Targeting Elements in the Amino-Terminal Part Direct the Human 70-kDa Peroxisomal Integral Membrane Protein (PMP70) to Peroxisomes

TtP

MD

R

napmefsphftatdtlt(hiP

tpP

ppfmphacm

F

Biochemical and Biophysical Research Communications 285, 649–655 (2001)

doi:10.1006/bbrc.2001.5220, available online at http://www.idealibrary.com on

argeting Elements in the Amino-Terminal Part Directhe Human 70-kDa Peroxisomal Integral Membranerotein (PMP70) to Peroxisomes

artina Biermanns and Jutta Gartner1

epartment of Pediatrics, Heinrich Heine University Dusseldorf, Moorenstrasse 5, D-40225 Dusseldorf, Germany

eceived June 14, 2001

sis disorders like Zellweger syndrome and Rhizomeliacld

llpipmnaNcpptLeslstwswgto

gpbmtpcbt

Peroxisomes are multipurpose organelles present inearly all eukaryotic cells. All peroxisomale matrixnd membrane proteins are synthesized in the cyto-lasm. While a clear picture of the basic targetingechanisms for peroxisomal matrix proteins has

merged over the past years, the targeting processesor peroxisomal membrane proteins are poorly under-tood. The 70-kDa peroxisomal integral membranerotein (PMP70) is one of the proteins located in theuman peroxisome membrane. PMP70 belongs to the

amily of ATP-binding cassette (ABC) transporter pro-eins. It consists of six transmembrane domains andn ATP-binding fold in the cytosol. Here we describehat efficient peroxisomal targeting of human PMP70epends on three targeting elements in the amino-erminal protein region, namely amino acids 61 to 80ocated in the cytosol as well as the first and secondransmembrane domains. Furthermore, peroxin 19PEX19) interactions are not required for targetinguman PMP70 to peroxisomes. PEX19 does not specif-

cally bind to the targeting elements of humanMP70. © 2001 Academic Press

Key Words: ATP-binding cassette transporter pro-ein; green fluorescent protein; peroxin; peroxisome;eroxisomal membrane protein; PMP70; targeting;EX19.

Peroxisomes are single-membrane bound organellesresent in nearly all eukaryotic cells. The number oferoxisomes per cell can range in abundance from aew, as in yeast, to hundreds or thousands in mam-als. Peroxisomes are essential for multiple metabolic

rocesses (1). Examples are plasmalogen biosynthesis,ydrogen peroxide metabolism, fatty acid b-oxidationnd phytanic acid a-oxidation. Mutations in genes en-oding peroxisomal proteins cause complex humanetabolic diseases. These include peroxisome biogene-1 To whom correspondence and reprint requests should be addressed.

ax: (149) (211) 8118757. E-mail: [email protected].

649

hondrodysplasia punctata and single protein defectsike X-linked adrenoleukodystrophy and adult Refsumisease (1, 2).Like other organelles, peroxisomes appear to use at

east two unique mechanisms for their biogenesis. Aarge number of studies provide strong evidence thateroxisomes arise by growth and division of preexist-ng peroxisomes (3). Other studies demonstrate thateroxisomes can be synthesized de novo (4). Peroxiso-al membrane and matrix proteins are encoded by

uclear genes, synthesized on free cytosolic ribosomes,nd imported posttranslationally into peroxisomes (3).ewly synthesized peroxisomal proteins contain spe-

ific targeting signals that direct them to and intoeroxisomes. The majority of matrix enzymes have theeroxisomal targeting signal 1 (PTS1), a carboxyl-erminus tripeptide with the consensus sequence Ser-ys-Leu or a conservative variant (5, 6). A few matrixnzymes are targeted by the peroxisomal targetingignal 2 (PTS 2) to the peroxisome (7). PTS2 signal isocated near the amino-terminus and has the consen-us sequence Arg/Lys-Leu-X5-Gln/His-Leu. Whilehere is a wealth of information on the import path-ays for peroxisomal matrix proteins, the targeting

ignals for peroxisomal membrane proteins are lessell characterized. Peroxisomal membrane proteinsenerally lack PTS1- and PTS2-like sequences and theargeting process seems to be more complex than thene of matrix proteins.Dyer and colleagues first described an internal tar-

eting signal for the 47-kDa peroxisomal membranerotein (PMP47) of Candida boidinii consisting of aasic cluster of amino acids in the second peroxisomalatrix loop (8). Recently, the same group reported that

he basic cluster by itself targets to peroxisomes veryoorly and that targeting of PMP47 requires aytoplasmic-oriented sequence, the second transmem-rane domain and an additional membrane-anchoringransmembrane domain (9). Other reported peroxiso-

