77

Systematic Botany (2004) 29(1) pp 77ndash96q Copyright 2004 by the American Society of Plant Taxonomists

Molecular Phylogeny and Biogeography of Ribes (Grossulariaceae) with anEmphasis on Gooseberries (subg Grossularia)

LISA M SCHULTHEIS123 and MICHAEL J DONOGHUE1

1Department of Ecology and Evolutionary Biology Yale University PO Box 208105New Haven Connecticut 06520

2The Arnold Arboretum of Harvard University 125 Arborway Jamaica Plain Massachusetts 021303Present address Biological and Health Sciences Division Foothill College 12345 El Monte Road

Los Altos Hills California 94022

Communicating Editor Matt Lavin

ABSTRACT Gooseberries are often distinguished from currants as a distinct genus (Grossularia) or subgenus (Ribes subgGrossularia) but recent molecular phylogenetic analyses of chloroplast and nuclear data disagree as to the monophyly of thisgroup We report new sequence data from the 18ndash26S nuclear rDNA ITS and ETS regions and from the chloroplast psbA-trnH intergenic spacer that in combination with previously reported data suggest subg Grossularia is monophyletic andnested within Ribes Two main lineages are evident within subg Grossularia corresponding to the true gooseberries (subgGrossularia sect Grossularia) and a clade of glabrous-styled western North American gooseberries (subg Grossularia sectRobsonia subg Hesperia Lobbia) Biogeographic analyses based on DIVA optimizations suggest a western North Americanorigin for subg Grossularia with subsequent dispersal to east Asia giving rise to a well-supported clade of Asian gooseberryspecies in sect Grossularia This example contrasts with the well-documented pattern of dispersal from Asia to NorthAmerica and highlights the need to investigate additional groups distributed widely through the Northern Hemisphere

Ribes L comprises approximately 150 species ofshrubby plants with strikingly diverse oral and fruitfeatures The infrageneric classication for Ribes variesamong the primary treatments (eg Janczewski 1907Coville and Britton 1908 Berger 1924 Rehder 1940Sinnott 1985) creating a difcult taxonomy (reviews inSpongberg 1972 Sinnott 1985) One of the more nota-ble and consistent divisions within the genus is be-tween the currants (subg Ribes) and the gooseberries(subg Grossularia) Currants are mostly spinelessshrubs bearing multi-owered racemes with jointedpedicels whereas gooseberries have nodal spines andsometimes bristly stems bear few-owered racemeswith non-jointed pedicels and have highly reexed se-pals (Senters and Soltis 2003) The differences betweengooseberries and currants have led many researchersto recognize gooseberries at the subgeneric (subgGrossularia) (Janczewski 1907 Sinnott 1985) or generic(Grossularia) (eg Coville and Britton 1908 Berger1924) level Previous phylogenetic analyses howeverare at odds regarding the status of the gooseberries asa natural group (Fig 1) Sequence data from the nu-clear 18Sndash26S rDNA internal transcribed spacer (ITS)region indicated monophyly of subg Grossularia (Sen-ters and Soltis 2003) while restriction site data fromthe 18Sndash26S nuclear rDNA region (Messinger et al1993) and from two chloroplast regions indicated poly-or paraphyly (Fig 1 Messinger et al 1999) The chlo-roplast data strongly resolved the morphologically in-termediate spiny currants (subg Ribes sect Grossular-ioides) as a paraphyletic grade subtending only the truegooseberries (subg Grossularia sect Grossularia) whilea clade of glabrous-styled gooseberries (subg HesperiaLobbia and Grossularia sect Robsonia) were weakly

placed along a separate lineage A second study usingITS sequence data also supported the monophyly ofthe true gooseberries (sect Grossularia) but did notsample glabrous-styled gooseberries or spiny currants(Fenton et al 2000) Given the long tradition of rec-ognizing the gooseberries as a distinct genus (eg Co-ville and Britton 1908 Berger 1924) or subgenus (Jan-czewski 1907 Sinnott 1985) one goal of this study wasto clarify the monophyly of subg Grossularia

A rst step towards addressing the monophyly ofthe gooseberries (subg Grossularia) is to combine theavailable chloroplast (Messinger et al 1999) and ITS(Senters and Soltis 2003) datasets and to obtain addi-tional data to resolve apparent conicts evident inthese previous studies Additional data may result ina convergence onto similar topologies indicating thatthe apparent conict was weak or due to insufcientdata or alternatively may reinforce the apparent con-ict between the chloroplast and nuclear genomes in-dicating possible hybridization and introgressionevents in the history of the group (Rieseberg and Wen-del 1993 Avise 1994) Additional datasets reportedhere include sequence data from the nuclear encoded18Sndash26S rDNA external transcribed spacer region(ETS) and from the chloroplast encoded psbA-trnH in-tergenic spacer region Previous studies reported levelsof variation in the ETS similar to or greater than thosetypical of the ITS regions (Baldwin and Markos 1998Bena et al 1998 Linder et al 2000) Studies have alsoreported sufcient variation within the psbA-trnH in-tergenic spacer region for phylogenetic reconstructionwithin genera (eg Sang et al 1997 Mast and Givnish2002 Mort et al 2002)

A second goal of this study was to consider Ribes

78 [Volume 29SYSTEMATIC BOTANY

FIG 1 A simplied representation of prior phylogenetic hypotheses for Ribes Chloroplast restriction site data from Mes-singer et al(1999) suggest that gooseberries (subg Grossularia) are non-monophyletic ITS data from Senters and Soltis (2003)support the monophyly of gooseberries

in the context of Northern Hemisphere biogeographyThe Northern Hemisphere problem has recently at-tracted attention from a phylogenetic perspective byboth zoologists (eg SanmartDaggern et al 2001) and bota-nists (eg Manos and Donoghue 2001) It has becomeclear that oristic similarities among the major areasof endemism such as eastern Asia and eastern NorthAmerica (see Boufford and Spongberg 1983 Wen1999) were established in several ways (eg move-ment through Beringia or the North Atlantic) and atdifferent times in different groups (eg Tiffney 1985aManchester 1999 Wen 1999 Xiang et al 1998 2000Donoghue et al 2001 Fritsch et al 2001 Manos andStanford 2001 Tiffney and Manchester 2001 Xiangand Soltis 2001) Several recent studies have highlight-ed plant groups that appear to have diversied ini-tially in Asia and subsequently moved to North Amer-ica via the Bering Land Bridge apparently at severaldifferent times (eg Donoghue et al 2001 Xiang andSoltis 2001) This iterative trans-Beringian movementresembles the pattern described for mammals earlierin the Tertiary (Beard 1998) and generally suggeststhat Asia has been a primary source area for NorthernHemisphere diversity However this may reect thesample of taxa that has been examined to date andother patterns including movement from North Amer-ica to Asia have also been described (see examples inSanmartDaggern et al 2001) It is noteworthy that NorthernHemisphere plant groups that are especially diversetoday in western North America have seldom been thefocus of phylogenetic biogeographic analyses

Ribes is very broadly distributed around the North-ern Hemisphere and extends south in the mountains

of South America but is especially diverse in westernNorth America both in terms of the number of speciesand the representation of major subclades Likewisesubg Grossularia which is the focus of our analysisoccurs around the Northern Hemisphere but is mostdiverse in western North America Specically nu-merous glabrous-styled gooseberries (subg HesperiaLobbia and sect Robsonia) are distributed in westernNorth America while the true gooseberries (sect Gros-sularia) are found throughout North America and Asia(including Taiwan and Japan) with one species in Eu-rope Better knowledge of phylogenetic relationships inRibes and especially in Grossularia would make it pos-sible to assess geographic patterns of diversicationand directions of movement in the group

MATERIALS AND METHODS

Samples New data reported here include 12 ITS sequences73 ETS sequences (from 57 species) and 53 psbA-trnH sequencesPrevious studies provided an additional 67 ITS sequences (Sentersand Soltis 2003) and restriction site data from two amplied chlo-roplast regions (rbcL to accD and rpoC1 to rpoC2) for 32 species(Messinger et al 1999) Our sampling was weighted towardssubg Grossularia the focus of this study We included all of thetrue gooseberry species (sect Grossularia) recognized by Sinnott(1985) all of the Asian true gooseberry species recognized by Ber-ger (1924) representatives from each of the three glabrous-styledgooseberry taxa (sect Robsonia subg Hesperia Lobbia) and bothspiny currant species (sect Grossularioides) In total 82 of the ap-proximately 150 species of Ribes were included in this study (Table1) representing all of the infrageneric taxa recognized by Berger(1924) but with nomenclature following Sinnott (1985) Itea rep-resented by I virginica and I ilicifolia was chosen as the outgroupbased on previously published studies (Soltis et al 1990 1993Morgan and Soltis 1993 Soltis and Soltis 1997) in which RibesItea and Saxifragaceae ss appeared to be closely related membersof Saxifragales

2004] 79SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

DNA Isolation Total DNA was isolated from fresh silica-des-iccated and herbarium material All extractions were performedusing QiaGen DNeasy Plant Mini kits following manufacturerrsquosinstructions except that plant material was ground in warmedAP1 buffer (provided in QiaGen kit) rather than liquid nitrogenSome DNA aliquots were provided by Senters and Soltis (Univer-sity of Florida) as indicated in Table 1

Amplication and Sequencing PCR and sequencing reactionswere performed using a Perkin-Elmer Corporation GeneAmp 9600or MJ Research Inc DNA Enginey Thermal Cycler PCR productswere cleaned using QiaGen QiaQuick PCR Purication kits Se-quencing reactions were performed with ABI Prism BigDye Ter-minator Cycle Sequencing Ready Reaction Kits using half or fullreactions and were cleaned using either EtOHNaOAc precipita-tion following recommendations in BigDye kits or Edge Biosys-tems Performa DTRy Gel Filtration systems In some cases se-quences were improved with the addition of DMSO to sequencingreactions (approximately 6 nal volume) Sequencing reactionswere resolved on 5 polyacrylamide gels with an Automated Bio-systems (ABI) 377 sequencer loaded with standard or Rapid Loadmembrane combs (The Gel Company) Sequencher version 311was used to examine and edit sequence chromatograms

ITS amplication products for the 12 new sequences reportedin this study were generated using primers ITS4 (White et al 1990)and ITS-I (59-GTCCACTGAACCTTATCATTTAG-39 designedby LE Urbatsch Louisiana State University) with the following param-eters initial denaturation (978C 1 min) followed by 35 cycles ofdenaturation (978C 10 sec) annealing (488C 30 sec) extension(728C 20 sec increasing 4 sec with each cycle) and concludingwith a nal extension (728C 7 min) PCR reactions contained25mL 10X AmpliTaq buffer (Perkin-Elmer) 25mL 10mM dNTPs25mL 25mM MgCl2 125mL BSA 125mL 10mM ITS4 primer125mL 10mM ITS-I primer 01mL AmpliTaq DNA polymerase(Perkin-Elmer) and 1ndash10ng DNA to a total volume of 25mL Am-plication products were sequenced with ITS4 ITS2 (White et al1990) ITS-I and ITS3B (the reverse complement of ITS3 White etal 1990) Most the length of ITS 2 was sequenced in both direc-tions Sequencing primers for ITS 1 often produced short sequenc-es with minimal overlap such that sequences were largely basedon a single strand A portion of the 58S region could not be re-covered from R cynosbati (41 bp) or R echinellum (77 bp) and wasthus coded as Nrsquos in the matrix Of the 67 ITS sequences obtainedfrom Senters and Soltis (2003) ve were missing a large portionof ITS 1 (approx 100bp for R giraldii and R montigenum approx240 for R missouriense approx 130 for R watsonianum approx230 for R rubrum)

Sequences from the external transcribed spacer of 18ndash26S nucle-ar rDNA (ETS) were obtained following the strategy of Baldwinand Markos (1998) Ribes odoratum (subg Ribes sect Symphocalyx)and R hirtellum (subg Grossularia sect Grossularia) were chosenfor initial long-distance PCR of the inter-genic spacer region (IGS)in order to design an internal primer conserved across RibesLong-distance PCR of the IGS was conducted with the followingparameters initial denaturation (948C 1 min) followed by 35 cy-cles of denaturation (948C 30 sec) and combined annealing andextension (728C 6 min) PCR reactions contained the followingcomponents 25mL 10X KlenTaq LA Polymerase Mix (ClontechLaboratories Inc) 25mL 10mM dNTPs 25mL 10mM 18S-IGSprimer (Baldwin and Markos 1998) 25m L10mM 26S-IGS primer(Baldwin and Markos 1998) 05mL KlenTaq LA DNA polymeraseand 1ndash10 ng DNA to a total volume of 25 mL Amplication prod-ucts were sequenced in one direction using primer 18S-E (Baldwinand Markos 1998) yielding approximately 480bp of readable se-quence Primer ETS-Rib1 (59 GAACTGTTGTCGCGTGCGTCGT39)was designed 59 of the 18S-E priming site from a conserved regionwithin ETS Attempts were made to sequence further into the ETSregion using primer ETS-Rib2 (59 ACGACGCACGCGACAA-CAGTTC 39) the reverse complement of ETS-Rib1 but readablesequences were only obtained from R hirtellum hindering effortsto identify a conserved site further 59 of ETS-Rib1

Short-distance PCR of the 39 portion of the ETS region was per-formed using the ETS-Rib1 primer in conjunction with the 18S-

ETS primer (Baldwin and Markos 1998) under the following pa-rameters initial denaturation (948C 2 min) followed by 35 cyclesof denaturation (948C 30 sec) annealing (658C 1 min) extension(728C 15 min) and concluding with a nal extension (728C 7min) PCR reactions contained 25mL 10X AmpliTaq buffer (Perkin-Elmer) 25mL 10mM dNTPs 25mL 25mM MgCl2 05mL 10mMETS-Rib1 primer 05mL 10mM 18S-ETS primer 01mL AmpliTaqDNA polymerase (Perkin-Elmer) and ndash10ng DNA to a total vol-ume of 25mL Cleaned amplication products were sequenced inboth directions with primers ETS-Rib1 and 18S-ETS Itea ilicifoliais a partial sequence missing the rst 107 bp

Primers psbAF and trnHR (Sang et al 1997) were used for bothamplication and sequencing of the psbA-trnH intergenic spacerregion PCR reaction parameters were initial denaturation (948C2 min) followed by 35 cycles of denaturation (948C 30 sec) an-nealing (618C 30 sec) extension (728C 1 min) and concludingwith a nal extension (728C 7 min) PCR reactions contained25mL 10X AmpliTaq buffer (Perkin-Elmer) 25mL 10mM dNTPs25mL 25mM MgCl2 125mL 10mM psbAF primer 125mL 10mMtrnHR primer 01mL AmpliTaq DNA polymerase (Perkin-Elmer)and1ndash10ng DNA to a total volume of 25mL For some samplesamplication was aided by the addition of 25mL BSA to the PCRreaction Ribes viburnifolium was not successfully sequenced pos-sibly due to homopolymer strings close to both the 59 and 39 prim-er sites A central portion of approximately 159 bp could not berecovered from Itea virginica and was coded as Nrsquos in the matrix

Sequence identities were veried by performing BLAST searches(National Center for Biotechnology Information National Insti-tutes of Health) using sequences from Ribes burejense

Alignment Sequences were initially aligned in Clustal X Mul-tiple Sequence Alignment Program version 181 under the defaultsettings then adjusted by eye using MacClade 4 sequencing editorfeatures (Maddison and Maddison 2000) All Ribes sequences werereadily alignable by eye as were Itea sequences but alignmentbetween Ribes and Itea was often difcult Ambiguous regionswere aligned so that the number of informative sites was mini-mized Base pairs that could not be assigned with condence dueto weak or noisy signal were coded with lsquolsquoNrsquorsquo or with IUPAC-IUBambiguity symbols Gaps inserted for alignment in regions of in-ferred indels were coded as rsquorsquondashrsquorsquo and treated as missing data Sevenlarge indels coded as present (1) or absent (0) were added to thepsbA-trnH matrix The seven coded indels included three inser-tions in Itea (positions 79ndash88 199ndash207 418ndash434) two deletions inItea (positions 110ndash114 359ndash372) an insertion consisting primarilyof TA repeats in members of sect Grossularia (positions 279ndash295)and a deletion in R himalense R manshuricum and R rubrum (po-sitions 111ndash116) Datasets are available at TreeBASE (study acces-sion number s1001)

Dataset Combinability Overlap among the four datasets (ITSETS psbA-trnH restriction sites) was not complete Of the 84 spe-cies included in this study 50 were represented in at least threeof the four datasets (Table 1) A series of partition homogeneitytests (Farris et al 1995) were performed in PAUP ver 40 (Swof-ford 2001) to assess dataset combinability Each test consisted of100 replicates employing heuristic searches with simple taxon ad-dition TBR branch swapping maxtrees set to 1000 and invariantcharacters excluded

Initial partition homogeneity tests indicated that the psbA-trnHand restriction site datasets were combinable (p5066) while allother dataset combinations were incongruent (p 001) To explorepotential sources of incongruence we conducted additional ho-mogeneity tests with individual taxa or groups of taxa excludedbased on differential and well-supported (bootstrap 70) place-ment in trees or on differential placement regardless of supportlevels (deQueiroz et al 1995) For the ETS and ITS comparisontaxa were excluded one at a time and in groups if they representedcomposites of multiple accessions (Table 1) and exhibited differ-ential placements in ETS versus ITS trees Samples of R oxyacan-thoides subsp oxyacanthoides were also excluded in ETS versus ITScomparisons because there was divergence between the two in-cluded ETS sequences (sequenced for this study) thus it was notclear which should be combined with the ITS sequence (obtained

80 [Volume 29SYSTEMATIC BOTANY

TABLE 1 Taxa included in this study with GenBank accession numbers Following Messinger et al (1999) taxonomy correspondsto Sinnott (1985) with Grossularia subg Hesperia and subg Lobbia treated under Ribes ITS sequences noted in boldface are from Sentersand Soltis (2003) Senters and Soltis provided the DNA for italicized sequences Restriction site data are from Messinger et al (1999)Voucher information is cited as per Senters and Soltis (2003) or Messinger et al (1999) when the data or DNA came from those sourcesHerbarium codes follow the Index Herbariorum Eighth Edition NPGR refers to the USDA-ARS National Plant Germplasm RepositoryUCBG refers to the University of California Botanical Garden RBGE refers to the Royal Botanic Garden Edinburgh

Subg Ribes LSect Berisia Spach (Alpine Currants)

R acuminatum (Hook FampThomson) Jancz Chase 3585 (K) ITS AF426376R alpinum L Arnold Arboretum 678ndash80E ETS AY138021 psbA-trnH AY138094 Chase 3587 (K) ITS AF426378 NPGR 6640

restriction sitesR diacanthum Pallas Arnold Arboretum 1852ndash81B ETS AY138022 psbA-trnH AY138095 ITS AY138047 NPGR 34 (Messinger

315 OSC) restriction sitesR giraldii Janczewski Arnold Arboretum 609ndash74B ETS AY138023 psbA-trnH AY138096 M Mort sn (WS) ITS AF426381R glaciale Wall UCBG 910285 ETS AY138024 psbA-trnH AY138097 ITS AY138048R komarovii Pojark UCBG 91078 ETS (1) AY138025 Arnold Arboretum 1094ndash82A ETS (2) AY138026 psbA-trnH AY138098R maximowiczii Batalin T S Elias 10940 (RSA) ITS AF426380 NPGR 267 restriction sitesR orientale Desf Boufford et al 28317 (A) ETS AY138027 psbA-trnH AY138099R tenue Janczewski Boufford et al 27604 (A) ETS AY138028 psbA-trnH AY138100 Chase 3610 (K) ITS AF426377R vilmorini Janczewski Chase 3612 (K) ITS AF426379

Sect Calobotrya (Spach) Jancz (Ornamental Currants)R afne HBK M Medina 2517 (NY) ITS AF426326R brandegeei Eastwood sc 350568 (WS) ITS AF426331R cereum Douglas UCBG 931213 ETS AY138013 psbA-trnH AY138087 NPGR 237001 restriction sites Ross 3425 (NY) ITS

AF426328R ceriferum Coville and Rose sc 05017194 (MO) ITS AF426333R ciliatum H and B Diggs 2625 (NY) ITS AF426327 NPGR 670001 (Messinger 311 OSC) restriction sitesR dugesii Greenman Siplivinsky 3939 (WS) ITS AF426329R glutinosum Benth Chase 3594 (K) ITS AF426340R indecorum Eastwood UCBG 860903 ETS AY138014 psbA-trnH AY138088 Mort 1370 (WS) ITS AF426336R malvaceum Smith UCBG 911481 ETS AY138015 psbA-trnH AY138089 Johnson sn (WS) ITS AF426338R mogollonicum Greene NPGR 294001 ITS AF426332 restriction sitesR neglectum Rose Villarrea 4940 (NY) ITS AF426330R nevadense Kellogg UCBG 891635 ETS AY138016 psbA-trnH AY138090 Mort 1373 (WS) ITS AF426339R sanguineum Pursh UCBG 900193 ETS AY138017 psbA-trnH AY138091 Mort 1372 (WS) ITS AF426335 NPGR 46 restriction

sitesR tortuosum Benth Breedlove 62230 (MO) ITS AF426325R viscosissimum Pursh Grimes 1878 (NY) ITS AF426334 NPGR 281001 (Fredricks 394 OSC) restriction sitesR woli Rothrock Siplivinsky 4587 (NY) ITS AF426341

Sect Coreosma (Spach) Jancz (Black Currants)R americanum Mill NPGR 93 restriction sites Nee 24196 (NY) ITS AF426375R bracteosum Douglas UCBG 891645 ETS AY138033 psbA-trnH AY138103 ITS AY138049R fragrans Pallas sc 4378976 (MO) ITS AF426373R hudsonianum Richardson B Ertter 3807 (NY) ITS AF426372

var petiolare (Douglas) Jancz NPGR 278 (Fredricks 390 OSC) restriction sitesR janczewskii Pojark Chase 3597 (K) ITS AF426370R nigrum L NPGR 215001 (OSC) ITS AF426374R viburnifolium A Gray UCBG 651431 ETS AY138034 NPGR 762001 ITS AF426371 restriction sites

Sect Grossularioides (Jancz) Rehd (Spiny or Gooseberry-stemmed Currants)R lacustre (Pers) Poiret Lesica 4710 (NY) ETS (1) AY138018 ITS AF426366 Arnold Arboretum 777ndash93A ETS (2) AY138019

psbA-trnH AY138092 NPGR 45 restriction sitesR montigenum McClatchie Bugham amp Miller sn (WS) ETS AY138020 psbA-trnH AY138093 ITS AF426367 NPGR 864001

(Messinger 254 OSC) restriction sitesSect Heritiera Jancz (Dwarf Currants)

R erythrocarpum Coville and Leiberg NPGR 860001 (Messinger 249 OSC) ITS AF426342 restriction sitesR howellii Greene NPGR 449001 (Messinger 333 OSC) ITS AF426343 restriction sitesR glandulosum Grauer UCBG 890750 ETS (1) AY138035 Schultheis 589ndash00 (YU) ETS (2) AY138036 psbA-trnH AY138105

NPGR 231 restriction sites Chase 3605 (K) ( 5 R prostratum LrsquoHer) ITS AF426345R laxiorum Pursh NPGR 439 restriction sites Goodrich 19052 (WS) ITS AF426344

Sect Parilla Jancz (Andine Currants)R andicola Jancz Friere-Fierro 2577 (NY) ITS AF426368R fasciculatum Sieb amp Zucc UCBG 880615 ETS (1) AY138043 psbA-trnH AY138104 Arnold Arboretum 1879 ETS (2)

AY138044 Chase 3592 (K) ITS AF426346R ovalifolium Jancz Gentry sn (MO) ITS AF426369R valdivianum Phil Messinger 314 (OSC) restriction sites

Sect Ribes L (Red Currants)

2004] 81SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

TABLE 1 Continued

R himalense Decaisne Boufford et al 28903 (A) ETS AY138037 psbA-trnH AY138106 sc 04714258 (MO) ITS AF426369R manshuricum Komarow Arnold Arboretum 67ndash7 ETS AY138038 psbA-trnH AY138107 Chase 3599 (K) ITS AF426320R petraeum Wulfen Chase 3604 (K) ITS AF426318R rubrum L Arnold Arboretum 1119ndash78A ETS (1) AY138039 psbA-trnH AY138108 Arnold Arboretum 214ndash96 ETS (2)

AY138040 Schuhwerk 7039 (NY) ITS AF426321R sativum (Rehbeh) Syme Missouri Botanical Garden ITS AF426323

cv rsquoDiplomarsquo NPGR 747 (Thompson 46 OSC) restriction sitesR spicatum Robs Chase 3609 (K) ITS AF426322R triste Pallas UCBG 941114 ETS (1) AY138041 Arnold Arboretum 407ndash94 ETS (2) AY138042 psbA-trnH AY138109 Mes-

singer 314 (OSC) restriction sites Baldwin 2269 (WS) ITS AF426319Sect Symphocalyx Berland (Golden Currants)

R aureum Pursh UCBG 560948 ETS (1) AY138030 Arnold Arboretum 460ndash81A ETS (2) AY138029 psbA-trnH AY138101NPGR 769 restriction sites Clement 26 (WS) ITS AF426382

R odoratum Wendl UCBG 860126 ETS (1) AY138032 Arnold Arboretum 1192ndash74A ETS (2) AY138031 psbA-trnH AY138102NPGR 691 restriction sites

Subg Grossularia (Mill) PersSect Grossularia (Mill) Nutt

R aciculare Sm AK Skvortsov sn (A) ETS AY137976 psbA-trnH AY138060 ITS AY138050R alpestre Wall ex Decne Boufford et al 28437 (A) ETS AY137975 psbA-trnH AY138059 Chase 3586 (K) ITS AF426349R burejense F Schmidt NPGR 259001 ETS AY137977 psbA-trnH AY138061 restriction sites Messinger 260 (OSC) ITS

AF426355R curvatum JK Small R Kral 53094 (GH) ETS AY137979R cynosbati L Arnold Arboretum 1108ndash78A ETS (1) AY137981 psbA-trnH AY138063 ITS AY138051 Schultheis 590ndash00 (YU)

ETS (2) AY137980R divaricatum Douglas UCBG 851596 ETS (1) AY137982 psbA-trnH AY138064 Chase 3591 (K) ETS (2) AY137983 ITS

AF426347R echinellum (Coville) Rehd Arnold Arboretum 234ndash96 ETS AY137984 psbA-trnH AY138065 ITS AY138052R formosanum Hayata Wang 1096 (MO) ETS (1) AY137985 ITS AF426354 RBGE 19934301 ETS (2) AY137986 psbA-trnH

AY138066R grossularioides Maxim RBGE 19592035 ETS AY137987 psbA-trnH AY138067 ITS AY138053R hirtellum Michx UCBG 860125 ETS (1) AY137988 Schultheis 588ndash00 (YU) ETS (2) AY137989 psbA-trnH AY138068 Chase

3595 (K) ITS AF426353R inerme Rydb Layser 1770 (UW) ETS (1) AY137990 ITS AF426356 Arnold Arboretum 225ndash80A ETS (2) AY137991 psbA-

trnH AY138069R missouriense Nutt WR Smith 11396 (GH) ETS AY137993 psbA-trnH AY138071 Solomon 859 (WS) ITS AF426348R niveum Lindl Messinger 226 (OSC) ETS AY137994 psbA-trnH AY138072 ITS AF426351 NPGR 777001 (Messinger 226

OSC) restriction sitesR oxyacanthoides L

subsp oxyacanthoides NPGR 139001 ETS (1) AY137996 Alverson 1645 (WIS) ETS (2) AY137995 psbA-trnH AY138073Peterson amp Annable 4440 (WS) ITS AF426383

subsp cognatum (Greene) Sinnott Woodland sn (WS) ETS AY137978 psbA-trnH AY138062 ITS AF426357subsp irriguum (Douglas) Sinnott RBGE 19794064 ETS AY137992 psbA-trnH AY138070 ITS AY138054 NPGR 773001

(Messinger 221 OSC) restriction sitessubsp setosum (Lindl) Sinnott Arnold Arboretum 1395ndash83A ETS AY137998 psbA-trnH AY138075 Lackschewitz 7845 (UW)

ITS AF426352R rotundifolium Michx Mitchell amp Barbour 10112 (NYS) ETS AY137997 psbA-trnH AY138074 ITS AY138055R stenocarpum Maxim RBGE 19698970 ETS AY137999 psbA-trnH AY138076 ITS AY138056R uva-crispa L UCBG 870719 ETS (1) AY138001 Arnold Arboretum 1404ndash80B ETS (2) AY138000 psbA-trnH AY138077

Hill 20953 (NY) ( 5 R grossularia L) ITS AF426350Subg Hesperia A BergerR amarum McClatchie UCBG 891081 ETS AY138002 psbA-trnH AY138078R californicum Hook and Arn UCBG 821692 ETS AY138004 psbA-trnH AY138080 ITS AY138057R menziesii Pursh Messinger 233 (OSC) ETS AY138006 psbA-trnH AY138082 ITS AF426364 NPGR 769001 (Messinger 233

OSC) restriction sitesR roezli Regel Nelson sn (WS) ETS AY138007 psbA-trnH AY138083 ITS AF426365

var cruentum (Greene) Regel NPGR 772001 (Messinger 217 OSC) restriction sitesSubg Lobbia A BergerR binominatum AHeller Messinger 260 (OSC) ETS AY138003 psbA-trnH AY138079 ITS AF426359 NPGR 867001 (Messinger

260 OSC) restriction sitesR lobbii A Gray UCBG 851496 ETS AY138005 psbA-trnH AY138081 Smith Jr 7443 (WS) ITS AF426361R velutinum Greene Annable 2503 (NY) ETS AY138011 psbA-trnH AY138085 ITS AF426358 NPGR 865 (Messinger 2551

OSC) restriction sitesR watsonianum Koehne Patrick sn (UW) ETS AY138012 psbA-trnH AY138086 ITS AF426360

Sect Robsonia BerlandR speciosum Pursh UCBG 840004 ETS (1) AY138008 psbA-trnH AY138084 Mort 1371 WS ETS (2) AY138009 ITS AF426362

NPGR 901001 restriction sitesR thacherianum Johnson sn (WS) ETS AY138010 ITS AF426363

82 [Volume 29SYSTEMATIC BOTANY

TABLE 1 Continued

OutgroupsItea virginica L New York Botanic Garden 7698C ETS AY138045 psbA-trnH AY138110 Messinger 337 (OSC) restriction sites

Ware 94 (WS) ITS AY231368I ilicifolia Oliver UCBG 860414 ETS AY138046 psbA-trnH AY138111 ITS AY138058

from Senters and Soltis 2003) It is possible that incongruence be-tween ETS and ITS datasets was due to intraspecic variation anas yet unexplored issue within Ribes that may limit future use ofcomposite accessions The presence of ETS and ITS regions on thesame transcript similar GC contents (ETS5 mean 049 ITS5mean058) similar proportions of invariant characters (ETS5 297462ITS5438700) and similar levels of rate heterogeneity across sites(ETS gamma 5 065 ITS gamma5 057) argued against differentevolutionary processes of sequence evolution as an explanation forincongruence

In order to maximize taxon sampling and data tests were alsoused to assess combinability of taxa represented in three of thefour available datasets While this required the inclusion of taxafor which one dataset was coded as missing the decrease in phy-logenetic accuracy was expected to be insignicant (Weins andReeder 1995)

Phylogenetic Analysis of Sequence Data Analyses of single(ITS ETS and psbA-trnH) and combined datasets were performedusing a parsimony criterion in PAUP 40 All sites and all changeswere equally weighted in contrast to the 13 gains10 loss weight-ing scheme used by Messinger et al (1999) in their analyses ofrestriction site data psbA-trnH data were analyzed both with in-dels treated as missing data and with seven large indels includedas binary characters Positions 309ndash327 and 448ndash465 of the alignedpsbA-trnH dataset were excluded from all analyses due to ambig-uous alignments

Analyses of the ITS ETS and psbA-trnH datasets consisted ofheuristic searches with 100 replicates of random addition and TBRbranch swapping No more than 400 trees greater than a speciedlength (234 for ETS 556 for ITS 137 for psbA-trnH) were savedper replicate or in the case of psbA-trnH with indels no more than250 trees greater than length 144 The limiting tree length wasdetermined based on the shortest trees found in prior incompletesearches and was imposed to prevent computational overloadsearching sub-optimal trees Analyses of all datasets combined orof combined chloroplast datasets were conducted with the branch-and-bound algorithm with taxa excluded based on partition ho-mogeneity test results For datasets combining ETS1ITSETS1psbA-trnH psbA-trnH1rDNA or all data for those taxa rep-resented in three of the four datasets analyses consisted of heu-ristic searches with 100 replicates of random addition TBR branchswapping and maxtrees set to 40000

Clade support was assessed using bootstrap analyses (Felsen-stein 1985) as implemented in PAUP 40 with 300 replicates ofheuristic searches each with 5 replicates of random taxon additionand Nearest Neighbor Interchange (NNI) branch swapping Forthe combination of all four datasets and for the combined chlo-roplast datasets clade support was assessed using 100 bootstrapreplicates each with branch and bound searches

Kishino-Hasegawa Tests The parsimony implementation of theKishino-Hasegawa test (Kishino and Hasegawa 1989) in PAUP 40was used to compare the hypothesis of subg Grossularia monophylyto that of subg Grossularia non-monophyly in which sect Grossu-larioides and sect Grossularia form a clade The parsimony version ofthe test was used because comparisons included restriction site dataAs recommended by Goldman et al (2000) comparisons were be-tween a priori hypotheses based on previously published phyloge-nies (Messinger et al 1999 Senters and Soltis 2003)

Analyses were run enforcing each of two constraint trees Therst constraint tree resolved subg Grossularia as monophyletic butleft relationships within subg Grossularia and among all remain-ing species unresolved The second constraint tree enforced res-olution of a clade containing sect Grossularioides plus sect Gros-

sularia but relationships within this clade were left unresolved aswere relationships among all remaining species Comparisonswere between trees from constrained branch and bound searchesfor the chloroplast data and from constrained heuristic searchesfor the rDNA data

Ancestral Area Reconstruction Ancestral areas were inferredusing DIVA which assigns areas to internal nodes such that dis-persal and extinction events are minimized (Ronquist 1996 1997)Default costs were used (vicariance 5 0 dispersal 5 1 extinction51) and the number of inferred areas per node was left uncon-strained These analyses used trees from the combined psbA-trnHand rDNA datasets (Fig 8) with species assigned to one or moreof four areas (eastern North America western North Americaeastern Eurasia and western Eurasia) Geographic distributionsfollowed Berger (1924) Janczewski (1907) and Sinnott (1985) SectCalobotrya R aureum R bracteosum R watsonianum and the cladecontaining the remaining glabrous-styled gooseberries (HesperiaLobbia Robsonia) were all coded with western North American dis-tributions Sect Grossularioides was coded for both North Americaand eastern Eurasia Subg Berisia was coded for both eastern andwestern Eurasia Ribes triste was coded for all areas except westernEurasia Itea was coded for both eastern North America and east-ern Eurasia

Because DIVA analyses do not permit polytomies we treated Raureum and R bracteosum as sister taxa Within sect Grossulariamembers of the Asian gooseberry clade were all coded as easternEurasia The remaining species of the large polytomy all live inwestern or eastern North America We resolved this polytomy inseveral different ways so as to explore some of the possibilitiesFor example in some analyses we created one eastern NorthAmerican and one western North American clade In others theNorth American species were arranged pectinately in relation tothe Asian clade

RESULTS

Sequence Characteristics and Analyses The aligned18ndash26S rDNA ITS dataset including 58S(positions 283ndash452) was 700 bp (282bp5ITS1 248bp5ITS2) with 28of the data matrix coded as missing data For the regionas a whole sequences ranged from 438ndash662bp (varia-tion due in part to missing terminal sequence data)uncorrected pairwise distances within Ribes rangedfrom 00ndash008 distances with Itea ranged from 027(with R missouriense) to 032 (with R malvaceum) andmean GC content was 058 Of the 700 aligned base-pairs 528 were constant within Ribes and 183 wereparsimony informative ITS1 displayed higher levels ofdivergence and a higher proportion of informativecharacters than did ITS2 (ITS1 5 00ndash015 65282 in-formative ITS2 5 00ndash011 25248 informative) In-cluded ITS1 sequences ranged from 34ndash258bpwith thelower limit due to taxa for which much of ITS1 se-quence data was missing ITS2 sequences ranged from216ndash241bp 58S ranged from 161ndash164bp but was only142bp in R sanguineum due to a large deletion

