Targeting of Proteins to the Outer Envelope Membrane Uses a Different Pathway than Transport

The Plant Cell, Vol. 3, 709-717, July 1991 O 1991 American Society of Plant Physiologists

Targeting of Proteins to the Outer Envelope Membrane Uses a Different Pathway than Transport into Chloroplasts

Hsou-min Li," Thomas Moore,b and Kenneth Keegstra".'

a Department of Botany, University of Wisconsin, Madison, Wisconsin 53706 Department of Vegetable Crops, University of California, Davis, California 9561 6

The chloroplastic envelope is composed of two membranes, inner and outer, each with a distinct set of polypeptides. Like proteins in other chloroplastic compartments, most envelope proteins are synthesized in the cytosol and post- translationally imported into chloroplasts. Considerable knowledge has been obtained concerning protein import into most chloroplastic compartments. However, very little is known about the biogenesis of envelope membrane proteins. We isolated a cDNA clone from pea that encodes a 14-kilodalton outer envelope membrane protein. The precursor form of this protein does not possess a cleavable transit peptide and its import into isolated chloroplasts does not require either ATP or a thermolysin-sensitive component on the chloroplastic surface. These findings, together with similar observations made with a spinach chloroplastic outer membrane protein, led us to propose that proteins destined for the outer membrane of the chloroplastic envelope follow an import pathway distinct from that followed by proteins destined for other chloroplastic compartments.

INTRODUCTION

Most proteins present in chloroplasts are encoded by the nuclear genome and synthesized on cytosolic ribosomes (Chua and Schmidt, 1979). The transport of these cytosolically synthesized proteins to chloroplasts has been studied extensively. The outlines of this transport process are well described although the mechanistic details are still poorly understood. The structural complexity of chloroplasts adds to the challenge of understanding targeting to this organelle. Chloropiasts consist of three distinct membranes: the inner and outer membranes of the envelope and the thylakoid membrane. These three membranes in turn enclose three aqueous spaces: the intermembrane space of the envelope, the stroma, and the thylakoid lumen. Thus, cytosolically synthesized proteins not only must be targeted to chloroplasts but also must be directed to the proper compartment within chloroplasts.

Most chloroplastic proteins are synthesized as precursor proteins with N-terminal extensions called transit peptides. Transit peptides are necessary and sufficient to direct the import of proteins into chloroplasts. Protein import to the inside of chloroplasts is initiated by an energy-dependent binding of precursors to the envelope, followed by an energy-dependent translocation across the envelope. Once in the stroma, precursor proteins are either pro- cessed to their mature size or further sorted to the thylakoid membrane or the thylakoid lumen (for a review, see

' To whom correspondence should be addressed.

Keegstra, 1989). Targeting of envelope proteins to their proper membrane locations is not yet well understood.

The chloroplastic envelope is the site where the organelle interacts with other cellular compartments. The envelope not only regulates the transport of metabolites between the stroma and the cytosol but also mediates the import of nuclear-encoded chloroplastic proteins into chloroplasts, as described above. The envelope plays a major role in the biosynthesis of various lipids including galacto- lipids, the predominant lipids in chloroplastic membranes (Douce and Joyard, 1990). Therefore, knowledge about the chloroplastic envelope, especially its protein constitu- ents, is fundamental for understanding the function and biogenesis of chloroplasts.

Despite the importance of chloroplastic envelope proteins, little is known about the biogenesis of these proteins, especially at the molecular level. One reason for this is that most envelope proteins are present in very low quantities compared to other chloroplastic proteins. Only a few genes encoding envelope proteins have been isolated. These include the genes encoding two inner membrane proteins from spinach chloroplasts: a 37-kD protein (Dreses-Wer- ringloer et al., 1991) and the phosphate translocator, which is the most abundant protein in the envelope (Flügge et al., 1989). The import of these two proteins shows characteristics similar to the import of the stromal and the thylakoid membrane proteins. A homologous gene for the phosphate translocator was also identified in pea, but in

Dow

nloaded from https://academ

ic.oup.com/plcell/article/3/7/709/5984250 by guest on 23 January 2022

710 The Plant Cell

this case it was reported to encode the import receptorfor the small subunit of ribulose-1,5-bisphosphate carbox-ylase (SS), and was localized to the contact sites betweenthe two membranes of the envelope (Schnell et al., 1990).Resolution of the controversy regarding the function andthe chloroplastic location of the protein encoded by thisgene will require further work.

Another spinach gene that has been isolated encodes a6.7-kD outer membrane protein (Salomon et al., 1990).The import of this protein is, however, very different fromother chloroplastic proteins. The protein is synthesizedwithout a cleavable transit peptide and its import intochloroplasts is not ATP dependent. At present it is unclearwhether this distinct import mechanism is unique to thisprotein or is a more general feature shared by otherchloroplastic outer membrane proteins. Also, because thespecificity of the insertion process was not demonstrated,it is possible that the insertion into the chloroplastic outermembrane occurred because chloroplasts were the onlyorganelle present in the experimental system.

To understand better the biogenesis of chloroplasticenvelope proteins, an effort was made to obtain cDNAclones encoding chloroplastic envelope proteins. We re-port here the isolation of a pea cDNA clone encoding achloroplastic outer envelope membrane protein. The im-port of this protein into chloroplasts was investigated. Theresults indicate that the import of this protein possessescharacteristics distinct from those of most chloroplasticproteins but are in good agreement with what has beenobserved with the 6.7-kD outer membrane protein.