0006-291X/01 $35.00Copyright © 2001 by Academic PressAll rights of reproduction in any form reserved.

mrfh1(tPpPscpp

tta

M

ifpTBVw

tc

i6bvwscDwPDcwPPsu

Rms9(tfn

wp

TABLE 1

Vol. 285, No. 3, 2001 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

al membrane protein targeting signals (mPTS) areegions in the amino-terminal part for human PEX3,or rat 22-kDa peroxisomal membrane protein and foruman 34-kDa peroxisomal membrane protein (10–3). Molecular and biochemical studies of peroxin 19PEX19) indicate that this protein plays a direct role inhe import of peroxisomal membrane proteins (14).EX19 may act as a chaperone for newly synthesizederoxisomal membrane proteins. Mislocalization ofEX19 to the nucleus led to an accumulation of newlyynthesized peroxisomal membrane proteins in the nu-leoplasm. Furthermore, PEX19 binds to regions oferoxisomal membrane proteins that are sufficient foreroxisomal targeting.Here we describe the targeting elements of PMP70

hat are sufficient for peroxisome localization. We fur-her discuss the interactions of PEX19 with PMP70nd especially its peroxisomal targeting elements.

ATERIALS AND METHODS

Construction of PMP70 expression plasmids for subcellular local-zation. Different PMP70 cDNA fragments were amplified using aull-length human PMP70 cDNA clone (PMP70 pcDNA1Neo) as tem-late and Vent DNA Polymerase (New England Biolab, Schwalbach/aunus). PCR-generated fragments of PMP70 with EcoRI andamHI restriction sites were subcloned in frame into the pEGFP-C1ector (Clontech Schwalbach/Taunus). The identity of the subclonesas confirmed by semi-automated sequencing using reagents and

Oligonucleotides Used for C

Fusion protein

GFP-PMP70(AA1–180) CTAA









myc-PMP70(AA80–160) GCCG



myc-PEX19p GCAATT

650

he protocol of PE Biosystems (Weiterstadt, Germany). The oligonu-leotide primers used are listed in Table 1.

Construction of PMP70, OAT, and PEX19 expression plasmids formmunoprecipitation. PMP70 cDNA fragments (AA 81 to 160, AA1 to 160, and AA 1 to 180) with BamHI/XhoI sites were generatedy PCR and subsequently subcloned in frame into the pCMV-Tag3Bector (Stratagene Heidelberg). Full-length PMP70 cDNA constructsere excised from a pcDNA1Neo plasmid (Invitrogen Leek) and

ubcloned into the pcDNA3 vector (Invitrogen Leek). A plasmidontaining ornithine-d-aminotransferase (OAT) was provided byavid Valle (Johns Hopkins Hospital, Baltimore, MD). OAT cDNAas subcloned into the pcDNA1Neo vector (Invitrogen Leek). AEX19 expression plasmid (PEX19 pCS3) was provided by Gabrieleodt (Department of Physiological Chemistry, University of Bo-

hum, Germany) and Ania Muntau (Department of Pediatrics, Lud-ig Maximilian University, Munich, Germany). N-myc-taggedEX19 cDNAs with BamHI/SalI restriction sites were generated byCR using PEX19 pCS3 plasmid DNA as template. PEX19 was thanubcloned in frame into pCMV-Tag3B. The oligonucleotide primerssed are listed in Table 1.

Culturing and transient transfection of cells. COS-7 cells (ATCCockville) were cultured on cover slides in Dulbecco’s modified Eagleedium (DMEM) supplemented with 10% heat-treated fetal calf

erum, 90 U/ml penicillin/streptomycin and 1.8 mM L-glutamine at% CO2. All transfections were performed using Superfect reagentQiagen, Hilden, Germany) according to the manufacturer’s instruc-ions. Two days after transfection the cells were fixed with 3%ormaldehyde in phosphate-buffered saline (PBS) for indirect immu-ofluorescence microscopy.