2004] 83SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

Lengths and GC contents fell within the ranges re-ported for a survey of angiosperm taxa (Baldwin et al1995) Analyses of the ITS and 58S regions generated36400 trees (length5556 CI5065 058 excluding un-informative characters RI5084)

Amplied products from the 18ndash26S rDNA inter-genic spacer region were approximately 2kb in R odor-atum (sect Symphocalyx) and 3kb in R hirtellum (sectGrossularia) the two species used to design internalprimers for amplifying 39 ETS Only 406bp of the 39end of the ETS region and 56bp of the 59 end of 18Swere sequenced in this study Included sequencesranged from 299ndash462bp in size with some variationdue to missing terminal sequence data and had amean GC content of 049 Uncorrected pairwise dis-tances among ETS sequences within Ribes ranged from00 to 007 Pairwise distances between Ribes and Itearanged from 026 (with R oxyacanthoides accession 2)to 032 (with R triste accession 1) Of the 462 alignedbasepairs 388 were constant within Ribes 60 were par-simony informative and 2 were coded as missingdata ETS analyses generated 34005 trees (length5234CI5080 074 excluding uninformative charactersRI5093 Fig 2)

The aligned psbA-trnH intergenic spacer dataset was502bp including a 39 portion of psbA (positions 1ndash37)and a 59 portion of trnH (position 484ndash502) One per-cent of the matrix was coded as missing data Includedsequences ranged from 355ndash445bp in length withsome variation due to missing terminal sequence dataand had a mean GC content of 029 The spacer regionalone ranged from 352ndash378bp within Ribes and was369bp in Itea based on complete sequences Uncor-rected pairwise distances (including psbA and trnHterminals) within Ribes ranged from 00 to 004 Dis-tances between Ribes and Itea ranged from 015 (withR odoratum accession 2) to 021 (with R bracteosum)Within Ribes 405465 included characters were con-stant and 34465 were parsimony informative Ex-cluded characters represented a polyA region rangingfrom 4ndash13bp and a 16ndash18bp insertion in Itea (relativeto Ribes) with which 5ndash6bp segments of Ribes could bealigned in various ways Analyses of sequence datafrom the psbA-trnH intergenic spacer produced 34000trees with little homoplasy (length5137 CI5092 088excluding uninformative characters RI5094 Fig 3)Analyses including indels coded as binary charactersproduced 18001 trees (length5144 CI5092 090 ex-cluding uninformative characters RI5095)

Trees Generated by Analyses of IndividualDatasets Results from the expanded ITS datasetconcur with those presented by Senters and Soltis(2003) and are not illustrated here Subg Grossulariawas resolved as monophyletic in ITS and ETS treeswith weak to moderate bootstrap support (Figs 1 2)psbA-trnH trees showed little resolution but did not

conict with a monophyletic subg Grossularia (Fig 3trees from analyses including indels are not shown)

Two main lineages may be identied within subgGrossularia the true gooseberries (sect Grossularia) andthe glabrous-styled gooseberries (Hesperia Lobbia Rob-sonia) The glabrous-styled gooseberries are resolved asa clade in ITS restriction site and psbA-trnH trees(Figs 1 3 Messinger et al 1999) ETS trees also resolvethe glabrous-styled gooseberries (Hesperia Lobbia Rob-sonia) as a clade with the exception of R watsonianum(subg Lobbia) placed with strong support in the truegooseberry clade (sect Grossularia) (Fig 2) The integ-rity of the individual sections comprising the glabrous-styled gooseberries (Hesperia Lobbia Robsonia) is un-clear The true gooseberries (sect Grossularia) are re-solved as a clade in restriction site ITS and ETS trees(including R watsonianum in the latter) and in psbA-trnH trees when indels are included (Figs 1 2 Mes-singer et al 1999 Senters and Soltis 2003) If indels areignored psbA-trnH trees resolve the majority of truegooseberries as a clade and are consistent with amonophyletic sect Grossularia (Fig 3) Within sectGrossularia the ETS dataset provided strong supportfor an Asian clade including the European R uvacris-pa ITS trees were consistent with an Asian clade butexcluded R uvacrispa psbA-trnH trees were also con-sistent with an Asian clade with the weakly support-ed inclusion of the North American R oxyacanthoidessubsp irriguum Restriction site trees had limited sam-pling in sect Grossularia but were consistent with anAsian versus North American divergence (Messingeret al 1999)

All datasets except the restriction sites resolved aclade comprising sect Calobotrya sect Grossularioidesand subg Grossularia (sect Grossularia sect Robsoniasubg Lobbia Hesperia) Members of this clade are large-ly from western North America with sect Grossulariahaving a wider distribution ETS trees included theblack currant Ribes bracteosum (sect Coreosma) withinthis clade in an unresolved position (Fig 2) ITS treesincluded the South American sect Parilla in this cladein an unresolved position (Senters and Soltis 2003) Inall trees sect Calobotrya was resolved as monophyleticincluding some members of sect Heritiera in restrictionsite and ITS trees (only one species of sect Heritierawas included in ETS and psbA-trnH analyses and fallselsewhere) Section Grossularioides was resolved withstrong support in ETS and ITS trees (Figs 1 2 Sentersand Soltis 2003) but is unresolved or strongly para-phyletic in the psbA-trnH and restriction site trees re-spectively (Figs 1 3 Messinger et al 1999)

The clade containing sects Calobotrya Grossularioidesand subg Grossularia was clearly nested within Ribesin ITS ETS and psbA-trnH trees (Figs 2 3 Senters andSoltis 2003) Among the remaining sections of Ribesall datasets provided strong support for sect Berisia

84 [Volume 29SYSTEMATIC BOTANY

FIG 2 The majority-rule consensus of 34005 trees resulting from analyses of ETS sequence data (CI5080 074 excludinguninformative characters RI5093) Numbers above the branches indicate the percentage of bootstrap replicates in which theclade appeared Numbers in parentheses below the branches indicate the percentage of trees in which the clade appearedwhen less than 100

2004] 85SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 3 The majority-rule consensus of 34000 trees resulting from analyses of psbA-trnH sequence data (CI5092 088excluding uninformative characters RI5094) Numbers above the branches indicate the percentage of bootstrap replicates inwhich the clade appeared Numbers in parentheses below the branches indicate the percentage of trees in which the cladeappeared when less than 100

86 [Volume 29SYSTEMATIC BOTANY

FIG 4 The strict consensus of six trees resulting fromanalyses of psbA-trnH sequence data combined with chloro-plast restriction site data (Messinger et al 1999) (CI5090 079excluding uninformative characters RI5087) Data combina-bility determined by partition homogeneity tests (p5066)Numbers above the branches indicate the percentage of boot-strap replicates in which the clade appeared

with the inclusion of some species of sect Ribes in ITStrees (Senters and Soltis 2003) Section Symphocalyxwasstrongly resolved in ETS and restriction site trees (Fig2 Messinger et al 1999) but was unresolved in psbA-trnH trees (Fig 3) (ITS trees included only one species)Section Heritiera appeared to be polyphyletic in ITSand restriction site trees (only one species of sect Her-itiera is included in ETS or psbA-trnH analyses) (Mes-singer et al 1999 Senters and Soltis 2003) The mono-phyly of sects Ribes and Coreosma remain unclear Forthose species sampled sect Ribes was resolved asmonophyletic in restriction site trees (Messinger et al1999) as monophyletic excluding R triste in ETS andpsbA-trnH trees (Figs 2 3) and as polyphyletic in ITStrees with some species clearly related to sect Berisia(Senters and Soltis 2003) Section Coreosma was re-solved as polyphyletic in ETS and restriction site trees(Fig 2 Messinger et al 1999) and as para- or poly-phyletic in ITS trees (Senters and Soltis 2003) (only onespecies was included in the psbA-trnH dataset) Previ-ous restriction site analyses of 18ndash26S rDNA suggestedthat members of sect Coreosma were divergent fromone another and from other Ribes species (Messingeret al 1993) Sampling from sect Parilla was too limitedto draw strong conclusions but the ITS trees support-ed its monophyly to the exclusion of R fasciculatumthe only non-South American member of the section(Senters and Soltis 2003) Relationships among the sec-tions outside of the predominantly western NorthAmerican clade (sects Calobotrya Grossularioides subgGrossularia) varied markedly among datasets with lit-tle support for any one resolution (Figs 2 3)

Trees Generated from Analyses of CombinedDatasets Dataset combinability is typically based ona critical value of p 5 005 (ie datasets are incongru-ent when p 005) However studies suggest that acritical value of p 5 005 may be too strict such thatthe null hypothesis of dataset congruence will be false-ly rejected (Huelsenbeck et al 1996 Sullivan 1996Cunningham 1997) and that a value such as p 5 001may be more appropriate (Cunningham 1997) Manyof the datasets reported here were not combinablebased on intitial partition homogeneity tests but theincongruence was generally eliminated when problem-atic taxa were excluded

Analyses of the readily combinable chloroplast psbA-trnH and restriction site data (p5066) generated sixtrees (length 144 CI5090 079 excluding uninforma-tive characters RI5087) In agreement with analysesof restriction site data alone true gooseberries (sectGrossularia) were not placed as sister to the remainingglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) suggesting that subg Grossularia is not monophy-letic (Figs 1 4) The true gooseberries were nested ina paraphyletic sect Grossularioides as in the restrictionsite trees with sect Calobotrya weakly placed as sister

Support for sect Grossularia sect Calobotrya and theglabrous-styled gooseberries (Hesperia Lobbia Robsonia)increased relative to analyses of either dataset alone(Fig 3 Messinger et al 1999) Support for a paraphy-letic sect Grossularioides decreased slightly relative tothe restriction site analyses (Fig 4 Messinger et al1999)

Analyses of the combined ETS and ITS rDNA data(p5004 excluded R fasciculatum R glandulosum Rhimalense R manshuricum R nevadense R rubrum Roxyacanthoides subsp oxycanthoides R uvacripsa) gener-ated 150 trees (length 614 CI5077 070 excluding un-informative characters RI5085) (Fig 5) Subg Gros-sularia was monophyletic as were the true gooseber-ries (sect Grossularia) (Fig 5) The glabrous-styledgooseberries (Hesperia Lobbia Robsonia) were stronglyresolved as monophyletic with the exception of R wat-sonianum (sect Lobbia) placed strongly as sister to thetrue gooseberries Within sect Grossularia only theAsian clade was resolved with strong support Theclade containing subg Grossularia sect Grossularioi-dies and sect Calobotrya was again evident with sectGrossularioides resolved as sister to subg GrossulariaSupport for the glabrous-styled gooseberries (HesperiaLobbia Robsonia) sect Calobotrya sect Grossularioidesand the Asian clade within sect Grossularia increasedrelative to support from ETS or ITS datasets analyzedindividually (Figs 2 5 Senters and Soltis 2003)

The most evident difference between chloroplast and

2004] 87SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 5 The strict consensus of 150 trees resulting from analyses of combined ETS and ITS sequence data (CI5077 070excluding uninformative characters RI5085) Data combinability determined by partition homogeneity tests (p5004) Num-bers above the branches indicate the percentage of bootstrap replicates in which the clade appeared

88 [Volume 29SYSTEMATIC BOTANY

FIG 6 The strict consensus of four trees resulting from analyses of the four datasets combined (ETS ITS psbA-trnHchloroplast restriction sites) Data combinability was determined by partition homogeneity tests (p5075) Numbers above thebranches indicate the percentage of bootstrap replicates in which the clade appeared

rDNA trees was the position of sect GrossularioidesSubgenus Grossularia is monophyletic in rDNA treeswith sect Grossularioides placed weakly as sister (Fig5) In contrast subg Grossularia is polyphyletic in chlo-roplast trees with sect Grossularia nested within sectGrossulariodes and sect Calobotrya sister to that group-ing (Fig 4) Analyses of the combined chloroplast andrDNA datasets (p5075 excluded R glandulosum Rlacustre R montigenum) generated four trees (length556 CI5088 069 excluding uninformative charactersRI5076) (Fig 6) Taxon sampling was limited due tothe limited overlap among datasets but trees showedstrong resolution of sect Calobotrya sect Grossulariaand the glabrous-styled gooseberries (Hesperia Lobbia

Robsonia) These groups again formed a well-support-ed clade nested within Ribes (Fig 6) The strongly sup-ported sister-group relationship between the true andglabrous-styled gooseberries (Fig 6) is consistent withthe monophyly of subg Grossularia but could changewith the inclusion of sect Grossularioides

ETS and psbA-trnH combined analyses (p5004 ex-cluded R oxyacanthoides subsp irriguum) generated 329trees (length 372 CI5084 077 excluding uninforma-tive characters RI5090) (Fig 7) Subgenus Grossulariawas resolved as monophyletic within which both theglabrous-styled and the true gooseberries were strong-ly supported the latter including R watsonianum(subg Lobbia) The Asian clade was well supported

2004] 89SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 7 The strict consensus of 329 trees resulting from analyses of combined ETS and psbA-trnH data (CI5084 077excluding uninformative characters RI5091) Dataset combinability was determined by partition-homogeneity tests (p5 004)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared

within sect Grossularia including the European R uva-crispa Both sect Calobotrya and sect Grossularioideswere strongly supported but neither was resolved assister to subg Grossularia The clade comprising subgGrossularia sect Grossularioides and sect Calobotryawas again evident nested within Ribes

Combined analyses of psbA-trnH and rDNA datasets(p5002 excluded R oxyacanthoides subsp irriguum andtaxa excluded from ETS1ITS analysis) generated 3080trees (length 5 719 CI5080 074 excluding uninfor-mative characters RI5085) Sects Grossularioides Calo-botrya Grossularia and the glabrous-styled gooseberries

90 [Volume 29SYSTEMATIC BOTANY

(Hesperia Lobbia Robsonia) were each strongly support-ed and again formed a strongly supported clade nestedin Ribes (Fig 8) Support for the monophyly of subgGrossularia was increased relative to support seen withany individual dataset (Figs 2 3 8)

Combinability (p5012) of all datasets for those taxarepresented in three of the four datasets required ex-clusion of composite taxa problematic within therDNA dataset as well as exclusion of taxa problematicfor the chloroplast versus rDNA datasets Combinedanalyses generated 4802 trees (length5768 CI5080074 excluding uninformative characters RI5085)Sec-tion Calobotrya sect Grossularia and the glabrous-styled gooseberries (Hesperia Lobbia Robsonia) exclud-ing R watsonianum were each well supported and to-gether formed a strongly supported clade (Fig 9) Sub-genus Grossularia was resolved as monophyleticbearing in mind that sect Grossularioides was excludedfrom the analyses

While all combined datasets resolved the clade con-taining sects Calobotrya Grossularioides and subgGrossularia as nested within Ribes (Figs 4ndash9) relation-ships among other lineages were unclear as in theanalyses of individual datasets (Figs 2 3) Basal rela-tionships were unresolved in the analyses of combinedchloroplast data (Fig 4) The combined ETS and psbA-trnH analyses suggested basal positions for goldencurrants (sect Symphocalyx) (Fig 7) All remaininganalyses suggested basal positions for sects Berisiaand Ribes (Figs 5 6 8 9) Basal relationships were notwell-supported in any analysis

Kishino-Hasegawa Tests Trees generated fromanalyses constraining the monophyly of subg Gros-sularia versus trees constrained to resolve a sister re-lationship between sect Grossularioides and sect Gros-sularia were marginally but signicantly different inboth the chloroplast (p5003) and the rDNA (p5005)datasets

Ancestral Area Reconstructions DIVA reconstruc-tions of ancestral areas support a western North Amer-ican origin for a large segment of Ribes beginningwith node 2 in Fig 8 Within this clade it is also thecase that subg Grossularia is inferred to have diversi-ed rst within western North America (Fig 8 node6) Subsequent movement to eastern Asia is inferred tohave occurred somewhere within sect Grossularia butthe ancestral area for the true gooseberries is equivo-cal and can include virtually any combination of areasdepending on the exact resolution of the large poly-tomy at the base of this clade (Fig 8 node 8) Impor-tantly our results indicate that the Asian species with-in sect Grossularia form a clade implying a single mi-gration from North America to Asia The ancestralarea for Ribes is reconstructed to be western NorthAmerica and western Eurasia or western North Amer-ica and all of Eurasia (Fig 8 node 1) However this

result hinges on resolution at the base which remainshighly uncertain and requires more intensive samplingof Ribes lineages outside of subg Grossularia

DISCUSSION

Gooseberry Monophyly Results from previousphylogenetic analyses based on nuclear 18Sndash26S rDNAITS data (Senters and Soltis 2003) and chloroplast re-striction site data (Messinger et al 1999) differed re-garding gooseberry monophyly Adding the additionalnuclear 18Sndash26S rDNA ETS and chloroplast psbA-trnHdatasets could increase support and resolution in re-sulting topologies or could reinforce the differencesbetween the nuclear and chloroplast topologies witheach reecting accurate but separate histories

Initial examination of the trees produced with theadditional datasets reinforced the apparent conict be-tween nuclear and chloroplast genomes ITS ETS andcombined rDNA datasets supported the monophyly ofsubg Grossularia (Figs 1 2 5) In contrast the com-bined chloroplast datasets (restriction sites plus psbA-trnH) suggested a closer relationship between the trueand glabrous-styled gooseberries than did the restric-tion site data alone (Fig 1 Messinger et al 1999) butstill resolved subg Grossularia as non-monophyleticwith sect Grossularioidies forming a grade at the baseof sect Grossularia (Fig 4) The increase in tree lengthwhen combined chloroplast data was constrained toresolve a monophyletic subg Grossularia (p5003) orwhen combined rDNA data was constrained to resolvesects Grossularioides and Grossularia as a clade(p5005) also indicated dataset incongruence

The discrepancy between nuclear and chloroplast to-pologies primarily involved the restriction sites datasetand not the psbA-trnH dataset The psbA-trnH datasetprovided little resolution (Fig 3) conicting with nei-ther the rDNA nor the restriction sites topologiesAnalyses combining the psbA-trnH data with either theETS data (p5004 Fig 7) or the rDNA data (p5002Fig 8) produced trees resolving subg Grossularia asmonophyletic with increased support relative to ETSor rDNA data alone (Figs 2 5) Section Grossularioideswas either sister to subg Grossularia (psbA-trnH 1rDNA Fig 8) or was unresolved in a polytomy withsubg Grossularia and sect Calobotrya (psbA-trnH 1ETS Fig 7) The monophyly of subg Grossularia wasalso supported by analyses of all datasets combinedwhether including taxa represented in all four datasets(p5075 Fig 6) or in three of the four datasets(p5012 Fig 9) Analyses combining all datasets re-quired exclusion of sect Grossularioides thus leavingsubg Grossularia monophyly uncertain However in-cluding sect Grossulariodes in spite of dataset incon-gruence (p5001) produced trees resolving a mono-phyletic subg Grossularia sister to a monophyletic sectGrossularioides (not shown)

2004] 91SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 8 The strict consensus of 3080 trees resulting from analyses of combined psbA-trnH and rDNA data (CI 5 080 074excluding uninformative characters RI 5 085) Dataset combinability was determined by partition homogeneity tests (p5002)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared DIVA (Ronquist 1996)was used to infer ancestral areas at the numbered nodes The ancestral areas at nodes two through seven were reconstructedas western North America Node one was reconstructed as western North America plus either western Eurasia or all of EurasiaThere were multiple possible reconstructions at node 8 including (1) western North America and eastern Eurasia (2) NorthAmerica and eastern Eurasia (3) North America or (4) western North America

92 [Volume 29SYSTEMATIC BOTANY

FIG 9 The strict consensus of 4802 trees resulting from analyses of all four datasets (ITS ETS psbA-trnH chloroplastrestriction sites) including taxa represented in at least three datasets (CI5080 074 excluding uninformative charactersRI5085) Dataset combinability was determined using partition homogeneity tests (p5012) Numbers above the branchesindicate the percentage of bootstrap replicates in which the clade appeared

2004] 93SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

The general picture that emerges from these analy-ses suggests that subg Grossularia is monophyletic(Figs 2 5ndash9) rDNA data supported gooseberry mono-phyly (Figs 2 5) psbA-trnH data while lacking suf-cient variation to resolve gooseberry monophyly ornon-monophyly supported gooseberry monophyly incombination with rDNA data (Figs 7 8) Finally anal-yses of all datasets combined supported gooseberrymonophyly although these analyses excluded thespiny currants (sect Grossularioides) (Figs 6 9) Whatrequires further investigation is the role hybridizationmay have played in the history of the spiny currants(sect Grossularioides) and the true gooseberries (sectGrossularia) Messinger et al (1999) encouraged furtherexploration of this possibility in Ribes in which theynoted potential chloroplast capture of the sect Gros-sularia chloroplast type by sect Grossularioides Crosseshave not been successful between species of sect Gros-sularioides and other sections within Ribes and are usu-ally unsuccessful between sections or subgenera (Keep1962) Conrmation of the pattern seen in trees gen-erated from the chloroplast restriction site data (Mes-singer et al 1999) is needed from additional chloro-plast datasets that provide greater resolution than didthe psbA-trnH dataset

Relationships Within the Gooseberries SubgenusGrossularia comprises two main lineages (Figs 2 5ndash9)the true gooseberries (sect Grossularia) and a clade ofglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) The four gooseberry sections are traditionally dis-tinguished from each other by basally pubescent stylesin sect Grossularia (with the exception of some Asianspecies) by four versus ve parted owers in sect Rob-sonia by anthers broader at the base in subg Hesperiaand by the absence of the above set of features in subgLobbia The glabrous-styled gooseberry lineage com-prising 27 species distributed through western NorthAmerica into Mexico (Berger 1924) was well-support-ed given our sampling but sections within this lineagewere not resolved Ribes watsonianum (subg Lobbia)was surprisingly placed outside of the glabrous-styledgooseberry lineage as sister to the true gooseberries(Figs 2 5 7ndash9) ITS data resolved R watsonianum with-in the glabrous-styled gooseberry lineage (Senters andSoltis 2003) but ETS data strongly resolved the specieswithin the true gooseberry lineage (sect Grossularia)(Fig 2) This conict within the rDNA data may reecthybridization between R watsonianum and a memberof sect Grossularia followed by xation within the Rwatsonianum genome of a recombinant rDNA repeattype Accounts of Ribes hybrids in the eld are rela-tively rare (Messler et al 1991) and do not implicateR watsonianum but fertile hybrids can be obtainedfrom articial crosses between glabrous-styled goose-berries and true gooseberries (Keep 1962 citing R lob-bii 3 R divaricatum) Alternatively R watsonianum may

posses multiple rDNA repeat types with different re-peat types sampled in our ITS versus ETS datasetsEach of these possibilities has been reported in otherplant taxa (Wendel et al 1995a Campbell et al 1997for potential recombinant rDNA repeat types Suh etal 1993 Wendel et al 1995b for incomplete homoge-nization of rDNA repeat types)

The true gooseberries (sect Grossularia) have a broadrange throughout the northern hemisphere with ninespecies in North America (Sinnott 1985) and seven spe-cies in Eurasia (Berger 1924) In his treatment of NorthAmerican gooseberries Sinnott (1985) divided his ninespecies into ve groups based on phenetic analysesThe groups consisted of (1) R cynosbati with spinyfruits (2) R niveum R curvatum and R missouriensewith highly exserted stamens and long sepals (3) Rrotundifolium and R divaricatum with medium lengthstamens and purple sepals (4) R inerme and R hirtel-lum with intermediate length stamens and small oralfeatures and (5) the ve subspecies of R oxyacanthoi-des with short stamens Sinnott (1985) recommendedthat R echinellum be excluded from the true gooseber-ries and aligned with the glabrous-styled gooseberriesof western North America (Hesperia Lobbia Robsonia)The analyses presented here showed strong supportfor the inclusion of R echinellum as well as the Eurasianspecies within the true gooseberry lineage (Figs 2ndash35 7ndash9) Resolution among the North American specieswas lacking or not well-supported (Figs 2ndash9) and thusneither supported nor conicted with Sinnottrsquos hy-pothesized relationships

The seven Eurasian species of sect Grossularia (Ber-ger 1924) include R uvacrispa in Europe R alpestre andR aciculare in the Himalayan region R stenocarpumand R formosanum in southern and eastern Asia andR burejense and R grossularioides in northern and east-ern Asia A clade of Asian species is well-supported(Figs 2 5 7ndash9) with possible inclusion of R uvacrispa(Figs 2 7) The psbA-trnH dataset includes R oxyacan-thoides subsp irriguum within the Asian clade (Fig 3)but this is weakly supported (Fig 3) and requires fur-ther substantiation particularly since R oxyacanthoidessubsp irriguum is restricted to northwestern NorthAmerica and may itself be of hybrid origin from cross-es between R oxyacanthoides subsp setosum and R in-erme (Sinnott 1985) both distributed in western NorthAmerica Resolution within the clade of Asian speciessuggests a correspondance to geographic and oristicregions within Asia Whether the Asian and NorthAmerican true gooseberries represent divergent line-ages or a monophyletic Asian clade nested within aNorth American grade is unclear given the availabledata

Other Groups within Ribes Since this study fo-cused on the gooseberries sampling within other sec-tions of Ribes was sometimes limited Nevertheless the

94 [Volume 29SYSTEMATIC BOTANY

data did support the monophyly of sects CalobotryaParilla Symphocalyx and Berisia Section Calobotrya is agroup of 21 western North American species (Berger1924) known as the ornamental currants The mono-phyly of sect Calobotrya was well-supported with theinclusion of some dwarf currants (sect Heritieria) (Figs2ndash9 Messinger et al 1999 Senters and Soltis 2003)Sampling was limited in sect Parilla a group of 41dioecious South American species (Janczewski 1907)but the group was supported in ITS trees excludingthe east Asian R fasciculatum the sectionrsquos only non-South American species (Senters and Soltis 2003) Apossible sister relationship between sect Parilla andsect Calobotrya (unpubl data cited in Weigend andBinder 2001) is consistent with the position of sect Pa-rilla seen with ITS data (Senters and Soltis 2003) Sec-tion Symphocalyx the golden currants includes vespecies distributed through northern Mexico and cen-tral and western North America (Berger 1924) Thegolden currants were well-supported given the avail-able sampling (Fig 2 4 9) The alpine currants sectBerisia are a group of 17 dioecious species distributedthrough Eurasia (Janczewski 1907) The monophyly ofsect Berisia was well-supported (Figs 2ndash9 Messingeret al 1999) but with the inclusion of some red currants(sect Ribes) in ITS trees (Senters and Soltis 2003)

The monophyly of sects Ribes and Coreosma wasquestionable (Figs 2 3 5) The red currants (sect Ri-bes) are a group of 15 Eurasian species with one spe-cies R triste also distributed in North America Sec-tion Coreosma the black currants includes six speciesin North America and six in Eurasia (Berger 1924) Sec-tion Heritiera the dwarf currants appeared to be poly-phyletic as seen in Messinger et al (1999) and Sentersand Soltis (2003) This group of six species (Berger1924) is dened primarily by a prostrate habit and assuggested by Messinger et al (1999) is likely a case ofconvergence

Biogeography The spread of taxa around theNorthern Hemisphere has been facilitated by the avail-ability at various times of two major migrationroutesmdashthe Beringian and the North Atlantic landbridges (Tiffney 1985a 1985b Donoghue et al 2001SanmartDaggern et al 2001) Especially in large and relative-ly old clades which have become widespread aroundthe Northern Hemisphere it is possible (perhaps evenlikely) that both pathways were used Information onthe timing of key divergences and on the direction ofmovement within subclades will be critical in sortingout the possibilities in particular cases Ribes providesan excellent example of such a group being represent-ed in Eurasia by six sections (Berisia Ribes and somespecies from Heritiera Coreosma Grossularioides andGrossularia) in western North America by nine (Sym-phocalyx Calobotrya Robsonia Hesperia Lobbia andsome species of Coreosma Heritiera Grossularioides and

Grossularia) and in eastern North America by three(some species of Heritiera Ribes and Grossularia) Oneapproach for sorting through a complex biogeographichistory as might be expected in Ribes is to examinephylogenetic patterns in component clades and ide-ally to date divergences

Our analyses indicate that subg Grossularia is nestedwithin a predominantly western North Americanclade (Figs 2 5ndash9) and that it diversied initially inthat region (Fig 8 node 6) Subsequently within sectGrossularia it appears that movement occurred fromwestern North America to eastern Asia presumablythrough Beringia followed by vicariance and the ori-gin and diversication of the well-supported Asiangooseberry clade Donoghue et al (2001) and Xiangand Soltis (2001) highlighted cases of movement out ofAsia into North America through the Bering LandBridge Ribes appears to provide a case of movementin the opposite direction Movement in both directionsis of course to be expected What remains to be de-termined in future studies of disjunct taxa is exactlywhich groups moved in which directions and whetherthere are any signicant generalizations that can bemade about these different patterns

Elsewhere in Ribes there are other possible cases ofmovement between North America and Asia One caseinvolves R lacustre of sect Grossularioides which is dis-tributed in eastern Asia as well as in North AmericaOther possible cases relate to resolution at the base ofRibes where relationships remain uncertain The basalpositions of sect Symphocalyx in trees resulting frompsbA-trnH data and from the combination of psbA-trnHand ETS data suggest a western North American ori-gin for the entire clade (Figs 2 7) This would implyearly dispersion to Asia giving rise to sects Berisiaand Ribes However all other datasets and dataset com-binations suggested a broader Eurasian plus westernNorth American distribution at the base (Fig 8 node1) owing to the basal positions of sects Berisia andRibes This would imply early vicariance involvingAsia and North America and movement back to Asiawithin the western North American clade Future stud-ies should include more sampling of sects Berisia Ri-bes Coreosma and Symphocalyx to help resolve basal re-lationships and biogeographic patterns in Ribes

The fossil record for Ribes consists largely of leaveswith few reports of seeds (Kremenetski 1998) fruits(Cevallos-Ferriz 1995) and owers (Gandolfo et al1998) The leaf record for Ribes in North America mayextend from approximately 2 mya (Hannibal 1911Dorf 1930 Axelrod 1966) to at least 345 mya (Mac-Ginitie 1953 Manchester 2001) and possibly to 45 or50 mya (Axelrod 1998 Wehr and Hopkins 1994) Al-though leaf features are seldom used to distinguishextant taxa of Ribes Wolfe (1964) used leaf serrationand venation features to distinguish between fossil

2004] 95SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

leaves of subg Ribes and subg Grossularia from Ne-vada If these features are reliable this dates subgGrossularia to at least 14 mya (Fig 9 node 6) A criticalnext step in understanding Ribes biogeography will beto accurately assign Ribes fossils to particular sub-clades so as to infer the timing of intercontinental di-vergences

ACKNOWLEDGEMENTS We thank the following individuals andinstitutions for providing plant material B Alverson D BouffordR Mitchell Arnold Arboretum of Harvard University Universityof California Botanical Garden Royal Botanic Garden EdinburghNew York Botanical Garden and the USDA-ARS National PlantGermplasm Repository A Senters and D Soltis graciously pro-vided numerous DNA aliquots DNA sequences and access to ear-ly manuscripts H Schorn and D Erwin provided assistance withpaleobotanical literature M Lavin P Herendeen and two anon-ymous reviewers provided numerous helpful comments This proj-ect was supported in part by a Putnam Fellowship through theArnold Arboretum of Harvard University

LITERATURE CITED

AVISE J C 1994 Molecular markers natural history and evolutionNew York Chapman amp Hall

AXELROD D I 1966 The Pleistocene Soboba ora of southern Califor-nia University of California Publications in Geological Sci-ences 60

mdashmdashmdash 1998 Thunder Mountain Idaho University of CaliforniaPublications in Geological Sciences 142

BALDWIN B G and S MARKOS 1998 Phylogenetic utility of theexternal transcribed spacer (ETS) of 18Sndash26S rDNA Congru-ence of ETS and ITS trees of Calycadenia (Compositae) Mo-lecular Phylogenetics and Evolution 10 449ndash463

mdashmdashmdash M J SANDERSON J M PORTER M F WOJCIECHOWSKI CS CAMPBELL and M J DONOGHUE 1995 The ITS region ofnuclear ribosomal DNA a valuable source of evidence onangiosperm phylogeny Annals of the Missouri Botanical Garden82 247ndash277

BEARD K H 1998 East of Eden Asia as an important center oftaxonomic origination in mammalian evolution Bulletin of theCarnegie Museum of Natural History 34 5ndash39

BENA G M F JUBIER I OLIVIERI and B LEJEUNE 1998 Ribosom-al external and internal transcribed spacers combined use inthe phylogenetic analysis of Medicago (Leguminosae) Journal ofMolecular Evolution 46 299ndash306

BERGER A 1924 A taxonomic review of currants and gooseberriesNew York Agricultural Experimental Station Technical Bulletin109 1ndash118

BOUFFORD D E and S A SPONGBERG 1983 Eastern Asia-EasternNorth American phytogeographical relationships-a historyfrom the time of Linnaeus to the twentieth century Annalsof the Missouri Botanical Garden 70 423ndash439

CAMPBELL C S M F WOJCIECHOWSKI B G BALDWIN L A AL-ICE and M J DONOGHUE 1997 Persistent nuclear ribosomalDNA sequence polymorphism in the Amelanchier agamiccomplex (Rosaceae) Molecular Biology and Evolution 14 81ndash90

CEVALLOS-FERRIZ S R S 1995 Fruits of Ribes from the Princetonchert British Columbia Canada American Journal of Botany82(6 supplement) 84

COVILLE F V and N L BRITTON 1908 Grossulariaceae NorthAmer-ican Flora 22 193ndash225

CUNNINGHAM C W 1997 Can three incongruence tests predictwhen data shold be combined Molecular Biology and Evolution14 733ndash740

DEQUEIROZ A M J DONOGHUE and J KIM 1995 Separate versuscombined analysis of phylogenetic evidence Annual Review ofEcology and Systematics 26 657ndash681

DONOGHUE M J C D BELL and J LI 2001 Phylogenetic patternsin northern hemisphere plant geography International Journalof Plant Sciences 162 S41ndashS52

DORF E 1930 Pliocene oras of California Carnegie Institution ofWashington Publication 412

FARRIS J S M KALLERSJO A G KLUGE and C BULT 1995 Test-ing signicance of incongruence Cladistics 10 315ndash319

FELSENSTEIN J 1985 Condence limits on phylogenies an ap-proach using the bootstrap Evolution 39 783ndash791

FENTON B A N E BIRCH G MALLOCH P G LANHAM and RM BRENNAN 2000 Gall mite molecular phylogeny and itsrelationship to the evolution of plant host specicity AppliedAcarology 24 831ndash861

FRITSCH P W C M MORTON T CHEN and C MELDRUM 2001Phylogeny and biogeography of the Styracaceae InternationalJournal of Plant Sciences 162 S95ndashS116

GANDOLFO M A P HOC S N SANTILLANA and S A MARENSSI1998 Una or fosil morfologicamente afDaggern a las Grossulari-aceae (orden Rosales) de la Formacion la Meseta (Eoceno me-dio) Isla Marambio Antartida Asociacion Paleontologica Argen-tina Publicacion Especial 5 Paleogeno de America del Sur y de laPenDaggernsula Antartica 147ndash153

GOLDMAN N J P ANDERSON and A G RODRIGO 2000 Likeli-hood-based tests of topologies in phylogenetics SystematicBiology 49 652ndash670

HANNIBAL H 1911 A Pliocene ora from the Coast Ranges ofCalifornia Bulletin of the Torrey Botanical Club 38 329ndash342

HUELSENBECK J P J J BULL and C W CUNNINGHAM 1996 Com-binined data in phylogenetic analysis Trends in Ecology andEvolution 11 152ndash158

JANCZEWSKI M E 1907 Monographies des groseilliers Ribes LMemoires Societe de Physique et DrsquoHistoire Naturelle de Geneve35 199ndash517