RESULTS

Isolation and Characterization of a cDNA Clone Encod-ing a Chloroplastic Outer Envelope Membrane Protein

Monoclonal antibodies were prepared against total enve-lope proteins. As shown in Figure 1A, lane 2, one of theantibodies recognized a 14-kD outer envelope membraneprotein. This antibody was used to screen a Xgt11 cDNAexpression library. A partial-length clone was isolated andthe cDNA insert was used to synthesize nucleic acidprobes to screen another Xgt11 cDNA library. Among thepositive clones, A14kom was chosen for further studybecause it contained the largest insert.

The cDNA insert of X14kom was subcloned into theexpression vector pSP65 (Promega), resulting in the plas-mid pSP14kom. When the cDNA insert in the plasmid wassubjected to sequential in vitro transcription and transla-tion, it directed the synthesis of a protein that migratedwith an apparent molecular mass of 14 kD when analyzedby SDS-polyacrylamide gel electrophoresis (PAGE) (Figure1A, lane 3). This molecular mass is identical to that of theprotein recognized by the monoclonal antibody. Because

A 1 2 3 BCL HS

.-18.4

,-14.3- 6.2

97-

66-1

49-

29-I

14-

Figure 1. A14kom Represents a Full-Length Clone with Respectto the Protein It Encodes.

(A) Size comparison between the protein recognized by themonoclonal antibody and the protein encoded by A14kom. Peachloroplastic outer membrane proteins (lane 1) were probed witha monoclonal antibody prepared against envelope proteins (lane2). Lane 3, in vitro translation product from the cDNA insert ofA14kom in plasmid pSP14kom. Lane 1 was stained with AmidoBlack. Lanes 2 and 3 were run on the same gel and blotted ontoone piece of membrane. The two lanes were then cut apart andtreated for antibody hybridization (lane 2) or fluorography (lane 3)by incubating the membrane with 20% 2,5-diphenyloxazole intoluene. Molecular mass markers in kilodaltons are indicated atleft.(B) Hybrid selection of the mRNA corresponding to the cDNAinsert of A14kom. Pea-leaf poly(A)* RNA was incubated withlinearized plasmid pSP14kom. The hybrid-selected mRNA wasused to program an in vitro wheat germ translation system. CL,translation product from the cDNA insert of pSP14kom; HS,translation product from the hybrid-selected mRNA. Sampleswere analyzed by SDS-PAGE. A fluorograph of the dried gel isshown. Molecular mass markers in kilodaltons are indicated atright.

nuclear-encoded chloroplastic proteins are usually synthe-sized as higher molecular weight precursors in the cytosol,we were concerned that the cDNA insert of \14kom maynot encode a full-length precursor protein. To investigatethis possibility, the cDNA insert was used to hybrid-selectits corresponding mRNA from pea-leaf poly (A)+ RNA.When the selected mRNA was translated in vitro, it di-rected the synthesis of a protein with a size identical to

Dow



Chloroplastic Envelope Protein Targeting 711

that of the protein translated from the cDNA insert (Figure1B). This result indicates that the cDNA insert in A14komcontains the entire protein coding region of the gene.

Figure 2 shows the DNA sequence of the cDNA insertin X14kom. It contains an open reading frame of 82 aminoacids with a calculated molecular mass of 9.0 kD, eventhough the translation products, both from the hybrid-selected mRNA and from the cDNA insert, migrated withan apparent molecular mass of 14 kD on an SDS gel(Figure 1B). No related sequences were found in theGenBank and EMBL sequence data bases.

Localization of the Protein Encoded by \14kom

To examine whether the protein encoded by X14kom couldbe imported into chloroplasts, the in vitro translation prod-uct from pSP14kom was incubated with isolated intactchloroplasts under conditions that normally lead to theimport of Chloroplastic precursor proteins (see Methods).As shown in Figure 3A, the in vitro translation productassociated with chloroplasts; however, no molecular

BTR C S E T TR C S E T

OM14-r -SS

Figure 3. Localization of the Protein Encoded by X14kom(OM14).

(A) Fractionation of chloroplasts after import of the protein en-coded by A14kom. Chloroplasts were incubated with the in vitrotranslation product from pSP14kom under standard import con-ditions. Intact chloroplasts were reisolated and subjected to fur-ther fractionation, as described in Methods. TR, in vitro translationproduct; C, total chloroplasts after import; S, stroma; E, envelope;T, thylakoid.(B) Fractional of chloroplasts after import of prSS. The import andfractionation conditions were the same as in (A) except the importreaction was performed on ice instead of room temperature toobtain enough envelope-bound precursor protein molecules. SS,small subunit of ribulose-1,5-bisphosphate carboxylase.