Indirect immunofluorescence. The fixed cells were permeabilizedith 1% Triton X-100 in PBS for 5 min and incubated with therimary antibody for 45 min. Primary antibodies used are rabbit

structing Fusion Proteins

DNA sequence 59–39

GAATTCAATGGCGGCCTTCAGCAAGCTCTTGGCGGGATCCGTTGTCCAGATTCCCCATGAATTCAATGGCGGCCTTCAGCAAGCTCTTGGCGGGATCCATCACAATATGTTCGAGACGAATTCAATGGCGGCCTTCAGCAAGCTCTTGGCGCTAGGATCCGTCCACCACAGCTCGCTCGAATTCAAAGGTGTTTTTCTCAAGGCTCCTCTTGGCGGGATCCACAAAATGTTCTAGGGACCGAATTCAAAGGTGTTTTTCTCAAGGCTCCTCTTGGCGGGATCCGTTGTCCAGATTCCCCATGAATTCAAAGGTGTTTTTCTCAAGGCTCCTCTTGGCGCTAGGATCCTTTAGTGAGCCTTACTCGAATTCAAAGGTGTTTTTCTCAAGGCTCCTCTTGGCGCTAGGATCCCAGAGAGATAAGAGGGAATTCAAAGGTGTTTTTCTCAAGGCTCCTCTTGGCGCTAGGATCCGAGTAAGTATCTCTTGGAATTCAAAAGAGACAGGTTACTTGCTCTTGGCGCTAGGATCCTTTAGTGAGCCTTACTCGGATCCAAAGAGACAGGTTACGCCGCTCGAGCTATTTAGTGAGCCTTACGGATCCAAGGTGTTTTTCTCAAGGGCCGCTCGAGCTATTTAGTGAGCCTTACGGATCCATGGCGGCCTTCAGCAAGGCCGCTCGAGCTAGTTGTCCAGATTCCGGATCCATGGCCGCCGCTGAGGAAGGCTGCTCTTGGCGGTCGACTTATCACATGATCAGACACTGCC

on

TCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGGCCCGCCCGCCCGCTGCA

aaamTTae

smwCmooeadmamaLbcra

R

P

gto

gpPbmctatcitwPmttacsaap2st1fimrPl

i


nti-human catalase (1:250 dilution; Europa, Cambridge, Great Brit-in), rabbit anti-human calreticulin (1:200 dilution; ABR Golden)nd mouse anti-human mitochondria (1:50 dilution; Chemicon, Te-ecula, CA). Antigen–antibody complexes were detected withRITC-conjugated goat anti-rabbit IgG (1:50 dilution; Europa) andRITC-conjugated goat anti-mouse IgG (1:50 dilution; Europa). Welso used the LysoTracker Red (Molecular Probes, Leiden, The Neth-rlands) according to the manufacturer’s suggestions.

Immunoprecipitation. Immunoprecipitation was carried out es-entially as described (11). N-myc-tagged PMP70, PMP70 frag-ents and PEX19 as well as untagged PMP70, PEX19 and OATere transcribed and translated in vitro for 90 min using the TNToupled Reticulocyte Lysate System (Promega, Mannheim, Ger-any). The proteins were used either labeled with [35S]methi-

nine (Amersham, Braunschweig, Germany). Twelve microlitersf PMP70 and OAT translation reactions were mixed with anqual amount of untagged or tagged PEX19 translation reactionnd incubated for one hour at 30°C. The reaction mixtures wereiluted to 175 ml with binding buffer (20 mM Hepes, pH 7.3, 110M potassium acetate, 5 mM sodium acetate, 2 mM magnesium

cetate, 1 mM EDTA, 0.3% Triton X-100, 0.5 mg/ml leupeptin, 0.5g/ml pepstatin, and 0.1 mM PMSF). They were incubated for andditional 2 h at 4°C with 25 ml anti-myc antibodies (Invitrogeneek) saturated with anti-mouse IgG dynabeads (Dynal, Ham-urg, Germany). Immunoprecipitation was done by magnet. Theollected precipitates were washed five times with binding buffer,esuspended in SDS sample buffer, denaturated for 5 min at 95°Cnd separated by SDS–PAGE.