KEEP E 1962 Interspecic hybridization in Ribes Genetica 33 1ndash23

KISHINO H and M HASEGAWA 1989 Evaluation of the maximumlikelihood estimate of the evolutionary tree topologies fromDNA sequence data and the branching order in HominoideaJournal of Molecular Evolution 29 170ndash179

KREMENETSKI C V 1998 Holocene history of the northern rangelimits of some trees and shrubs in Russia Arctic and AlpineResearch 30 317ndash333

LINDER C R L R GOERTZEN B V HEUVEL J FRANCISCO-OR-TEGA and R K JANSEN 2000 The complete external tran-scribed spacer of 18Sndash26S rDNA amplication and phylo-genetic utility at low taxonomic levels in Asteraceae andclosely allied families Molecular Phylogenetics and Evolution 14285ndash303

MACGINITIE D 1953 Fossil plants of the Florissant beds ColoradoCarnegie Institution of Washington Publication 599

MADDISON D R and W P MADDISON 2000 MacClade 4 Sun-derland Sinauer Associates

MANCHESTER S R 1999 Biogeographical relationships of NorthAmerican Tertiary oras Annals of the Missouri Botanical Gar-den 86 472ndash522

mdashmdashmdash 2001 Update on the megafossil ora of Florissant Colo-rado Proceedings of the Denver Museum of Nature amp ScienceSeries 4 No1 137

MANOS P S and M J DONOGHUE 2001 Progress in northernhemisphere phytogeography an introduction InternationalJournal of Plant Sciences 162 S1ndashS2

mdashmdashmdash and A M STANFORD 2001 The historical biogeography ofFagaceae tracking the tertiary history of temperate and sub-tropical forests of the northern hemisphere International Jour-nal of Plant Sciences 162 S77ndashS93

MAST A R and T J GIVNISH 2002 Historical biogeography andthe origin of stomatal distributions in Banksia and Dryandra(Proteaceae) based on their cpDNA phylogeny American Jour-nal of Botany 89 1311ndash1323

MESSINGER W K HUMMER and A LISTON 1999 Ribes (Grossu-

78 [Volume 29SYSTEMATIC BOTANY

FIG 1 A simplied representation of prior phylogenetic hypotheses for Ribes Chloroplast restriction site data from Mes-singer et al(1999) suggest that gooseberries (subg Grossularia) are non-monophyletic ITS data from Senters and Soltis (2003)support the monophyly of gooseberries

in the context of Northern Hemisphere biogeographyThe Northern Hemisphere problem has recently at-tracted attention from a phylogenetic perspective byboth zoologists (eg SanmartDaggern et al 2001) and bota-nists (eg Manos and Donoghue 2001) It has becomeclear that oristic similarities among the major areasof endemism such as eastern Asia and eastern NorthAmerica (see Boufford and Spongberg 1983 Wen1999) were established in several ways (eg move-ment through Beringia or the North Atlantic) and atdifferent times in different groups (eg Tiffney 1985aManchester 1999 Wen 1999 Xiang et al 1998 2000Donoghue et al 2001 Fritsch et al 2001 Manos andStanford 2001 Tiffney and Manchester 2001 Xiangand Soltis 2001) Several recent studies have highlight-ed plant groups that appear to have diversied ini-tially in Asia and subsequently moved to North Amer-ica via the Bering Land Bridge apparently at severaldifferent times (eg Donoghue et al 2001 Xiang andSoltis 2001) This iterative trans-Beringian movementresembles the pattern described for mammals earlierin the Tertiary (Beard 1998) and generally suggeststhat Asia has been a primary source area for NorthernHemisphere diversity However this may reect thesample of taxa that has been examined to date andother patterns including movement from North Amer-ica to Asia have also been described (see examples inSanmartDaggern et al 2001) It is noteworthy that NorthernHemisphere plant groups that are especially diversetoday in western North America have seldom been thefocus of phylogenetic biogeographic analyses

Ribes is very broadly distributed around the North-ern Hemisphere and extends south in the mountains

of South America but is especially diverse in westernNorth America both in terms of the number of speciesand the representation of major subclades Likewisesubg Grossularia which is the focus of our analysisoccurs around the Northern Hemisphere but is mostdiverse in western North America Specically nu-merous glabrous-styled gooseberries (subg HesperiaLobbia and sect Robsonia) are distributed in westernNorth America while the true gooseberries (sect Gros-sularia) are found throughout North America and Asia(including Taiwan and Japan) with one species in Eu-rope Better knowledge of phylogenetic relationships inRibes and especially in Grossularia would make it pos-sible to assess geographic patterns of diversicationand directions of movement in the group

MATERIALS AND METHODS

Samples New data reported here include 12 ITS sequences73 ETS sequences (from 57 species) and 53 psbA-trnH sequencesPrevious studies provided an additional 67 ITS sequences (Sentersand Soltis 2003) and restriction site data from two amplied chlo-roplast regions (rbcL to accD and rpoC1 to rpoC2) for 32 species(Messinger et al 1999) Our sampling was weighted towardssubg Grossularia the focus of this study We included all of thetrue gooseberry species (sect Grossularia) recognized by Sinnott(1985) all of the Asian true gooseberry species recognized by Ber-ger (1924) representatives from each of the three glabrous-styledgooseberry taxa (sect Robsonia subg Hesperia Lobbia) and bothspiny currant species (sect Grossularioides) In total 82 of the ap-proximately 150 species of Ribes were included in this study (Table1) representing all of the infrageneric taxa recognized by Berger(1924) but with nomenclature following Sinnott (1985) Itea rep-resented by I virginica and I ilicifolia was chosen as the outgroupbased on previously published studies (Soltis et al 1990 1993Morgan and Soltis 1993 Soltis and Soltis 1997) in which RibesItea and Saxifragaceae ss appeared to be closely related membersof Saxifragales

2004] 79SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

DNA Isolation Total DNA was isolated from fresh silica-des-iccated and herbarium material All extractions were performedusing QiaGen DNeasy Plant Mini kits following manufacturerrsquosinstructions except that plant material was ground in warmedAP1 buffer (provided in QiaGen kit) rather than liquid nitrogenSome DNA aliquots were provided by Senters and Soltis (Univer-sity of Florida) as indicated in Table 1

Amplication and Sequencing PCR and sequencing reactionswere performed using a Perkin-Elmer Corporation GeneAmp 9600or MJ Research Inc DNA Enginey Thermal Cycler PCR productswere cleaned using QiaGen QiaQuick PCR Purication kits Se-quencing reactions were performed with ABI Prism BigDye Ter-minator Cycle Sequencing Ready Reaction Kits using half or fullreactions and were cleaned using either EtOHNaOAc precipita-tion following recommendations in BigDye kits or Edge Biosys-tems Performa DTRy Gel Filtration systems In some cases se-quences were improved with the addition of DMSO to sequencingreactions (approximately 6 nal volume) Sequencing reactionswere resolved on 5 polyacrylamide gels with an Automated Bio-systems (ABI) 377 sequencer loaded with standard or Rapid Loadmembrane combs (The Gel Company) Sequencher version 311was used to examine and edit sequence chromatograms

ITS amplication products for the 12 new sequences reportedin this study were generated using primers ITS4 (White et al 1990)and ITS-I (59-GTCCACTGAACCTTATCATTTAG-39 designedby LE Urbatsch Louisiana State University) with the following param-eters initial denaturation (978C 1 min) followed by 35 cycles ofdenaturation (978C 10 sec) annealing (488C 30 sec) extension(728C 20 sec increasing 4 sec with each cycle) and concludingwith a nal extension (728C 7 min) PCR reactions contained25mL 10X AmpliTaq buffer (Perkin-Elmer) 25mL 10mM dNTPs25mL 25mM MgCl2 125mL BSA 125mL 10mM ITS4 primer125mL 10mM ITS-I primer 01mL AmpliTaq DNA polymerase(Perkin-Elmer) and 1ndash10ng DNA to a total volume of 25mL Am-plication products were sequenced with ITS4 ITS2 (White et al1990) ITS-I and ITS3B (the reverse complement of ITS3 White etal 1990) Most the length of ITS 2 was sequenced in both direc-tions Sequencing primers for ITS 1 often produced short sequenc-es with minimal overlap such that sequences were largely basedon a single strand A portion of the 58S region could not be re-covered from R cynosbati (41 bp) or R echinellum (77 bp) and wasthus coded as Nrsquos in the matrix Of the 67 ITS sequences obtainedfrom Senters and Soltis (2003) ve were missing a large portionof ITS 1 (approx 100bp for R giraldii and R montigenum approx240 for R missouriense approx 130 for R watsonianum approx230 for R rubrum)

Sequences from the external transcribed spacer of 18ndash26S nucle-ar rDNA (ETS) were obtained following the strategy of Baldwinand Markos (1998) Ribes odoratum (subg Ribes sect Symphocalyx)and R hirtellum (subg Grossularia sect Grossularia) were chosenfor initial long-distance PCR of the inter-genic spacer region (IGS)in order to design an internal primer conserved across RibesLong-distance PCR of the IGS was conducted with the followingparameters initial denaturation (948C 1 min) followed by 35 cy-cles of denaturation (948C 30 sec) and combined annealing andextension (728C 6 min) PCR reactions contained the followingcomponents 25mL 10X KlenTaq LA Polymerase Mix (ClontechLaboratories Inc) 25mL 10mM dNTPs 25mL 10mM 18S-IGSprimer (Baldwin and Markos 1998) 25m L10mM 26S-IGS primer(Baldwin and Markos 1998) 05mL KlenTaq LA DNA polymeraseand 1ndash10 ng DNA to a total volume of 25 mL Amplication prod-ucts were sequenced in one direction using primer 18S-E (Baldwinand Markos 1998) yielding approximately 480bp of readable se-quence Primer ETS-Rib1 (59 GAACTGTTGTCGCGTGCGTCGT39)was designed 59 of the 18S-E priming site from a conserved regionwithin ETS Attempts were made to sequence further into the ETSregion using primer ETS-Rib2 (59 ACGACGCACGCGACAA-CAGTTC 39) the reverse complement of ETS-Rib1 but readablesequences were only obtained from R hirtellum hindering effortsto identify a conserved site further 59 of ETS-Rib1

Short-distance PCR of the 39 portion of the ETS region was per-formed using the ETS-Rib1 primer in conjunction with the 18S-

ETS primer (Baldwin and Markos 1998) under the following pa-rameters initial denaturation (948C 2 min) followed by 35 cyclesof denaturation (948C 30 sec) annealing (658C 1 min) extension(728C 15 min) and concluding with a nal extension (728C 7min) PCR reactions contained 25mL 10X AmpliTaq buffer (Perkin-Elmer) 25mL 10mM dNTPs 25mL 25mM MgCl2 05mL 10mMETS-Rib1 primer 05mL 10mM 18S-ETS primer 01mL AmpliTaqDNA polymerase (Perkin-Elmer) and ndash10ng DNA to a total vol-ume of 25mL Cleaned amplication products were sequenced inboth directions with primers ETS-Rib1 and 18S-ETS Itea ilicifoliais a partial sequence missing the rst 107 bp

Primers psbAF and trnHR (Sang et al 1997) were used for bothamplication and sequencing of the psbA-trnH intergenic spacerregion PCR reaction parameters were initial denaturation (948C2 min) followed by 35 cycles of denaturation (948C 30 sec) an-nealing (618C 30 sec) extension (728C 1 min) and concludingwith a nal extension (728C 7 min) PCR reactions contained25mL 10X AmpliTaq buffer (Perkin-Elmer) 25mL 10mM dNTPs25mL 25mM MgCl2 125mL 10mM psbAF primer 125mL 10mMtrnHR primer 01mL AmpliTaq DNA polymerase (Perkin-Elmer)and1ndash10ng DNA to a total volume of 25mL For some samplesamplication was aided by the addition of 25mL BSA to the PCRreaction Ribes viburnifolium was not successfully sequenced pos-sibly due to homopolymer strings close to both the 59 and 39 prim-er sites A central portion of approximately 159 bp could not berecovered from Itea virginica and was coded as Nrsquos in the matrix

Sequence identities were veried by performing BLAST searches(National Center for Biotechnology Information National Insti-tutes of Health) using sequences from Ribes burejense

Alignment Sequences were initially aligned in Clustal X Mul-tiple Sequence Alignment Program version 181 under the defaultsettings then adjusted by eye using MacClade 4 sequencing editorfeatures (Maddison and Maddison 2000) All Ribes sequences werereadily alignable by eye as were Itea sequences but alignmentbetween Ribes and Itea was often difcult Ambiguous regionswere aligned so that the number of informative sites was mini-mized Base pairs that could not be assigned with condence dueto weak or noisy signal were coded with lsquolsquoNrsquorsquo or with IUPAC-IUBambiguity symbols Gaps inserted for alignment in regions of in-ferred indels were coded as rsquorsquondashrsquorsquo and treated as missing data Sevenlarge indels coded as present (1) or absent (0) were added to thepsbA-trnH matrix The seven coded indels included three inser-tions in Itea (positions 79ndash88 199ndash207 418ndash434) two deletions inItea (positions 110ndash114 359ndash372) an insertion consisting primarilyof TA repeats in members of sect Grossularia (positions 279ndash295)and a deletion in R himalense R manshuricum and R rubrum (po-sitions 111ndash116) Datasets are available at TreeBASE (study acces-sion number s1001)

Dataset Combinability Overlap among the four datasets (ITSETS psbA-trnH restriction sites) was not complete Of the 84 spe-cies included in this study 50 were represented in at least threeof the four datasets (Table 1) A series of partition homogeneitytests (Farris et al 1995) were performed in PAUP ver 40 (Swof-ford 2001) to assess dataset combinability Each test consisted of100 replicates employing heuristic searches with simple taxon ad-dition TBR branch swapping maxtrees set to 1000 and invariantcharacters excluded

Initial partition homogeneity tests indicated that the psbA-trnHand restriction site datasets were combinable (p5066) while allother dataset combinations were incongruent (p 001) To explorepotential sources of incongruence we conducted additional ho-mogeneity tests with individual taxa or groups of taxa excludedbased on differential and well-supported (bootstrap 70) place-ment in trees or on differential placement regardless of supportlevels (deQueiroz et al 1995) For the ETS and ITS comparisontaxa were excluded one at a time and in groups if they representedcomposites of multiple accessions (Table 1) and exhibited differ-ential placements in ETS versus ITS trees Samples of R oxyacan-thoides subsp oxyacanthoides were also excluded in ETS versus ITScomparisons because there was divergence between the two in-cluded ETS sequences (sequenced for this study) thus it was notclear which should be combined with the ITS sequence (obtained

80 [Volume 29SYSTEMATIC BOTANY

TABLE 1 Taxa included in this study with GenBank accession numbers Following Messinger et al (1999) taxonomy correspondsto Sinnott (1985) with Grossularia subg Hesperia and subg Lobbia treated under Ribes ITS sequences noted in boldface are from Sentersand Soltis (2003) Senters and Soltis provided the DNA for italicized sequences Restriction site data are from Messinger et al (1999)Voucher information is cited as per Senters and Soltis (2003) or Messinger et al (1999) when the data or DNA came from those sourcesHerbarium codes follow the Index Herbariorum Eighth Edition NPGR refers to the USDA-ARS National Plant Germplasm RepositoryUCBG refers to the University of California Botanical Garden RBGE refers to the Royal Botanic Garden Edinburgh

Subg Ribes LSect Berisia Spach (Alpine Currants)

R acuminatum (Hook FampThomson) Jancz Chase 3585 (K) ITS AF426376R alpinum L Arnold Arboretum 678ndash80E ETS AY138021 psbA-trnH AY138094 Chase 3587 (K) ITS AF426378 NPGR 6640

restriction sitesR diacanthum Pallas Arnold Arboretum 1852ndash81B ETS AY138022 psbA-trnH AY138095 ITS AY138047 NPGR 34 (Messinger

315 OSC) restriction sitesR giraldii Janczewski Arnold Arboretum 609ndash74B ETS AY138023 psbA-trnH AY138096 M Mort sn (WS) ITS AF426381R glaciale Wall UCBG 910285 ETS AY138024 psbA-trnH AY138097 ITS AY138048R komarovii Pojark UCBG 91078 ETS (1) AY138025 Arnold Arboretum 1094ndash82A ETS (2) AY138026 psbA-trnH AY138098R maximowiczii Batalin T S Elias 10940 (RSA) ITS AF426380 NPGR 267 restriction sitesR orientale Desf Boufford et al 28317 (A) ETS AY138027 psbA-trnH AY138099R tenue Janczewski Boufford et al 27604 (A) ETS AY138028 psbA-trnH AY138100 Chase 3610 (K) ITS AF426377R vilmorini Janczewski Chase 3612 (K) ITS AF426379

Sect Calobotrya (Spach) Jancz (Ornamental Currants)R afne HBK M Medina 2517 (NY) ITS AF426326R brandegeei Eastwood sc 350568 (WS) ITS AF426331R cereum Douglas UCBG 931213 ETS AY138013 psbA-trnH AY138087 NPGR 237001 restriction sites Ross 3425 (NY) ITS

AF426328R ceriferum Coville and Rose sc 05017194 (MO) ITS AF426333R ciliatum H and B Diggs 2625 (NY) ITS AF426327 NPGR 670001 (Messinger 311 OSC) restriction sitesR dugesii Greenman Siplivinsky 3939 (WS) ITS AF426329R glutinosum Benth Chase 3594 (K) ITS AF426340R indecorum Eastwood UCBG 860903 ETS AY138014 psbA-trnH AY138088 Mort 1370 (WS) ITS AF426336R malvaceum Smith UCBG 911481 ETS AY138015 psbA-trnH AY138089 Johnson sn (WS) ITS AF426338R mogollonicum Greene NPGR 294001 ITS AF426332 restriction sitesR neglectum Rose Villarrea 4940 (NY) ITS AF426330R nevadense Kellogg UCBG 891635 ETS AY138016 psbA-trnH AY138090 Mort 1373 (WS) ITS AF426339R sanguineum Pursh UCBG 900193 ETS AY138017 psbA-trnH AY138091 Mort 1372 (WS) ITS AF426335 NPGR 46 restriction

sitesR tortuosum Benth Breedlove 62230 (MO) ITS AF426325R viscosissimum Pursh Grimes 1878 (NY) ITS AF426334 NPGR 281001 (Fredricks 394 OSC) restriction sitesR woli Rothrock Siplivinsky 4587 (NY) ITS AF426341

Sect Coreosma (Spach) Jancz (Black Currants)R americanum Mill NPGR 93 restriction sites Nee 24196 (NY) ITS AF426375R bracteosum Douglas UCBG 891645 ETS AY138033 psbA-trnH AY138103 ITS AY138049R fragrans Pallas sc 4378976 (MO) ITS AF426373R hudsonianum Richardson B Ertter 3807 (NY) ITS AF426372

var petiolare (Douglas) Jancz NPGR 278 (Fredricks 390 OSC) restriction sitesR janczewskii Pojark Chase 3597 (K) ITS AF426370R nigrum L NPGR 215001 (OSC) ITS AF426374R viburnifolium A Gray UCBG 651431 ETS AY138034 NPGR 762001 ITS AF426371 restriction sites

Sect Grossularioides (Jancz) Rehd (Spiny or Gooseberry-stemmed Currants)R lacustre (Pers) Poiret Lesica 4710 (NY) ETS (1) AY138018 ITS AF426366 Arnold Arboretum 777ndash93A ETS (2) AY138019

psbA-trnH AY138092 NPGR 45 restriction sitesR montigenum McClatchie Bugham amp Miller sn (WS) ETS AY138020 psbA-trnH AY138093 ITS AF426367 NPGR 864001

(Messinger 254 OSC) restriction sitesSect Heritiera Jancz (Dwarf Currants)

R erythrocarpum Coville and Leiberg NPGR 860001 (Messinger 249 OSC) ITS AF426342 restriction sitesR howellii Greene NPGR 449001 (Messinger 333 OSC) ITS AF426343 restriction sitesR glandulosum Grauer UCBG 890750 ETS (1) AY138035 Schultheis 589ndash00 (YU) ETS (2) AY138036 psbA-trnH AY138105

NPGR 231 restriction sites Chase 3605 (K) ( 5 R prostratum LrsquoHer) ITS AF426345R laxiorum Pursh NPGR 439 restriction sites Goodrich 19052 (WS) ITS AF426344

Sect Parilla Jancz (Andine Currants)R andicola Jancz Friere-Fierro 2577 (NY) ITS AF426368R fasciculatum Sieb amp Zucc UCBG 880615 ETS (1) AY138043 psbA-trnH AY138104 Arnold Arboretum 1879 ETS (2)

AY138044 Chase 3592 (K) ITS AF426346R ovalifolium Jancz Gentry sn (MO) ITS AF426369R valdivianum Phil Messinger 314 (OSC) restriction sites

Sect Ribes L (Red Currants)

2004] 81SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

TABLE 1 Continued

R himalense Decaisne Boufford et al 28903 (A) ETS AY138037 psbA-trnH AY138106 sc 04714258 (MO) ITS AF426369R manshuricum Komarow Arnold Arboretum 67ndash7 ETS AY138038 psbA-trnH AY138107 Chase 3599 (K) ITS AF426320R petraeum Wulfen Chase 3604 (K) ITS AF426318R rubrum L Arnold Arboretum 1119ndash78A ETS (1) AY138039 psbA-trnH AY138108 Arnold Arboretum 214ndash96 ETS (2)

AY138040 Schuhwerk 7039 (NY) ITS AF426321R sativum (Rehbeh) Syme Missouri Botanical Garden ITS AF426323

cv rsquoDiplomarsquo NPGR 747 (Thompson 46 OSC) restriction sitesR spicatum Robs Chase 3609 (K) ITS AF426322R triste Pallas UCBG 941114 ETS (1) AY138041 Arnold Arboretum 407ndash94 ETS (2) AY138042 psbA-trnH AY138109 Mes-

singer 314 (OSC) restriction sites Baldwin 2269 (WS) ITS AF426319Sect Symphocalyx Berland (Golden Currants)

R aureum Pursh UCBG 560948 ETS (1) AY138030 Arnold Arboretum 460ndash81A ETS (2) AY138029 psbA-trnH AY138101NPGR 769 restriction sites Clement 26 (WS) ITS AF426382

R odoratum Wendl UCBG 860126 ETS (1) AY138032 Arnold Arboretum 1192ndash74A ETS (2) AY138031 psbA-trnH AY138102NPGR 691 restriction sites

Subg Grossularia (Mill) PersSect Grossularia (Mill) Nutt

R aciculare Sm AK Skvortsov sn (A) ETS AY137976 psbA-trnH AY138060 ITS AY138050R alpestre Wall ex Decne Boufford et al 28437 (A) ETS AY137975 psbA-trnH AY138059 Chase 3586 (K) ITS AF426349R burejense F Schmidt NPGR 259001 ETS AY137977 psbA-trnH AY138061 restriction sites Messinger 260 (OSC) ITS

AF426355R curvatum JK Small R Kral 53094 (GH) ETS AY137979R cynosbati L Arnold Arboretum 1108ndash78A ETS (1) AY137981 psbA-trnH AY138063 ITS AY138051 Schultheis 590ndash00 (YU)

ETS (2) AY137980R divaricatum Douglas UCBG 851596 ETS (1) AY137982 psbA-trnH AY138064 Chase 3591 (K) ETS (2) AY137983 ITS

AF426347R echinellum (Coville) Rehd Arnold Arboretum 234ndash96 ETS AY137984 psbA-trnH AY138065 ITS AY138052R formosanum Hayata Wang 1096 (MO) ETS (1) AY137985 ITS AF426354 RBGE 19934301 ETS (2) AY137986 psbA-trnH

AY138066R grossularioides Maxim RBGE 19592035 ETS AY137987 psbA-trnH AY138067 ITS AY138053R hirtellum Michx UCBG 860125 ETS (1) AY137988 Schultheis 588ndash00 (YU) ETS (2) AY137989 psbA-trnH AY138068 Chase

3595 (K) ITS AF426353R inerme Rydb Layser 1770 (UW) ETS (1) AY137990 ITS AF426356 Arnold Arboretum 225ndash80A ETS (2) AY137991 psbA-

trnH AY138069R missouriense Nutt WR Smith 11396 (GH) ETS AY137993 psbA-trnH AY138071 Solomon 859 (WS) ITS AF426348R niveum Lindl Messinger 226 (OSC) ETS AY137994 psbA-trnH AY138072 ITS AF426351 NPGR 777001 (Messinger 226

OSC) restriction sitesR oxyacanthoides L

subsp oxyacanthoides NPGR 139001 ETS (1) AY137996 Alverson 1645 (WIS) ETS (2) AY137995 psbA-trnH AY138073Peterson amp Annable 4440 (WS) ITS AF426383

subsp cognatum (Greene) Sinnott Woodland sn (WS) ETS AY137978 psbA-trnH AY138062 ITS AF426357subsp irriguum (Douglas) Sinnott RBGE 19794064 ETS AY137992 psbA-trnH AY138070 ITS AY138054 NPGR 773001

(Messinger 221 OSC) restriction sitessubsp setosum (Lindl) Sinnott Arnold Arboretum 1395ndash83A ETS AY137998 psbA-trnH AY138075 Lackschewitz 7845 (UW)

ITS AF426352R rotundifolium Michx Mitchell amp Barbour 10112 (NYS) ETS AY137997 psbA-trnH AY138074 ITS AY138055R stenocarpum Maxim RBGE 19698970 ETS AY137999 psbA-trnH AY138076 ITS AY138056R uva-crispa L UCBG 870719 ETS (1) AY138001 Arnold Arboretum 1404ndash80B ETS (2) AY138000 psbA-trnH AY138077

Hill 20953 (NY) ( 5 R grossularia L) ITS AF426350Subg Hesperia A BergerR amarum McClatchie UCBG 891081 ETS AY138002 psbA-trnH AY138078R californicum Hook and Arn UCBG 821692 ETS AY138004 psbA-trnH AY138080 ITS AY138057R menziesii Pursh Messinger 233 (OSC) ETS AY138006 psbA-trnH AY138082 ITS AF426364 NPGR 769001 (Messinger 233

OSC) restriction sitesR roezli Regel Nelson sn (WS) ETS AY138007 psbA-trnH AY138083 ITS AF426365

var cruentum (Greene) Regel NPGR 772001 (Messinger 217 OSC) restriction sitesSubg Lobbia A BergerR binominatum AHeller Messinger 260 (OSC) ETS AY138003 psbA-trnH AY138079 ITS AF426359 NPGR 867001 (Messinger

260 OSC) restriction sitesR lobbii A Gray UCBG 851496 ETS AY138005 psbA-trnH AY138081 Smith Jr 7443 (WS) ITS AF426361R velutinum Greene Annable 2503 (NY) ETS AY138011 psbA-trnH AY138085 ITS AF426358 NPGR 865 (Messinger 2551

OSC) restriction sitesR watsonianum Koehne Patrick sn (UW) ETS AY138012 psbA-trnH AY138086 ITS AF426360

Sect Robsonia BerlandR speciosum Pursh UCBG 840004 ETS (1) AY138008 psbA-trnH AY138084 Mort 1371 WS ETS (2) AY138009 ITS AF426362

NPGR 901001 restriction sitesR thacherianum Johnson sn (WS) ETS AY138010 ITS AF426363

82 [Volume 29SYSTEMATIC BOTANY

TABLE 1 Continued

OutgroupsItea virginica L New York Botanic Garden 7698C ETS AY138045 psbA-trnH AY138110 Messinger 337 (OSC) restriction sites

Ware 94 (WS) ITS AY231368I ilicifolia Oliver UCBG 860414 ETS AY138046 psbA-trnH AY138111 ITS AY138058

from Senters and Soltis 2003) It is possible that incongruence be-tween ETS and ITS datasets was due to intraspecic variation anas yet unexplored issue within Ribes that may limit future use ofcomposite accessions The presence of ETS and ITS regions on thesame transcript similar GC contents (ETS5 mean 049 ITS5mean058) similar proportions of invariant characters (ETS5 297462ITS5438700) and similar levels of rate heterogeneity across sites(ETS gamma 5 065 ITS gamma5 057) argued against differentevolutionary processes of sequence evolution as an explanation forincongruence

In order to maximize taxon sampling and data tests were alsoused to assess combinability of taxa represented in three of thefour available datasets While this required the inclusion of taxafor which one dataset was coded as missing the decrease in phy-logenetic accuracy was expected to be insignicant (Weins andReeder 1995)

Phylogenetic Analysis of Sequence Data Analyses of single(ITS ETS and psbA-trnH) and combined datasets were performedusing a parsimony criterion in PAUP 40 All sites and all changeswere equally weighted in contrast to the 13 gains10 loss weight-ing scheme used by Messinger et al (1999) in their analyses ofrestriction site data psbA-trnH data were analyzed both with in-dels treated as missing data and with seven large indels includedas binary characters Positions 309ndash327 and 448ndash465 of the alignedpsbA-trnH dataset were excluded from all analyses due to ambig-uous alignments

Analyses of the ITS ETS and psbA-trnH datasets consisted ofheuristic searches with 100 replicates of random addition and TBRbranch swapping No more than 400 trees greater than a speciedlength (234 for ETS 556 for ITS 137 for psbA-trnH) were savedper replicate or in the case of psbA-trnH with indels no more than250 trees greater than length 144 The limiting tree length wasdetermined based on the shortest trees found in prior incompletesearches and was imposed to prevent computational overloadsearching sub-optimal trees Analyses of all datasets combined orof combined chloroplast datasets were conducted with the branch-and-bound algorithm with taxa excluded based on partition ho-mogeneity test results For datasets combining ETS1ITSETS1psbA-trnH psbA-trnH1rDNA or all data for those taxa rep-resented in three of the four datasets analyses consisted of heu-ristic searches with 100 replicates of random addition TBR branchswapping and maxtrees set to 40000

Clade support was assessed using bootstrap analyses (Felsen-stein 1985) as implemented in PAUP 40 with 300 replicates ofheuristic searches each with 5 replicates of random taxon additionand Nearest Neighbor Interchange (NNI) branch swapping Forthe combination of all four datasets and for the combined chlo-roplast datasets clade support was assessed using 100 bootstrapreplicates each with branch and bound searches

Kishino-Hasegawa Tests The parsimony implementation of theKishino-Hasegawa test (Kishino and Hasegawa 1989) in PAUP 40was used to compare the hypothesis of subg Grossularia monophylyto that of subg Grossularia non-monophyly in which sect Grossu-larioides and sect Grossularia form a clade The parsimony version ofthe test was used because comparisons included restriction site dataAs recommended by Goldman et al (2000) comparisons were be-tween a priori hypotheses based on previously published phyloge-nies (Messinger et al 1999 Senters and Soltis 2003)

Analyses were run enforcing each of two constraint trees Therst constraint tree resolved subg Grossularia as monophyletic butleft relationships within subg Grossularia and among all remain-ing species unresolved The second constraint tree enforced res-olution of a clade containing sect Grossularioides plus sect Gros-

sularia but relationships within this clade were left unresolved aswere relationships among all remaining species Comparisonswere between trees from constrained branch and bound searchesfor the chloroplast data and from constrained heuristic searchesfor the rDNA data

Ancestral Area Reconstruction Ancestral areas were inferredusing DIVA which assigns areas to internal nodes such that dis-persal and extinction events are minimized (Ronquist 1996 1997)Default costs were used (vicariance 5 0 dispersal 5 1 extinction51) and the number of inferred areas per node was left uncon-strained These analyses used trees from the combined psbA-trnHand rDNA datasets (Fig 8) with species assigned to one or moreof four areas (eastern North America western North Americaeastern Eurasia and western Eurasia) Geographic distributionsfollowed Berger (1924) Janczewski (1907) and Sinnott (1985) SectCalobotrya R aureum R bracteosum R watsonianum and the cladecontaining the remaining glabrous-styled gooseberries (HesperiaLobbia Robsonia) were all coded with western North American dis-tributions Sect Grossularioides was coded for both North Americaand eastern Eurasia Subg Berisia was coded for both eastern andwestern Eurasia Ribes triste was coded for all areas except westernEurasia Itea was coded for both eastern North America and east-ern Eurasia

Because DIVA analyses do not permit polytomies we treated Raureum and R bracteosum as sister taxa Within sect Grossulariamembers of the Asian gooseberry clade were all coded as easternEurasia The remaining species of the large polytomy all live inwestern or eastern North America We resolved this polytomy inseveral different ways so as to explore some of the possibilitiesFor example in some analyses we created one eastern NorthAmerican and one western North American clade In others theNorth American species were arranged pectinately in relation tothe Asian clade

RESULTS

Sequence Characteristics and Analyses The aligned18ndash26S rDNA ITS dataset including 58S(positions 283ndash452) was 700 bp (282bp5ITS1 248bp5ITS2) with 28of the data matrix coded as missing data For the regionas a whole sequences ranged from 438ndash662bp (varia-tion due in part to missing terminal sequence data)uncorrected pairwise distances within Ribes rangedfrom 00ndash008 distances with Itea ranged from 027(with R missouriense) to 032 (with R malvaceum) andmean GC content was 058 Of the 700 aligned base-pairs 528 were constant within Ribes and 183 wereparsimony informative ITS1 displayed higher levels ofdivergence and a higher proportion of informativecharacters than did ITS2 (ITS1 5 00ndash015 65282 in-formative ITS2 5 00ndash011 25248 informative) In-cluded ITS1 sequences ranged from 34ndash258bpwith thelower limit due to taxa for which much of ITS1 se-quence data was missing ITS2 sequences ranged from216ndash241bp 58S ranged from 161ndash164bp but was only142bp in R sanguineum due to a large deletion

2004] 83SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

Lengths and GC contents fell within the ranges re-ported for a survey of angiosperm taxa (Baldwin et al1995) Analyses of the ITS and 58S regions generated36400 trees (length5556 CI5065 058 excluding un-informative characters RI5084)

Amplied products from the 18ndash26S rDNA inter-genic spacer region were approximately 2kb in R odor-atum (sect Symphocalyx) and 3kb in R hirtellum (sectGrossularia) the two species used to design internalprimers for amplifying 39 ETS Only 406bp of the 39end of the ETS region and 56bp of the 59 end of 18Swere sequenced in this study Included sequencesranged from 299ndash462bp in size with some variationdue to missing terminal sequence data and had amean GC content of 049 Uncorrected pairwise dis-tances among ETS sequences within Ribes ranged from00 to 007 Pairwise distances between Ribes and Itearanged from 026 (with R oxyacanthoides accession 2)to 032 (with R triste accession 1) Of the 462 alignedbasepairs 388 were constant within Ribes 60 were par-simony informative and 2 were coded as missingdata ETS analyses generated 34005 trees (length5234CI5080 074 excluding uninformative charactersRI5093 Fig 2)

The aligned psbA-trnH intergenic spacer dataset was502bp including a 39 portion of psbA (positions 1ndash37)and a 59 portion of trnH (position 484ndash502) One per-cent of the matrix was coded as missing data Includedsequences ranged from 355ndash445bp in length withsome variation due to missing terminal sequence dataand had a mean GC content of 029 The spacer regionalone ranged from 352ndash378bp within Ribes and was369bp in Itea based on complete sequences Uncor-rected pairwise distances (including psbA and trnHterminals) within Ribes ranged from 00 to 004 Dis-tances between Ribes and Itea ranged from 015 (withR odoratum accession 2) to 021 (with R bracteosum)Within Ribes 405465 included characters were con-stant and 34465 were parsimony informative Ex-cluded characters represented a polyA region rangingfrom 4ndash13bp and a 16ndash18bp insertion in Itea (relativeto Ribes) with which 5ndash6bp segments of Ribes could bealigned in various ways Analyses of sequence datafrom the psbA-trnH intergenic spacer produced 34000trees with little homoplasy (length5137 CI5092 088excluding uninformative characters RI5094 Fig 3)Analyses including indels coded as binary charactersproduced 18001 trees (length5144 CI5092 090 ex-cluding uninformative characters RI5095)

Trees Generated by Analyses of IndividualDatasets Results from the expanded ITS datasetconcur with those presented by Senters and Soltis(2003) and are not illustrated here Subg Grossulariawas resolved as monophyletic in ITS and ETS treeswith weak to moderate bootstrap support (Figs 1 2)psbA-trnH trees showed little resolution but did not

conict with a monophyletic subg Grossularia (Fig 3trees from analyses including indels are not shown)