GAATTCCAA

ATG GGA AAG GCG AAA GAA GCG GTT GTG GTG1 M G K A K E A V V VGCG GGT GCC CTA GCA TTT GTC TGG CTC GCT1 1 A G A L A F V W L AATT GAA CTC GCT TTC AAA CCC TTC CTT TCT2 1 I E L A F K P F L SCAG ACC CGT GAC TCC ATC GAC AAA TCC GAC3 1 Q T R D S I D K S DCGA CCC GGG ATC CTG ACG ATG CTC CTC CTC4 1 R P G I L T M L L LCTC CTC CTC CTG AAA CTG ACG CCG GAG ATG5 1 L L L L K L T P E MCCG ACA AAG ACG ACT GAT GAT TTG AGC GCG6 1 P T K T T D D L S AGTT GTT ACT ATT CCT TTC TTG CAT TCT GTA7 1 V V T I P F L H S VTTT CGT TAA ATTGTTAAGTGAAATAACATTAACTAT

81 F R *GTTCTTTGTTGTGTTTTCTGTTCTGATCTGATTTCTGGAATACTGTAATTTTAGGATTAGGATTGAATGCCAGGTTGTTCACTTCATACGTTGGACAATTGGTTTGTTAATTTGGTGTTTGTCTCTTTAGCTATTGCAAATGCAATCGTGTTGTGAAAATAACAAAGCTTCTGAATCAAAAAAAAAAAAAGGAATTC

Figure 2. Nucleotide Sequence of the cDNA Insert in X14komand the Deduced Amino Acid Sequence.

Amino acid numbers are indicated at left. The standard one-lettercode for amino acids is used.

weight shift was observed after import. This result sug-gested that the protein encoded by X14kom was synthe-sized as a precursor protein without a cleavable transitpeptide.

Fractionation studies of the chloroplasts after import ofthe translation product from pSP14kom were performedto obtain information on the suborganellar localization ofthe imported protein. A parallel experiment was performedwith the precursor to SS (prSS) because the imported,mature-size SS can serve as a marker for the stromalfraction and the prSS bound on the surface of chloroplastscan serve as a marker for the envelope fraction. As shownin Figure 3B, prSS associated mostly with the envelopefraction, with a small portion associated with the thylakoidfraction. Some association with thylakoids was expectedbecause the thylakoid fraction is always contaminated withenvelope membranes (Cline and Keegstra, 1983). Thesame fractionation pattern as prSS was observed with theprotein encoded by X14kom, indicating that this proteinwas directed to the Chloroplastic envelope during importinto chloroplasts. Furthermore, the result shown in Figure4, lane 2, demonstrated that the protein was thermolysinsensitive after import, indicating that it was located in theouter membrane. Thermolysin at this concentration hasbeen shown to be unable to penetrate the outer membrane(Cline et al., 1984). This protein was thus named OM14(for outer membrane 14-kD protein).

Dow



712 The Plant Cell

Fluorography Immunoblot1 2 3 4 5 6

OM14 — 14.3

protease — -f — +

Figure 4. Identification of the Authentic OM14 in Chloroplasts.

Chloroplasts after import of OM14 (lane 1) were treated withthermolysin (lane 2), revealing that the imported OM14 was ther-molysin sensitive. A protein with this same property and the samemolecular mass as OM14 was identified in Chloroplasts (lanes 3to 5, see below). Lane 6 shows outer membrane proteins probedwith a polyclonal antibody against total outer membrane proteins.This polyclonal antibody was incubated with the fusion proteincontaining OM14, expressed from M 4kom, to affinity purify mono-specific antibody reactive with OM14. The purified monospecificantibody was then used to probe total chloroplastic protein (lane3), Chloroplasts treated with thermolysin (lane 4), and outer mem-brane proteins (lane 5). Lanes 1 to 5 were run on the same geland blotted onto one piece of membrane. The membrane wasthen cut into two parts and treated for fluorography or immunoblotanalysis as indicated. Molecular mass markers in kilodaltons areindicated at right. Thermolysin treatment of samples are indicatedat bottom.

Identification of the Authentic OM14 in Chloroplasts

It is not surprising that a chloroplastic outer membraneprotein is susceptible to thermolysin digestion. However,a hydrophobic protein that nonspecifically associated withthe surface of Chloroplasts might exhibit the same prop-erty. To verify that OM14 is a genuine chloroplastic protein,we tested the ability of a polyclonal antibody, raised againsttotal outer membrane protein (Figure 4, lane 6), to reactwith OM14. If OM14 could be recognized by this antibody,it would provide independent evidence that OM14 is anauthentic chloroplastic outer membrane protein. The poly-clonal antibody preparation was incubated with a fusionprotein containing OM14 that was immobilized on nitro-cellulose membranes after expression of X14kom (Johnson

et al., 1985). Monospecific antibodies that reacted withOM14 were eluted with a low-pH solution. When analyzedon immunoblots, this eluted antibody recognized a singleprotein in Chloroplasts (Figure 4, lane 3). This protein waslocated in the outer membrane and had the same molecularweight and the same thermolysin sensitivity as OM14(Figure 4, lanes 4 and 5). When this antibody preparationwas used to probe cellular fractions enriched in mitochon-dria or microsomes, no cross-reactive protein was de-tected (data not shown). The same results were alsoobtained with the monoclonal antibody (data not shown).In addition, under the same condition that led to the importof OM14 into Chloroplasts, OM14 could not be importedinto pea mitochondria (data not shown). From these stud-ies, we concluded that OM14 is an authentic chloroplasticprotein.