ESULTS AND DISCUSSION

eroxisomal Targeting Elements in theAmino-Terminal Region of PMP70

To identify candidate sequences important for tar-eting of human PMP70 to peroxisomes, we comparedhe amino-terminal cDNA region of PMP70 with thatf the preliminary reported peroxisomal targeting re-

FIG. 1. Constructs of PMP70 deletion mutants and their intracelndicate the position of the two putative transmembrane domains (1

651

ion in the amino-terminus of the adrenoleukodystro-hy protein (ALDP) (15). The PXMP1 gene encodingMP70 and the ALD gene encoding ALDP are mem-ers of a family of four genes encoding peroxisomalembrane ABC-transporters. PMP70 and ALDP more

losely resemble each other than any other members ofhe ABC transporter superfamily (16). In the ALDP themino-terminal 281 amino acids are sufficient to directhis protein to the peroxisomal membrane. Based on aomparison of this ALDP targeting sequence locationn the human PXMP1 and ALD genes, we speculatedhat the targeting elements for PMP70 are containedithin the first amino-terminal 180 amino acids. ThisMP70 protein fragment contains the first two trans-embrane domains with the adjacent peroxisomal ma-

rix and cytosolic regions (17). To determine whetherhese domains are sufficient for peroxisomal targeting,mino acids 1 to 180 were fused to the green fluores-ent protein (GFP). This GFP-PMP70(AA 1–180) fu-ion protein targeted to peroxisomes at an efficiencylmost comparable to the full length protein (Fig. 1)nd yielded a perfect colocalization pattern with theeroxisomal marker enzyme catalase (Figs. 2A andB). To further enclose the putative targeting region aeries of amino-terminal and carboxyl-terminal dele-ions of GFP-PMP70(AA 1–180) were constructed (Fig.). A region of 20 amino acids (AA 61–80) within therst cytosolic loop contains important targeting infor-ation. All fusion proteins that lacked this amino acid

egion, as in GFP-PMP70(AA 1–60) and GFP-MP70(AA 81–160), did not display any peroxisomal

ocalization and were found in the cytoplasm (Figs. 2G

r localization. The ellipse shows the position of GFP, the solid boxes30%; 11, 30–80%; 111, .80%).

lula, ,


652

afifipilia2GfaGfipm

lmtwthtfbidttkcw1

o(cd

fG


nd 2H). However, no peroxisomal targeting was seenor the GFP-PMP70(AA 61–80) fusion protein indicat-ng that this cytosolic region is necessary but not suf-cient for targeting. Peroxisomal localization reap-eared in fusion proteins that in addition to thendispensable cytosolic targeting region contained ateast the first and second transmembrane domain, asn GFP-PMP70(AA 61–180), GFP-PMP70(AA 61–160)nd GFP-PMP70(AA 61–138) (Figs. 2C, 2D, 2E, andF). Peroxisome targeting was most efficient in theFP-PMP70(AA 61–180) and GFP-PMP70(AA 61–160)

usion proteins (Fig. 1). Deleting amino acids directlydjacent to the second transmembrane domain, as inFP-PMP70(AA 61–138), dropped the localization ef-ciency and lead to partially mistargeting of the fusionrotein to mitochondria (Figs. 3A and 3B). Further-ore, deleting the second transmembrane domain mis-

FIG. 2. Intracellular localization of PMP70 fusion protein constrf the fusion proteins is compared with the localization of the peroxisoB, D, F, H). The GFP-PMP70(AA 1–180) (A and B), the GFP-PMP70(olocalize with catalase. In contrast, the GFP-PMP70(AA 81–160) fuoes not colocalize with catalase.