Two main lineages may be identied within subgGrossularia the true gooseberries (sect Grossularia) andthe glabrous-styled gooseberries (Hesperia Lobbia Rob-sonia) The glabrous-styled gooseberries are resolved asa clade in ITS restriction site and psbA-trnH trees(Figs 1 3 Messinger et al 1999) ETS trees also resolvethe glabrous-styled gooseberries (Hesperia Lobbia Rob-sonia) as a clade with the exception of R watsonianum(subg Lobbia) placed with strong support in the truegooseberry clade (sect Grossularia) (Fig 2) The integ-rity of the individual sections comprising the glabrous-styled gooseberries (Hesperia Lobbia Robsonia) is un-clear The true gooseberries (sect Grossularia) are re-solved as a clade in restriction site ITS and ETS trees(including R watsonianum in the latter) and in psbA-trnH trees when indels are included (Figs 1 2 Mes-singer et al 1999 Senters and Soltis 2003) If indels areignored psbA-trnH trees resolve the majority of truegooseberries as a clade and are consistent with amonophyletic sect Grossularia (Fig 3) Within sectGrossularia the ETS dataset provided strong supportfor an Asian clade including the European R uvacris-pa ITS trees were consistent with an Asian clade butexcluded R uvacrispa psbA-trnH trees were also con-sistent with an Asian clade with the weakly support-ed inclusion of the North American R oxyacanthoidessubsp irriguum Restriction site trees had limited sam-pling in sect Grossularia but were consistent with anAsian versus North American divergence (Messingeret al 1999)

All datasets except the restriction sites resolved aclade comprising sect Calobotrya sect Grossularioidesand subg Grossularia (sect Grossularia sect Robsoniasubg Lobbia Hesperia) Members of this clade are large-ly from western North America with sect Grossulariahaving a wider distribution ETS trees included theblack currant Ribes bracteosum (sect Coreosma) withinthis clade in an unresolved position (Fig 2) ITS treesincluded the South American sect Parilla in this cladein an unresolved position (Senters and Soltis 2003) Inall trees sect Calobotrya was resolved as monophyleticincluding some members of sect Heritiera in restrictionsite and ITS trees (only one species of sect Heritierawas included in ETS and psbA-trnH analyses and fallselsewhere) Section Grossularioides was resolved withstrong support in ETS and ITS trees (Figs 1 2 Sentersand Soltis 2003) but is unresolved or strongly para-phyletic in the psbA-trnH and restriction site trees re-spectively (Figs 1 3 Messinger et al 1999)

The clade containing sects Calobotrya Grossularioidesand subg Grossularia was clearly nested within Ribesin ITS ETS and psbA-trnH trees (Figs 2 3 Senters andSoltis 2003) Among the remaining sections of Ribesall datasets provided strong support for sect Berisia

84 [Volume 29SYSTEMATIC BOTANY

FIG 2 The majority-rule consensus of 34005 trees resulting from analyses of ETS sequence data (CI5080 074 excludinguninformative characters RI5093) Numbers above the branches indicate the percentage of bootstrap replicates in which theclade appeared Numbers in parentheses below the branches indicate the percentage of trees in which the clade appearedwhen less than 100

2004] 85SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 3 The majority-rule consensus of 34000 trees resulting from analyses of psbA-trnH sequence data (CI5092 088excluding uninformative characters RI5094) Numbers above the branches indicate the percentage of bootstrap replicates inwhich the clade appeared Numbers in parentheses below the branches indicate the percentage of trees in which the cladeappeared when less than 100

86 [Volume 29SYSTEMATIC BOTANY

FIG 4 The strict consensus of six trees resulting fromanalyses of psbA-trnH sequence data combined with chloro-plast restriction site data (Messinger et al 1999) (CI5090 079excluding uninformative characters RI5087) Data combina-bility determined by partition homogeneity tests (p5066)Numbers above the branches indicate the percentage of boot-strap replicates in which the clade appeared

with the inclusion of some species of sect Ribes in ITStrees (Senters and Soltis 2003) Section Symphocalyxwasstrongly resolved in ETS and restriction site trees (Fig2 Messinger et al 1999) but was unresolved in psbA-trnH trees (Fig 3) (ITS trees included only one species)Section Heritiera appeared to be polyphyletic in ITSand restriction site trees (only one species of sect Her-itiera is included in ETS or psbA-trnH analyses) (Mes-singer et al 1999 Senters and Soltis 2003) The mono-phyly of sects Ribes and Coreosma remain unclear Forthose species sampled sect Ribes was resolved asmonophyletic in restriction site trees (Messinger et al1999) as monophyletic excluding R triste in ETS andpsbA-trnH trees (Figs 2 3) and as polyphyletic in ITStrees with some species clearly related to sect Berisia(Senters and Soltis 2003) Section Coreosma was re-solved as polyphyletic in ETS and restriction site trees(Fig 2 Messinger et al 1999) and as para- or poly-phyletic in ITS trees (Senters and Soltis 2003) (only onespecies was included in the psbA-trnH dataset) Previ-ous restriction site analyses of 18ndash26S rDNA suggestedthat members of sect Coreosma were divergent fromone another and from other Ribes species (Messingeret al 1993) Sampling from sect Parilla was too limitedto draw strong conclusions but the ITS trees support-ed its monophyly to the exclusion of R fasciculatumthe only non-South American member of the section(Senters and Soltis 2003) Relationships among the sec-tions outside of the predominantly western NorthAmerican clade (sects Calobotrya Grossularioides subgGrossularia) varied markedly among datasets with lit-tle support for any one resolution (Figs 2 3)

Trees Generated from Analyses of CombinedDatasets Dataset combinability is typically based ona critical value of p 5 005 (ie datasets are incongru-ent when p 005) However studies suggest that acritical value of p 5 005 may be too strict such thatthe null hypothesis of dataset congruence will be false-ly rejected (Huelsenbeck et al 1996 Sullivan 1996Cunningham 1997) and that a value such as p 5 001may be more appropriate (Cunningham 1997) Manyof the datasets reported here were not combinablebased on intitial partition homogeneity tests but theincongruence was generally eliminated when problem-atic taxa were excluded

Analyses of the readily combinable chloroplast psbA-trnH and restriction site data (p5066) generated sixtrees (length 144 CI5090 079 excluding uninforma-tive characters RI5087) In agreement with analysesof restriction site data alone true gooseberries (sectGrossularia) were not placed as sister to the remainingglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) suggesting that subg Grossularia is not monophy-letic (Figs 1 4) The true gooseberries were nested ina paraphyletic sect Grossularioides as in the restrictionsite trees with sect Calobotrya weakly placed as sister

Support for sect Grossularia sect Calobotrya and theglabrous-styled gooseberries (Hesperia Lobbia Robsonia)increased relative to analyses of either dataset alone(Fig 3 Messinger et al 1999) Support for a paraphy-letic sect Grossularioides decreased slightly relative tothe restriction site analyses (Fig 4 Messinger et al1999)

Analyses of the combined ETS and ITS rDNA data(p5004 excluded R fasciculatum R glandulosum Rhimalense R manshuricum R nevadense R rubrum Roxyacanthoides subsp oxycanthoides R uvacripsa) gener-ated 150 trees (length 614 CI5077 070 excluding un-informative characters RI5085) (Fig 5) Subg Gros-sularia was monophyletic as were the true gooseber-ries (sect Grossularia) (Fig 5) The glabrous-styledgooseberries (Hesperia Lobbia Robsonia) were stronglyresolved as monophyletic with the exception of R wat-sonianum (sect Lobbia) placed strongly as sister to thetrue gooseberries Within sect Grossularia only theAsian clade was resolved with strong support Theclade containing subg Grossularia sect Grossularioi-dies and sect Calobotrya was again evident with sectGrossularioides resolved as sister to subg GrossulariaSupport for the glabrous-styled gooseberries (HesperiaLobbia Robsonia) sect Calobotrya sect Grossularioidesand the Asian clade within sect Grossularia increasedrelative to support from ETS or ITS datasets analyzedindividually (Figs 2 5 Senters and Soltis 2003)

The most evident difference between chloroplast and

2004] 87SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 5 The strict consensus of 150 trees resulting from analyses of combined ETS and ITS sequence data (CI5077 070excluding uninformative characters RI5085) Data combinability determined by partition homogeneity tests (p5004) Num-bers above the branches indicate the percentage of bootstrap replicates in which the clade appeared

88 [Volume 29SYSTEMATIC BOTANY

FIG 6 The strict consensus of four trees resulting from analyses of the four datasets combined (ETS ITS psbA-trnHchloroplast restriction sites) Data combinability was determined by partition homogeneity tests (p5075) Numbers above thebranches indicate the percentage of bootstrap replicates in which the clade appeared

rDNA trees was the position of sect GrossularioidesSubgenus Grossularia is monophyletic in rDNA treeswith sect Grossularioides placed weakly as sister (Fig5) In contrast subg Grossularia is polyphyletic in chlo-roplast trees with sect Grossularia nested within sectGrossulariodes and sect Calobotrya sister to that group-ing (Fig 4) Analyses of the combined chloroplast andrDNA datasets (p5075 excluded R glandulosum Rlacustre R montigenum) generated four trees (length556 CI5088 069 excluding uninformative charactersRI5076) (Fig 6) Taxon sampling was limited due tothe limited overlap among datasets but trees showedstrong resolution of sect Calobotrya sect Grossulariaand the glabrous-styled gooseberries (Hesperia Lobbia

Robsonia) These groups again formed a well-support-ed clade nested within Ribes (Fig 6) The strongly sup-ported sister-group relationship between the true andglabrous-styled gooseberries (Fig 6) is consistent withthe monophyly of subg Grossularia but could changewith the inclusion of sect Grossularioides

ETS and psbA-trnH combined analyses (p5004 ex-cluded R oxyacanthoides subsp irriguum) generated 329trees (length 372 CI5084 077 excluding uninforma-tive characters RI5090) (Fig 7) Subgenus Grossulariawas resolved as monophyletic within which both theglabrous-styled and the true gooseberries were strong-ly supported the latter including R watsonianum(subg Lobbia) The Asian clade was well supported

2004] 89SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 7 The strict consensus of 329 trees resulting from analyses of combined ETS and psbA-trnH data (CI5084 077excluding uninformative characters RI5091) Dataset combinability was determined by partition-homogeneity tests (p5 004)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared

within sect Grossularia including the European R uva-crispa Both sect Calobotrya and sect Grossularioideswere strongly supported but neither was resolved assister to subg Grossularia The clade comprising subgGrossularia sect Grossularioides and sect Calobotryawas again evident nested within Ribes

Combined analyses of psbA-trnH and rDNA datasets(p5002 excluded R oxyacanthoides subsp irriguum andtaxa excluded from ETS1ITS analysis) generated 3080trees (length 5 719 CI5080 074 excluding uninfor-mative characters RI5085) Sects Grossularioides Calo-botrya Grossularia and the glabrous-styled gooseberries

90 [Volume 29SYSTEMATIC BOTANY

(Hesperia Lobbia Robsonia) were each strongly support-ed and again formed a strongly supported clade nestedin Ribes (Fig 8) Support for the monophyly of subgGrossularia was increased relative to support seen withany individual dataset (Figs 2 3 8)

Combinability (p5012) of all datasets for those taxarepresented in three of the four datasets required ex-clusion of composite taxa problematic within therDNA dataset as well as exclusion of taxa problematicfor the chloroplast versus rDNA datasets Combinedanalyses generated 4802 trees (length5768 CI5080074 excluding uninformative characters RI5085)Sec-tion Calobotrya sect Grossularia and the glabrous-styled gooseberries (Hesperia Lobbia Robsonia) exclud-ing R watsonianum were each well supported and to-gether formed a strongly supported clade (Fig 9) Sub-genus Grossularia was resolved as monophyleticbearing in mind that sect Grossularioides was excludedfrom the analyses

While all combined datasets resolved the clade con-taining sects Calobotrya Grossularioides and subgGrossularia as nested within Ribes (Figs 4ndash9) relation-ships among other lineages were unclear as in theanalyses of individual datasets (Figs 2 3) Basal rela-tionships were unresolved in the analyses of combinedchloroplast data (Fig 4) The combined ETS and psbA-trnH analyses suggested basal positions for goldencurrants (sect Symphocalyx) (Fig 7) All remaininganalyses suggested basal positions for sects Berisiaand Ribes (Figs 5 6 8 9) Basal relationships were notwell-supported in any analysis

Kishino-Hasegawa Tests Trees generated fromanalyses constraining the monophyly of subg Gros-sularia versus trees constrained to resolve a sister re-lationship between sect Grossularioides and sect Gros-sularia were marginally but signicantly different inboth the chloroplast (p5003) and the rDNA (p5005)datasets

Ancestral Area Reconstructions DIVA reconstruc-tions of ancestral areas support a western North Amer-ican origin for a large segment of Ribes beginningwith node 2 in Fig 8 Within this clade it is also thecase that subg Grossularia is inferred to have diversi-ed rst within western North America (Fig 8 node6) Subsequent movement to eastern Asia is inferred tohave occurred somewhere within sect Grossularia butthe ancestral area for the true gooseberries is equivo-cal and can include virtually any combination of areasdepending on the exact resolution of the large poly-tomy at the base of this clade (Fig 8 node 8) Impor-tantly our results indicate that the Asian species with-in sect Grossularia form a clade implying a single mi-gration from North America to Asia The ancestralarea for Ribes is reconstructed to be western NorthAmerica and western Eurasia or western North Amer-ica and all of Eurasia (Fig 8 node 1) However this

result hinges on resolution at the base which remainshighly uncertain and requires more intensive samplingof Ribes lineages outside of subg Grossularia

DISCUSSION

Gooseberry Monophyly Results from previousphylogenetic analyses based on nuclear 18Sndash26S rDNAITS data (Senters and Soltis 2003) and chloroplast re-striction site data (Messinger et al 1999) differed re-garding gooseberry monophyly Adding the additionalnuclear 18Sndash26S rDNA ETS and chloroplast psbA-trnHdatasets could increase support and resolution in re-sulting topologies or could reinforce the differencesbetween the nuclear and chloroplast topologies witheach reecting accurate but separate histories

Initial examination of the trees produced with theadditional datasets reinforced the apparent conict be-tween nuclear and chloroplast genomes ITS ETS andcombined rDNA datasets supported the monophyly ofsubg Grossularia (Figs 1 2 5) In contrast the com-bined chloroplast datasets (restriction sites plus psbA-trnH) suggested a closer relationship between the trueand glabrous-styled gooseberries than did the restric-tion site data alone (Fig 1 Messinger et al 1999) butstill resolved subg Grossularia as non-monophyleticwith sect Grossularioidies forming a grade at the baseof sect Grossularia (Fig 4) The increase in tree lengthwhen combined chloroplast data was constrained toresolve a monophyletic subg Grossularia (p5003) orwhen combined rDNA data was constrained to resolvesects Grossularioides and Grossularia as a clade(p5005) also indicated dataset incongruence

The discrepancy between nuclear and chloroplast to-pologies primarily involved the restriction sites datasetand not the psbA-trnH dataset The psbA-trnH datasetprovided little resolution (Fig 3) conicting with nei-ther the rDNA nor the restriction sites topologiesAnalyses combining the psbA-trnH data with either theETS data (p5004 Fig 7) or the rDNA data (p5002Fig 8) produced trees resolving subg Grossularia asmonophyletic with increased support relative to ETSor rDNA data alone (Figs 2 5) Section Grossularioideswas either sister to subg Grossularia (psbA-trnH 1rDNA Fig 8) or was unresolved in a polytomy withsubg Grossularia and sect Calobotrya (psbA-trnH 1ETS Fig 7) The monophyly of subg Grossularia wasalso supported by analyses of all datasets combinedwhether including taxa represented in all four datasets(p5075 Fig 6) or in three of the four datasets(p5012 Fig 9) Analyses combining all datasets re-quired exclusion of sect Grossularioides thus leavingsubg Grossularia monophyly uncertain However in-cluding sect Grossulariodes in spite of dataset incon-gruence (p5001) produced trees resolving a mono-phyletic subg Grossularia sister to a monophyletic sectGrossularioides (not shown)

2004] 91SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 8 The strict consensus of 3080 trees resulting from analyses of combined psbA-trnH and rDNA data (CI 5 080 074excluding uninformative characters RI 5 085) Dataset combinability was determined by partition homogeneity tests (p5002)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared DIVA (Ronquist 1996)was used to infer ancestral areas at the numbered nodes The ancestral areas at nodes two through seven were reconstructedas western North America Node one was reconstructed as western North America plus either western Eurasia or all of EurasiaThere were multiple possible reconstructions at node 8 including (1) western North America and eastern Eurasia (2) NorthAmerica and eastern Eurasia (3) North America or (4) western North America

92 [Volume 29SYSTEMATIC BOTANY

FIG 9 The strict consensus of 4802 trees resulting from analyses of all four datasets (ITS ETS psbA-trnH chloroplastrestriction sites) including taxa represented in at least three datasets (CI5080 074 excluding uninformative charactersRI5085) Dataset combinability was determined using partition homogeneity tests (p5012) Numbers above the branchesindicate the percentage of bootstrap replicates in which the clade appeared

2004] 93SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

The general picture that emerges from these analy-ses suggests that subg Grossularia is monophyletic(Figs 2 5ndash9) rDNA data supported gooseberry mono-phyly (Figs 2 5) psbA-trnH data while lacking suf-cient variation to resolve gooseberry monophyly ornon-monophyly supported gooseberry monophyly incombination with rDNA data (Figs 7 8) Finally anal-yses of all datasets combined supported gooseberrymonophyly although these analyses excluded thespiny currants (sect Grossularioides) (Figs 6 9) Whatrequires further investigation is the role hybridizationmay have played in the history of the spiny currants(sect Grossularioides) and the true gooseberries (sectGrossularia) Messinger et al (1999) encouraged furtherexploration of this possibility in Ribes in which theynoted potential chloroplast capture of the sect Gros-sularia chloroplast type by sect Grossularioides Crosseshave not been successful between species of sect Gros-sularioides and other sections within Ribes and are usu-ally unsuccessful between sections or subgenera (Keep1962) Conrmation of the pattern seen in trees gen-erated from the chloroplast restriction site data (Mes-singer et al 1999) is needed from additional chloro-plast datasets that provide greater resolution than didthe psbA-trnH dataset

Relationships Within the Gooseberries SubgenusGrossularia comprises two main lineages (Figs 2 5ndash9)the true gooseberries (sect Grossularia) and a clade ofglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) The four gooseberry sections are traditionally dis-tinguished from each other by basally pubescent stylesin sect Grossularia (with the exception of some Asianspecies) by four versus ve parted owers in sect Rob-sonia by anthers broader at the base in subg Hesperiaand by the absence of the above set of features in subgLobbia The glabrous-styled gooseberry lineage com-prising 27 species distributed through western NorthAmerica into Mexico (Berger 1924) was well-support-ed given our sampling but sections within this lineagewere not resolved Ribes watsonianum (subg Lobbia)was surprisingly placed outside of the glabrous-styledgooseberry lineage as sister to the true gooseberries(Figs 2 5 7ndash9) ITS data resolved R watsonianum with-in the glabrous-styled gooseberry lineage (Senters andSoltis 2003) but ETS data strongly resolved the specieswithin the true gooseberry lineage (sect Grossularia)(Fig 2) This conict within the rDNA data may reecthybridization between R watsonianum and a memberof sect Grossularia followed by xation within the Rwatsonianum genome of a recombinant rDNA repeattype Accounts of Ribes hybrids in the eld are rela-tively rare (Messler et al 1991) and do not implicateR watsonianum but fertile hybrids can be obtainedfrom articial crosses between glabrous-styled goose-berries and true gooseberries (Keep 1962 citing R lob-bii 3 R divaricatum) Alternatively R watsonianum may

posses multiple rDNA repeat types with different re-peat types sampled in our ITS versus ETS datasetsEach of these possibilities has been reported in otherplant taxa (Wendel et al 1995a Campbell et al 1997for potential recombinant rDNA repeat types Suh etal 1993 Wendel et al 1995b for incomplete homoge-nization of rDNA repeat types)

The true gooseberries (sect Grossularia) have a broadrange throughout the northern hemisphere with ninespecies in North America (Sinnott 1985) and seven spe-cies in Eurasia (Berger 1924) In his treatment of NorthAmerican gooseberries Sinnott (1985) divided his ninespecies into ve groups based on phenetic analysesThe groups consisted of (1) R cynosbati with spinyfruits (2) R niveum R curvatum and R missouriensewith highly exserted stamens and long sepals (3) Rrotundifolium and R divaricatum with medium lengthstamens and purple sepals (4) R inerme and R hirtel-lum with intermediate length stamens and small oralfeatures and (5) the ve subspecies of R oxyacanthoi-des with short stamens Sinnott (1985) recommendedthat R echinellum be excluded from the true gooseber-ries and aligned with the glabrous-styled gooseberriesof western North America (Hesperia Lobbia Robsonia)The analyses presented here showed strong supportfor the inclusion of R echinellum as well as the Eurasianspecies within the true gooseberry lineage (Figs 2ndash35 7ndash9) Resolution among the North American specieswas lacking or not well-supported (Figs 2ndash9) and thusneither supported nor conicted with Sinnottrsquos hy-pothesized relationships

The seven Eurasian species of sect Grossularia (Ber-ger 1924) include R uvacrispa in Europe R alpestre andR aciculare in the Himalayan region R stenocarpumand R formosanum in southern and eastern Asia andR burejense and R grossularioides in northern and east-ern Asia A clade of Asian species is well-supported(Figs 2 5 7ndash9) with possible inclusion of R uvacrispa(Figs 2 7) The psbA-trnH dataset includes R oxyacan-thoides subsp irriguum within the Asian clade (Fig 3)but this is weakly supported (Fig 3) and requires fur-ther substantiation particularly since R oxyacanthoidessubsp irriguum is restricted to northwestern NorthAmerica and may itself be of hybrid origin from cross-es between R oxyacanthoides subsp setosum and R in-erme (Sinnott 1985) both distributed in western NorthAmerica Resolution within the clade of Asian speciessuggests a correspondance to geographic and oristicregions within Asia Whether the Asian and NorthAmerican true gooseberries represent divergent line-ages or a monophyletic Asian clade nested within aNorth American grade is unclear given the availabledata

Other Groups within Ribes Since this study fo-cused on the gooseberries sampling within other sec-tions of Ribes was sometimes limited Nevertheless the

94 [Volume 29SYSTEMATIC BOTANY

data did support the monophyly of sects CalobotryaParilla Symphocalyx and Berisia Section Calobotrya is agroup of 21 western North American species (Berger1924) known as the ornamental currants The mono-phyly of sect Calobotrya was well-supported with theinclusion of some dwarf currants (sect Heritieria) (Figs2ndash9 Messinger et al 1999 Senters and Soltis 2003)Sampling was limited in sect Parilla a group of 41dioecious South American species (Janczewski 1907)but the group was supported in ITS trees excludingthe east Asian R fasciculatum the sectionrsquos only non-South American species (Senters and Soltis 2003) Apossible sister relationship between sect Parilla andsect Calobotrya (unpubl data cited in Weigend andBinder 2001) is consistent with the position of sect Pa-rilla seen with ITS data (Senters and Soltis 2003) Sec-tion Symphocalyx the golden currants includes vespecies distributed through northern Mexico and cen-tral and western North America (Berger 1924) Thegolden currants were well-supported given the avail-able sampling (Fig 2 4 9) The alpine currants sectBerisia are a group of 17 dioecious species distributedthrough Eurasia (Janczewski 1907) The monophyly ofsect Berisia was well-supported (Figs 2ndash9 Messingeret al 1999) but with the inclusion of some red currants(sect Ribes) in ITS trees (Senters and Soltis 2003)

The monophyly of sects Ribes and Coreosma wasquestionable (Figs 2 3 5) The red currants (sect Ri-bes) are a group of 15 Eurasian species with one spe-cies R triste also distributed in North America Sec-tion Coreosma the black currants includes six speciesin North America and six in Eurasia (Berger 1924) Sec-tion Heritiera the dwarf currants appeared to be poly-phyletic as seen in Messinger et al (1999) and Sentersand Soltis (2003) This group of six species (Berger1924) is dened primarily by a prostrate habit and assuggested by Messinger et al (1999) is likely a case ofconvergence

Biogeography The spread of taxa around theNorthern Hemisphere has been facilitated by the avail-ability at various times of two major migrationroutesmdashthe Beringian and the North Atlantic landbridges (Tiffney 1985a 1985b Donoghue et al 2001SanmartDaggern et al 2001) Especially in large and relative-ly old clades which have become widespread aroundthe Northern Hemisphere it is possible (perhaps evenlikely) that both pathways were used Information onthe timing of key divergences and on the direction ofmovement within subclades will be critical in sortingout the possibilities in particular cases Ribes providesan excellent example of such a group being represent-ed in Eurasia by six sections (Berisia Ribes and somespecies from Heritiera Coreosma Grossularioides andGrossularia) in western North America by nine (Sym-phocalyx Calobotrya Robsonia Hesperia Lobbia andsome species of Coreosma Heritiera Grossularioides and

Grossularia) and in eastern North America by three(some species of Heritiera Ribes and Grossularia) Oneapproach for sorting through a complex biogeographichistory as might be expected in Ribes is to examinephylogenetic patterns in component clades and ide-ally to date divergences

Our analyses indicate that subg Grossularia is nestedwithin a predominantly western North Americanclade (Figs 2 5ndash9) and that it diversied initially inthat region (Fig 8 node 6) Subsequently within sectGrossularia it appears that movement occurred fromwestern North America to eastern Asia presumablythrough Beringia followed by vicariance and the ori-gin and diversication of the well-supported Asiangooseberry clade Donoghue et al (2001) and Xiangand Soltis (2001) highlighted cases of movement out ofAsia into North America through the Bering LandBridge Ribes appears to provide a case of movementin the opposite direction Movement in both directionsis of course to be expected What remains to be de-termined in future studies of disjunct taxa is exactlywhich groups moved in which directions and whetherthere are any signicant generalizations that can bemade about these different patterns

Elsewhere in Ribes there are other possible cases ofmovement between North America and Asia One caseinvolves R lacustre of sect Grossularioides which is dis-tributed in eastern Asia as well as in North AmericaOther possible cases relate to resolution at the base ofRibes where relationships remain uncertain The basalpositions of sect Symphocalyx in trees resulting frompsbA-trnH data and from the combination of psbA-trnHand ETS data suggest a western North American ori-gin for the entire clade (Figs 2 7) This would implyearly dispersion to Asia giving rise to sects Berisiaand Ribes However all other datasets and dataset com-binations suggested a broader Eurasian plus westernNorth American distribution at the base (Fig 8 node1) owing to the basal positions of sects Berisia andRibes This would imply early vicariance involvingAsia and North America and movement back to Asiawithin the western North American clade Future stud-ies should include more sampling of sects Berisia Ri-bes Coreosma and Symphocalyx to help resolve basal re-lationships and biogeographic patterns in Ribes

The fossil record for Ribes consists largely of leaveswith few reports of seeds (Kremenetski 1998) fruits(Cevallos-Ferriz 1995) and owers (Gandolfo et al1998) The leaf record for Ribes in North America mayextend from approximately 2 mya (Hannibal 1911Dorf 1930 Axelrod 1966) to at least 345 mya (Mac-Ginitie 1953 Manchester 2001) and possibly to 45 or50 mya (Axelrod 1998 Wehr and Hopkins 1994) Al-though leaf features are seldom used to distinguishextant taxa of Ribes Wolfe (1964) used leaf serrationand venation features to distinguish between fossil

2004] 95SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

leaves of subg Ribes and subg Grossularia from Ne-vada If these features are reliable this dates subgGrossularia to at least 14 mya (Fig 9 node 6) A criticalnext step in understanding Ribes biogeography will beto accurately assign Ribes fossils to particular sub-clades so as to infer the timing of intercontinental di-vergences

ACKNOWLEDGEMENTS We thank the following individuals andinstitutions for providing plant material B Alverson D BouffordR Mitchell Arnold Arboretum of Harvard University Universityof California Botanical Garden Royal Botanic Garden EdinburghNew York Botanical Garden and the USDA-ARS National PlantGermplasm Repository A Senters and D Soltis graciously pro-vided numerous DNA aliquots DNA sequences and access to ear-ly manuscripts H Schorn and D Erwin provided assistance withpaleobotanical literature M Lavin P Herendeen and two anon-ymous reviewers provided numerous helpful comments This proj-ect was supported in part by a Putnam Fellowship through theArnold Arboretum of Harvard University

LITERATURE CITED

AVISE J C 1994 Molecular markers natural history and evolutionNew York Chapman amp Hall

AXELROD D I 1966 The Pleistocene Soboba ora of southern Califor-nia University of California Publications in Geological Sci-ences 60

mdashmdashmdash 1998 Thunder Mountain Idaho University of CaliforniaPublications in Geological Sciences 142

BALDWIN B G and S MARKOS 1998 Phylogenetic utility of theexternal transcribed spacer (ETS) of 18Sndash26S rDNA Congru-ence of ETS and ITS trees of Calycadenia (Compositae) Mo-lecular Phylogenetics and Evolution 10 449ndash463

mdashmdashmdash M J SANDERSON J M PORTER M F WOJCIECHOWSKI CS CAMPBELL and M J DONOGHUE 1995 The ITS region ofnuclear ribosomal DNA a valuable source of evidence onangiosperm phylogeny Annals of the Missouri Botanical Garden82 247ndash277

BEARD K H 1998 East of Eden Asia as an important center oftaxonomic origination in mammalian evolution Bulletin of theCarnegie Museum of Natural History 34 5ndash39

BENA G M F JUBIER I OLIVIERI and B LEJEUNE 1998 Ribosom-al external and internal transcribed spacers combined use inthe phylogenetic analysis of Medicago (Leguminosae) Journal ofMolecular Evolution 46 299ndash306

BERGER A 1924 A taxonomic review of currants and gooseberriesNew York Agricultural Experimental Station Technical Bulletin109 1ndash118

BOUFFORD D E and S A SPONGBERG 1983 Eastern Asia-EasternNorth American phytogeographical relationships-a historyfrom the time of Linnaeus to the twentieth century Annalsof the Missouri Botanical Garden 70 423ndash439

CAMPBELL C S M F WOJCIECHOWSKI B G BALDWIN L A AL-ICE and M J DONOGHUE 1997 Persistent nuclear ribosomalDNA sequence polymorphism in the Amelanchier agamiccomplex (Rosaceae) Molecular Biology and Evolution 14 81ndash90

CEVALLOS-FERRIZ S R S 1995 Fruits of Ribes from the Princetonchert British Columbia Canada American Journal of Botany82(6 supplement) 84

COVILLE F V and N L BRITTON 1908 Grossulariaceae NorthAmer-ican Flora 22 193ndash225

CUNNINGHAM C W 1997 Can three incongruence tests predictwhen data shold be combined Molecular Biology and Evolution14 733ndash740

DEQUEIROZ A M J DONOGHUE and J KIM 1995 Separate versuscombined analysis of phylogenetic evidence Annual Review ofEcology and Systematics 26 657ndash681

DONOGHUE M J C D BELL and J LI 2001 Phylogenetic patternsin northern hemisphere plant geography International Journalof Plant Sciences 162 S41ndashS52

DORF E 1930 Pliocene oras of California Carnegie Institution ofWashington Publication 412

FARRIS J S M KALLERSJO A G KLUGE and C BULT 1995 Test-ing signicance of incongruence Cladistics 10 315ndash319

FELSENSTEIN J 1985 Condence limits on phylogenies an ap-proach using the bootstrap Evolution 39 783ndash791

FENTON B A N E BIRCH G MALLOCH P G LANHAM and RM BRENNAN 2000 Gall mite molecular phylogeny and itsrelationship to the evolution of plant host specicity AppliedAcarology 24 831ndash861

FRITSCH P W C M MORTON T CHEN and C MELDRUM 2001Phylogeny and biogeography of the Styracaceae InternationalJournal of Plant Sciences 162 S95ndashS116

GANDOLFO M A P HOC S N SANTILLANA and S A MARENSSI1998 Una or fosil morfologicamente afDaggern a las Grossulari-aceae (orden Rosales) de la Formacion la Meseta (Eoceno me-dio) Isla Marambio Antartida Asociacion Paleontologica Argen-tina Publicacion Especial 5 Paleogeno de America del Sur y de laPenDaggernsula Antartica 147ndash153

GOLDMAN N J P ANDERSON and A G RODRIGO 2000 Likeli-hood-based tests of topologies in phylogenetics SystematicBiology 49 652ndash670

HANNIBAL H 1911 A Pliocene ora from the Coast Ranges ofCalifornia Bulletin of the Torrey Botanical Club 38 329ndash342

HUELSENBECK J P J J BULL and C W CUNNINGHAM 1996 Com-binined data in phylogenetic analysis Trends in Ecology andEvolution 11 152ndash158

JANCZEWSKI M E 1907 Monographies des groseilliers Ribes LMemoires Societe de Physique et DrsquoHistoire Naturelle de Geneve35 199ndash517

KEEP E 1962 Interspecic hybridization in Ribes Genetica 33 1ndash23

KISHINO H and M HASEGAWA 1989 Evaluation of the maximumlikelihood estimate of the evolutionary tree topologies fromDNA sequence data and the branching order in HominoideaJournal of Molecular Evolution 29 170ndash179

KREMENETSKI C V 1998 Holocene history of the northern rangelimits of some trees and shrubs in Russia Arctic and AlpineResearch 30 317ndash333

LINDER C R L R GOERTZEN B V HEUVEL J FRANCISCO-OR-TEGA and R K JANSEN 2000 The complete external tran-scribed spacer of 18Sndash26S rDNA amplication and phylo-genetic utility at low taxonomic levels in Asteraceae andclosely allied families Molecular Phylogenetics and Evolution 14285ndash303

MACGINITIE D 1953 Fossil plants of the Florissant beds ColoradoCarnegie Institution of Washington Publication 599

MADDISON D R and W P MADDISON 2000 MacClade 4 Sun-derland Sinauer Associates

MANCHESTER S R 1999 Biogeographical relationships of NorthAmerican Tertiary oras Annals of the Missouri Botanical Gar-den 86 472ndash522

mdashmdashmdash 2001 Update on the megafossil ora of Florissant Colo-rado Proceedings of the Denver Museum of Nature amp ScienceSeries 4 No1 137

MANOS P S and M J DONOGHUE 2001 Progress in northernhemisphere phytogeography an introduction InternationalJournal of Plant Sciences 162 S1ndashS2

mdashmdashmdash and A M STANFORD 2001 The historical biogeography ofFagaceae tracking the tertiary history of temperate and sub-tropical forests of the northern hemisphere International Jour-nal of Plant Sciences 162 S77ndashS93

MAST A R and T J GIVNISH 2002 Historical biogeography andthe origin of stomatal distributions in Banksia and Dryandra(Proteaceae) based on their cpDNA phylogeny American Jour-nal of Botany 89 1311ndash1323

MESSINGER W K HUMMER and A LISTON 1999 Ribes (Grossu-

2004] 79SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

DNA Isolation Total DNA was isolated from fresh silica-des-iccated and herbarium material All extractions were performedusing QiaGen DNeasy Plant Mini kits following manufacturerrsquosinstructions except that plant material was ground in warmedAP1 buffer (provided in QiaGen kit) rather than liquid nitrogenSome DNA aliquots were provided by Senters and Soltis (Univer-sity of Florida) as indicated in Table 1

Amplication and Sequencing PCR and sequencing reactionswere performed using a Perkin-Elmer Corporation GeneAmp 9600or MJ Research Inc DNA Enginey Thermal Cycler PCR productswere cleaned using QiaGen QiaQuick PCR Purication kits Se-quencing reactions were performed with ABI Prism BigDye Ter-minator Cycle Sequencing Ready Reaction Kits using half or fullreactions and were cleaned using either EtOHNaOAc precipita-tion following recommendations in BigDye kits or Edge Biosys-tems Performa DTRy Gel Filtration systems In some cases se-quences were improved with the addition of DMSO to sequencingreactions (approximately 6 nal volume) Sequencing reactionswere resolved on 5 polyacrylamide gels with an Automated Bio-systems (ABI) 377 sequencer loaded with standard or Rapid Loadmembrane combs (The Gel Company) Sequencher version 311was used to examine and edit sequence chromatograms