Membrane Topology of OM14

Imported OM14 could not be removed from the outermembrane by alkaline or high salt extraction (data notshown), suggesting that OM14 was an integral membraneprotein. Figure 5A shows the hydrophobicity analysis (Kyteand Doolittle, 1982) of the deduced OM14 polypeptidesequence. It predicts that the protein spans the outermembrane at least twice (using the criterion that the hy-drophobicity value exceeds 1.58 for at least 1 residue;Jahnig, 1990) with a major hydrophilic domain connectingtwo membrane spanning domains. The conformation ofthe C-terminal end of the polypeptide is not clear; althoughit is hydrophobic, its hydrophobicity and its length areprobably not sufficient for this region of the polypeptide tospan the membrane another time. To investigate the to-pology of OM14 within the membrane, i.e., to determinewhether the hydrophilic domain faces the cytosol or theintermembrane space, we employed the protease chymo-trypsin. Chymotrypsin cleaves peptide bonds predomi-nantly after tyrosine, tryptophan, or phenylalanine resi-dues. In OM14 polypeptide, two phenylalanines are locatedin the hydrophilic domain with other target residues ofChymotrypsin all located in the hydrophobic regions, i.e.,possibly buried in the membrane (Figure 5A). If the hydro-philic domain is located on the cytosolic site of the outermembrane so that the two target sites in the hydrophilicdomain are exposed on the surface of Chloroplasts, theprotein should be susceptible to Chymotrypsin digestion.On the other hand, if the hydrophilic domain is located inthe intermembrane space, the protein should be relativelyChymotrypsin resistant.

Digestion of translation products with Chymotrypsin re-vealed that the precursor form of OM14 was sensitive toChymotrypsin before import (Figure 5B, lane 2). After beinginserted into the outer membrane, OM14 was resistant toChymotrypsin digestion (Figure 5B, lane 4). The protein

Dow



Chloroplastic Envelope Protein Targeting 713

A

+3-

Hydrophobic -0

Hydrophilic --3-

iW

| I I I I I I I I I I I I I I I

20 40 60 80Amino Acid Number

BChymotrypsin — + — + — + — + —Sonication — — — — - — + + —Thermolysin — — -— — — — - +

1 2 3 4 5 6 7 8 9

CH

Figures. Membrane Topology of OM14.

OM

(A) Hydrophobicity analysis of the deduced amino acid sequenceof OM14. The analysis was carried out using the method of Kyteand Doolittle (1982) with a window of 19 residues as suggestedby Jahnig (1990). Positions of Chymotrypsin target sites in thepolypeptide are indicated. F, phenylalanine; W, tryptophan.(B) Chymotrypsin sensitivity of OM14 under various conditions.OM14 from the in vitro translation mixture (TR), chloroplasts afterimport of OM14 (CH), or isolated outer membrane vesicles fromchloroplasts after the import reactions (OM) were treated withChymotrypsin, thermolysin, and/or sonication, as indicated on thetop of the figure.

was Chymotrypsin resistant even in outer membrane ves-icles isolated from chloroplasts of import reactions (Figure5B, lane 6), indicating that most of the isolated outermembrane vesicles possessed a right-side-out orientation.The resistance of the protein to Chymotrypsin was not dueto the inaccessibility of the protein in the isolated mem-brane vesicles because OM14 was still sensitive to ther-molysin (Figure 5B, lane 9). Furthermore, the resistance toChymotrypsin was lost when the protease had access toboth sides of the outer membrane, i.e., after the membranevesicles were sonicated in the presence of the protease(Figure 5B, lane 8). This result indicated that importedOM14 in intact chloroplasts was Chymotrypsin resistantbecause the protease target sites were located in theintermembrane space and thus protected from the pro-tease. The same results were obtained with the authenticOM14 in chloroplasts by using immunoblot analysis (datanot shown). Accordingly, we propose that OM14 spans

the outer membrane at least twice with the connectinghydrophilic domain exposed to the intermembrane space.However, because Chymotrypsin does sometimes have abroader specificity, the possibility that OM14 has someother membrane topology cannot be excluded.

Import Characteristics of OM14

Time course studies of the import of OM14 into chloro-plasts revealed that the import process was time andtemperature dependent. The data in Figure 6 demon-strated that, at 25°C, the initial rate of import was rapidand gradually reached a plateau. This process was influ-enced strongly by temperature because, at 4°C, not onlydid import proceed at a lower rate but much less proteinwas imported. The reason for this drastic change of importby low temperature is unknown. It could be an effect ofthe temperature on membrane fluidity, on the import com-petence of the protein, or on the association(s) of otherrequired protein(s) with OM14.

The energy requirement for the import of OM14 wasalso investigated. The in vitro translation product was gel

400-25° C

I25

I30

00 5 10 15 20

Time (minutes)Figure 6. Import Time Course of OM14.

Import reactions were conducted at either 25°C or 4°C. At eachtime point, 60 t^L of the reaction mixture was removed and thereaction terminated as described (Theg et al., 1989). Sampleswere analyzed by SDS-PAGE. Quantitation of samples in the gelis shown.

Dow



714 The Plant Cell

filtered to remove most of the ATP in the translation mixture (Olsen et al., 1989). As a control, prSS synthesized in vitro and the translation mixture treated the same way were tested in parallel experiments. No translocation of prSS was observed when there was no ATP in the import reaction (data not shown; Olsen et al., 1989). However, as shown in Figure 7, the amount of OM14 imported was essentially the same regardless of the amount of ATP provided. Nigericin and valinomycin also had no effect on the import of OM14. We concluded, therefore, that neither ATP nor a proton-motive force was required for the import of OM14.

It has been shown for several chloroplastic precursor proteins that protein import into chloroplasts requires some proteinaceous component(s) on the chloroplastic surface. When chloroplasts are pretreated with thermolysin, the amount of protein imported is reduced greatly (Cline et al., 1985). However, the same treatment had almost no effect on the import of OM14 (data not shown). Combining this result with the observation of an ATP- independent import, we concluded that the “import” of OMI 4 to the chloroplastic outer membrane is very different from the “import” of proteins into the inside of chloroplasts. The former probably represents the integration of a protein into a membrane without any translocation event. It is thus more proper to refer the association of OM14 with chloroplasts as “insertion” instead of “import.”