FIG. 3. Intracellular localization of PMP70 fusion protein construsion proteins is compared with the localization of a mitochondrFP-PMP70(AA 61–138) (A and B) and the GFP-PMP70(AA 61–127)

653

ocalized the GFP-PMP70(AA 61–127) fusion protein toitochondria (Figs. 3C and 3D). These results suggest

hat important targeting information is containedithin the cytosolic region of amino acids 61 to 80 and

hat the first and second transmembrane domainsave an additional effect on peroxisomal membraneargeting. These domains may contribute to correctolding of the fusion protein necessary for its mem-rane integration. The peroxisomal membrane target-ng signal of PMP70 is different from those so farescribed for other, non-ABC-transporter proteins inhe peroxisomal membrane. The targeting signals forhe 34-kDa peroxisomal membrane protein, the 47-Da peroxisomal membrane protein, and peroxin 3 allontain a cluster of positively charged amino acids thatere not found in the targeting elements of PMP70 (8,1, 13, 18–21).

s expressed in Cos-7 cells (A, C, E, and G). The cellular distributionl marker enzyme catalase detected by immunofluorescence staining61–180) (C and D), and the GFP-PMP70(AA 61–160) fusion proteinsn protein (G and H) shows a diffuse distribution in the cytosol and

s expressed in Cos-7 cells (A and C). The cellular distribution of themarker detected by immunofluorescence staining (B and D). Theand D) fusion proteins colocalize with the marker for mitochondria.

uctma

AAsio

uctial(C

GapmcPtssteTPpftpPGlpfisaatpamt

Tgipnso

P

itpsipPbiiPmtPPrtcaw

ca


Our results confirm and extend the observations byloeckner and co-workers (15) as well as by Sackstedernd co-workers (14) that the amino-terminal part oferoxisomal ABC-transporters contains the peroxiso-al membrane targeting signal. Regarding the dis-

rete targeting signals in the amino-terminal part ofMP70, our findings do not completely agree withhose by Sacksteder and co-workers (14). Their analy-es assume that the peroxisomal membrane targetingignal is contained within the first 61 amino acids andhat the first 124 amino acids of PMP70 are needed forfficient targeting of the fusion protein to peroxisomes.hey demonstrated that the first 61 amino acids ofMP70 were able to partially localize the protein toeroxisomes. In contrast, our GFP-PMP70(AA 1–60)usion protein was exclusively mislocalized in the cy-osol. Furthermore, we could demonstrate that fusionroteins missing the first 60 amino acids, as in GFP-MP70(AA 61–180), GFP-PMP70(AA 61–160) andFP-PMP70(AA 61–138) showed a perfect peroxisomal

ocalization (Figs. 2C and 2D). There are at least twoossibilities to explain these discrepant findings. Therst possibility is that the targeting efficiency of thehort PMP70 fusion protein with the first 60 aminocids might be severely reduced and hence undetect-ble with the peroxisome localization methods used inhis study. An alternative possibility is that the fusionrotein itself influences targeting. While Sackstedernd co-workers analyzed PMP70 regions in fusion withyc at the carboxyl-terminus, we fused PMP70 regions

o the green fluorescent protein at the amino-terminus.

FIG. 4. Coimmunoprecipitation of PMP70 deletion mutants withipitated and separated by SDS–PAGE. All three PMP70 fragmenminotransferase (OAT) was used as a negative control and does no

654

o examine these possibilities, more information re-arding the physiologic mechanisms of PMP70 target-ng and insertion as well as the influence of fusionrotein systems must be acquired. Others and we didot rule out that the carboxyl-terminal half of peroxi-omal ABC transporters includes further discrete per-xisomal membrane targeting signals.

MP70 Interacts with PEX19

PEX19 is a farnesylated protein essential for perox-some biogenesis and most likely for the synthesis ofhe peroxisome membrane (14, 22, 23). Although itsrecise function and site of action are unknown, iteems to be a cytosolic acceptor protein for the target-ng and insertion of various peroxisomal membraneroteins including PMP70 (14, 23, 24). To determine ifEX19 functions as a targeting receptor for PMP70 byinding the peroxisomal targeting elements, we exam-ned the interactions by coimmunoprecipitation exper-ments. For these analyses, we used N-myc-taggedMP70 fragments with and without targeting ele-ents as well as full-length PMP70 and OAT as con-

rols. The results are shown in Fig. 4. Both, the myc-MP70(AA 60–160) fusion protein as well as the myc-MP70myc(AA 1–180) located to peroxisomes andetained the ability to interact with PEX19. In addi-ion, the myc-PMP70(AA 80–160) fusion protein notontaining any specific peroxisomal targeting elementslso interacted with PEX19. Thus, PEX19 interactedith multiple amino-terminal PMP70 fragments, and

X19. The in vitro translated and labeled proteins were immunopre-interact with PEX19 and are marked by arrows (A). Ornithine-d-veal any interaction with PEX19 (B).

