., 4 (1990) 1886-1898.

[24] Martin, D.I.K., Zon, L.I., Mutter, G. and Orkin, S.H., Expres- sion of an erythroid transcription factor in megakaryocytic and mast cell lineages, Nature, 344 (1990) 444-447.

[25] Martinez, S. and Alvarado-Mallart, R.-M., Expression of the homeobox cbick-en gene in chick/quail chimeras with inverted mes-metencephalic grafts, Det,. Biol., 139 (1990) 432-436.

[26] Martinez, S., M., W. and Alvarado-Mallart, R.-M., Induction of a mesencephalic phenotype in the 2-day-old chick prosen- cephalon is preceded by the early expression of the homeobox gene en, Neuron, 6 (1991) 971-981.

[27] McLoon, S.C., Evidence for shifting connections during development of the chick retinotectal projection, J. Neurosci., 5 (1985) 2570-2580.

[28] Patel, N.H., Martin-Blanco, E., Coleman, K.G., Poole, S.J., Ellis, M.C., Kornberg, T.B. and Goodman, C.S., Expression of engrailed proteins in arthropods, annelids and chordates, Cell, 58 (1989) 955-969.

[29] Pevny, L., Simon, M.C., Robertson, E., Klein, W.H., Tsai, S.-F., D'Agati, V., Orkin, S.H. and Costantini, F., Erythroid differentiation in chimaeric mice blocked by a targeted mutation in the gene for transcription factor GATA-1, Nature, 349 (1991) 257- 260.

[3(/] Ramon, P., Investigaciones de histologic comparada en los cen- tros opticos de distintos vertebrados. In Memoria Leida Aute El Caluastro de la Facultad de Medicina de la Unieersidad Central, Guiterrez, Madrid, 1980, pp. 1-47.

[31] Redondo, J.M., Pfohl, J.L. and Krangel, M.S., Identification of an essential site for transcriptional activation within the human T-cell receptor 6 enhancer, Mol. Cell. Biol., 11 (1991) 5671-5680.

[32] Romeo, P.-H., Prandini, M.-H., Joulin, V., Mignotte, V., Prenant, M., Vainchenker, W., Marguerie, G. and Uzan, G., Megakaryocytic and erythrocytic lineages share specific transcription factors, Nature, 344 (1990) 447-449.

[33] Sauer, F.C., Mitosis in the neural tube, J. Comp. Neurol., 62 (1935) 377-406.

[34] Senut, M.C. and Alvarado-Mallart, R.M., Development of the retinotectal system in normal quail embryos: cytoarchitectonic development and optic fiber innervation, Del,. Brain Res., 29 (1986) 123-140.

[35] Suhr, S.T., Rahal, J.O. and Mayo, K.E., Mouse growth hormone-releasing hormone: precursor structure and expression in brain and placenta, Mol. Endocrinol., 3 (1989) 1693-1700.

[36] Trainor, C.D., Evans, T., Felsenfeld, G. and Boguski, M.S., Structure and evolution of a human erythroid transcription factor, Nature, 343 (1990) 92-96.

[37] Trueb, B., Schreier, T., Winterhalter, K.H. and Strehler, E.E., Sequence of a cDNA clone encoding chicken ribosomal protein S17, Nucl. Acids Res., 16 (1988) 4723.

[38] Tsai, S.-F., Martin, D.I.K., Zon, L.I., D'Andrea, A.D., Wong, G.G. and S.H. Orkin, S.H., Cloning of cDNA for the major DNA-binding protein of the erytbroid lineage through expression in mammalian cells, Nature, 339 (1989) 446-451.

[39] Wall, L., de Boer, E. and Grosveld, F., The human /3-globin gene 3' enhancer contains multiple binding sites for an erythroid-specific protein, Genes Det~., 2 (1988) 1089-1100.

[40] Wilson, D.B., Dorfman, D.M. and Orkin, S.H., A non-erythroid GATA-binding protein is required for function of the human preproendothelin-1 promoter in endothelial cells, Mol. Cell, Biol., 10 (1990) 4854-4862.

[41] Yamamoto, M., Ko, L.J., Leonard, M.W., Beug, H., Orkin, S.H. and Engel, J.D., Activity and tissue-specific expression of the transcription factor NF-EI multigene family, Genes Dec., 4 (1990) 1650-1662.

[42] Zon, L.I., Mather, C., Burgess, S., Bolce, M.E., Harland, R.M. and Orkin, S.H., Expression of GATA-binding proteins during embryonic development in Xenopus laeL,is, Proc. Natl, Acad. Sci. US~t, 88 (19911 10642-10646.

Documents

Temporal and spatial changes in GATA transcription factor expression are coincident with development of the chicken optic tectum