ITS amplication products for the 12 new sequences reportedin this study were generated using primers ITS4 (White et al 1990)and ITS-I (59-GTCCACTGAACCTTATCATTTAG-39 designedby LE Urbatsch Louisiana State University) with the following param-eters initial denaturation (978C 1 min) followed by 35 cycles ofdenaturation (978C 10 sec) annealing (488C 30 sec) extension(728C 20 sec increasing 4 sec with each cycle) and concludingwith a nal extension (728C 7 min) PCR reactions contained25mL 10X AmpliTaq buffer (Perkin-Elmer) 25mL 10mM dNTPs25mL 25mM MgCl2 125mL BSA 125mL 10mM ITS4 primer125mL 10mM ITS-I primer 01mL AmpliTaq DNA polymerase(Perkin-Elmer) and 1ndash10ng DNA to a total volume of 25mL Am-plication products were sequenced with ITS4 ITS2 (White et al1990) ITS-I and ITS3B (the reverse complement of ITS3 White etal 1990) Most the length of ITS 2 was sequenced in both direc-tions Sequencing primers for ITS 1 often produced short sequenc-es with minimal overlap such that sequences were largely basedon a single strand A portion of the 58S region could not be re-covered from R cynosbati (41 bp) or R echinellum (77 bp) and wasthus coded as Nrsquos in the matrix Of the 67 ITS sequences obtainedfrom Senters and Soltis (2003) ve were missing a large portionof ITS 1 (approx 100bp for R giraldii and R montigenum approx240 for R missouriense approx 130 for R watsonianum approx230 for R rubrum)

Sequences from the external transcribed spacer of 18ndash26S nucle-ar rDNA (ETS) were obtained following the strategy of Baldwinand Markos (1998) Ribes odoratum (subg Ribes sect Symphocalyx)and R hirtellum (subg Grossularia sect Grossularia) were chosenfor initial long-distance PCR of the inter-genic spacer region (IGS)in order to design an internal primer conserved across RibesLong-distance PCR of the IGS was conducted with the followingparameters initial denaturation (948C 1 min) followed by 35 cy-cles of denaturation (948C 30 sec) and combined annealing andextension (728C 6 min) PCR reactions contained the followingcomponents 25mL 10X KlenTaq LA Polymerase Mix (ClontechLaboratories Inc) 25mL 10mM dNTPs 25mL 10mM 18S-IGSprimer (Baldwin and Markos 1998) 25m L10mM 26S-IGS primer(Baldwin and Markos 1998) 05mL KlenTaq LA DNA polymeraseand 1ndash10 ng DNA to a total volume of 25 mL Amplication prod-ucts were sequenced in one direction using primer 18S-E (Baldwinand Markos 1998) yielding approximately 480bp of readable se-quence Primer ETS-Rib1 (59 GAACTGTTGTCGCGTGCGTCGT39)was designed 59 of the 18S-E priming site from a conserved regionwithin ETS Attempts were made to sequence further into the ETSregion using primer ETS-Rib2 (59 ACGACGCACGCGACAA-CAGTTC 39) the reverse complement of ETS-Rib1 but readablesequences were only obtained from R hirtellum hindering effortsto identify a conserved site further 59 of ETS-Rib1

Short-distance PCR of the 39 portion of the ETS region was per-formed using the ETS-Rib1 primer in conjunction with the 18S-

ETS primer (Baldwin and Markos 1998) under the following pa-rameters initial denaturation (948C 2 min) followed by 35 cyclesof denaturation (948C 30 sec) annealing (658C 1 min) extension(728C 15 min) and concluding with a nal extension (728C 7min) PCR reactions contained 25mL 10X AmpliTaq buffer (Perkin-Elmer) 25mL 10mM dNTPs 25mL 25mM MgCl2 05mL 10mMETS-Rib1 primer 05mL 10mM 18S-ETS primer 01mL AmpliTaqDNA polymerase (Perkin-Elmer) and ndash10ng DNA to a total vol-ume of 25mL Cleaned amplication products were sequenced inboth directions with primers ETS-Rib1 and 18S-ETS Itea ilicifoliais a partial sequence missing the rst 107 bp

Primers psbAF and trnHR (Sang et al 1997) were used for bothamplication and sequencing of the psbA-trnH intergenic spacerregion PCR reaction parameters were initial denaturation (948C2 min) followed by 35 cycles of denaturation (948C 30 sec) an-nealing (618C 30 sec) extension (728C 1 min) and concludingwith a nal extension (728C 7 min) PCR reactions contained25mL 10X AmpliTaq buffer (Perkin-Elmer) 25mL 10mM dNTPs25mL 25mM MgCl2 125mL 10mM psbAF primer 125mL 10mMtrnHR primer 01mL AmpliTaq DNA polymerase (Perkin-Elmer)and1ndash10ng DNA to a total volume of 25mL For some samplesamplication was aided by the addition of 25mL BSA to the PCRreaction Ribes viburnifolium was not successfully sequenced pos-sibly due to homopolymer strings close to both the 59 and 39 prim-er sites A central portion of approximately 159 bp could not berecovered from Itea virginica and was coded as Nrsquos in the matrix

Sequence identities were veried by performing BLAST searches(National Center for Biotechnology Information National Insti-tutes of Health) using sequences from Ribes burejense

Alignment Sequences were initially aligned in Clustal X Mul-tiple Sequence Alignment Program version 181 under the defaultsettings then adjusted by eye using MacClade 4 sequencing editorfeatures (Maddison and Maddison 2000) All Ribes sequences werereadily alignable by eye as were Itea sequences but alignmentbetween Ribes and Itea was often difcult Ambiguous regionswere aligned so that the number of informative sites was mini-mized Base pairs that could not be assigned with condence dueto weak or noisy signal were coded with lsquolsquoNrsquorsquo or with IUPAC-IUBambiguity symbols Gaps inserted for alignment in regions of in-ferred indels were coded as rsquorsquondashrsquorsquo and treated as missing data Sevenlarge indels coded as present (1) or absent (0) were added to thepsbA-trnH matrix The seven coded indels included three inser-tions in Itea (positions 79ndash88 199ndash207 418ndash434) two deletions inItea (positions 110ndash114 359ndash372) an insertion consisting primarilyof TA repeats in members of sect Grossularia (positions 279ndash295)and a deletion in R himalense R manshuricum and R rubrum (po-sitions 111ndash116) Datasets are available at TreeBASE (study acces-sion number s1001)

Dataset Combinability Overlap among the four datasets (ITSETS psbA-trnH restriction sites) was not complete Of the 84 spe-cies included in this study 50 were represented in at least threeof the four datasets (Table 1) A series of partition homogeneitytests (Farris et al 1995) were performed in PAUP ver 40 (Swof-ford 2001) to assess dataset combinability Each test consisted of100 replicates employing heuristic searches with simple taxon ad-dition TBR branch swapping maxtrees set to 1000 and invariantcharacters excluded

Initial partition homogeneity tests indicated that the psbA-trnHand restriction site datasets were combinable (p5066) while allother dataset combinations were incongruent (p 001) To explorepotential sources of incongruence we conducted additional ho-mogeneity tests with individual taxa or groups of taxa excludedbased on differential and well-supported (bootstrap 70) place-ment in trees or on differential placement regardless of supportlevels (deQueiroz et al 1995) For the ETS and ITS comparisontaxa were excluded one at a time and in groups if they representedcomposites of multiple accessions (Table 1) and exhibited differ-ential placements in ETS versus ITS trees Samples of R oxyacan-thoides subsp oxyacanthoides were also excluded in ETS versus ITScomparisons because there was divergence between the two in-cluded ETS sequences (sequenced for this study) thus it was notclear which should be combined with the ITS sequence (obtained

80 [Volume 29SYSTEMATIC BOTANY

TABLE 1 Taxa included in this study with GenBank accession numbers Following Messinger et al (1999) taxonomy correspondsto Sinnott (1985) with Grossularia subg Hesperia and subg Lobbia treated under Ribes ITS sequences noted in boldface are from Sentersand Soltis (2003) Senters and Soltis provided the DNA for italicized sequences Restriction site data are from Messinger et al (1999)Voucher information is cited as per Senters and Soltis (2003) or Messinger et al (1999) when the data or DNA came from those sourcesHerbarium codes follow the Index Herbariorum Eighth Edition NPGR refers to the USDA-ARS National Plant Germplasm RepositoryUCBG refers to the University of California Botanical Garden RBGE refers to the Royal Botanic Garden Edinburgh

Subg Ribes LSect Berisia Spach (Alpine Currants)

R acuminatum (Hook FampThomson) Jancz Chase 3585 (K) ITS AF426376R alpinum L Arnold Arboretum 678ndash80E ETS AY138021 psbA-trnH AY138094 Chase 3587 (K) ITS AF426378 NPGR 6640

restriction sitesR diacanthum Pallas Arnold Arboretum 1852ndash81B ETS AY138022 psbA-trnH AY138095 ITS AY138047 NPGR 34 (Messinger

315 OSC) restriction sitesR giraldii Janczewski Arnold Arboretum 609ndash74B ETS AY138023 psbA-trnH AY138096 M Mort sn (WS) ITS AF426381R glaciale Wall UCBG 910285 ETS AY138024 psbA-trnH AY138097 ITS AY138048R komarovii Pojark UCBG 91078 ETS (1) AY138025 Arnold Arboretum 1094ndash82A ETS (2) AY138026 psbA-trnH AY138098R maximowiczii Batalin T S Elias 10940 (RSA) ITS AF426380 NPGR 267 restriction sitesR orientale Desf Boufford et al 28317 (A) ETS AY138027 psbA-trnH AY138099R tenue Janczewski Boufford et al 27604 (A) ETS AY138028 psbA-trnH AY138100 Chase 3610 (K) ITS AF426377R vilmorini Janczewski Chase 3612 (K) ITS AF426379

Sect Calobotrya (Spach) Jancz (Ornamental Currants)R afne HBK M Medina 2517 (NY) ITS AF426326R brandegeei Eastwood sc 350568 (WS) ITS AF426331R cereum Douglas UCBG 931213 ETS AY138013 psbA-trnH AY138087 NPGR 237001 restriction sites Ross 3425 (NY) ITS

AF426328R ceriferum Coville and Rose sc 05017194 (MO) ITS AF426333R ciliatum H and B Diggs 2625 (NY) ITS AF426327 NPGR 670001 (Messinger 311 OSC) restriction sitesR dugesii Greenman Siplivinsky 3939 (WS) ITS AF426329R glutinosum Benth Chase 3594 (K) ITS AF426340R indecorum Eastwood UCBG 860903 ETS AY138014 psbA-trnH AY138088 Mort 1370 (WS) ITS AF426336R malvaceum Smith UCBG 911481 ETS AY138015 psbA-trnH AY138089 Johnson sn (WS) ITS AF426338R mogollonicum Greene NPGR 294001 ITS AF426332 restriction sitesR neglectum Rose Villarrea 4940 (NY) ITS AF426330R nevadense Kellogg UCBG 891635 ETS AY138016 psbA-trnH AY138090 Mort 1373 (WS) ITS AF426339R sanguineum Pursh UCBG 900193 ETS AY138017 psbA-trnH AY138091 Mort 1372 (WS) ITS AF426335 NPGR 46 restriction

sitesR tortuosum Benth Breedlove 62230 (MO) ITS AF426325R viscosissimum Pursh Grimes 1878 (NY) ITS AF426334 NPGR 281001 (Fredricks 394 OSC) restriction sitesR woli Rothrock Siplivinsky 4587 (NY) ITS AF426341

Sect Coreosma (Spach) Jancz (Black Currants)R americanum Mill NPGR 93 restriction sites Nee 24196 (NY) ITS AF426375R bracteosum Douglas UCBG 891645 ETS AY138033 psbA-trnH AY138103 ITS AY138049R fragrans Pallas sc 4378976 (MO) ITS AF426373R hudsonianum Richardson B Ertter 3807 (NY) ITS AF426372

var petiolare (Douglas) Jancz NPGR 278 (Fredricks 390 OSC) restriction sitesR janczewskii Pojark Chase 3597 (K) ITS AF426370R nigrum L NPGR 215001 (OSC) ITS AF426374R viburnifolium A Gray UCBG 651431 ETS AY138034 NPGR 762001 ITS AF426371 restriction sites

Sect Grossularioides (Jancz) Rehd (Spiny or Gooseberry-stemmed Currants)R lacustre (Pers) Poiret Lesica 4710 (NY) ETS (1) AY138018 ITS AF426366 Arnold Arboretum 777ndash93A ETS (2) AY138019

psbA-trnH AY138092 NPGR 45 restriction sitesR montigenum McClatchie Bugham amp Miller sn (WS) ETS AY138020 psbA-trnH AY138093 ITS AF426367 NPGR 864001

(Messinger 254 OSC) restriction sitesSect Heritiera Jancz (Dwarf Currants)

R erythrocarpum Coville and Leiberg NPGR 860001 (Messinger 249 OSC) ITS AF426342 restriction sitesR howellii Greene NPGR 449001 (Messinger 333 OSC) ITS AF426343 restriction sitesR glandulosum Grauer UCBG 890750 ETS (1) AY138035 Schultheis 589ndash00 (YU) ETS (2) AY138036 psbA-trnH AY138105

NPGR 231 restriction sites Chase 3605 (K) ( 5 R prostratum LrsquoHer) ITS AF426345R laxiorum Pursh NPGR 439 restriction sites Goodrich 19052 (WS) ITS AF426344

Sect Parilla Jancz (Andine Currants)R andicola Jancz Friere-Fierro 2577 (NY) ITS AF426368R fasciculatum Sieb amp Zucc UCBG 880615 ETS (1) AY138043 psbA-trnH AY138104 Arnold Arboretum 1879 ETS (2)

AY138044 Chase 3592 (K) ITS AF426346R ovalifolium Jancz Gentry sn (MO) ITS AF426369R valdivianum Phil Messinger 314 (OSC) restriction sites

Sect Ribes L (Red Currants)

2004] 81SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

TABLE 1 Continued

R himalense Decaisne Boufford et al 28903 (A) ETS AY138037 psbA-trnH AY138106 sc 04714258 (MO) ITS AF426369R manshuricum Komarow Arnold Arboretum 67ndash7 ETS AY138038 psbA-trnH AY138107 Chase 3599 (K) ITS AF426320R petraeum Wulfen Chase 3604 (K) ITS AF426318R rubrum L Arnold Arboretum 1119ndash78A ETS (1) AY138039 psbA-trnH AY138108 Arnold Arboretum 214ndash96 ETS (2)

AY138040 Schuhwerk 7039 (NY) ITS AF426321R sativum (Rehbeh) Syme Missouri Botanical Garden ITS AF426323

cv rsquoDiplomarsquo NPGR 747 (Thompson 46 OSC) restriction sitesR spicatum Robs Chase 3609 (K) ITS AF426322R triste Pallas UCBG 941114 ETS (1) AY138041 Arnold Arboretum 407ndash94 ETS (2) AY138042 psbA-trnH AY138109 Mes-

singer 314 (OSC) restriction sites Baldwin 2269 (WS) ITS AF426319Sect Symphocalyx Berland (Golden Currants)

R aureum Pursh UCBG 560948 ETS (1) AY138030 Arnold Arboretum 460ndash81A ETS (2) AY138029 psbA-trnH AY138101NPGR 769 restriction sites Clement 26 (WS) ITS AF426382

R odoratum Wendl UCBG 860126 ETS (1) AY138032 Arnold Arboretum 1192ndash74A ETS (2) AY138031 psbA-trnH AY138102NPGR 691 restriction sites

Subg Grossularia (Mill) PersSect Grossularia (Mill) Nutt

R aciculare Sm AK Skvortsov sn (A) ETS AY137976 psbA-trnH AY138060 ITS AY138050R alpestre Wall ex Decne Boufford et al 28437 (A) ETS AY137975 psbA-trnH AY138059 Chase 3586 (K) ITS AF426349R burejense F Schmidt NPGR 259001 ETS AY137977 psbA-trnH AY138061 restriction sites Messinger 260 (OSC) ITS

AF426355R curvatum JK Small R Kral 53094 (GH) ETS AY137979R cynosbati L Arnold Arboretum 1108ndash78A ETS (1) AY137981 psbA-trnH AY138063 ITS AY138051 Schultheis 590ndash00 (YU)

ETS (2) AY137980R divaricatum Douglas UCBG 851596 ETS (1) AY137982 psbA-trnH AY138064 Chase 3591 (K) ETS (2) AY137983 ITS

AF426347R echinellum (Coville) Rehd Arnold Arboretum 234ndash96 ETS AY137984 psbA-trnH AY138065 ITS AY138052R formosanum Hayata Wang 1096 (MO) ETS (1) AY137985 ITS AF426354 RBGE 19934301 ETS (2) AY137986 psbA-trnH

AY138066R grossularioides Maxim RBGE 19592035 ETS AY137987 psbA-trnH AY138067 ITS AY138053R hirtellum Michx UCBG 860125 ETS (1) AY137988 Schultheis 588ndash00 (YU) ETS (2) AY137989 psbA-trnH AY138068 Chase

3595 (K) ITS AF426353R inerme Rydb Layser 1770 (UW) ETS (1) AY137990 ITS AF426356 Arnold Arboretum 225ndash80A ETS (2) AY137991 psbA-

trnH AY138069R missouriense Nutt WR Smith 11396 (GH) ETS AY137993 psbA-trnH AY138071 Solomon 859 (WS) ITS AF426348R niveum Lindl Messinger 226 (OSC) ETS AY137994 psbA-trnH AY138072 ITS AF426351 NPGR 777001 (Messinger 226

OSC) restriction sitesR oxyacanthoides L

subsp oxyacanthoides NPGR 139001 ETS (1) AY137996 Alverson 1645 (WIS) ETS (2) AY137995 psbA-trnH AY138073Peterson amp Annable 4440 (WS) ITS AF426383

subsp cognatum (Greene) Sinnott Woodland sn (WS) ETS AY137978 psbA-trnH AY138062 ITS AF426357subsp irriguum (Douglas) Sinnott RBGE 19794064 ETS AY137992 psbA-trnH AY138070 ITS AY138054 NPGR 773001

(Messinger 221 OSC) restriction sitessubsp setosum (Lindl) Sinnott Arnold Arboretum 1395ndash83A ETS AY137998 psbA-trnH AY138075 Lackschewitz 7845 (UW)

ITS AF426352R rotundifolium Michx Mitchell amp Barbour 10112 (NYS) ETS AY137997 psbA-trnH AY138074 ITS AY138055R stenocarpum Maxim RBGE 19698970 ETS AY137999 psbA-trnH AY138076 ITS AY138056R uva-crispa L UCBG 870719 ETS (1) AY138001 Arnold Arboretum 1404ndash80B ETS (2) AY138000 psbA-trnH AY138077

Hill 20953 (NY) ( 5 R grossularia L) ITS AF426350Subg Hesperia A BergerR amarum McClatchie UCBG 891081 ETS AY138002 psbA-trnH AY138078R californicum Hook and Arn UCBG 821692 ETS AY138004 psbA-trnH AY138080 ITS AY138057R menziesii Pursh Messinger 233 (OSC) ETS AY138006 psbA-trnH AY138082 ITS AF426364 NPGR 769001 (Messinger 233

OSC) restriction sitesR roezli Regel Nelson sn (WS) ETS AY138007 psbA-trnH AY138083 ITS AF426365

var cruentum (Greene) Regel NPGR 772001 (Messinger 217 OSC) restriction sitesSubg Lobbia A BergerR binominatum AHeller Messinger 260 (OSC) ETS AY138003 psbA-trnH AY138079 ITS AF426359 NPGR 867001 (Messinger

260 OSC) restriction sitesR lobbii A Gray UCBG 851496 ETS AY138005 psbA-trnH AY138081 Smith Jr 7443 (WS) ITS AF426361R velutinum Greene Annable 2503 (NY) ETS AY138011 psbA-trnH AY138085 ITS AF426358 NPGR 865 (Messinger 2551

OSC) restriction sitesR watsonianum Koehne Patrick sn (UW) ETS AY138012 psbA-trnH AY138086 ITS AF426360

Sect Robsonia BerlandR speciosum Pursh UCBG 840004 ETS (1) AY138008 psbA-trnH AY138084 Mort 1371 WS ETS (2) AY138009 ITS AF426362

NPGR 901001 restriction sitesR thacherianum Johnson sn (WS) ETS AY138010 ITS AF426363

82 [Volume 29SYSTEMATIC BOTANY

TABLE 1 Continued

OutgroupsItea virginica L New York Botanic Garden 7698C ETS AY138045 psbA-trnH AY138110 Messinger 337 (OSC) restriction sites

Ware 94 (WS) ITS AY231368I ilicifolia Oliver UCBG 860414 ETS AY138046 psbA-trnH AY138111 ITS AY138058

from Senters and Soltis 2003) It is possible that incongruence be-tween ETS and ITS datasets was due to intraspecic variation anas yet unexplored issue within Ribes that may limit future use ofcomposite accessions The presence of ETS and ITS regions on thesame transcript similar GC contents (ETS5 mean 049 ITS5mean058) similar proportions of invariant characters (ETS5 297462ITS5438700) and similar levels of rate heterogeneity across sites(ETS gamma 5 065 ITS gamma5 057) argued against differentevolutionary processes of sequence evolution as an explanation forincongruence

In order to maximize taxon sampling and data tests were alsoused to assess combinability of taxa represented in three of thefour available datasets While this required the inclusion of taxafor which one dataset was coded as missing the decrease in phy-logenetic accuracy was expected to be insignicant (Weins andReeder 1995)

Phylogenetic Analysis of Sequence Data Analyses of single(ITS ETS and psbA-trnH) and combined datasets were performedusing a parsimony criterion in PAUP 40 All sites and all changeswere equally weighted in contrast to the 13 gains10 loss weight-ing scheme used by Messinger et al (1999) in their analyses ofrestriction site data psbA-trnH data were analyzed both with in-dels treated as missing data and with seven large indels includedas binary characters Positions 309ndash327 and 448ndash465 of the alignedpsbA-trnH dataset were excluded from all analyses due to ambig-uous alignments

Analyses of the ITS ETS and psbA-trnH datasets consisted ofheuristic searches with 100 replicates of random addition and TBRbranch swapping No more than 400 trees greater than a speciedlength (234 for ETS 556 for ITS 137 for psbA-trnH) were savedper replicate or in the case of psbA-trnH with indels no more than250 trees greater than length 144 The limiting tree length wasdetermined based on the shortest trees found in prior incompletesearches and was imposed to prevent computational overloadsearching sub-optimal trees Analyses of all datasets combined orof combined chloroplast datasets were conducted with the branch-and-bound algorithm with taxa excluded based on partition ho-mogeneity test results For datasets combining ETS1ITSETS1psbA-trnH psbA-trnH1rDNA or all data for those taxa rep-resented in three of the four datasets analyses consisted of heu-ristic searches with 100 replicates of random addition TBR branchswapping and maxtrees set to 40000

Clade support was assessed using bootstrap analyses (Felsen-stein 1985) as implemented in PAUP 40 with 300 replicates ofheuristic searches each with 5 replicates of random taxon additionand Nearest Neighbor Interchange (NNI) branch swapping Forthe combination of all four datasets and for the combined chlo-roplast datasets clade support was assessed using 100 bootstrapreplicates each with branch and bound searches

Kishino-Hasegawa Tests The parsimony implementation of theKishino-Hasegawa test (Kishino and Hasegawa 1989) in PAUP 40was used to compare the hypothesis of subg Grossularia monophylyto that of subg Grossularia non-monophyly in which sect Grossu-larioides and sect Grossularia form a clade The parsimony version ofthe test was used because comparisons included restriction site dataAs recommended by Goldman et al (2000) comparisons were be-tween a priori hypotheses based on previously published phyloge-nies (Messinger et al 1999 Senters and Soltis 2003)

Analyses were run enforcing each of two constraint trees Therst constraint tree resolved subg Grossularia as monophyletic butleft relationships within subg Grossularia and among all remain-ing species unresolved The second constraint tree enforced res-olution of a clade containing sect Grossularioides plus sect Gros-

sularia but relationships within this clade were left unresolved aswere relationships among all remaining species Comparisonswere between trees from constrained branch and bound searchesfor the chloroplast data and from constrained heuristic searchesfor the rDNA data

Ancestral Area Reconstruction Ancestral areas were inferredusing DIVA which assigns areas to internal nodes such that dis-persal and extinction events are minimized (Ronquist 1996 1997)Default costs were used (vicariance 5 0 dispersal 5 1 extinction51) and the number of inferred areas per node was left uncon-strained These analyses used trees from the combined psbA-trnHand rDNA datasets (Fig 8) with species assigned to one or moreof four areas (eastern North America western North Americaeastern Eurasia and western Eurasia) Geographic distributionsfollowed Berger (1924) Janczewski (1907) and Sinnott (1985) SectCalobotrya R aureum R bracteosum R watsonianum and the cladecontaining the remaining glabrous-styled gooseberries (HesperiaLobbia Robsonia) were all coded with western North American dis-tributions Sect Grossularioides was coded for both North Americaand eastern Eurasia Subg Berisia was coded for both eastern andwestern Eurasia Ribes triste was coded for all areas except westernEurasia Itea was coded for both eastern North America and east-ern Eurasia

Because DIVA analyses do not permit polytomies we treated Raureum and R bracteosum as sister taxa Within sect Grossulariamembers of the Asian gooseberry clade were all coded as easternEurasia The remaining species of the large polytomy all live inwestern or eastern North America We resolved this polytomy inseveral different ways so as to explore some of the possibilitiesFor example in some analyses we created one eastern NorthAmerican and one western North American clade In others theNorth American species were arranged pectinately in relation tothe Asian clade

RESULTS

Sequence Characteristics and Analyses The aligned18ndash26S rDNA ITS dataset including 58S(positions 283ndash452) was 700 bp (282bp5ITS1 248bp5ITS2) with 28of the data matrix coded as missing data For the regionas a whole sequences ranged from 438ndash662bp (varia-tion due in part to missing terminal sequence data)uncorrected pairwise distances within Ribes rangedfrom 00ndash008 distances with Itea ranged from 027(with R missouriense) to 032 (with R malvaceum) andmean GC content was 058 Of the 700 aligned base-pairs 528 were constant within Ribes and 183 wereparsimony informative ITS1 displayed higher levels ofdivergence and a higher proportion of informativecharacters than did ITS2 (ITS1 5 00ndash015 65282 in-formative ITS2 5 00ndash011 25248 informative) In-cluded ITS1 sequences ranged from 34ndash258bpwith thelower limit due to taxa for which much of ITS1 se-quence data was missing ITS2 sequences ranged from216ndash241bp 58S ranged from 161ndash164bp but was only142bp in R sanguineum due to a large deletion

2004] 83SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

Lengths and GC contents fell within the ranges re-ported for a survey of angiosperm taxa (Baldwin et al1995) Analyses of the ITS and 58S regions generated36400 trees (length5556 CI5065 058 excluding un-informative characters RI5084)

Amplied products from the 18ndash26S rDNA inter-genic spacer region were approximately 2kb in R odor-atum (sect Symphocalyx) and 3kb in R hirtellum (sectGrossularia) the two species used to design internalprimers for amplifying 39 ETS Only 406bp of the 39end of the ETS region and 56bp of the 59 end of 18Swere sequenced in this study Included sequencesranged from 299ndash462bp in size with some variationdue to missing terminal sequence data and had amean GC content of 049 Uncorrected pairwise dis-tances among ETS sequences within Ribes ranged from00 to 007 Pairwise distances between Ribes and Itearanged from 026 (with R oxyacanthoides accession 2)to 032 (with R triste accession 1) Of the 462 alignedbasepairs 388 were constant within Ribes 60 were par-simony informative and 2 were coded as missingdata ETS analyses generated 34005 trees (length5234CI5080 074 excluding uninformative charactersRI5093 Fig 2)

The aligned psbA-trnH intergenic spacer dataset was502bp including a 39 portion of psbA (positions 1ndash37)and a 59 portion of trnH (position 484ndash502) One per-cent of the matrix was coded as missing data Includedsequences ranged from 355ndash445bp in length withsome variation due to missing terminal sequence dataand had a mean GC content of 029 The spacer regionalone ranged from 352ndash378bp within Ribes and was369bp in Itea based on complete sequences Uncor-rected pairwise distances (including psbA and trnHterminals) within Ribes ranged from 00 to 004 Dis-tances between Ribes and Itea ranged from 015 (withR odoratum accession 2) to 021 (with R bracteosum)Within Ribes 405465 included characters were con-stant and 34465 were parsimony informative Ex-cluded characters represented a polyA region rangingfrom 4ndash13bp and a 16ndash18bp insertion in Itea (relativeto Ribes) with which 5ndash6bp segments of Ribes could bealigned in various ways Analyses of sequence datafrom the psbA-trnH intergenic spacer produced 34000trees with little homoplasy (length5137 CI5092 088excluding uninformative characters RI5094 Fig 3)Analyses including indels coded as binary charactersproduced 18001 trees (length5144 CI5092 090 ex-cluding uninformative characters RI5095)

Trees Generated by Analyses of IndividualDatasets Results from the expanded ITS datasetconcur with those presented by Senters and Soltis(2003) and are not illustrated here Subg Grossulariawas resolved as monophyletic in ITS and ETS treeswith weak to moderate bootstrap support (Figs 1 2)psbA-trnH trees showed little resolution but did not

conict with a monophyletic subg Grossularia (Fig 3trees from analyses including indels are not shown)

Two main lineages may be identied within subgGrossularia the true gooseberries (sect Grossularia) andthe glabrous-styled gooseberries (Hesperia Lobbia Rob-sonia) The glabrous-styled gooseberries are resolved asa clade in ITS restriction site and psbA-trnH trees(Figs 1 3 Messinger et al 1999) ETS trees also resolvethe glabrous-styled gooseberries (Hesperia Lobbia Rob-sonia) as a clade with the exception of R watsonianum(subg Lobbia) placed with strong support in the truegooseberry clade (sect Grossularia) (Fig 2) The integ-rity of the individual sections comprising the glabrous-styled gooseberries (Hesperia Lobbia Robsonia) is un-clear The true gooseberries (sect Grossularia) are re-solved as a clade in restriction site ITS and ETS trees(including R watsonianum in the latter) and in psbA-trnH trees when indels are included (Figs 1 2 Mes-singer et al 1999 Senters and Soltis 2003) If indels areignored psbA-trnH trees resolve the majority of truegooseberries as a clade and are consistent with amonophyletic sect Grossularia (Fig 3) Within sectGrossularia the ETS dataset provided strong supportfor an Asian clade including the European R uvacris-pa ITS trees were consistent with an Asian clade butexcluded R uvacrispa psbA-trnH trees were also con-sistent with an Asian clade with the weakly support-ed inclusion of the North American R oxyacanthoidessubsp irriguum Restriction site trees had limited sam-pling in sect Grossularia but were consistent with anAsian versus North American divergence (Messingeret al 1999)

All datasets except the restriction sites resolved aclade comprising sect Calobotrya sect Grossularioidesand subg Grossularia (sect Grossularia sect Robsoniasubg Lobbia Hesperia) Members of this clade are large-ly from western North America with sect Grossulariahaving a wider distribution ETS trees included theblack currant Ribes bracteosum (sect Coreosma) withinthis clade in an unresolved position (Fig 2) ITS treesincluded the South American sect Parilla in this cladein an unresolved position (Senters and Soltis 2003) Inall trees sect Calobotrya was resolved as monophyleticincluding some members of sect Heritiera in restrictionsite and ITS trees (only one species of sect Heritierawas included in ETS and psbA-trnH analyses and fallselsewhere) Section Grossularioides was resolved withstrong support in ETS and ITS trees (Figs 1 2 Sentersand Soltis 2003) but is unresolved or strongly para-phyletic in the psbA-trnH and restriction site trees re-spectively (Figs 1 3 Messinger et al 1999)

The clade containing sects Calobotrya Grossularioidesand subg Grossularia was clearly nested within Ribesin ITS ETS and psbA-trnH trees (Figs 2 3 Senters andSoltis 2003) Among the remaining sections of Ribesall datasets provided strong support for sect Berisia

84 [Volume 29SYSTEMATIC BOTANY

FIG 2 The majority-rule consensus of 34005 trees resulting from analyses of ETS sequence data (CI5080 074 excludinguninformative characters RI5093) Numbers above the branches indicate the percentage of bootstrap replicates in which theclade appeared Numbers in parentheses below the branches indicate the percentage of trees in which the clade appearedwhen less than 100

2004] 85SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 3 The majority-rule consensus of 34000 trees resulting from analyses of psbA-trnH sequence data (CI5092 088excluding uninformative characters RI5094) Numbers above the branches indicate the percentage of bootstrap replicates inwhich the clade appeared Numbers in parentheses below the branches indicate the percentage of trees in which the cladeappeared when less than 100

86 [Volume 29SYSTEMATIC BOTANY

FIG 4 The strict consensus of six trees resulting fromanalyses of psbA-trnH sequence data combined with chloro-plast restriction site data (Messinger et al 1999) (CI5090 079excluding uninformative characters RI5087) Data combina-bility determined by partition homogeneity tests (p5066)Numbers above the branches indicate the percentage of boot-strap replicates in which the clade appeared

with the inclusion of some species of sect Ribes in ITStrees (Senters and Soltis 2003) Section Symphocalyxwasstrongly resolved in ETS and restriction site trees (Fig2 Messinger et al 1999) but was unresolved in psbA-trnH trees (Fig 3) (ITS trees included only one species)Section Heritiera appeared to be polyphyletic in ITSand restriction site trees (only one species of sect Her-itiera is included in ETS or psbA-trnH analyses) (Mes-singer et al 1999 Senters and Soltis 2003) The mono-phyly of sects Ribes and Coreosma remain unclear Forthose species sampled sect Ribes was resolved asmonophyletic in restriction site trees (Messinger et al1999) as monophyletic excluding R triste in ETS andpsbA-trnH trees (Figs 2 3) and as polyphyletic in ITStrees with some species clearly related to sect Berisia(Senters and Soltis 2003) Section Coreosma was re-solved as polyphyletic in ETS and restriction site trees(Fig 2 Messinger et al 1999) and as para- or poly-phyletic in ITS trees (Senters and Soltis 2003) (only onespecies was included in the psbA-trnH dataset) Previ-ous restriction site analyses of 18ndash26S rDNA suggestedthat members of sect Coreosma were divergent fromone another and from other Ribes species (Messingeret al 1993) Sampling from sect Parilla was too limitedto draw strong conclusions but the ITS trees support-ed its monophyly to the exclusion of R fasciculatumthe only non-South American member of the section(Senters and Soltis 2003) Relationships among the sec-tions outside of the predominantly western NorthAmerican clade (sects Calobotrya Grossularioides subgGrossularia) varied markedly among datasets with lit-tle support for any one resolution (Figs 2 3)

Trees Generated from Analyses of CombinedDatasets Dataset combinability is typically based ona critical value of p 5 005 (ie datasets are incongru-ent when p 005) However studies suggest that acritical value of p 5 005 may be too strict such thatthe null hypothesis of dataset congruence will be false-ly rejected (Huelsenbeck et al 1996 Sullivan 1996Cunningham 1997) and that a value such as p 5 001may be more appropriate (Cunningham 1997) Manyof the datasets reported here were not combinablebased on intitial partition homogeneity tests but theincongruence was generally eliminated when problem-atic taxa were excluded

Analyses of the readily combinable chloroplast psbA-trnH and restriction site data (p5066) generated sixtrees (length 144 CI5090 079 excluding uninforma-tive characters RI5087) In agreement with analysesof restriction site data alone true gooseberries (sectGrossularia) were not placed as sister to the remainingglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) suggesting that subg Grossularia is not monophy-letic (Figs 1 4) The true gooseberries were nested ina paraphyletic sect Grossularioides as in the restrictionsite trees with sect Calobotrya weakly placed as sister

Support for sect Grossularia sect Calobotrya and theglabrous-styled gooseberries (Hesperia Lobbia Robsonia)increased relative to analyses of either dataset alone(Fig 3 Messinger et al 1999) Support for a paraphy-letic sect Grossularioides decreased slightly relative tothe restriction site analyses (Fig 4 Messinger et al1999)