DISCUSSION

Severa1 lines of evidence demonstrated that OM14 is a chloroplastic outer membrane protein. A monospecific antibody preparation, affinity purified by reaction with OM14 derived from the cloned gene, recognized a protein in the chloroplastic outer membrane that had the same molecular mass, same thermolysin sensitivity, and same membrane topology as OMI 4. In addition, proteins with cross-reactiv- ity to this antibody could not be detected in other cell fractions. These observations demonstrated that OM14 is an authentic chloroplastic protein in vivo.

Protein insertion into the chloroplastic outer membrane has now been studied with two proteins, OM14 of pea chloroplasts reported here and a 6.7-kD protein of spinach chloroplasts (Salomon et al., 1990). 60th proteins are synthesized without cleavable transit peptides and, in both cases, insertion into the outer membrane does not require ATP. For both proteins, thermolysin pretreatment of chloroplasts has no effect on their insertion. Because of these characteristics, it is important to demonstrate that the insertion is specific because it is possible that such small hydrophobic proteins might insert into any membrane. Consequently, we demonstrated that in vitro synthesized OM14 could be inserted into the outer envelope membrane

O 100 200 300 1OOO Nig Val

[ATP] (pM) & lonophores Figure 7. ATP and Proton-Motive Force Requirements for the lmport of OM14.

lrnport reactions for the ATP requirement experiment were carried out in the dark with the indicated amount of ATP added to each reaction mixture. The ionophore experiment was carried out in the light with each ionophore present at 2 wM. lmport reactions were carried out for 6 min. Reisolated chloroplasts after import were treated further with chymotrypsin in an attempt to remove noninserted protein molecules. Quantitation of samples analyzed by SDS-PAGE is shown. [ATP], ATP concentrations; Nig, nigericin; Val, valinomycin.

of isolated chloroplasts but not mitochondria, indicating that the in vitro import of OM14 faithfully reflects the organelle specificity of protein targeting in vivo.

The insertion of OM14 was not inhibited by synthetic peptide analogues of the transit peptide of prSS (data not shown). These peptides were shown to inhibit the binding and translocation of several precursors destined for other chloroplastic compartments (Perry et al., 1991). These observations provide additional evidence that OMI 4 used a different import receptor from that used by the majority of chloroplastic proteins. Alternatively, it is possible that OM14 interacted directly with the lipid components of the outer membrane so that it did not utilize a proteinaceous receptor.

Two different mechanisms have been described for the insertion of proteins into mitochondrial outer membranes. Porin of Neurospora crassa and monoamine oxidase B of beef heart mitochondria require ATP and a trypsin-sensitive component on the mitochondrial surface for their insertion (Zhuang et al., 1988; Pfaller et al., 1990). On the other hand, insertion of porin into the Saccharomyces cerevisiae mitochondrial outer membrane does not require ATP, and a trypsin pretreatment of the mitochondria does not inhibit this insertion (Gasser and Schatz, 1983). In addition, cytochrome c of mitochondria, a protein present in the intermembrane space of the envelope, also does not require ATP or a protein on the mitochondrial surface for

Dow



Chloroplastic Envelope Protein Targeting 71 5

its translocation across the outer membrane (Nicholson et al., 1988). It is unclear whether these differences represent variations on a single pathway to the outer membrane or whether they reflect two different pathways.

The specificity of OM14 insertion to the chloroplastic outer membrane was shown by its exclusive presence in the chloroplastic outer membrane in vivo and the failure to insert into mitochondrial outer membrane in vitro. Because OM14 does not possess a cleavable transit peptide, it is uncertain where the targeting information that mediates this specificity resides. A similar question arises with mitochondrial outer membrane proteins, which also lack cleavable presequences (Hartl et al., 1989). This question has been addressed with a 70-kD mitochondrial outer membrane protein, where the first 12 amino acid residues function as a matrix targeting sequence and the subsequent hydrophobic residues function as a “stop-transfer” signal that anchors the protein in the outer membrane (Nakai et ai., 1989). The situation with OM14 is more complex because it is predicted to span the membrane at least two times. Hypotheses for OM14 insertion can be derived by drawing analogies with integral membrane proteins of the endoplasmic reticulum (Blobel, 1980; Lipp et al., 1989). The first membrane-spanning domain of OM14 may function as a signal-anchor sequence that initiates the insertion of the protein into the chloroplastic outer membrane. The second membrane-spanning domain may then function as a stop-transfer sequence resulting in an Ni,-Ci, topology of the protein (“in” refers to the cytosol). This prediction is also in agreement with the “positive inside” hypothesis (von Heijne and Gavel, 1988) because the residues on the amino-terminal side of the first membrane- spanning domain has a net positive charge. Alternatively, the two membrane-spanning domains could pair together and spontaneously insert into the outer membrane, as described by the “helical hairpin hypothesis” (Engelman and Steitz, 1981).

Regardless of the mechanistic details, the current data support the conclusion that chloroplastic outer membrane proteins utilize an import pathway that is distinct from that of protein transport to other chloroplastic compartments. Outer membrane protein targeting involves a direct insertion from the cytosol with no need of an extra peptide extension and its subsequent removal by way of process- ing. This feature is shared with proteins destined for the outer membrane of mitochondria and seems to be a general feature of protein targeting to the outer membrane of each organelle. The lack of an ATP requirement and the apparent independence of a proteinaceous receptor that have been observed with OM14 and E6.7 have also been observed with some, but not all, mitochondrial outer membrane proteins. It remains to be determined whether these features are general for all chloroplastic outer membrane proteins.