PEtst re

these interactions are not restricted to the specific per-oSadiaoiftdisoippmb

R

1

1

1

(2000) Targeting of the 22 kDa integrale peroxisomal membrane

1

1

1

1

1

1

1

2

2

2

2

2

2


xisomal targeting elements. In contrast to work byacksteder and co-workers (14), we conclude that thebility of PEX19 to bind PMP70 fragments is not me-iated by the region necessary for peroxisomal target-ng. Our results confirm and extend the ones by Snydernd co-workers (25). Six of seven known integral per-xisomal membrane proteins analyzed in this studynteracted with PEX19. By mapping the domains, theyound that in the majority of proteins the peroxisomalargeting sequences and the PEX19 interaction sitesid not overlap. All these results suggest that. PEX19s not the receptor for peroxisomal membrane targetingignals. Nevertheless, PEX 19 is indispensable for per-xisome membrane formation and may facilitate thensertion of peroxisomal membrane proteins into theeroxisome membrane. This hypothesis is also sup-orted by the observation that loss of PEX19 results inislocalization or degradation of peroxisomal mem-

rane proteins (14).

EFERENCES

1. Gould, S., Raymond, G. V., and Valle, D. (2001) The peroxisomebiogenesis disorders. In The Metabolic and Molecular Bases ofInherited Diseases (Scriver, C. R., et al., Eds.), Vol. II, pp. 3181–3217, McGraw-Hill.

2. Gould, S. J., and Valle, D. (2000) Peroxisome biogenesis disor-ders. TIG 16(8).

3. Lazarow, P. B., and Fujiki, Y. (1985) Biogenesis of peroxisomes.Annu. Rev. Cell Biol. 1, 489–530.

4. South, S. T., and Gould, S. J. (1999) Peroxisome synthesis in theabsence of preexisting peroxisomes. J. Cell Biol. 144, 255–266.

5. Gould, S. J., Keller, G. A., Hoskens, N., Wilkinson, J., and Sub-ramani, S. (1989) A conserved tripeptid sorts proteins to peroxi-somes. J. Cell Biol. 108, 1657–1664.

6. Subramani, S. (1993) Protein import into peroxisomes and bio-genesis of the organelle. Annu. Rev. Cell Biol. 9, 445–454.

7. Swinkels, B. W., Gould, S. J., Bodnar, A. G., Rachubinski, R. A.,and Subramani, S. (1991) A novel, cleavable peroxisomal target-ing signal at the amino-terminus of the rat 3-ketoaccy-CoA thio-lase. EMBO J. 19, 3255–3262.

8. Dyer, J. M., McNew, J. A., and Goodmann, J. M. (1996) Thesorting sequence of the peroxisomal integral membrane proteinPMP47 is contained within a short hydrophilic loop. J. Cell Biol.133, 269–280.

9. Wang, X., Unruh, M. J., and Goodmann, J. M. (2001) Discretetargeting signals direct Pmp47 to oleate-induced peroxisomes inSaccharomyces cerevisiae. J. Biol. Chem. 276, 10897–10905.

0. Wylin, T., Baes, M., Brees, C., Mannaerts, G. P., Fransen, M.,and van Veldenhoven, P. P. (1998) Identification and character-ization of human PMP34, a protein closely related to the perox-isomal integrale membrane protein PMP47 of Candida boidinii.Eur. J. Biochem. 258, 332–338.

1. Soukopova, M., Srenger, C., Gorgas, K., Kunau, W.-H., and Dodt,G. (1999) Identification and characterization of the human per-oxin PEX3. Eur. J. Cell Biol. 78, 357–374.

2. Pause, B., Saffrich, R., Hunziker, A., Ansorge, W., and Just, W.

655

protein. FEBS Lett. 471, 23–28.3. Honsho, M., and Fujiki, Y. (2000) Topogenesis of peroxisomal

membrane protein requires a short, positively chargedinterventing-loop sequence and flanking hydrophobic segments.J. Biol. Cell 276, 9375–9382.