Analyses of the combined ETS and ITS rDNA data(p5004 excluded R fasciculatum R glandulosum Rhimalense R manshuricum R nevadense R rubrum Roxyacanthoides subsp oxycanthoides R uvacripsa) gener-ated 150 trees (length 614 CI5077 070 excluding un-informative characters RI5085) (Fig 5) Subg Gros-sularia was monophyletic as were the true gooseber-ries (sect Grossularia) (Fig 5) The glabrous-styledgooseberries (Hesperia Lobbia Robsonia) were stronglyresolved as monophyletic with the exception of R wat-sonianum (sect Lobbia) placed strongly as sister to thetrue gooseberries Within sect Grossularia only theAsian clade was resolved with strong support Theclade containing subg Grossularia sect Grossularioi-dies and sect Calobotrya was again evident with sectGrossularioides resolved as sister to subg GrossulariaSupport for the glabrous-styled gooseberries (HesperiaLobbia Robsonia) sect Calobotrya sect Grossularioidesand the Asian clade within sect Grossularia increasedrelative to support from ETS or ITS datasets analyzedindividually (Figs 2 5 Senters and Soltis 2003)

The most evident difference between chloroplast and

2004] 87SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 5 The strict consensus of 150 trees resulting from analyses of combined ETS and ITS sequence data (CI5077 070excluding uninformative characters RI5085) Data combinability determined by partition homogeneity tests (p5004) Num-bers above the branches indicate the percentage of bootstrap replicates in which the clade appeared

88 [Volume 29SYSTEMATIC BOTANY

FIG 6 The strict consensus of four trees resulting from analyses of the four datasets combined (ETS ITS psbA-trnHchloroplast restriction sites) Data combinability was determined by partition homogeneity tests (p5075) Numbers above thebranches indicate the percentage of bootstrap replicates in which the clade appeared

rDNA trees was the position of sect GrossularioidesSubgenus Grossularia is monophyletic in rDNA treeswith sect Grossularioides placed weakly as sister (Fig5) In contrast subg Grossularia is polyphyletic in chlo-roplast trees with sect Grossularia nested within sectGrossulariodes and sect Calobotrya sister to that group-ing (Fig 4) Analyses of the combined chloroplast andrDNA datasets (p5075 excluded R glandulosum Rlacustre R montigenum) generated four trees (length556 CI5088 069 excluding uninformative charactersRI5076) (Fig 6) Taxon sampling was limited due tothe limited overlap among datasets but trees showedstrong resolution of sect Calobotrya sect Grossulariaand the glabrous-styled gooseberries (Hesperia Lobbia

Robsonia) These groups again formed a well-support-ed clade nested within Ribes (Fig 6) The strongly sup-ported sister-group relationship between the true andglabrous-styled gooseberries (Fig 6) is consistent withthe monophyly of subg Grossularia but could changewith the inclusion of sect Grossularioides

ETS and psbA-trnH combined analyses (p5004 ex-cluded R oxyacanthoides subsp irriguum) generated 329trees (length 372 CI5084 077 excluding uninforma-tive characters RI5090) (Fig 7) Subgenus Grossulariawas resolved as monophyletic within which both theglabrous-styled and the true gooseberries were strong-ly supported the latter including R watsonianum(subg Lobbia) The Asian clade was well supported

2004] 89SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 7 The strict consensus of 329 trees resulting from analyses of combined ETS and psbA-trnH data (CI5084 077excluding uninformative characters RI5091) Dataset combinability was determined by partition-homogeneity tests (p5 004)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared

within sect Grossularia including the European R uva-crispa Both sect Calobotrya and sect Grossularioideswere strongly supported but neither was resolved assister to subg Grossularia The clade comprising subgGrossularia sect Grossularioides and sect Calobotryawas again evident nested within Ribes

Combined analyses of psbA-trnH and rDNA datasets(p5002 excluded R oxyacanthoides subsp irriguum andtaxa excluded from ETS1ITS analysis) generated 3080trees (length 5 719 CI5080 074 excluding uninfor-mative characters RI5085) Sects Grossularioides Calo-botrya Grossularia and the glabrous-styled gooseberries

90 [Volume 29SYSTEMATIC BOTANY

(Hesperia Lobbia Robsonia) were each strongly support-ed and again formed a strongly supported clade nestedin Ribes (Fig 8) Support for the monophyly of subgGrossularia was increased relative to support seen withany individual dataset (Figs 2 3 8)

Combinability (p5012) of all datasets for those taxarepresented in three of the four datasets required ex-clusion of composite taxa problematic within therDNA dataset as well as exclusion of taxa problematicfor the chloroplast versus rDNA datasets Combinedanalyses generated 4802 trees (length5768 CI5080074 excluding uninformative characters RI5085)Sec-tion Calobotrya sect Grossularia and the glabrous-styled gooseberries (Hesperia Lobbia Robsonia) exclud-ing R watsonianum were each well supported and to-gether formed a strongly supported clade (Fig 9) Sub-genus Grossularia was resolved as monophyleticbearing in mind that sect Grossularioides was excludedfrom the analyses

While all combined datasets resolved the clade con-taining sects Calobotrya Grossularioides and subgGrossularia as nested within Ribes (Figs 4ndash9) relation-ships among other lineages were unclear as in theanalyses of individual datasets (Figs 2 3) Basal rela-tionships were unresolved in the analyses of combinedchloroplast data (Fig 4) The combined ETS and psbA-trnH analyses suggested basal positions for goldencurrants (sect Symphocalyx) (Fig 7) All remaininganalyses suggested basal positions for sects Berisiaand Ribes (Figs 5 6 8 9) Basal relationships were notwell-supported in any analysis

Kishino-Hasegawa Tests Trees generated fromanalyses constraining the monophyly of subg Gros-sularia versus trees constrained to resolve a sister re-lationship between sect Grossularioides and sect Gros-sularia were marginally but signicantly different inboth the chloroplast (p5003) and the rDNA (p5005)datasets

Ancestral Area Reconstructions DIVA reconstruc-tions of ancestral areas support a western North Amer-ican origin for a large segment of Ribes beginningwith node 2 in Fig 8 Within this clade it is also thecase that subg Grossularia is inferred to have diversi-ed rst within western North America (Fig 8 node6) Subsequent movement to eastern Asia is inferred tohave occurred somewhere within sect Grossularia butthe ancestral area for the true gooseberries is equivo-cal and can include virtually any combination of areasdepending on the exact resolution of the large poly-tomy at the base of this clade (Fig 8 node 8) Impor-tantly our results indicate that the Asian species with-in sect Grossularia form a clade implying a single mi-gration from North America to Asia The ancestralarea for Ribes is reconstructed to be western NorthAmerica and western Eurasia or western North Amer-ica and all of Eurasia (Fig 8 node 1) However this

result hinges on resolution at the base which remainshighly uncertain and requires more intensive samplingof Ribes lineages outside of subg Grossularia

DISCUSSION

Gooseberry Monophyly Results from previousphylogenetic analyses based on nuclear 18Sndash26S rDNAITS data (Senters and Soltis 2003) and chloroplast re-striction site data (Messinger et al 1999) differed re-garding gooseberry monophyly Adding the additionalnuclear 18Sndash26S rDNA ETS and chloroplast psbA-trnHdatasets could increase support and resolution in re-sulting topologies or could reinforce the differencesbetween the nuclear and chloroplast topologies witheach reecting accurate but separate histories

Initial examination of the trees produced with theadditional datasets reinforced the apparent conict be-tween nuclear and chloroplast genomes ITS ETS andcombined rDNA datasets supported the monophyly ofsubg Grossularia (Figs 1 2 5) In contrast the com-bined chloroplast datasets (restriction sites plus psbA-trnH) suggested a closer relationship between the trueand glabrous-styled gooseberries than did the restric-tion site data alone (Fig 1 Messinger et al 1999) butstill resolved subg Grossularia as non-monophyleticwith sect Grossularioidies forming a grade at the baseof sect Grossularia (Fig 4) The increase in tree lengthwhen combined chloroplast data was constrained toresolve a monophyletic subg Grossularia (p5003) orwhen combined rDNA data was constrained to resolvesects Grossularioides and Grossularia as a clade(p5005) also indicated dataset incongruence

The discrepancy between nuclear and chloroplast to-pologies primarily involved the restriction sites datasetand not the psbA-trnH dataset The psbA-trnH datasetprovided little resolution (Fig 3) conicting with nei-ther the rDNA nor the restriction sites topologiesAnalyses combining the psbA-trnH data with either theETS data (p5004 Fig 7) or the rDNA data (p5002Fig 8) produced trees resolving subg Grossularia asmonophyletic with increased support relative to ETSor rDNA data alone (Figs 2 5) Section Grossularioideswas either sister to subg Grossularia (psbA-trnH 1rDNA Fig 8) or was unresolved in a polytomy withsubg Grossularia and sect Calobotrya (psbA-trnH 1ETS Fig 7) The monophyly of subg Grossularia wasalso supported by analyses of all datasets combinedwhether including taxa represented in all four datasets(p5075 Fig 6) or in three of the four datasets(p5012 Fig 9) Analyses combining all datasets re-quired exclusion of sect Grossularioides thus leavingsubg Grossularia monophyly uncertain However in-cluding sect Grossulariodes in spite of dataset incon-gruence (p5001) produced trees resolving a mono-phyletic subg Grossularia sister to a monophyletic sectGrossularioides (not shown)

2004] 91SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 8 The strict consensus of 3080 trees resulting from analyses of combined psbA-trnH and rDNA data (CI 5 080 074excluding uninformative characters RI 5 085) Dataset combinability was determined by partition homogeneity tests (p5002)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared DIVA (Ronquist 1996)was used to infer ancestral areas at the numbered nodes The ancestral areas at nodes two through seven were reconstructedas western North America Node one was reconstructed as western North America plus either western Eurasia or all of EurasiaThere were multiple possible reconstructions at node 8 including (1) western North America and eastern Eurasia (2) NorthAmerica and eastern Eurasia (3) North America or (4) western North America

92 [Volume 29SYSTEMATIC BOTANY

FIG 9 The strict consensus of 4802 trees resulting from analyses of all four datasets (ITS ETS psbA-trnH chloroplastrestriction sites) including taxa represented in at least three datasets (CI5080 074 excluding uninformative charactersRI5085) Dataset combinability was determined using partition homogeneity tests (p5012) Numbers above the branchesindicate the percentage of bootstrap replicates in which the clade appeared

2004] 93SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

The general picture that emerges from these analy-ses suggests that subg Grossularia is monophyletic(Figs 2 5ndash9) rDNA data supported gooseberry mono-phyly (Figs 2 5) psbA-trnH data while lacking suf-cient variation to resolve gooseberry monophyly ornon-monophyly supported gooseberry monophyly incombination with rDNA data (Figs 7 8) Finally anal-yses of all datasets combined supported gooseberrymonophyly although these analyses excluded thespiny currants (sect Grossularioides) (Figs 6 9) Whatrequires further investigation is the role hybridizationmay have played in the history of the spiny currants(sect Grossularioides) and the true gooseberries (sectGrossularia) Messinger et al (1999) encouraged furtherexploration of this possibility in Ribes in which theynoted potential chloroplast capture of the sect Gros-sularia chloroplast type by sect Grossularioides Crosseshave not been successful between species of sect Gros-sularioides and other sections within Ribes and are usu-ally unsuccessful between sections or subgenera (Keep1962) Conrmation of the pattern seen in trees gen-erated from the chloroplast restriction site data (Mes-singer et al 1999) is needed from additional chloro-plast datasets that provide greater resolution than didthe psbA-trnH dataset

Relationships Within the Gooseberries SubgenusGrossularia comprises two main lineages (Figs 2 5ndash9)the true gooseberries (sect Grossularia) and a clade ofglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) The four gooseberry sections are traditionally dis-tinguished from each other by basally pubescent stylesin sect Grossularia (with the exception of some Asianspecies) by four versus ve parted owers in sect Rob-sonia by anthers broader at the base in subg Hesperiaand by the absence of the above set of features in subgLobbia The glabrous-styled gooseberry lineage com-prising 27 species distributed through western NorthAmerica into Mexico (Berger 1924) was well-support-ed given our sampling but sections within this lineagewere not resolved Ribes watsonianum (subg Lobbia)was surprisingly placed outside of the glabrous-styledgooseberry lineage as sister to the true gooseberries(Figs 2 5 7ndash9) ITS data resolved R watsonianum with-in the glabrous-styled gooseberry lineage (Senters andSoltis 2003) but ETS data strongly resolved the specieswithin the true gooseberry lineage (sect Grossularia)(Fig 2) This conict within the rDNA data may reecthybridization between R watsonianum and a memberof sect Grossularia followed by xation within the Rwatsonianum genome of a recombinant rDNA repeattype Accounts of Ribes hybrids in the eld are rela-tively rare (Messler et al 1991) and do not implicateR watsonianum but fertile hybrids can be obtainedfrom articial crosses between glabrous-styled goose-berries and true gooseberries (Keep 1962 citing R lob-bii 3 R divaricatum) Alternatively R watsonianum may

posses multiple rDNA repeat types with different re-peat types sampled in our ITS versus ETS datasetsEach of these possibilities has been reported in otherplant taxa (Wendel et al 1995a Campbell et al 1997for potential recombinant rDNA repeat types Suh etal 1993 Wendel et al 1995b for incomplete homoge-nization of rDNA repeat types)

The true gooseberries (sect Grossularia) have a broadrange throughout the northern hemisphere with ninespecies in North America (Sinnott 1985) and seven spe-cies in Eurasia (Berger 1924) In his treatment of NorthAmerican gooseberries Sinnott (1985) divided his ninespecies into ve groups based on phenetic analysesThe groups consisted of (1) R cynosbati with spinyfruits (2) R niveum R curvatum and R missouriensewith highly exserted stamens and long sepals (3) Rrotundifolium and R divaricatum with medium lengthstamens and purple sepals (4) R inerme and R hirtel-lum with intermediate length stamens and small oralfeatures and (5) the ve subspecies of R oxyacanthoi-des with short stamens Sinnott (1985) recommendedthat R echinellum be excluded from the true gooseber-ries and aligned with the glabrous-styled gooseberriesof western North America (Hesperia Lobbia Robsonia)The analyses presented here showed strong supportfor the inclusion of R echinellum as well as the Eurasianspecies within the true gooseberry lineage (Figs 2ndash35 7ndash9) Resolution among the North American specieswas lacking or not well-supported (Figs 2ndash9) and thusneither supported nor conicted with Sinnottrsquos hy-pothesized relationships

The seven Eurasian species of sect Grossularia (Ber-ger 1924) include R uvacrispa in Europe R alpestre andR aciculare in the Himalayan region R stenocarpumand R formosanum in southern and eastern Asia andR burejense and R grossularioides in northern and east-ern Asia A clade of Asian species is well-supported(Figs 2 5 7ndash9) with possible inclusion of R uvacrispa(Figs 2 7) The psbA-trnH dataset includes R oxyacan-thoides subsp irriguum within the Asian clade (Fig 3)but this is weakly supported (Fig 3) and requires fur-ther substantiation particularly since R oxyacanthoidessubsp irriguum is restricted to northwestern NorthAmerica and may itself be of hybrid origin from cross-es between R oxyacanthoides subsp setosum and R in-erme (Sinnott 1985) both distributed in western NorthAmerica Resolution within the clade of Asian speciessuggests a correspondance to geographic and oristicregions within Asia Whether the Asian and NorthAmerican true gooseberries represent divergent line-ages or a monophyletic Asian clade nested within aNorth American grade is unclear given the availabledata

Other Groups within Ribes Since this study fo-cused on the gooseberries sampling within other sec-tions of Ribes was sometimes limited Nevertheless the

94 [Volume 29SYSTEMATIC BOTANY

data did support the monophyly of sects CalobotryaParilla Symphocalyx and Berisia Section Calobotrya is agroup of 21 western North American species (Berger1924) known as the ornamental currants The mono-phyly of sect Calobotrya was well-supported with theinclusion of some dwarf currants (sect Heritieria) (Figs2ndash9 Messinger et al 1999 Senters and Soltis 2003)Sampling was limited in sect Parilla a group of 41dioecious South American species (Janczewski 1907)but the group was supported in ITS trees excludingthe east Asian R fasciculatum the sectionrsquos only non-South American species (Senters and Soltis 2003) Apossible sister relationship between sect Parilla andsect Calobotrya (unpubl data cited in Weigend andBinder 2001) is consistent with the position of sect Pa-rilla seen with ITS data (Senters and Soltis 2003) Sec-tion Symphocalyx the golden currants includes vespecies distributed through northern Mexico and cen-tral and western North America (Berger 1924) Thegolden currants were well-supported given the avail-able sampling (Fig 2 4 9) The alpine currants sectBerisia are a group of 17 dioecious species distributedthrough Eurasia (Janczewski 1907) The monophyly ofsect Berisia was well-supported (Figs 2ndash9 Messingeret al 1999) but with the inclusion of some red currants(sect Ribes) in ITS trees (Senters and Soltis 2003)

The monophyly of sects Ribes and Coreosma wasquestionable (Figs 2 3 5) The red currants (sect Ri-bes) are a group of 15 Eurasian species with one spe-cies R triste also distributed in North America Sec-tion Coreosma the black currants includes six speciesin North America and six in Eurasia (Berger 1924) Sec-tion Heritiera the dwarf currants appeared to be poly-phyletic as seen in Messinger et al (1999) and Sentersand Soltis (2003) This group of six species (Berger1924) is dened primarily by a prostrate habit and assuggested by Messinger et al (1999) is likely a case ofconvergence

Biogeography The spread of taxa around theNorthern Hemisphere has been facilitated by the avail-ability at various times of two major migrationroutesmdashthe Beringian and the North Atlantic landbridges (Tiffney 1985a 1985b Donoghue et al 2001SanmartDaggern et al 2001) Especially in large and relative-ly old clades which have become widespread aroundthe Northern Hemisphere it is possible (perhaps evenlikely) that both pathways were used Information onthe timing of key divergences and on the direction ofmovement within subclades will be critical in sortingout the possibilities in particular cases Ribes providesan excellent example of such a group being represent-ed in Eurasia by six sections (Berisia Ribes and somespecies from Heritiera Coreosma Grossularioides andGrossularia) in western North America by nine (Sym-phocalyx Calobotrya Robsonia Hesperia Lobbia andsome species of Coreosma Heritiera Grossularioides and

Grossularia) and in eastern North America by three(some species of Heritiera Ribes and Grossularia) Oneapproach for sorting through a complex biogeographichistory as might be expected in Ribes is to examinephylogenetic patterns in component clades and ide-ally to date divergences

Our analyses indicate that subg Grossularia is nestedwithin a predominantly western North Americanclade (Figs 2 5ndash9) and that it diversied initially inthat region (Fig 8 node 6) Subsequently within sectGrossularia it appears that movement occurred fromwestern North America to eastern Asia presumablythrough Beringia followed by vicariance and the ori-gin and diversication of the well-supported Asiangooseberry clade Donoghue et al (2001) and Xiangand Soltis (2001) highlighted cases of movement out ofAsia into North America through the Bering LandBridge Ribes appears to provide a case of movementin the opposite direction Movement in both directionsis of course to be expected What remains to be de-termined in future studies of disjunct taxa is exactlywhich groups moved in which directions and whetherthere are any signicant generalizations that can bemade about these different patterns

Elsewhere in Ribes there are other possible cases ofmovement between North America and Asia One caseinvolves R lacustre of sect Grossularioides which is dis-tributed in eastern Asia as well as in North AmericaOther possible cases relate to resolution at the base ofRibes where relationships remain uncertain The basalpositions of sect Symphocalyx in trees resulting frompsbA-trnH data and from the combination of psbA-trnHand ETS data suggest a western North American ori-gin for the entire clade (Figs 2 7) This would implyearly dispersion to Asia giving rise to sects Berisiaand Ribes However all other datasets and dataset com-binations suggested a broader Eurasian plus westernNorth American distribution at the base (Fig 8 node1) owing to the basal positions of sects Berisia andRibes This would imply early vicariance involvingAsia and North America and movement back to Asiawithin the western North American clade Future stud-ies should include more sampling of sects Berisia Ri-bes Coreosma and Symphocalyx to help resolve basal re-lationships and biogeographic patterns in Ribes

The fossil record for Ribes consists largely of leaveswith few reports of seeds (Kremenetski 1998) fruits(Cevallos-Ferriz 1995) and owers (Gandolfo et al1998) The leaf record for Ribes in North America mayextend from approximately 2 mya (Hannibal 1911Dorf 1930 Axelrod 1966) to at least 345 mya (Mac-Ginitie 1953 Manchester 2001) and possibly to 45 or50 mya (Axelrod 1998 Wehr and Hopkins 1994) Al-though leaf features are seldom used to distinguishextant taxa of Ribes Wolfe (1964) used leaf serrationand venation features to distinguish between fossil

2004] 95SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

leaves of subg Ribes and subg Grossularia from Ne-vada If these features are reliable this dates subgGrossularia to at least 14 mya (Fig 9 node 6) A criticalnext step in understanding Ribes biogeography will beto accurately assign Ribes fossils to particular sub-clades so as to infer the timing of intercontinental di-vergences

ACKNOWLEDGEMENTS We thank the following individuals andinstitutions for providing plant material B Alverson D BouffordR Mitchell Arnold Arboretum of Harvard University Universityof California Botanical Garden Royal Botanic Garden EdinburghNew York Botanical Garden and the USDA-ARS National PlantGermplasm Repository A Senters and D Soltis graciously pro-vided numerous DNA aliquots DNA sequences and access to ear-ly manuscripts H Schorn and D Erwin provided assistance withpaleobotanical literature M Lavin P Herendeen and two anon-ymous reviewers provided numerous helpful comments This proj-ect was supported in part by a Putnam Fellowship through theArnold Arboretum of Harvard University

LITERATURE CITED

AVISE J C 1994 Molecular markers natural history and evolutionNew York Chapman amp Hall

AXELROD D I 1966 The Pleistocene Soboba ora of southern Califor-nia University of California Publications in Geological Sci-ences 60

mdashmdashmdash 1998 Thunder Mountain Idaho University of CaliforniaPublications in Geological Sciences 142

BALDWIN B G and S MARKOS 1998 Phylogenetic utility of theexternal transcribed spacer (ETS) of 18Sndash26S rDNA Congru-ence of ETS and ITS trees of Calycadenia (Compositae) Mo-lecular Phylogenetics and Evolution 10 449ndash463

mdashmdashmdash M J SANDERSON J M PORTER M F WOJCIECHOWSKI CS CAMPBELL and M J DONOGHUE 1995 The ITS region ofnuclear ribosomal DNA a valuable source of evidence onangiosperm phylogeny Annals of the Missouri Botanical Garden82 247ndash277

BEARD K H 1998 East of Eden Asia as an important center oftaxonomic origination in mammalian evolution Bulletin of theCarnegie Museum of Natural History 34 5ndash39

BENA G M F JUBIER I OLIVIERI and B LEJEUNE 1998 Ribosom-al external and internal transcribed spacers combined use inthe phylogenetic analysis of Medicago (Leguminosae) Journal ofMolecular Evolution 46 299ndash306

BERGER A 1924 A taxonomic review of currants and gooseberriesNew York Agricultural Experimental Station Technical Bulletin109 1ndash118

BOUFFORD D E and S A SPONGBERG 1983 Eastern Asia-EasternNorth American phytogeographical relationships-a historyfrom the time of Linnaeus to the twentieth century Annalsof the Missouri Botanical Garden 70 423ndash439

CAMPBELL C S M F WOJCIECHOWSKI B G BALDWIN L A AL-ICE and M J DONOGHUE 1997 Persistent nuclear ribosomalDNA sequence polymorphism in the Amelanchier agamiccomplex (Rosaceae) Molecular Biology and Evolution 14 81ndash90

CEVALLOS-FERRIZ S R S 1995 Fruits of Ribes from the Princetonchert British Columbia Canada American Journal of Botany82(6 supplement) 84

COVILLE F V and N L BRITTON 1908 Grossulariaceae NorthAmer-ican Flora 22 193ndash225

CUNNINGHAM C W 1997 Can three incongruence tests predictwhen data shold be combined Molecular Biology and Evolution14 733ndash740

DEQUEIROZ A M J DONOGHUE and J KIM 1995 Separate versuscombined analysis of phylogenetic evidence Annual Review ofEcology and Systematics 26 657ndash681

DONOGHUE M J C D BELL and J LI 2001 Phylogenetic patternsin northern hemisphere plant geography International Journalof Plant Sciences 162 S41ndashS52

DORF E 1930 Pliocene oras of California Carnegie Institution ofWashington Publication 412

FARRIS J S M KALLERSJO A G KLUGE and C BULT 1995 Test-ing signicance of incongruence Cladistics 10 315ndash319

FELSENSTEIN J 1985 Condence limits on phylogenies an ap-proach using the bootstrap Evolution 39 783ndash791

FENTON B A N E BIRCH G MALLOCH P G LANHAM and RM BRENNAN 2000 Gall mite molecular phylogeny and itsrelationship to the evolution of plant host specicity AppliedAcarology 24 831ndash861

FRITSCH P W C M MORTON T CHEN and C MELDRUM 2001Phylogeny and biogeography of the Styracaceae InternationalJournal of Plant Sciences 162 S95ndashS116

GANDOLFO M A P HOC S N SANTILLANA and S A MARENSSI1998 Una or fosil morfologicamente afDaggern a las Grossulari-aceae (orden Rosales) de la Formacion la Meseta (Eoceno me-dio) Isla Marambio Antartida Asociacion Paleontologica Argen-tina Publicacion Especial 5 Paleogeno de America del Sur y de laPenDaggernsula Antartica 147ndash153

GOLDMAN N J P ANDERSON and A G RODRIGO 2000 Likeli-hood-based tests of topologies in phylogenetics SystematicBiology 49 652ndash670

HANNIBAL H 1911 A Pliocene ora from the Coast Ranges ofCalifornia Bulletin of the Torrey Botanical Club 38 329ndash342

HUELSENBECK J P J J BULL and C W CUNNINGHAM 1996 Com-binined data in phylogenetic analysis Trends in Ecology andEvolution 11 152ndash158

JANCZEWSKI M E 1907 Monographies des groseilliers Ribes LMemoires Societe de Physique et DrsquoHistoire Naturelle de Geneve35 199ndash517

KEEP E 1962 Interspecic hybridization in Ribes Genetica 33 1ndash23

KISHINO H and M HASEGAWA 1989 Evaluation of the maximumlikelihood estimate of the evolutionary tree topologies fromDNA sequence data and the branching order in HominoideaJournal of Molecular Evolution 29 170ndash179

KREMENETSKI C V 1998 Holocene history of the northern rangelimits of some trees and shrubs in Russia Arctic and AlpineResearch 30 317ndash333

LINDER C R L R GOERTZEN B V HEUVEL J FRANCISCO-OR-TEGA and R K JANSEN 2000 The complete external tran-scribed spacer of 18Sndash26S rDNA amplication and phylo-genetic utility at low taxonomic levels in Asteraceae andclosely allied families Molecular Phylogenetics and Evolution 14285ndash303

MACGINITIE D 1953 Fossil plants of the Florissant beds ColoradoCarnegie Institution of Washington Publication 599

MADDISON D R and W P MADDISON 2000 MacClade 4 Sun-derland Sinauer Associates

MANCHESTER S R 1999 Biogeographical relationships of NorthAmerican Tertiary oras Annals of the Missouri Botanical Gar-den 86 472ndash522

mdashmdashmdash 2001 Update on the megafossil ora of Florissant Colo-rado Proceedings of the Denver Museum of Nature amp ScienceSeries 4 No1 137

MANOS P S and M J DONOGHUE 2001 Progress in northernhemisphere phytogeography an introduction InternationalJournal of Plant Sciences 162 S1ndashS2

mdashmdashmdash and A M STANFORD 2001 The historical biogeography ofFagaceae tracking the tertiary history of temperate and sub-tropical forests of the northern hemisphere International Jour-nal of Plant Sciences 162 S77ndashS93

MAST A R and T J GIVNISH 2002 Historical biogeography andthe origin of stomatal distributions in Banksia and Dryandra(Proteaceae) based on their cpDNA phylogeny American Jour-nal of Botany 89 1311ndash1323

MESSINGER W K HUMMER and A LISTON 1999 Ribes (Grossu-

80 [Volume 29SYSTEMATIC BOTANY

TABLE 1 Taxa included in this study with GenBank accession numbers Following Messinger et al (1999) taxonomy correspondsto Sinnott (1985) with Grossularia subg Hesperia and subg Lobbia treated under Ribes ITS sequences noted in boldface are from Sentersand Soltis (2003) Senters and Soltis provided the DNA for italicized sequences Restriction site data are from Messinger et al (1999)Voucher information is cited as per Senters and Soltis (2003) or Messinger et al (1999) when the data or DNA came from those sourcesHerbarium codes follow the Index Herbariorum Eighth Edition NPGR refers to the USDA-ARS National Plant Germplasm RepositoryUCBG refers to the University of California Botanical Garden RBGE refers to the Royal Botanic Garden Edinburgh

Subg Ribes LSect Berisia Spach (Alpine Currants)

R acuminatum (Hook FampThomson) Jancz Chase 3585 (K) ITS AF426376R alpinum L Arnold Arboretum 678ndash80E ETS AY138021 psbA-trnH AY138094 Chase 3587 (K) ITS AF426378 NPGR 6640

restriction sitesR diacanthum Pallas Arnold Arboretum 1852ndash81B ETS AY138022 psbA-trnH AY138095 ITS AY138047 NPGR 34 (Messinger

315 OSC) restriction sitesR giraldii Janczewski Arnold Arboretum 609ndash74B ETS AY138023 psbA-trnH AY138096 M Mort sn (WS) ITS AF426381R glaciale Wall UCBG 910285 ETS AY138024 psbA-trnH AY138097 ITS AY138048R komarovii Pojark UCBG 91078 ETS (1) AY138025 Arnold Arboretum 1094ndash82A ETS (2) AY138026 psbA-trnH AY138098R maximowiczii Batalin T S Elias 10940 (RSA) ITS AF426380 NPGR 267 restriction sitesR orientale Desf Boufford et al 28317 (A) ETS AY138027 psbA-trnH AY138099R tenue Janczewski Boufford et al 27604 (A) ETS AY138028 psbA-trnH AY138100 Chase 3610 (K) ITS AF426377R vilmorini Janczewski Chase 3612 (K) ITS AF426379

Sect Calobotrya (Spach) Jancz (Ornamental Currants)R afne HBK M Medina 2517 (NY) ITS AF426326R brandegeei Eastwood sc 350568 (WS) ITS AF426331R cereum Douglas UCBG 931213 ETS AY138013 psbA-trnH AY138087 NPGR 237001 restriction sites Ross 3425 (NY) ITS

AF426328R ceriferum Coville and Rose sc 05017194 (MO) ITS AF426333R ciliatum H and B Diggs 2625 (NY) ITS AF426327 NPGR 670001 (Messinger 311 OSC) restriction sitesR dugesii Greenman Siplivinsky 3939 (WS) ITS AF426329R glutinosum Benth Chase 3594 (K) ITS AF426340R indecorum Eastwood UCBG 860903 ETS AY138014 psbA-trnH AY138088 Mort 1370 (WS) ITS AF426336R malvaceum Smith UCBG 911481 ETS AY138015 psbA-trnH AY138089 Johnson sn (WS) ITS AF426338R mogollonicum Greene NPGR 294001 ITS AF426332 restriction sitesR neglectum Rose Villarrea 4940 (NY) ITS AF426330R nevadense Kellogg UCBG 891635 ETS AY138016 psbA-trnH AY138090 Mort 1373 (WS) ITS AF426339R sanguineum Pursh UCBG 900193 ETS AY138017 psbA-trnH AY138091 Mort 1372 (WS) ITS AF426335 NPGR 46 restriction

sitesR tortuosum Benth Breedlove 62230 (MO) ITS AF426325R viscosissimum Pursh Grimes 1878 (NY) ITS AF426334 NPGR 281001 (Fredricks 394 OSC) restriction sitesR woli Rothrock Siplivinsky 4587 (NY) ITS AF426341

Sect Coreosma (Spach) Jancz (Black Currants)R americanum Mill NPGR 93 restriction sites Nee 24196 (NY) ITS AF426375R bracteosum Douglas UCBG 891645 ETS AY138033 psbA-trnH AY138103 ITS AY138049R fragrans Pallas sc 4378976 (MO) ITS AF426373R hudsonianum Richardson B Ertter 3807 (NY) ITS AF426372

var petiolare (Douglas) Jancz NPGR 278 (Fredricks 390 OSC) restriction sitesR janczewskii Pojark Chase 3597 (K) ITS AF426370R nigrum L NPGR 215001 (OSC) ITS AF426374R viburnifolium A Gray UCBG 651431 ETS AY138034 NPGR 762001 ITS AF426371 restriction sites

Sect Grossularioides (Jancz) Rehd (Spiny or Gooseberry-stemmed Currants)R lacustre (Pers) Poiret Lesica 4710 (NY) ETS (1) AY138018 ITS AF426366 Arnold Arboretum 777ndash93A ETS (2) AY138019

psbA-trnH AY138092 NPGR 45 restriction sitesR montigenum McClatchie Bugham amp Miller sn (WS) ETS AY138020 psbA-trnH AY138093 ITS AF426367 NPGR 864001

(Messinger 254 OSC) restriction sitesSect Heritiera Jancz (Dwarf Currants)

R erythrocarpum Coville and Leiberg NPGR 860001 (Messinger 249 OSC) ITS AF426342 restriction sitesR howellii Greene NPGR 449001 (Messinger 333 OSC) ITS AF426343 restriction sitesR glandulosum Grauer UCBG 890750 ETS (1) AY138035 Schultheis 589ndash00 (YU) ETS (2) AY138036 psbA-trnH AY138105

NPGR 231 restriction sites Chase 3605 (K) ( 5 R prostratum LrsquoHer) ITS AF426345R laxiorum Pursh NPGR 439 restriction sites Goodrich 19052 (WS) ITS AF426344

Sect Parilla Jancz (Andine Currants)R andicola Jancz Friere-Fierro 2577 (NY) ITS AF426368R fasciculatum Sieb amp Zucc UCBG 880615 ETS (1) AY138043 psbA-trnH AY138104 Arnold Arboretum 1879 ETS (2)

AY138044 Chase 3592 (K) ITS AF426346R ovalifolium Jancz Gentry sn (MO) ITS AF426369R valdivianum Phil Messinger 314 (OSC) restriction sites

Sect Ribes L (Red Currants)

2004] 81SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

TABLE 1 Continued

R himalense Decaisne Boufford et al 28903 (A) ETS AY138037 psbA-trnH AY138106 sc 04714258 (MO) ITS AF426369R manshuricum Komarow Arnold Arboretum 67ndash7 ETS AY138038 psbA-trnH AY138107 Chase 3599 (K) ITS AF426320R petraeum Wulfen Chase 3604 (K) ITS AF426318R rubrum L Arnold Arboretum 1119ndash78A ETS (1) AY138039 psbA-trnH AY138108 Arnold Arboretum 214ndash96 ETS (2)

AY138040 Schuhwerk 7039 (NY) ITS AF426321R sativum (Rehbeh) Syme Missouri Botanical Garden ITS AF426323

cv rsquoDiplomarsquo NPGR 747 (Thompson 46 OSC) restriction sitesR spicatum Robs Chase 3609 (K) ITS AF426322R triste Pallas UCBG 941114 ETS (1) AY138041 Arnold Arboretum 407ndash94 ETS (2) AY138042 psbA-trnH AY138109 Mes-

singer 314 (OSC) restriction sites Baldwin 2269 (WS) ITS AF426319Sect Symphocalyx Berland (Golden Currants)

R aureum Pursh UCBG 560948 ETS (1) AY138030 Arnold Arboretum 460ndash81A ETS (2) AY138029 psbA-trnH AY138101NPGR 769 restriction sites Clement 26 (WS) ITS AF426382

R odoratum Wendl UCBG 860126 ETS (1) AY138032 Arnold Arboretum 1192ndash74A ETS (2) AY138031 psbA-trnH AY138102NPGR 691 restriction sites