METHODS

Antibody Preparations, cDNA Cloning, and Sequencing

For monoclonal antibody preparation, total envelope proteins were used to immunize 8-week-old Balb/c mice according to the procedure described (Stahli et al., 1983). The spleen cells from an immunized mouse were fused with NS-1 mouse myeloma cells, an 8-azaguanine resistant, nonsecreting cell line. Supernatants from cultured hybrid cells were assayed using ELISA, as described (Voller et al., 1980), with envelope proteins as immobilized anti- gens. Positive cell lines were expanded and rescreened by ELISA against both envelope and stromal proteins. Selected lines were cloned by limiting dilution, and frozen. Those lines that reacted only with envelope but not stromal proteins were analyzed further on immunoblots. The polyclonal antibody against purified outer membrane proteins was prepared as described in Marshall et al. (1990). Monospecific antibody affinity purified by OM14 was prepared as described (Johnson et al., 1985).

cDNA libraries were made from pea-leaf poly(A)+ RNA and were gifts of Dr. S. Gantt (Gantt and Key, 1986) and Dr. G. Coruzzi (Tingey et al., 1987). The screening process using antibodies was performed as described (Huynh et al., 1985). Synthesis of nucleic acid probes by in vitro transcription of a partia1 cDNA clone and the screening process using these probes were performed as described (Wahl et al., 1987).

For DNA sequencing, the cDNA insert from X14kom was subcloned in both orientations into the Phagescript vector (Strata- gene). A series of nested deletions was made using exonuclease 111 and S1 nuclease according to the procedure of Henikoff (1987) with modifications described by Greenler et al. (1 989). Single- stranded DNA was isolated and sequenced using the dideoxy chain termination method (Sanger et al., 1980) with the Klenow fragment of DNA polymerase I and LP~*P-~ATP. Overlapping clones from the nested deletions were chosen by running T-tracking reactions before the full sequencing. Both strands of the cDNA were sequenced in their entirety. Sequence data analysis was carried out using the UWGCG software (Devereux et al., 1984).

Hybrid selection of mRNA was performed as described (Man- iatis et al., 1982). Pea-leaf poly(A)+ RNA was prepared as described (Cline et al., 1985).

Precursor Protein Synthesis and lmport into lsolated Chloroplasts

The cDNA insert from X14kom was subcloned into the pSP65 vector (Promega), resulting in the plasmid pSPl4kom. Tritium- labeled precursor proteins were synthesized from pSP14kom by using in vitro transcription/translation systems as described (Smeekens et al., 1986). Where indicated, ATP was removed from the translation mixture by filtering the translation mixture through a Sephadex G-25 column after the translation reactions (Olsen et al., 1989).

lntact chloroplasts were isolated from 10- to 15-day old pea (fisum sarivum cv Perfection) seedlings as described (Cline, 1986). lmport experiments were performed in import buffer (330 mM sorbitol/50 mM Hepes.KOH, pH 8.0) at room temperature

Dow



716 The Plant Cell

as described (Li et al., 1990) except that the amount of precursor proteins was reduced to 5 x 105 dpm for OM14 and 1 x 10' dpm for prSS. After import, intact chloroplasts were reisolated by centrifugation through a 40% Percoll cushion. Recovered chloroplasts were subjected to further fractionation or protease treatments. The experiment shown in Figure 6 was performed using the silicone oil/perchloric acid method as described (Theg et al., 1989) except that the oil volume was increased from 1 O0 pL to 160 pL. Thermolysin pretreatment of chloroplasts was done as described by Cline et al. (1985).

of monoclonal antibodies, Dr. Jerry Marshall for the polyclonal antibody against outer membrane proteins, and Jim Sloan for advice on DNA sequencing. This work was supported in part by a grant to K.K. from the Office of Basic Energy Sciences at the Department of Energy. The nucleotide sequence data reported in this paper will appear in the GenBank Nucleotide Sequence Database under the accession number M69105.

Post-lmport Treatments of Chloroplasts

For fractionation of chloroplasts, reisolated intact chloroplasts from a 450-pL import reaction were hypotonically lysed in 450 pL of 10 mM Tris.HCI, pH 7.5/2 mM EDTA (TE) by incubating on ice for 1 O min. Lysed chloroplasts were loaded onto a sucrose step gradient with 1.2 mL of 1.2 M sucrose, 1.5 mL of 1 M sucrose, and 1.5 mL of 0.46 M sucrose, and centrifuged in a Beckman SW 50.1 rotor at 47,000 rpm for 1 hr. Stromal, envelope (a mixture of inner and outer membranes), and thylakoid fractions were retrieved from the supernatant, the 0.46 M/1 M sucrose interface, and the pellet, respectively. Proteins in the stromal fraction were concentrated by acetone precipitation. The envelope fraction was diluted with TE buffer and pelleted by centrifugation in a Beckman JA-20 rotor at 20,000 rpm for 45 min. The thylakoid fraction was washed with TE buffer and pelleted by centrifugation in a micro- centrifuge at 7,500 rpm for 5 min. A similar procedure was used to isolate outer membrane vesicles except that the chloroplasts were lysed hypertonically in 0.6 M sucrose by one cycle of freezing and thawing (Keegstra and Yousif, 1986) and the sucrose step gradient was made with 1.8 mL of 1 M sucrose, 1.6 mL of 0.8 M sucrose, and 1.3 mL of 0.46 M sucrose. The outer membrane fraction was retrieved from the 0.46 M/0.8 M sucrose interface. All sucrose solutions were made in TE buffer.