4. Sacksteder, K. A., Jones, J. M., South, S. T., Li, X., Liu, Y., andGould, S. J. (2000) PEX19 binds multiple peroxisomal membraneproteins, is predominantly cytoplasmatic, and is required forperoxisome membrane synthesis. J. Cell Biol. 148, 931–944.

5. Gloeckner, C. J., Mayerhofer, P. U., Landgraf, P., Muntau, A. C.,Holzinger, A., Gerber, J. K., Kammerer, S., Adamski, J., andRoscher, A. (2000) Human adrenoleukodystrophy protein andrelated peroxisomal ABC transporters interacts with the perox-isomal assembly protein PEX19p. Biochem. Biophys. Res. Com-mun. 271, 144–150, doi:10.1006/bbrc.2000.2572.

6. Shani, N., Jimenez-Sanchez, G., Steel, G., Dean, M., and Valle,D. (1997) Identification of a fourth half ABC transporter in thehuman peroxisomal membrane. Hum. Mol. Genet. 6, 1925–1931.

7. Gartner, J., and Valle, D. (1993) The 70 kD peroxisomal mem-brane protein: An ATP-binding cassette transporter protein in-volved in the peroxisome biogenesis. Semin. Cell Biol. 4, 45–52.

8. Kammerer, S., Holzinger, A., Welsch, U., and Roscher, A. A.(1998) Cloning and characterization of the gene encoding thehuman peroxisomal assembly protein PEX3p. FEBS Lett. 429,53–60.

9. Ghaedi, K., Itagaki, A., Toyama, R., Tamura, S., Matsumura, T.,Kawai, A., Shimozawa, N., Suzuki, Y., Kondo, N., and Fujiki, Y.(1999) Newly identified Chinese hamster ovary cell mutantsdefective in peroxisome assembly represent complementationgroup A of human peroxisome biogenesis disorders and one novelgroup in mammals. Exp. Cell Res. 248, 482–488.

0. Wiemer, E. A. C., Luers, G. H., Faber, K. N., Wenzel, T., Veen-huis, M., and Subramani, S. (1996) Isolation and characteriza-tion of Pas2p, a peroxisomal membrane protein essential forperoxisome biogenesis in the methylotrophic yeast Pichia pasto-ris. J. Biol. Chem. 271, 18973–18980.

1. Baerends, R. J. S., Faber, K. N., Kram, A. M., Kiel, J. A. K. W.,van der Klei, I. J., and Veenhuis, M. (2000) A stretch of positivelycharged amino acids at the N terminus of Hansenula polymor-pha Pex3p is involved in incorporation of the protein into theperoxisomal membrane. J. Biol. Chem. 275, 9986–9995.

2. Gotte, K., Girzalsky, W., Linkert, M., Baumgart, E., Kammerer,S., Kunau, W.-H., and Erdmann, R. (1997) PEX19p, a farnesy-lated protein essential for peroxisome biogenesis. Mol. Cell. Biol.18, 616–628.

3. Snyder, W. B., Faber, K. N., Wenzel, T. J., Koller, A., Luers,G. H., Rangell, L., Keller, G. A., and Subramani, S. (1999)PEX19p interacts with Pex3p and Pex10p and is essential forperoxisome biogenesis in Pichia pastoris. Mol. Biol. Cell 10,1745–1761.

4. Snyder, W. B., Koller, A., Choy, A. J., Johnson, M. A., Cregg,J. M., Rangell, Keller, G. A., and Subramani, S. (1999) PEX17pis required for import of both peroxisome membrane and lume-nal proteins and interacts with PEX19p and the peroxisometargeting signal-receptor docking complex in Pichia pastoris.Mol. Biol. Cell 10, 4005–4019.

5. Snyder, W. B., Koller, A., Choy, A. J., and Subramani, S. (2000)The peroxin PEX19p interacts with multiple, integrale mem-brane proteins at the peroxisomal membrane. J. Cell Biol. 149,1171–1177.

Documents

Targeting Elements in the Amino-Terminal Part Direct the Human 70-kDa Peroxisomal Integral Membrane Protein (PMP70) to Peroxisomes