Subg Grossularia (Mill) PersSect Grossularia (Mill) Nutt

R aciculare Sm AK Skvortsov sn (A) ETS AY137976 psbA-trnH AY138060 ITS AY138050R alpestre Wall ex Decne Boufford et al 28437 (A) ETS AY137975 psbA-trnH AY138059 Chase 3586 (K) ITS AF426349R burejense F Schmidt NPGR 259001 ETS AY137977 psbA-trnH AY138061 restriction sites Messinger 260 (OSC) ITS

AF426355R curvatum JK Small R Kral 53094 (GH) ETS AY137979R cynosbati L Arnold Arboretum 1108ndash78A ETS (1) AY137981 psbA-trnH AY138063 ITS AY138051 Schultheis 590ndash00 (YU)

ETS (2) AY137980R divaricatum Douglas UCBG 851596 ETS (1) AY137982 psbA-trnH AY138064 Chase 3591 (K) ETS (2) AY137983 ITS

AF426347R echinellum (Coville) Rehd Arnold Arboretum 234ndash96 ETS AY137984 psbA-trnH AY138065 ITS AY138052R formosanum Hayata Wang 1096 (MO) ETS (1) AY137985 ITS AF426354 RBGE 19934301 ETS (2) AY137986 psbA-trnH

AY138066R grossularioides Maxim RBGE 19592035 ETS AY137987 psbA-trnH AY138067 ITS AY138053R hirtellum Michx UCBG 860125 ETS (1) AY137988 Schultheis 588ndash00 (YU) ETS (2) AY137989 psbA-trnH AY138068 Chase

3595 (K) ITS AF426353R inerme Rydb Layser 1770 (UW) ETS (1) AY137990 ITS AF426356 Arnold Arboretum 225ndash80A ETS (2) AY137991 psbA-

trnH AY138069R missouriense Nutt WR Smith 11396 (GH) ETS AY137993 psbA-trnH AY138071 Solomon 859 (WS) ITS AF426348R niveum Lindl Messinger 226 (OSC) ETS AY137994 psbA-trnH AY138072 ITS AF426351 NPGR 777001 (Messinger 226

OSC) restriction sitesR oxyacanthoides L

subsp oxyacanthoides NPGR 139001 ETS (1) AY137996 Alverson 1645 (WIS) ETS (2) AY137995 psbA-trnH AY138073Peterson amp Annable 4440 (WS) ITS AF426383

subsp cognatum (Greene) Sinnott Woodland sn (WS) ETS AY137978 psbA-trnH AY138062 ITS AF426357subsp irriguum (Douglas) Sinnott RBGE 19794064 ETS AY137992 psbA-trnH AY138070 ITS AY138054 NPGR 773001

(Messinger 221 OSC) restriction sitessubsp setosum (Lindl) Sinnott Arnold Arboretum 1395ndash83A ETS AY137998 psbA-trnH AY138075 Lackschewitz 7845 (UW)

ITS AF426352R rotundifolium Michx Mitchell amp Barbour 10112 (NYS) ETS AY137997 psbA-trnH AY138074 ITS AY138055R stenocarpum Maxim RBGE 19698970 ETS AY137999 psbA-trnH AY138076 ITS AY138056R uva-crispa L UCBG 870719 ETS (1) AY138001 Arnold Arboretum 1404ndash80B ETS (2) AY138000 psbA-trnH AY138077

Hill 20953 (NY) ( 5 R grossularia L) ITS AF426350Subg Hesperia A BergerR amarum McClatchie UCBG 891081 ETS AY138002 psbA-trnH AY138078R californicum Hook and Arn UCBG 821692 ETS AY138004 psbA-trnH AY138080 ITS AY138057R menziesii Pursh Messinger 233 (OSC) ETS AY138006 psbA-trnH AY138082 ITS AF426364 NPGR 769001 (Messinger 233

OSC) restriction sitesR roezli Regel Nelson sn (WS) ETS AY138007 psbA-trnH AY138083 ITS AF426365

var cruentum (Greene) Regel NPGR 772001 (Messinger 217 OSC) restriction sitesSubg Lobbia A BergerR binominatum AHeller Messinger 260 (OSC) ETS AY138003 psbA-trnH AY138079 ITS AF426359 NPGR 867001 (Messinger

260 OSC) restriction sitesR lobbii A Gray UCBG 851496 ETS AY138005 psbA-trnH AY138081 Smith Jr 7443 (WS) ITS AF426361R velutinum Greene Annable 2503 (NY) ETS AY138011 psbA-trnH AY138085 ITS AF426358 NPGR 865 (Messinger 2551

OSC) restriction sitesR watsonianum Koehne Patrick sn (UW) ETS AY138012 psbA-trnH AY138086 ITS AF426360

Sect Robsonia BerlandR speciosum Pursh UCBG 840004 ETS (1) AY138008 psbA-trnH AY138084 Mort 1371 WS ETS (2) AY138009 ITS AF426362

NPGR 901001 restriction sitesR thacherianum Johnson sn (WS) ETS AY138010 ITS AF426363

82 [Volume 29SYSTEMATIC BOTANY

TABLE 1 Continued

OutgroupsItea virginica L New York Botanic Garden 7698C ETS AY138045 psbA-trnH AY138110 Messinger 337 (OSC) restriction sites

Ware 94 (WS) ITS AY231368I ilicifolia Oliver UCBG 860414 ETS AY138046 psbA-trnH AY138111 ITS AY138058

from Senters and Soltis 2003) It is possible that incongruence be-tween ETS and ITS datasets was due to intraspecic variation anas yet unexplored issue within Ribes that may limit future use ofcomposite accessions The presence of ETS and ITS regions on thesame transcript similar GC contents (ETS5 mean 049 ITS5mean058) similar proportions of invariant characters (ETS5 297462ITS5438700) and similar levels of rate heterogeneity across sites(ETS gamma 5 065 ITS gamma5 057) argued against differentevolutionary processes of sequence evolution as an explanation forincongruence

In order to maximize taxon sampling and data tests were alsoused to assess combinability of taxa represented in three of thefour available datasets While this required the inclusion of taxafor which one dataset was coded as missing the decrease in phy-logenetic accuracy was expected to be insignicant (Weins andReeder 1995)

Phylogenetic Analysis of Sequence Data Analyses of single(ITS ETS and psbA-trnH) and combined datasets were performedusing a parsimony criterion in PAUP 40 All sites and all changeswere equally weighted in contrast to the 13 gains10 loss weight-ing scheme used by Messinger et al (1999) in their analyses ofrestriction site data psbA-trnH data were analyzed both with in-dels treated as missing data and with seven large indels includedas binary characters Positions 309ndash327 and 448ndash465 of the alignedpsbA-trnH dataset were excluded from all analyses due to ambig-uous alignments

Analyses of the ITS ETS and psbA-trnH datasets consisted ofheuristic searches with 100 replicates of random addition and TBRbranch swapping No more than 400 trees greater than a speciedlength (234 for ETS 556 for ITS 137 for psbA-trnH) were savedper replicate or in the case of psbA-trnH with indels no more than250 trees greater than length 144 The limiting tree length wasdetermined based on the shortest trees found in prior incompletesearches and was imposed to prevent computational overloadsearching sub-optimal trees Analyses of all datasets combined orof combined chloroplast datasets were conducted with the branch-and-bound algorithm with taxa excluded based on partition ho-mogeneity test results For datasets combining ETS1ITSETS1psbA-trnH psbA-trnH1rDNA or all data for those taxa rep-resented in three of the four datasets analyses consisted of heu-ristic searches with 100 replicates of random addition TBR branchswapping and maxtrees set to 40000

Clade support was assessed using bootstrap analyses (Felsen-stein 1985) as implemented in PAUP 40 with 300 replicates ofheuristic searches each with 5 replicates of random taxon additionand Nearest Neighbor Interchange (NNI) branch swapping Forthe combination of all four datasets and for the combined chlo-roplast datasets clade support was assessed using 100 bootstrapreplicates each with branch and bound searches

Kishino-Hasegawa Tests The parsimony implementation of theKishino-Hasegawa test (Kishino and Hasegawa 1989) in PAUP 40was used to compare the hypothesis of subg Grossularia monophylyto that of subg Grossularia non-monophyly in which sect Grossu-larioides and sect Grossularia form a clade The parsimony version ofthe test was used because comparisons included restriction site dataAs recommended by Goldman et al (2000) comparisons were be-tween a priori hypotheses based on previously published phyloge-nies (Messinger et al 1999 Senters and Soltis 2003)

Analyses were run enforcing each of two constraint trees Therst constraint tree resolved subg Grossularia as monophyletic butleft relationships within subg Grossularia and among all remain-ing species unresolved The second constraint tree enforced res-olution of a clade containing sect Grossularioides plus sect Gros-

sularia but relationships within this clade were left unresolved aswere relationships among all remaining species Comparisonswere between trees from constrained branch and bound searchesfor the chloroplast data and from constrained heuristic searchesfor the rDNA data

Ancestral Area Reconstruction Ancestral areas were inferredusing DIVA which assigns areas to internal nodes such that dis-persal and extinction events are minimized (Ronquist 1996 1997)Default costs were used (vicariance 5 0 dispersal 5 1 extinction51) and the number of inferred areas per node was left uncon-strained These analyses used trees from the combined psbA-trnHand rDNA datasets (Fig 8) with species assigned to one or moreof four areas (eastern North America western North Americaeastern Eurasia and western Eurasia) Geographic distributionsfollowed Berger (1924) Janczewski (1907) and Sinnott (1985) SectCalobotrya R aureum R bracteosum R watsonianum and the cladecontaining the remaining glabrous-styled gooseberries (HesperiaLobbia Robsonia) were all coded with western North American dis-tributions Sect Grossularioides was coded for both North Americaand eastern Eurasia Subg Berisia was coded for both eastern andwestern Eurasia Ribes triste was coded for all areas except westernEurasia Itea was coded for both eastern North America and east-ern Eurasia

Because DIVA analyses do not permit polytomies we treated Raureum and R bracteosum as sister taxa Within sect Grossulariamembers of the Asian gooseberry clade were all coded as easternEurasia The remaining species of the large polytomy all live inwestern or eastern North America We resolved this polytomy inseveral different ways so as to explore some of the possibilitiesFor example in some analyses we created one eastern NorthAmerican and one western North American clade In others theNorth American species were arranged pectinately in relation tothe Asian clade

RESULTS

Sequence Characteristics and Analyses The aligned18ndash26S rDNA ITS dataset including 58S(positions 283ndash452) was 700 bp (282bp5ITS1 248bp5ITS2) with 28of the data matrix coded as missing data For the regionas a whole sequences ranged from 438ndash662bp (varia-tion due in part to missing terminal sequence data)uncorrected pairwise distances within Ribes rangedfrom 00ndash008 distances with Itea ranged from 027(with R missouriense) to 032 (with R malvaceum) andmean GC content was 058 Of the 700 aligned base-pairs 528 were constant within Ribes and 183 wereparsimony informative ITS1 displayed higher levels ofdivergence and a higher proportion of informativecharacters than did ITS2 (ITS1 5 00ndash015 65282 in-formative ITS2 5 00ndash011 25248 informative) In-cluded ITS1 sequences ranged from 34ndash258bpwith thelower limit due to taxa for which much of ITS1 se-quence data was missing ITS2 sequences ranged from216ndash241bp 58S ranged from 161ndash164bp but was only142bp in R sanguineum due to a large deletion

2004] 83SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

Lengths and GC contents fell within the ranges re-ported for a survey of angiosperm taxa (Baldwin et al1995) Analyses of the ITS and 58S regions generated36400 trees (length5556 CI5065 058 excluding un-informative characters RI5084)

Amplied products from the 18ndash26S rDNA inter-genic spacer region were approximately 2kb in R odor-atum (sect Symphocalyx) and 3kb in R hirtellum (sectGrossularia) the two species used to design internalprimers for amplifying 39 ETS Only 406bp of the 39end of the ETS region and 56bp of the 59 end of 18Swere sequenced in this study Included sequencesranged from 299ndash462bp in size with some variationdue to missing terminal sequence data and had amean GC content of 049 Uncorrected pairwise dis-tances among ETS sequences within Ribes ranged from00 to 007 Pairwise distances between Ribes and Itearanged from 026 (with R oxyacanthoides accession 2)to 032 (with R triste accession 1) Of the 462 alignedbasepairs 388 were constant within Ribes 60 were par-simony informative and 2 were coded as missingdata ETS analyses generated 34005 trees (length5234CI5080 074 excluding uninformative charactersRI5093 Fig 2)

The aligned psbA-trnH intergenic spacer dataset was502bp including a 39 portion of psbA (positions 1ndash37)and a 59 portion of trnH (position 484ndash502) One per-cent of the matrix was coded as missing data Includedsequences ranged from 355ndash445bp in length withsome variation due to missing terminal sequence dataand had a mean GC content of 029 The spacer regionalone ranged from 352ndash378bp within Ribes and was369bp in Itea based on complete sequences Uncor-rected pairwise distances (including psbA and trnHterminals) within Ribes ranged from 00 to 004 Dis-tances between Ribes and Itea ranged from 015 (withR odoratum accession 2) to 021 (with R bracteosum)Within Ribes 405465 included characters were con-stant and 34465 were parsimony informative Ex-cluded characters represented a polyA region rangingfrom 4ndash13bp and a 16ndash18bp insertion in Itea (relativeto Ribes) with which 5ndash6bp segments of Ribes could bealigned in various ways Analyses of sequence datafrom the psbA-trnH intergenic spacer produced 34000trees with little homoplasy (length5137 CI5092 088excluding uninformative characters RI5094 Fig 3)Analyses including indels coded as binary charactersproduced 18001 trees (length5144 CI5092 090 ex-cluding uninformative characters RI5095)

Trees Generated by Analyses of IndividualDatasets Results from the expanded ITS datasetconcur with those presented by Senters and Soltis(2003) and are not illustrated here Subg Grossulariawas resolved as monophyletic in ITS and ETS treeswith weak to moderate bootstrap support (Figs 1 2)psbA-trnH trees showed little resolution but did not

conict with a monophyletic subg Grossularia (Fig 3trees from analyses including indels are not shown)

Two main lineages may be identied within subgGrossularia the true gooseberries (sect Grossularia) andthe glabrous-styled gooseberries (Hesperia Lobbia Rob-sonia) The glabrous-styled gooseberries are resolved asa clade in ITS restriction site and psbA-trnH trees(Figs 1 3 Messinger et al 1999) ETS trees also resolvethe glabrous-styled gooseberries (Hesperia Lobbia Rob-sonia) as a clade with the exception of R watsonianum(subg Lobbia) placed with strong support in the truegooseberry clade (sect Grossularia) (Fig 2) The integ-rity of the individual sections comprising the glabrous-styled gooseberries (Hesperia Lobbia Robsonia) is un-clear The true gooseberries (sect Grossularia) are re-solved as a clade in restriction site ITS and ETS trees(including R watsonianum in the latter) and in psbA-trnH trees when indels are included (Figs 1 2 Mes-singer et al 1999 Senters and Soltis 2003) If indels areignored psbA-trnH trees resolve the majority of truegooseberries as a clade and are consistent with amonophyletic sect Grossularia (Fig 3) Within sectGrossularia the ETS dataset provided strong supportfor an Asian clade including the European R uvacris-pa ITS trees were consistent with an Asian clade butexcluded R uvacrispa psbA-trnH trees were also con-sistent with an Asian clade with the weakly support-ed inclusion of the North American R oxyacanthoidessubsp irriguum Restriction site trees had limited sam-pling in sect Grossularia but were consistent with anAsian versus North American divergence (Messingeret al 1999)

All datasets except the restriction sites resolved aclade comprising sect Calobotrya sect Grossularioidesand subg Grossularia (sect Grossularia sect Robsoniasubg Lobbia Hesperia) Members of this clade are large-ly from western North America with sect Grossulariahaving a wider distribution ETS trees included theblack currant Ribes bracteosum (sect Coreosma) withinthis clade in an unresolved position (Fig 2) ITS treesincluded the South American sect Parilla in this cladein an unresolved position (Senters and Soltis 2003) Inall trees sect Calobotrya was resolved as monophyleticincluding some members of sect Heritiera in restrictionsite and ITS trees (only one species of sect Heritierawas included in ETS and psbA-trnH analyses and fallselsewhere) Section Grossularioides was resolved withstrong support in ETS and ITS trees (Figs 1 2 Sentersand Soltis 2003) but is unresolved or strongly para-phyletic in the psbA-trnH and restriction site trees re-spectively (Figs 1 3 Messinger et al 1999)

The clade containing sects Calobotrya Grossularioidesand subg Grossularia was clearly nested within Ribesin ITS ETS and psbA-trnH trees (Figs 2 3 Senters andSoltis 2003) Among the remaining sections of Ribesall datasets provided strong support for sect Berisia

84 [Volume 29SYSTEMATIC BOTANY

FIG 2 The majority-rule consensus of 34005 trees resulting from analyses of ETS sequence data (CI5080 074 excludinguninformative characters RI5093) Numbers above the branches indicate the percentage of bootstrap replicates in which theclade appeared Numbers in parentheses below the branches indicate the percentage of trees in which the clade appearedwhen less than 100

2004] 85SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 3 The majority-rule consensus of 34000 trees resulting from analyses of psbA-trnH sequence data (CI5092 088excluding uninformative characters RI5094) Numbers above the branches indicate the percentage of bootstrap replicates inwhich the clade appeared Numbers in parentheses below the branches indicate the percentage of trees in which the cladeappeared when less than 100

86 [Volume 29SYSTEMATIC BOTANY

FIG 4 The strict consensus of six trees resulting fromanalyses of psbA-trnH sequence data combined with chloro-plast restriction site data (Messinger et al 1999) (CI5090 079excluding uninformative characters RI5087) Data combina-bility determined by partition homogeneity tests (p5066)Numbers above the branches indicate the percentage of boot-strap replicates in which the clade appeared

with the inclusion of some species of sect Ribes in ITStrees (Senters and Soltis 2003) Section Symphocalyxwasstrongly resolved in ETS and restriction site trees (Fig2 Messinger et al 1999) but was unresolved in psbA-trnH trees (Fig 3) (ITS trees included only one species)Section Heritiera appeared to be polyphyletic in ITSand restriction site trees (only one species of sect Her-itiera is included in ETS or psbA-trnH analyses) (Mes-singer et al 1999 Senters and Soltis 2003) The mono-phyly of sects Ribes and Coreosma remain unclear Forthose species sampled sect Ribes was resolved asmonophyletic in restriction site trees (Messinger et al1999) as monophyletic excluding R triste in ETS andpsbA-trnH trees (Figs 2 3) and as polyphyletic in ITStrees with some species clearly related to sect Berisia(Senters and Soltis 2003) Section Coreosma was re-solved as polyphyletic in ETS and restriction site trees(Fig 2 Messinger et al 1999) and as para- or poly-phyletic in ITS trees (Senters and Soltis 2003) (only onespecies was included in the psbA-trnH dataset) Previ-ous restriction site analyses of 18ndash26S rDNA suggestedthat members of sect Coreosma were divergent fromone another and from other Ribes species (Messingeret al 1993) Sampling from sect Parilla was too limitedto draw strong conclusions but the ITS trees support-ed its monophyly to the exclusion of R fasciculatumthe only non-South American member of the section(Senters and Soltis 2003) Relationships among the sec-tions outside of the predominantly western NorthAmerican clade (sects Calobotrya Grossularioides subgGrossularia) varied markedly among datasets with lit-tle support for any one resolution (Figs 2 3)

Trees Generated from Analyses of CombinedDatasets Dataset combinability is typically based ona critical value of p 5 005 (ie datasets are incongru-ent when p 005) However studies suggest that acritical value of p 5 005 may be too strict such thatthe null hypothesis of dataset congruence will be false-ly rejected (Huelsenbeck et al 1996 Sullivan 1996Cunningham 1997) and that a value such as p 5 001may be more appropriate (Cunningham 1997) Manyof the datasets reported here were not combinablebased on intitial partition homogeneity tests but theincongruence was generally eliminated when problem-atic taxa were excluded

Analyses of the readily combinable chloroplast psbA-trnH and restriction site data (p5066) generated sixtrees (length 144 CI5090 079 excluding uninforma-tive characters RI5087) In agreement with analysesof restriction site data alone true gooseberries (sectGrossularia) were not placed as sister to the remainingglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) suggesting that subg Grossularia is not monophy-letic (Figs 1 4) The true gooseberries were nested ina paraphyletic sect Grossularioides as in the restrictionsite trees with sect Calobotrya weakly placed as sister

Support for sect Grossularia sect Calobotrya and theglabrous-styled gooseberries (Hesperia Lobbia Robsonia)increased relative to analyses of either dataset alone(Fig 3 Messinger et al 1999) Support for a paraphy-letic sect Grossularioides decreased slightly relative tothe restriction site analyses (Fig 4 Messinger et al1999)

Analyses of the combined ETS and ITS rDNA data(p5004 excluded R fasciculatum R glandulosum Rhimalense R manshuricum R nevadense R rubrum Roxyacanthoides subsp oxycanthoides R uvacripsa) gener-ated 150 trees (length 614 CI5077 070 excluding un-informative characters RI5085) (Fig 5) Subg Gros-sularia was monophyletic as were the true gooseber-ries (sect Grossularia) (Fig 5) The glabrous-styledgooseberries (Hesperia Lobbia Robsonia) were stronglyresolved as monophyletic with the exception of R wat-sonianum (sect Lobbia) placed strongly as sister to thetrue gooseberries Within sect Grossularia only theAsian clade was resolved with strong support Theclade containing subg Grossularia sect Grossularioi-dies and sect Calobotrya was again evident with sectGrossularioides resolved as sister to subg GrossulariaSupport for the glabrous-styled gooseberries (HesperiaLobbia Robsonia) sect Calobotrya sect Grossularioidesand the Asian clade within sect Grossularia increasedrelative to support from ETS or ITS datasets analyzedindividually (Figs 2 5 Senters and Soltis 2003)

The most evident difference between chloroplast and

2004] 87SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 5 The strict consensus of 150 trees resulting from analyses of combined ETS and ITS sequence data (CI5077 070excluding uninformative characters RI5085) Data combinability determined by partition homogeneity tests (p5004) Num-bers above the branches indicate the percentage of bootstrap replicates in which the clade appeared

88 [Volume 29SYSTEMATIC BOTANY

FIG 6 The strict consensus of four trees resulting from analyses of the four datasets combined (ETS ITS psbA-trnHchloroplast restriction sites) Data combinability was determined by partition homogeneity tests (p5075) Numbers above thebranches indicate the percentage of bootstrap replicates in which the clade appeared

rDNA trees was the position of sect GrossularioidesSubgenus Grossularia is monophyletic in rDNA treeswith sect Grossularioides placed weakly as sister (Fig5) In contrast subg Grossularia is polyphyletic in chlo-roplast trees with sect Grossularia nested within sectGrossulariodes and sect Calobotrya sister to that group-ing (Fig 4) Analyses of the combined chloroplast andrDNA datasets (p5075 excluded R glandulosum Rlacustre R montigenum) generated four trees (length556 CI5088 069 excluding uninformative charactersRI5076) (Fig 6) Taxon sampling was limited due tothe limited overlap among datasets but trees showedstrong resolution of sect Calobotrya sect Grossulariaand the glabrous-styled gooseberries (Hesperia Lobbia

Robsonia) These groups again formed a well-support-ed clade nested within Ribes (Fig 6) The strongly sup-ported sister-group relationship between the true andglabrous-styled gooseberries (Fig 6) is consistent withthe monophyly of subg Grossularia but could changewith the inclusion of sect Grossularioides

ETS and psbA-trnH combined analyses (p5004 ex-cluded R oxyacanthoides subsp irriguum) generated 329trees (length 372 CI5084 077 excluding uninforma-tive characters RI5090) (Fig 7) Subgenus Grossulariawas resolved as monophyletic within which both theglabrous-styled and the true gooseberries were strong-ly supported the latter including R watsonianum(subg Lobbia) The Asian clade was well supported

2004] 89SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 7 The strict consensus of 329 trees resulting from analyses of combined ETS and psbA-trnH data (CI5084 077excluding uninformative characters RI5091) Dataset combinability was determined by partition-homogeneity tests (p5 004)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared

within sect Grossularia including the European R uva-crispa Both sect Calobotrya and sect Grossularioideswere strongly supported but neither was resolved assister to subg Grossularia The clade comprising subgGrossularia sect Grossularioides and sect Calobotryawas again evident nested within Ribes

Combined analyses of psbA-trnH and rDNA datasets(p5002 excluded R oxyacanthoides subsp irriguum andtaxa excluded from ETS1ITS analysis) generated 3080trees (length 5 719 CI5080 074 excluding uninfor-mative characters RI5085) Sects Grossularioides Calo-botrya Grossularia and the glabrous-styled gooseberries

90 [Volume 29SYSTEMATIC BOTANY

(Hesperia Lobbia Robsonia) were each strongly support-ed and again formed a strongly supported clade nestedin Ribes (Fig 8) Support for the monophyly of subgGrossularia was increased relative to support seen withany individual dataset (Figs 2 3 8)

Combinability (p5012) of all datasets for those taxarepresented in three of the four datasets required ex-clusion of composite taxa problematic within therDNA dataset as well as exclusion of taxa problematicfor the chloroplast versus rDNA datasets Combinedanalyses generated 4802 trees (length5768 CI5080074 excluding uninformative characters RI5085)Sec-tion Calobotrya sect Grossularia and the glabrous-styled gooseberries (Hesperia Lobbia Robsonia) exclud-ing R watsonianum were each well supported and to-gether formed a strongly supported clade (Fig 9) Sub-genus Grossularia was resolved as monophyleticbearing in mind that sect Grossularioides was excludedfrom the analyses

While all combined datasets resolved the clade con-taining sects Calobotrya Grossularioides and subgGrossularia as nested within Ribes (Figs 4ndash9) relation-ships among other lineages were unclear as in theanalyses of individual datasets (Figs 2 3) Basal rela-tionships were unresolved in the analyses of combinedchloroplast data (Fig 4) The combined ETS and psbA-trnH analyses suggested basal positions for goldencurrants (sect Symphocalyx) (Fig 7) All remaininganalyses suggested basal positions for sects Berisiaand Ribes (Figs 5 6 8 9) Basal relationships were notwell-supported in any analysis

Kishino-Hasegawa Tests Trees generated fromanalyses constraining the monophyly of subg Gros-sularia versus trees constrained to resolve a sister re-lationship between sect Grossularioides and sect Gros-sularia were marginally but signicantly different inboth the chloroplast (p5003) and the rDNA (p5005)datasets

Ancestral Area Reconstructions DIVA reconstruc-tions of ancestral areas support a western North Amer-ican origin for a large segment of Ribes beginningwith node 2 in Fig 8 Within this clade it is also thecase that subg Grossularia is inferred to have diversi-ed rst within western North America (Fig 8 node6) Subsequent movement to eastern Asia is inferred tohave occurred somewhere within sect Grossularia butthe ancestral area for the true gooseberries is equivo-cal and can include virtually any combination of areasdepending on the exact resolution of the large poly-tomy at the base of this clade (Fig 8 node 8) Impor-tantly our results indicate that the Asian species with-in sect Grossularia form a clade implying a single mi-gration from North America to Asia The ancestralarea for Ribes is reconstructed to be western NorthAmerica and western Eurasia or western North Amer-ica and all of Eurasia (Fig 8 node 1) However this

result hinges on resolution at the base which remainshighly uncertain and requires more intensive samplingof Ribes lineages outside of subg Grossularia

DISCUSSION

Gooseberry Monophyly Results from previousphylogenetic analyses based on nuclear 18Sndash26S rDNAITS data (Senters and Soltis 2003) and chloroplast re-striction site data (Messinger et al 1999) differed re-garding gooseberry monophyly Adding the additionalnuclear 18Sndash26S rDNA ETS and chloroplast psbA-trnHdatasets could increase support and resolution in re-sulting topologies or could reinforce the differencesbetween the nuclear and chloroplast topologies witheach reecting accurate but separate histories

Initial examination of the trees produced with theadditional datasets reinforced the apparent conict be-tween nuclear and chloroplast genomes ITS ETS andcombined rDNA datasets supported the monophyly ofsubg Grossularia (Figs 1 2 5) In contrast the com-bined chloroplast datasets (restriction sites plus psbA-trnH) suggested a closer relationship between the trueand glabrous-styled gooseberries than did the restric-tion site data alone (Fig 1 Messinger et al 1999) butstill resolved subg Grossularia as non-monophyleticwith sect Grossularioidies forming a grade at the baseof sect Grossularia (Fig 4) The increase in tree lengthwhen combined chloroplast data was constrained toresolve a monophyletic subg Grossularia (p5003) orwhen combined rDNA data was constrained to resolvesects Grossularioides and Grossularia as a clade(p5005) also indicated dataset incongruence

The discrepancy between nuclear and chloroplast to-pologies primarily involved the restriction sites datasetand not the psbA-trnH dataset The psbA-trnH datasetprovided little resolution (Fig 3) conicting with nei-ther the rDNA nor the restriction sites topologiesAnalyses combining the psbA-trnH data with either theETS data (p5004 Fig 7) or the rDNA data (p5002Fig 8) produced trees resolving subg Grossularia asmonophyletic with increased support relative to ETSor rDNA data alone (Figs 2 5) Section Grossularioideswas either sister to subg Grossularia (psbA-trnH 1rDNA Fig 8) or was unresolved in a polytomy withsubg Grossularia and sect Calobotrya (psbA-trnH 1ETS Fig 7) The monophyly of subg Grossularia wasalso supported by analyses of all datasets combinedwhether including taxa represented in all four datasets(p5075 Fig 6) or in three of the four datasets(p5012 Fig 9) Analyses combining all datasets re-quired exclusion of sect Grossularioides thus leavingsubg Grossularia monophyly uncertain However in-cluding sect Grossulariodes in spite of dataset incon-gruence (p5001) produced trees resolving a mono-phyletic subg Grossularia sister to a monophyletic sectGrossularioides (not shown)

2004] 91SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 8 The strict consensus of 3080 trees resulting from analyses of combined psbA-trnH and rDNA data (CI 5 080 074excluding uninformative characters RI 5 085) Dataset combinability was determined by partition homogeneity tests (p5002)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared DIVA (Ronquist 1996)was used to infer ancestral areas at the numbered nodes The ancestral areas at nodes two through seven were reconstructedas western North America Node one was reconstructed as western North America plus either western Eurasia or all of EurasiaThere were multiple possible reconstructions at node 8 including (1) western North America and eastern Eurasia (2) NorthAmerica and eastern Eurasia (3) North America or (4) western North America

92 [Volume 29SYSTEMATIC BOTANY

FIG 9 The strict consensus of 4802 trees resulting from analyses of all four datasets (ITS ETS psbA-trnH chloroplastrestriction sites) including taxa represented in at least three datasets (CI5080 074 excluding uninformative charactersRI5085) Dataset combinability was determined using partition homogeneity tests (p5012) Numbers above the branchesindicate the percentage of bootstrap replicates in which the clade appeared

2004] 93SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

The general picture that emerges from these analy-ses suggests that subg Grossularia is monophyletic(Figs 2 5ndash9) rDNA data supported gooseberry mono-phyly (Figs 2 5) psbA-trnH data while lacking suf-cient variation to resolve gooseberry monophyly ornon-monophyly supported gooseberry monophyly incombination with rDNA data (Figs 7 8) Finally anal-yses of all datasets combined supported gooseberrymonophyly although these analyses excluded thespiny currants (sect Grossularioides) (Figs 6 9) Whatrequires further investigation is the role hybridizationmay have played in the history of the spiny currants(sect Grossularioides) and the true gooseberries (sectGrossularia) Messinger et al (1999) encouraged furtherexploration of this possibility in Ribes in which theynoted potential chloroplast capture of the sect Gros-sularia chloroplast type by sect Grossularioides Crosseshave not been successful between species of sect Gros-sularioides and other sections within Ribes and are usu-ally unsuccessful between sections or subgenera (Keep1962) Conrmation of the pattern seen in trees gen-erated from the chloroplast restriction site data (Mes-singer et al 1999) is needed from additional chloro-plast datasets that provide greater resolution than didthe psbA-trnH dataset

Relationships Within the Gooseberries SubgenusGrossularia comprises two main lineages (Figs 2 5ndash9)the true gooseberries (sect Grossularia) and a clade ofglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) The four gooseberry sections are traditionally dis-tinguished from each other by basally pubescent stylesin sect Grossularia (with the exception of some Asianspecies) by four versus ve parted owers in sect Rob-sonia by anthers broader at the base in subg Hesperiaand by the absence of the above set of features in subgLobbia The glabrous-styled gooseberry lineage com-prising 27 species distributed through western NorthAmerica into Mexico (Berger 1924) was well-support-ed given our sampling but sections within this lineagewere not resolved Ribes watsonianum (subg Lobbia)was surprisingly placed outside of the glabrous-styledgooseberry lineage as sister to the true gooseberries(Figs 2 5 7ndash9) ITS data resolved R watsonianum with-in the glabrous-styled gooseberry lineage (Senters andSoltis 2003) but ETS data strongly resolved the specieswithin the true gooseberry lineage (sect Grossularia)(Fig 2) This conict within the rDNA data may reecthybridization between R watsonianum and a memberof sect Grossularia followed by xation within the Rwatsonianum genome of a recombinant rDNA repeattype Accounts of Ribes hybrids in the eld are rela-tively rare (Messler et al 1991) and do not implicateR watsonianum but fertile hybrids can be obtainedfrom articial crosses between glabrous-styled goose-berries and true gooseberries (Keep 1962 citing R lob-bii 3 R divaricatum) Alternatively R watsonianum may

posses multiple rDNA repeat types with different re-peat types sampled in our ITS versus ETS datasetsEach of these possibilities has been reported in otherplant taxa (Wendel et al 1995a Campbell et al 1997for potential recombinant rDNA repeat types Suh etal 1993 Wendel et al 1995b for incomplete homoge-nization of rDNA repeat types)

The true gooseberries (sect Grossularia) have a broadrange throughout the northern hemisphere with ninespecies in North America (Sinnott 1985) and seven spe-cies in Eurasia (Berger 1924) In his treatment of NorthAmerican gooseberries Sinnott (1985) divided his ninespecies into ve groups based on phenetic analysesThe groups consisted of (1) R cynosbati with spinyfruits (2) R niveum R curvatum and R missouriensewith highly exserted stamens and long sepals (3) Rrotundifolium and R divaricatum with medium lengthstamens and purple sepals (4) R inerme and R hirtel-lum with intermediate length stamens and small oralfeatures and (5) the ve subspecies of R oxyacanthoi-des with short stamens Sinnott (1985) recommendedthat R echinellum be excluded from the true gooseber-ries and aligned with the glabrous-styled gooseberriesof western North America (Hesperia Lobbia Robsonia)The analyses presented here showed strong supportfor the inclusion of R echinellum as well as the Eurasianspecies within the true gooseberry lineage (Figs 2ndash35 7ndash9) Resolution among the North American specieswas lacking or not well-supported (Figs 2ndash9) and thusneither supported nor conicted with Sinnottrsquos hy-pothesized relationships

The seven Eurasian species of sect Grossularia (Ber-ger 1924) include R uvacrispa in Europe R alpestre andR aciculare in the Himalayan region R stenocarpumand R formosanum in southern and eastern Asia andR burejense and R grossularioides in northern and east-ern Asia A clade of Asian species is well-supported(Figs 2 5 7ndash9) with possible inclusion of R uvacrispa(Figs 2 7) The psbA-trnH dataset includes R oxyacan-thoides subsp irriguum within the Asian clade (Fig 3)but this is weakly supported (Fig 3) and requires fur-ther substantiation particularly since R oxyacanthoidessubsp irriguum is restricted to northwestern NorthAmerica and may itself be of hybrid origin from cross-es between R oxyacanthoides subsp setosum and R in-erme (Sinnott 1985) both distributed in western NorthAmerica Resolution within the clade of Asian speciessuggests a correspondance to geographic and oristicregions within Asia Whether the Asian and NorthAmerican true gooseberries represent divergent line-ages or a monophyletic Asian clade nested within aNorth American grade is unclear given the availabledata