Thermolysin treatment of chloroplasts or outer membrane vesicles was performed as described (Smeekens et al., 1986). Chy- motrypsin treatment of chloroplasts or outer membrane vesicles was performed in import buffer containing 10 mM CaCI2 and 30 pg/mL tosyl-L-lysine chloromethyl ketone-treated chymotrypsin. The reaction was incubated at room temperature for 30 min and the digestion was terminated by adding phenylmethanesulfonyl fluoride to 1 mM. Sonication of outer membrane vesicles was done using a tip sonicator with six 2.5-sec bursts at 25 to 30 Watts.

All samples were analyzed by SDS-PAGE with buffer systems described by Laemmli (1 970) and a 10% to 15% polyacrylamide gradient. After electrophoresis, gels were either fluorographed and exposed to x-ray films, or prepared for immunoblots. Immu- noblots were carried out with Immobilon-P membrane (Millipore, Bedford, MA) and alkaline phosphatase-conjugated secondary antibodies as described (Marshall et al., 1990). Quantitation of each radiolabeled protein species in the gel was done by extract- ing proteins from gel slices as described (Olsen et al., 1989).

'

ACKNOWLEDGMENTS

We thank Dr. Stephen Gantt and Dr. Gloria Coruzzi for the generous gifts of cDNA libraries, Beth Hammer for the preparation

Received April 16, 1991 ; accepted May 15, 1991.

REFERENCES

Blobel, G. (1 980). Intracellular protein topogenesis. Proc. Natl. Acad. Sci. USA 77,1469-1500.

Chua, N.-H., and Schmidt, G.W. (1979). Transport of proteins into mitochondria and chloroplasts. J. Cell Biol. 81, 461-483.

Cline, K. (1 986). lmport of proteins into chloroplasts: Membrane integration of a thylakoid precursor protein reconstituted in chloroplast lysates. J. Biol. Chem. 261, 14804-1481 O.

Cline, K., and Keegstra, K. (1 983). Galactosyltransferases in- volved in galactolipid biosynthesis are located in the outer membrane of pea chloroplast envelopes. Plant Physiol. 71,

Cline, K., Werner-Washburne, M., Andrews, J., and Keegstra, K. (1984). Thermolysin is a suitable protease for probing the surface of intact pea chloroplasts. Plant Physiol. 75, 675-678.

Cline, K., Werner-Washburne, M., Lubben, T.H., and Keegstra, K. (1 985). Precursors to two nuclear-encoded chloroplast proteins bind to the outer envelope membrane before being imported into chloroplasts. J. Biol. Chem. 260, 3691-3696.

Devereux, J., Haeberli, P., and Smithies, O. (1984). A compre- hensive set of sequence analysis programs for the VAX. Nucl. Acids. Res. 12, 387-395.

Douce, R., and Joyard, J. (1990). Biochemistry and function of the plastid envelope. Annu. Rev. Cell Biol. 6, 173-216.

Dreses-Werringloer, U., Fischer, K., Wachter, E., Link, T.A., and Flügge, U.4. (1991). cDNA sequence and deduced amino acid sequence of the precursor of the 37-kDa inner envelope membrane polypeptide from spinach chloroplasts: Its transit peptide contains an amphiphilic a-helix as the only detectable structural element. Eur. J. Biochem. 195, 361-368.

Engelman, D. M., and Steitz, T. A. (1981). The spontaneous insertion of proteins into and across membranes: The helical hairpin hypothesis. Cell 23, 41 1-422.

Flügge, U.4, Fischer, K., Gross, A., Sebald, W., Lottspeich, F., and Eckerskorn, C. (1 989). The triose phosphate-3-phospho- glycerate-phosphate translocator from spinach chloroplasts: Nucleotide sequence of a full length cDNA clone and import of the in vitro synthesized precursor protein into chloroplasts.

Gantt, J.S., and Key, J.L. (1986). lsolation of nuclear encoded plastid ribosomal protein cDNAs. MOI. Gen. Genet. 202,

366-372.

EM60 J. 8,39-46.

186-1 93.

Dow



Chloroplastic Envelope Protein Targeting 71 7

Gasser, S.M., and Schatz, G. (1983). lmport of protein into mitochondria: In vitro studies on the biogenesis of the outer membrane. J. Biol. Chem. 258, 3427-3430.

Greenler, J.M., Sloan, J.S., Schwartz, B.W., and Becker, W.M. (1 989). Isolation, characterization and sequence analysis of a full-length cDNA clone encoding NADH-dependent hydroxypy- ruvate reductase from cucumber. Plant MOI. Biol. 13, 139-1 50.

Hartl, F., Pfanner, N., Nicholson, D.W., and Neupert, W. (1989). Mitochondrial protein import. Biochim. Biophys. Acta 988,

Henikoff, S. (1 987). Unidirectional digestion with Exonuclease 111 in DNA sequence analysis. Methods Enzymol. 155, 156-165.

Huynh, T.V., Young, R.A., and Davis, R.W. (1985). Constructing and screening cDNA libraries in XgtlO and Xgtll. In DNA Cloning: A Practical Approach, Vol. 1, D.M. Glover, ed (Wash- ington, DC: IRL Press), pp. 49-78.

Jahnig, F. (1 990). Structure predictions of membrane proteins are not that bad. Trends Biochem. Sci. 15, 93-95.

Johnson, L.M., Snyder, M., Chang, L.M.S., Davis, R.W., and Campbell, J.L. (1 985). lsolation of the gene encoding yeast DNA polymerase I. Cell 43, 369-377.

Keegstra, K. (1989). Transport and routing of proteins into chloroplasts. Cell 56, 247-253.

Keegstra, K., and Yousif, A.E. (1 986). lsolation and characterization of chloroplast envelope membranes. Methods Enzymol.

Kyte, J., and Doolittle, R.F. (1 982). A simple method for displaying the hydropathic character of a protein. J. MOI. Biol. 157,

Laemmli, U.K. (1970). Cleavage of structural protein during the assembly of the head of bacteriophage T4. Nature 227,

Li, H., Theg, S.M., Bauerle, C.M., and Keegstra, K. (1990). Metal-ion-center assembly of ferredoxin and plastocyanin in isolated chloroplasts. Proc. Natl. Acad. Sci. USA 87,

Lipp, J., Flint, N., Haeuptl, M.-T., and Dobberstein, B. (1989). Structural requirements for membrane assembly of proteins spanning the membrane severa1 times. J. Cell Biol. 109,

Maniatis, T., Fritsch, E.F., and Sambrook, J. (1 982). Hybridiza- tion selection using DNA bound to nitrocellulose. In Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, NY: Cold Spring Harbor Laboratory), pp. 330-333.

Marshall, J.S., DeRocher, A.E., Keegstra, K., and Vierling, E. (1 990). ldentification of heat shock protein hsp70 homologues in chloroplasts. Proc. Natl. Acad. Sci. USA 87, 374-378.

Nakai, M., Hase, T., and Matsubara, H. (1989). Precise deter- mination of the mitochondrial import signal contained in a 70

1-45.

118,173-182.

105-1 32.

680-685.

6748-6752.

2013-2022.

kDa protein of yeast mitochondrial outer membrane. J. Biochem. 105,513-519.

Nicholson, D.W., Hergersberg, C., and Neupert, W. (1988). Role of cytochrome c heme lyase in the import of cytochrome c into mitochondria. J. Biol. Chem. 263, 19034-19042.

Olsen, L.J., Theg, S.M., Selman, B.R., and Keegstra, K. (1989). ATP is required for the binding of precursor proteins to chloroplasts. J. Biol. Chem. 264, 6724-6729.

Perry, S.E., Buvinger, W.E., Bennett, J., and Keegstra, K. (1991). Synthetic analogues of a transit peptide inhibit binding or translocation of chloroplastic precursor proteins. J. Biol. Chem. 266, in press.

Pfaller, R., Kleene, R., and Neupert, W. (1990). Biogenesis of mitochondrial porin: The import pathway. Experientia 46,

Salomon, M., Fischer, K., Flügge, U.4, and Soll, J. (1990). Sequence analysis and protein import studies of an outer chloroplast envelope polypeptide. Proc. Natl. Acad. Sci. USA 87,

Sanger, F., Coulson, R., Barrell, B.G., Smith, A.J.H., and Roe, B.A. (1 980). Cloning in single-stranded bacteriophage as an aid to rapid DNA sequencing. J. MOI. Biol. 143, 161 -1 78.

Schnell, D.J., Blobel, G., and Pain, D. (1990). The chloroplast import receptor is an integral membrane protein of chloroplast envelope contact sites. J. Cell Biol. 111, 1825-1838.

Smeekens, S., Bauerle, C., Hageman, J., Keegstra, K., and Weisbeek, P. (1986). The role of the transit peptide in the routing of precursors toward different chloroplast compartments. Cell46, 365-375.

Stahli, C., Staehelin, T., and Miggiano, V. (1983). Spleen cell analysis and optimal immunization for high-frequency produc- tion of specific hybridomas. Methods Enzymol. 92, 26-36.

Theg, S.M., Bauerle, C., Olsen, L.J., Selman, B.R., and Keegs- tra, K. (1989). Interna1 ATP is the only energy requirement for the translocation of precursor proteins across chloroplastic membranes. J. Biol. Chem. 264,6730-6736.

Tingey, S.V., Walker, E.L., and Coruzzi, G.M. (1987). Glutamine synthetase genes of pea encode distinct polypeptides which are differentially expressed in leaves, roots and nodules. EM60

Voller, A., Bidwell, D., and Bartlett, A. (1980). Enzyme-linked immunosorbent assay. In Manual of Clinical Immunology, N.R. Rose and H. Friedman, eds (Washington, DC: American Society of Microbiology), pp. 359-371.

von Heijne, G., and Gavel, Y. (1988). Topogenic signals in integral membrane proteins. Eur. J. Biochem. 174, 671-678.

Wahl, G.M., Meinkoth, J.L., and Kimmel, A.R. (1987). Northern and Southern blots. Methods Enzymol. 152, 572-587.

Zhuang, Z., Hogan, M., and McCauley, R. (1988). The in vitro insertion of monoamine oxidase B into mitochondrial outer membranes. FEBS Lett. 238, 185-1 90.

153-1 61.

5778-5782.

J. 6, 1-9.

Dow



Documents

Targeting of Proteins to the Outer Envelope Membrane Uses a Different Pathway than Transport