Other Groups within Ribes Since this study fo-cused on the gooseberries sampling within other sec-tions of Ribes was sometimes limited Nevertheless the

94 [Volume 29SYSTEMATIC BOTANY

data did support the monophyly of sects CalobotryaParilla Symphocalyx and Berisia Section Calobotrya is agroup of 21 western North American species (Berger1924) known as the ornamental currants The mono-phyly of sect Calobotrya was well-supported with theinclusion of some dwarf currants (sect Heritieria) (Figs2ndash9 Messinger et al 1999 Senters and Soltis 2003)Sampling was limited in sect Parilla a group of 41dioecious South American species (Janczewski 1907)but the group was supported in ITS trees excludingthe east Asian R fasciculatum the sectionrsquos only non-South American species (Senters and Soltis 2003) Apossible sister relationship between sect Parilla andsect Calobotrya (unpubl data cited in Weigend andBinder 2001) is consistent with the position of sect Pa-rilla seen with ITS data (Senters and Soltis 2003) Sec-tion Symphocalyx the golden currants includes vespecies distributed through northern Mexico and cen-tral and western North America (Berger 1924) Thegolden currants were well-supported given the avail-able sampling (Fig 2 4 9) The alpine currants sectBerisia are a group of 17 dioecious species distributedthrough Eurasia (Janczewski 1907) The monophyly ofsect Berisia was well-supported (Figs 2ndash9 Messingeret al 1999) but with the inclusion of some red currants(sect Ribes) in ITS trees (Senters and Soltis 2003)

The monophyly of sects Ribes and Coreosma wasquestionable (Figs 2 3 5) The red currants (sect Ri-bes) are a group of 15 Eurasian species with one spe-cies R triste also distributed in North America Sec-tion Coreosma the black currants includes six speciesin North America and six in Eurasia (Berger 1924) Sec-tion Heritiera the dwarf currants appeared to be poly-phyletic as seen in Messinger et al (1999) and Sentersand Soltis (2003) This group of six species (Berger1924) is dened primarily by a prostrate habit and assuggested by Messinger et al (1999) is likely a case ofconvergence

Biogeography The spread of taxa around theNorthern Hemisphere has been facilitated by the avail-ability at various times of two major migrationroutesmdashthe Beringian and the North Atlantic landbridges (Tiffney 1985a 1985b Donoghue et al 2001SanmartDaggern et al 2001) Especially in large and relative-ly old clades which have become widespread aroundthe Northern Hemisphere it is possible (perhaps evenlikely) that both pathways were used Information onthe timing of key divergences and on the direction ofmovement within subclades will be critical in sortingout the possibilities in particular cases Ribes providesan excellent example of such a group being represent-ed in Eurasia by six sections (Berisia Ribes and somespecies from Heritiera Coreosma Grossularioides andGrossularia) in western North America by nine (Sym-phocalyx Calobotrya Robsonia Hesperia Lobbia andsome species of Coreosma Heritiera Grossularioides and

Grossularia) and in eastern North America by three(some species of Heritiera Ribes and Grossularia) Oneapproach for sorting through a complex biogeographichistory as might be expected in Ribes is to examinephylogenetic patterns in component clades and ide-ally to date divergences

Our analyses indicate that subg Grossularia is nestedwithin a predominantly western North Americanclade (Figs 2 5ndash9) and that it diversied initially inthat region (Fig 8 node 6) Subsequently within sectGrossularia it appears that movement occurred fromwestern North America to eastern Asia presumablythrough Beringia followed by vicariance and the ori-gin and diversication of the well-supported Asiangooseberry clade Donoghue et al (2001) and Xiangand Soltis (2001) highlighted cases of movement out ofAsia into North America through the Bering LandBridge Ribes appears to provide a case of movementin the opposite direction Movement in both directionsis of course to be expected What remains to be de-termined in future studies of disjunct taxa is exactlywhich groups moved in which directions and whetherthere are any signicant generalizations that can bemade about these different patterns

Elsewhere in Ribes there are other possible cases ofmovement between North America and Asia One caseinvolves R lacustre of sect Grossularioides which is dis-tributed in eastern Asia as well as in North AmericaOther possible cases relate to resolution at the base ofRibes where relationships remain uncertain The basalpositions of sect Symphocalyx in trees resulting frompsbA-trnH data and from the combination of psbA-trnHand ETS data suggest a western North American ori-gin for the entire clade (Figs 2 7) This would implyearly dispersion to Asia giving rise to sects Berisiaand Ribes However all other datasets and dataset com-binations suggested a broader Eurasian plus westernNorth American distribution at the base (Fig 8 node1) owing to the basal positions of sects Berisia andRibes This would imply early vicariance involvingAsia and North America and movement back to Asiawithin the western North American clade Future stud-ies should include more sampling of sects Berisia Ri-bes Coreosma and Symphocalyx to help resolve basal re-lationships and biogeographic patterns in Ribes

The fossil record for Ribes consists largely of leaveswith few reports of seeds (Kremenetski 1998) fruits(Cevallos-Ferriz 1995) and owers (Gandolfo et al1998) The leaf record for Ribes in North America mayextend from approximately 2 mya (Hannibal 1911Dorf 1930 Axelrod 1966) to at least 345 mya (Mac-Ginitie 1953 Manchester 2001) and possibly to 45 or50 mya (Axelrod 1998 Wehr and Hopkins 1994) Al-though leaf features are seldom used to distinguishextant taxa of Ribes Wolfe (1964) used leaf serrationand venation features to distinguish between fossil

2004] 95SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

leaves of subg Ribes and subg Grossularia from Ne-vada If these features are reliable this dates subgGrossularia to at least 14 mya (Fig 9 node 6) A criticalnext step in understanding Ribes biogeography will beto accurately assign Ribes fossils to particular sub-clades so as to infer the timing of intercontinental di-vergences

ACKNOWLEDGEMENTS We thank the following individuals andinstitutions for providing plant material B Alverson D BouffordR Mitchell Arnold Arboretum of Harvard University Universityof California Botanical Garden Royal Botanic Garden EdinburghNew York Botanical Garden and the USDA-ARS National PlantGermplasm Repository A Senters and D Soltis graciously pro-vided numerous DNA aliquots DNA sequences and access to ear-ly manuscripts H Schorn and D Erwin provided assistance withpaleobotanical literature M Lavin P Herendeen and two anon-ymous reviewers provided numerous helpful comments This proj-ect was supported in part by a Putnam Fellowship through theArnold Arboretum of Harvard University

LITERATURE CITED

AVISE J C 1994 Molecular markers natural history and evolutionNew York Chapman amp Hall

AXELROD D I 1966 The Pleistocene Soboba ora of southern Califor-nia University of California Publications in Geological Sci-ences 60

mdashmdashmdash 1998 Thunder Mountain Idaho University of CaliforniaPublications in Geological Sciences 142

BALDWIN B G and S MARKOS 1998 Phylogenetic utility of theexternal transcribed spacer (ETS) of 18Sndash26S rDNA Congru-ence of ETS and ITS trees of Calycadenia (Compositae) Mo-lecular Phylogenetics and Evolution 10 449ndash463

mdashmdashmdash M J SANDERSON J M PORTER M F WOJCIECHOWSKI CS CAMPBELL and M J DONOGHUE 1995 The ITS region ofnuclear ribosomal DNA a valuable source of evidence onangiosperm phylogeny Annals of the Missouri Botanical Garden82 247ndash277

BEARD K H 1998 East of Eden Asia as an important center oftaxonomic origination in mammalian evolution Bulletin of theCarnegie Museum of Natural History 34 5ndash39

BENA G M F JUBIER I OLIVIERI and B LEJEUNE 1998 Ribosom-al external and internal transcribed spacers combined use inthe phylogenetic analysis of Medicago (Leguminosae) Journal ofMolecular Evolution 46 299ndash306

BERGER A 1924 A taxonomic review of currants and gooseberriesNew York Agricultural Experimental Station Technical Bulletin109 1ndash118

BOUFFORD D E and S A SPONGBERG 1983 Eastern Asia-EasternNorth American phytogeographical relationships-a historyfrom the time of Linnaeus to the twentieth century Annalsof the Missouri Botanical Garden 70 423ndash439

CAMPBELL C S M F WOJCIECHOWSKI B G BALDWIN L A AL-ICE and M J DONOGHUE 1997 Persistent nuclear ribosomalDNA sequence polymorphism in the Amelanchier agamiccomplex (Rosaceae) Molecular Biology and Evolution 14 81ndash90

CEVALLOS-FERRIZ S R S 1995 Fruits of Ribes from the Princetonchert British Columbia Canada American Journal of Botany82(6 supplement) 84

COVILLE F V and N L BRITTON 1908 Grossulariaceae NorthAmer-ican Flora 22 193ndash225

CUNNINGHAM C W 1997 Can three incongruence tests predictwhen data shold be combined Molecular Biology and Evolution14 733ndash740

DEQUEIROZ A M J DONOGHUE and J KIM 1995 Separate versuscombined analysis of phylogenetic evidence Annual Review ofEcology and Systematics 26 657ndash681

DONOGHUE M J C D BELL and J LI 2001 Phylogenetic patternsin northern hemisphere plant geography International Journalof Plant Sciences 162 S41ndashS52

DORF E 1930 Pliocene oras of California Carnegie Institution ofWashington Publication 412

FARRIS J S M KALLERSJO A G KLUGE and C BULT 1995 Test-ing signicance of incongruence Cladistics 10 315ndash319

FELSENSTEIN J 1985 Condence limits on phylogenies an ap-proach using the bootstrap Evolution 39 783ndash791

FENTON B A N E BIRCH G MALLOCH P G LANHAM and RM BRENNAN 2000 Gall mite molecular phylogeny and itsrelationship to the evolution of plant host specicity AppliedAcarology 24 831ndash861

FRITSCH P W C M MORTON T CHEN and C MELDRUM 2001Phylogeny and biogeography of the Styracaceae InternationalJournal of Plant Sciences 162 S95ndashS116

GANDOLFO M A P HOC S N SANTILLANA and S A MARENSSI1998 Una or fosil morfologicamente afDaggern a las Grossulari-aceae (orden Rosales) de la Formacion la Meseta (Eoceno me-dio) Isla Marambio Antartida Asociacion Paleontologica Argen-tina Publicacion Especial 5 Paleogeno de America del Sur y de laPenDaggernsula Antartica 147ndash153

GOLDMAN N J P ANDERSON and A G RODRIGO 2000 Likeli-hood-based tests of topologies in phylogenetics SystematicBiology 49 652ndash670

HANNIBAL H 1911 A Pliocene ora from the Coast Ranges ofCalifornia Bulletin of the Torrey Botanical Club 38 329ndash342

HUELSENBECK J P J J BULL and C W CUNNINGHAM 1996 Com-binined data in phylogenetic analysis Trends in Ecology andEvolution 11 152ndash158

JANCZEWSKI M E 1907 Monographies des groseilliers Ribes LMemoires Societe de Physique et DrsquoHistoire Naturelle de Geneve35 199ndash517

KEEP E 1962 Interspecic hybridization in Ribes Genetica 33 1ndash23

KISHINO H and M HASEGAWA 1989 Evaluation of the maximumlikelihood estimate of the evolutionary tree topologies fromDNA sequence data and the branching order in HominoideaJournal of Molecular Evolution 29 170ndash179

KREMENETSKI C V 1998 Holocene history of the northern rangelimits of some trees and shrubs in Russia Arctic and AlpineResearch 30 317ndash333

LINDER C R L R GOERTZEN B V HEUVEL J FRANCISCO-OR-TEGA and R K JANSEN 2000 The complete external tran-scribed spacer of 18Sndash26S rDNA amplication and phylo-genetic utility at low taxonomic levels in Asteraceae andclosely allied families Molecular Phylogenetics and Evolution 14285ndash303

MACGINITIE D 1953 Fossil plants of the Florissant beds ColoradoCarnegie Institution of Washington Publication 599

MADDISON D R and W P MADDISON 2000 MacClade 4 Sun-derland Sinauer Associates

MANCHESTER S R 1999 Biogeographical relationships of NorthAmerican Tertiary oras Annals of the Missouri Botanical Gar-den 86 472ndash522

mdashmdashmdash 2001 Update on the megafossil ora of Florissant Colo-rado Proceedings of the Denver Museum of Nature amp ScienceSeries 4 No1 137

MANOS P S and M J DONOGHUE 2001 Progress in northernhemisphere phytogeography an introduction InternationalJournal of Plant Sciences 162 S1ndashS2

mdashmdashmdash and A M STANFORD 2001 The historical biogeography ofFagaceae tracking the tertiary history of temperate and sub-tropical forests of the northern hemisphere International Jour-nal of Plant Sciences 162 S77ndashS93

MAST A R and T J GIVNISH 2002 Historical biogeography andthe origin of stomatal distributions in Banksia and Dryandra(Proteaceae) based on their cpDNA phylogeny American Jour-nal of Botany 89 1311ndash1323

MESSINGER W K HUMMER and A LISTON 1999 Ribes (Grossu-

2004] 81SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

TABLE 1 Continued

R himalense Decaisne Boufford et al 28903 (A) ETS AY138037 psbA-trnH AY138106 sc 04714258 (MO) ITS AF426369R manshuricum Komarow Arnold Arboretum 67ndash7 ETS AY138038 psbA-trnH AY138107 Chase 3599 (K) ITS AF426320R petraeum Wulfen Chase 3604 (K) ITS AF426318R rubrum L Arnold Arboretum 1119ndash78A ETS (1) AY138039 psbA-trnH AY138108 Arnold Arboretum 214ndash96 ETS (2)

AY138040 Schuhwerk 7039 (NY) ITS AF426321R sativum (Rehbeh) Syme Missouri Botanical Garden ITS AF426323

cv rsquoDiplomarsquo NPGR 747 (Thompson 46 OSC) restriction sitesR spicatum Robs Chase 3609 (K) ITS AF426322R triste Pallas UCBG 941114 ETS (1) AY138041 Arnold Arboretum 407ndash94 ETS (2) AY138042 psbA-trnH AY138109 Mes-

singer 314 (OSC) restriction sites Baldwin 2269 (WS) ITS AF426319Sect Symphocalyx Berland (Golden Currants)

R aureum Pursh UCBG 560948 ETS (1) AY138030 Arnold Arboretum 460ndash81A ETS (2) AY138029 psbA-trnH AY138101NPGR 769 restriction sites Clement 26 (WS) ITS AF426382

R odoratum Wendl UCBG 860126 ETS (1) AY138032 Arnold Arboretum 1192ndash74A ETS (2) AY138031 psbA-trnH AY138102NPGR 691 restriction sites

Subg Grossularia (Mill) PersSect Grossularia (Mill) Nutt

R aciculare Sm AK Skvortsov sn (A) ETS AY137976 psbA-trnH AY138060 ITS AY138050R alpestre Wall ex Decne Boufford et al 28437 (A) ETS AY137975 psbA-trnH AY138059 Chase 3586 (K) ITS AF426349R burejense F Schmidt NPGR 259001 ETS AY137977 psbA-trnH AY138061 restriction sites Messinger 260 (OSC) ITS

AF426355R curvatum JK Small R Kral 53094 (GH) ETS AY137979R cynosbati L Arnold Arboretum 1108ndash78A ETS (1) AY137981 psbA-trnH AY138063 ITS AY138051 Schultheis 590ndash00 (YU)

ETS (2) AY137980R divaricatum Douglas UCBG 851596 ETS (1) AY137982 psbA-trnH AY138064 Chase 3591 (K) ETS (2) AY137983 ITS

AF426347R echinellum (Coville) Rehd Arnold Arboretum 234ndash96 ETS AY137984 psbA-trnH AY138065 ITS AY138052R formosanum Hayata Wang 1096 (MO) ETS (1) AY137985 ITS AF426354 RBGE 19934301 ETS (2) AY137986 psbA-trnH

AY138066R grossularioides Maxim RBGE 19592035 ETS AY137987 psbA-trnH AY138067 ITS AY138053R hirtellum Michx UCBG 860125 ETS (1) AY137988 Schultheis 588ndash00 (YU) ETS (2) AY137989 psbA-trnH AY138068 Chase

3595 (K) ITS AF426353R inerme Rydb Layser 1770 (UW) ETS (1) AY137990 ITS AF426356 Arnold Arboretum 225ndash80A ETS (2) AY137991 psbA-

trnH AY138069R missouriense Nutt WR Smith 11396 (GH) ETS AY137993 psbA-trnH AY138071 Solomon 859 (WS) ITS AF426348R niveum Lindl Messinger 226 (OSC) ETS AY137994 psbA-trnH AY138072 ITS AF426351 NPGR 777001 (Messinger 226

OSC) restriction sitesR oxyacanthoides L

subsp oxyacanthoides NPGR 139001 ETS (1) AY137996 Alverson 1645 (WIS) ETS (2) AY137995 psbA-trnH AY138073Peterson amp Annable 4440 (WS) ITS AF426383

subsp cognatum (Greene) Sinnott Woodland sn (WS) ETS AY137978 psbA-trnH AY138062 ITS AF426357subsp irriguum (Douglas) Sinnott RBGE 19794064 ETS AY137992 psbA-trnH AY138070 ITS AY138054 NPGR 773001

(Messinger 221 OSC) restriction sitessubsp setosum (Lindl) Sinnott Arnold Arboretum 1395ndash83A ETS AY137998 psbA-trnH AY138075 Lackschewitz 7845 (UW)

ITS AF426352R rotundifolium Michx Mitchell amp Barbour 10112 (NYS) ETS AY137997 psbA-trnH AY138074 ITS AY138055R stenocarpum Maxim RBGE 19698970 ETS AY137999 psbA-trnH AY138076 ITS AY138056R uva-crispa L UCBG 870719 ETS (1) AY138001 Arnold Arboretum 1404ndash80B ETS (2) AY138000 psbA-trnH AY138077

Hill 20953 (NY) ( 5 R grossularia L) ITS AF426350Subg Hesperia A BergerR amarum McClatchie UCBG 891081 ETS AY138002 psbA-trnH AY138078R californicum Hook and Arn UCBG 821692 ETS AY138004 psbA-trnH AY138080 ITS AY138057R menziesii Pursh Messinger 233 (OSC) ETS AY138006 psbA-trnH AY138082 ITS AF426364 NPGR 769001 (Messinger 233

OSC) restriction sitesR roezli Regel Nelson sn (WS) ETS AY138007 psbA-trnH AY138083 ITS AF426365

var cruentum (Greene) Regel NPGR 772001 (Messinger 217 OSC) restriction sitesSubg Lobbia A BergerR binominatum AHeller Messinger 260 (OSC) ETS AY138003 psbA-trnH AY138079 ITS AF426359 NPGR 867001 (Messinger

260 OSC) restriction sitesR lobbii A Gray UCBG 851496 ETS AY138005 psbA-trnH AY138081 Smith Jr 7443 (WS) ITS AF426361R velutinum Greene Annable 2503 (NY) ETS AY138011 psbA-trnH AY138085 ITS AF426358 NPGR 865 (Messinger 2551

OSC) restriction sitesR watsonianum Koehne Patrick sn (UW) ETS AY138012 psbA-trnH AY138086 ITS AF426360

Sect Robsonia BerlandR speciosum Pursh UCBG 840004 ETS (1) AY138008 psbA-trnH AY138084 Mort 1371 WS ETS (2) AY138009 ITS AF426362

NPGR 901001 restriction sitesR thacherianum Johnson sn (WS) ETS AY138010 ITS AF426363

82 [Volume 29SYSTEMATIC BOTANY

TABLE 1 Continued

OutgroupsItea virginica L New York Botanic Garden 7698C ETS AY138045 psbA-trnH AY138110 Messinger 337 (OSC) restriction sites

Ware 94 (WS) ITS AY231368I ilicifolia Oliver UCBG 860414 ETS AY138046 psbA-trnH AY138111 ITS AY138058

from Senters and Soltis 2003) It is possible that incongruence be-tween ETS and ITS datasets was due to intraspecic variation anas yet unexplored issue within Ribes that may limit future use ofcomposite accessions The presence of ETS and ITS regions on thesame transcript similar GC contents (ETS5 mean 049 ITS5mean058) similar proportions of invariant characters (ETS5 297462ITS5438700) and similar levels of rate heterogeneity across sites(ETS gamma 5 065 ITS gamma5 057) argued against differentevolutionary processes of sequence evolution as an explanation forincongruence

In order to maximize taxon sampling and data tests were alsoused to assess combinability of taxa represented in three of thefour available datasets While this required the inclusion of taxafor which one dataset was coded as missing the decrease in phy-logenetic accuracy was expected to be insignicant (Weins andReeder 1995)

Phylogenetic Analysis of Sequence Data Analyses of single(ITS ETS and psbA-trnH) and combined datasets were performedusing a parsimony criterion in PAUP 40 All sites and all changeswere equally weighted in contrast to the 13 gains10 loss weight-ing scheme used by Messinger et al (1999) in their analyses ofrestriction site data psbA-trnH data were analyzed both with in-dels treated as missing data and with seven large indels includedas binary characters Positions 309ndash327 and 448ndash465 of the alignedpsbA-trnH dataset were excluded from all analyses due to ambig-uous alignments

Analyses of the ITS ETS and psbA-trnH datasets consisted ofheuristic searches with 100 replicates of random addition and TBRbranch swapping No more than 400 trees greater than a speciedlength (234 for ETS 556 for ITS 137 for psbA-trnH) were savedper replicate or in the case of psbA-trnH with indels no more than250 trees greater than length 144 The limiting tree length wasdetermined based on the shortest trees found in prior incompletesearches and was imposed to prevent computational overloadsearching sub-optimal trees Analyses of all datasets combined orof combined chloroplast datasets were conducted with the branch-and-bound algorithm with taxa excluded based on partition ho-mogeneity test results For datasets combining ETS1ITSETS1psbA-trnH psbA-trnH1rDNA or all data for those taxa rep-resented in three of the four datasets analyses consisted of heu-ristic searches with 100 replicates of random addition TBR branchswapping and maxtrees set to 40000

Clade support was assessed using bootstrap analyses (Felsen-stein 1985) as implemented in PAUP 40 with 300 replicates ofheuristic searches each with 5 replicates of random taxon additionand Nearest Neighbor Interchange (NNI) branch swapping Forthe combination of all four datasets and for the combined chlo-roplast datasets clade support was assessed using 100 bootstrapreplicates each with branch and bound searches

Kishino-Hasegawa Tests The parsimony implementation of theKishino-Hasegawa test (Kishino and Hasegawa 1989) in PAUP 40was used to compare the hypothesis of subg Grossularia monophylyto that of subg Grossularia non-monophyly in which sect Grossu-larioides and sect Grossularia form a clade The parsimony version ofthe test was used because comparisons included restriction site dataAs recommended by Goldman et al (2000) comparisons were be-tween a priori hypotheses based on previously published phyloge-nies (Messinger et al 1999 Senters and Soltis 2003)

Analyses were run enforcing each of two constraint trees Therst constraint tree resolved subg Grossularia as monophyletic butleft relationships within subg Grossularia and among all remain-ing species unresolved The second constraint tree enforced res-olution of a clade containing sect Grossularioides plus sect Gros-

sularia but relationships within this clade were left unresolved aswere relationships among all remaining species Comparisonswere between trees from constrained branch and bound searchesfor the chloroplast data and from constrained heuristic searchesfor the rDNA data

Ancestral Area Reconstruction Ancestral areas were inferredusing DIVA which assigns areas to internal nodes such that dis-persal and extinction events are minimized (Ronquist 1996 1997)Default costs were used (vicariance 5 0 dispersal 5 1 extinction51) and the number of inferred areas per node was left uncon-strained These analyses used trees from the combined psbA-trnHand rDNA datasets (Fig 8) with species assigned to one or moreof four areas (eastern North America western North Americaeastern Eurasia and western Eurasia) Geographic distributionsfollowed Berger (1924) Janczewski (1907) and Sinnott (1985) SectCalobotrya R aureum R bracteosum R watsonianum and the cladecontaining the remaining glabrous-styled gooseberries (HesperiaLobbia Robsonia) were all coded with western North American dis-tributions Sect Grossularioides was coded for both North Americaand eastern Eurasia Subg Berisia was coded for both eastern andwestern Eurasia Ribes triste was coded for all areas except westernEurasia Itea was coded for both eastern North America and east-ern Eurasia

Because DIVA analyses do not permit polytomies we treated Raureum and R bracteosum as sister taxa Within sect Grossulariamembers of the Asian gooseberry clade were all coded as easternEurasia The remaining species of the large polytomy all live inwestern or eastern North America We resolved this polytomy inseveral different ways so as to explore some of the possibilitiesFor example in some analyses we created one eastern NorthAmerican and one western North American clade In others theNorth American species were arranged pectinately in relation tothe Asian clade

RESULTS

Sequence Characteristics and Analyses The aligned18ndash26S rDNA ITS dataset including 58S(positions 283ndash452) was 700 bp (282bp5ITS1 248bp5ITS2) with 28of the data matrix coded as missing data For the regionas a whole sequences ranged from 438ndash662bp (varia-tion due in part to missing terminal sequence data)uncorrected pairwise distances within Ribes rangedfrom 00ndash008 distances with Itea ranged from 027(with R missouriense) to 032 (with R malvaceum) andmean GC content was 058 Of the 700 aligned base-pairs 528 were constant within Ribes and 183 wereparsimony informative ITS1 displayed higher levels ofdivergence and a higher proportion of informativecharacters than did ITS2 (ITS1 5 00ndash015 65282 in-formative ITS2 5 00ndash011 25248 informative) In-cluded ITS1 sequences ranged from 34ndash258bpwith thelower limit due to taxa for which much of ITS1 se-quence data was missing ITS2 sequences ranged from216ndash241bp 58S ranged from 161ndash164bp but was only142bp in R sanguineum due to a large deletion

2004] 83SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

Lengths and GC contents fell within the ranges re-ported for a survey of angiosperm taxa (Baldwin et al1995) Analyses of the ITS and 58S regions generated36400 trees (length5556 CI5065 058 excluding un-informative characters RI5084)

Amplied products from the 18ndash26S rDNA inter-genic spacer region were approximately 2kb in R odor-atum (sect Symphocalyx) and 3kb in R hirtellum (sectGrossularia) the two species used to design internalprimers for amplifying 39 ETS Only 406bp of the 39end of the ETS region and 56bp of the 59 end of 18Swere sequenced in this study Included sequencesranged from 299ndash462bp in size with some variationdue to missing terminal sequence data and had amean GC content of 049 Uncorrected pairwise dis-tances among ETS sequences within Ribes ranged from00 to 007 Pairwise distances between Ribes and Itearanged from 026 (with R oxyacanthoides accession 2)to 032 (with R triste accession 1) Of the 462 alignedbasepairs 388 were constant within Ribes 60 were par-simony informative and 2 were coded as missingdata ETS analyses generated 34005 trees (length5234CI5080 074 excluding uninformative charactersRI5093 Fig 2)

The aligned psbA-trnH intergenic spacer dataset was502bp including a 39 portion of psbA (positions 1ndash37)and a 59 portion of trnH (position 484ndash502) One per-cent of the matrix was coded as missing data Includedsequences ranged from 355ndash445bp in length withsome variation due to missing terminal sequence dataand had a mean GC content of 029 The spacer regionalone ranged from 352ndash378bp within Ribes and was369bp in Itea based on complete sequences Uncor-rected pairwise distances (including psbA and trnHterminals) within Ribes ranged from 00 to 004 Dis-tances between Ribes and Itea ranged from 015 (withR odoratum accession 2) to 021 (with R bracteosum)Within Ribes 405465 included characters were con-stant and 34465 were parsimony informative Ex-cluded characters represented a polyA region rangingfrom 4ndash13bp and a 16ndash18bp insertion in Itea (relativeto Ribes) with which 5ndash6bp segments of Ribes could bealigned in various ways Analyses of sequence datafrom the psbA-trnH intergenic spacer produced 34000trees with little homoplasy (length5137 CI5092 088excluding uninformative characters RI5094 Fig 3)Analyses including indels coded as binary charactersproduced 18001 trees (length5144 CI5092 090 ex-cluding uninformative characters RI5095)

Trees Generated by Analyses of IndividualDatasets Results from the expanded ITS datasetconcur with those presented by Senters and Soltis(2003) and are not illustrated here Subg Grossulariawas resolved as monophyletic in ITS and ETS treeswith weak to moderate bootstrap support (Figs 1 2)psbA-trnH trees showed little resolution but did not

conict with a monophyletic subg Grossularia (Fig 3trees from analyses including indels are not shown)

Two main lineages may be identied within subgGrossularia the true gooseberries (sect Grossularia) andthe glabrous-styled gooseberries (Hesperia Lobbia Rob-sonia) The glabrous-styled gooseberries are resolved asa clade in ITS restriction site and psbA-trnH trees(Figs 1 3 Messinger et al 1999) ETS trees also resolvethe glabrous-styled gooseberries (Hesperia Lobbia Rob-sonia) as a clade with the exception of R watsonianum(subg Lobbia) placed with strong support in the truegooseberry clade (sect Grossularia) (Fig 2) The integ-rity of the individual sections comprising the glabrous-styled gooseberries (Hesperia Lobbia Robsonia) is un-clear The true gooseberries (sect Grossularia) are re-solved as a clade in restriction site ITS and ETS trees(including R watsonianum in the latter) and in psbA-trnH trees when indels are included (Figs 1 2 Mes-singer et al 1999 Senters and Soltis 2003) If indels areignored psbA-trnH trees resolve the majority of truegooseberries as a clade and are consistent with amonophyletic sect Grossularia (Fig 3) Within sectGrossularia the ETS dataset provided strong supportfor an Asian clade including the European R uvacris-pa ITS trees were consistent with an Asian clade butexcluded R uvacrispa psbA-trnH trees were also con-sistent with an Asian clade with the weakly support-ed inclusion of the North American R oxyacanthoidessubsp irriguum Restriction site trees had limited sam-pling in sect Grossularia but were consistent with anAsian versus North American divergence (Messingeret al 1999)

All datasets except the restriction sites resolved aclade comprising sect Calobotrya sect Grossularioidesand subg Grossularia (sect Grossularia sect Robsoniasubg Lobbia Hesperia) Members of this clade are large-ly from western North America with sect Grossulariahaving a wider distribution ETS trees included theblack currant Ribes bracteosum (sect Coreosma) withinthis clade in an unresolved position (Fig 2) ITS treesincluded the South American sect Parilla in this cladein an unresolved position (Senters and Soltis 2003) Inall trees sect Calobotrya was resolved as monophyleticincluding some members of sect Heritiera in restrictionsite and ITS trees (only one species of sect Heritierawas included in ETS and psbA-trnH analyses and fallselsewhere) Section Grossularioides was resolved withstrong support in ETS and ITS trees (Figs 1 2 Sentersand Soltis 2003) but is unresolved or strongly para-phyletic in the psbA-trnH and restriction site trees re-spectively (Figs 1 3 Messinger et al 1999)

The clade containing sects Calobotrya Grossularioidesand subg Grossularia was clearly nested within Ribesin ITS ETS and psbA-trnH trees (Figs 2 3 Senters andSoltis 2003) Among the remaining sections of Ribesall datasets provided strong support for sect Berisia

84 [Volume 29SYSTEMATIC BOTANY

FIG 2 The majority-rule consensus of 34005 trees resulting from analyses of ETS sequence data (CI5080 074 excludinguninformative characters RI5093) Numbers above the branches indicate the percentage of bootstrap replicates in which theclade appeared Numbers in parentheses below the branches indicate the percentage of trees in which the clade appearedwhen less than 100

2004] 85SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 3 The majority-rule consensus of 34000 trees resulting from analyses of psbA-trnH sequence data (CI5092 088excluding uninformative characters RI5094) Numbers above the branches indicate the percentage of bootstrap replicates inwhich the clade appeared Numbers in parentheses below the branches indicate the percentage of trees in which the cladeappeared when less than 100

86 [Volume 29SYSTEMATIC BOTANY

FIG 4 The strict consensus of six trees resulting fromanalyses of psbA-trnH sequence data combined with chloro-plast restriction site data (Messinger et al 1999) (CI5090 079excluding uninformative characters RI5087) Data combina-bility determined by partition homogeneity tests (p5066)Numbers above the branches indicate the percentage of boot-strap replicates in which the clade appeared

with the inclusion of some species of sect Ribes in ITStrees (Senters and Soltis 2003) Section Symphocalyxwasstrongly resolved in ETS and restriction site trees (Fig2 Messinger et al 1999) but was unresolved in psbA-trnH trees (Fig 3) (ITS trees included only one species)Section Heritiera appeared to be polyphyletic in ITSand restriction site trees (only one species of sect Her-itiera is included in ETS or psbA-trnH analyses) (Mes-singer et al 1999 Senters and Soltis 2003) The mono-phyly of sects Ribes and Coreosma remain unclear Forthose species sampled sect Ribes was resolved asmonophyletic in restriction site trees (Messinger et al1999) as monophyletic excluding R triste in ETS andpsbA-trnH trees (Figs 2 3) and as polyphyletic in ITStrees with some species clearly related to sect Berisia(Senters and Soltis 2003) Section Coreosma was re-solved as polyphyletic in ETS and restriction site trees(Fig 2 Messinger et al 1999) and as para- or poly-phyletic in ITS trees (Senters and Soltis 2003) (only onespecies was included in the psbA-trnH dataset) Previ-ous restriction site analyses of 18ndash26S rDNA suggestedthat members of sect Coreosma were divergent fromone another and from other Ribes species (Messingeret al 1993) Sampling from sect Parilla was too limitedto draw strong conclusions but the ITS trees support-ed its monophyly to the exclusion of R fasciculatumthe only non-South American member of the section(Senters and Soltis 2003) Relationships among the sec-tions outside of the predominantly western NorthAmerican clade (sects Calobotrya Grossularioides subgGrossularia) varied markedly among datasets with lit-tle support for any one resolution (Figs 2 3)

Trees Generated from Analyses of CombinedDatasets Dataset combinability is typically based ona critical value of p 5 005 (ie datasets are incongru-ent when p 005) However studies suggest that acritical value of p 5 005 may be too strict such thatthe null hypothesis of dataset congruence will be false-ly rejected (Huelsenbeck et al 1996 Sullivan 1996Cunningham 1997) and that a value such as p 5 001may be more appropriate (Cunningham 1997) Manyof the datasets reported here were not combinablebased on intitial partition homogeneity tests but theincongruence was generally eliminated when problem-atic taxa were excluded

Analyses of the readily combinable chloroplast psbA-trnH and restriction site data (p5066) generated sixtrees (length 144 CI5090 079 excluding uninforma-tive characters RI5087) In agreement with analysesof restriction site data alone true gooseberries (sectGrossularia) were not placed as sister to the remainingglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) suggesting that subg Grossularia is not monophy-letic (Figs 1 4) The true gooseberries were nested ina paraphyletic sect Grossularioides as in the restrictionsite trees with sect Calobotrya weakly placed as sister

Support for sect Grossularia sect Calobotrya and theglabrous-styled gooseberries (Hesperia Lobbia Robsonia)increased relative to analyses of either dataset alone(Fig 3 Messinger et al 1999) Support for a paraphy-letic sect Grossularioides decreased slightly relative tothe restriction site analyses (Fig 4 Messinger et al1999)

Analyses of the combined ETS and ITS rDNA data(p5004 excluded R fasciculatum R glandulosum Rhimalense R manshuricum R nevadense R rubrum Roxyacanthoides subsp oxycanthoides R uvacripsa) gener-ated 150 trees (length 614 CI5077 070 excluding un-informative characters RI5085) (Fig 5) Subg Gros-sularia was monophyletic as were the true gooseber-ries (sect Grossularia) (Fig 5) The glabrous-styledgooseberries (Hesperia Lobbia Robsonia) were stronglyresolved as monophyletic with the exception of R wat-sonianum (sect Lobbia) placed strongly as sister to thetrue gooseberries Within sect Grossularia only theAsian clade was resolved with strong support Theclade containing subg Grossularia sect Grossularioi-dies and sect Calobotrya was again evident with sectGrossularioides resolved as sister to subg GrossulariaSupport for the glabrous-styled gooseberries (HesperiaLobbia Robsonia) sect Calobotrya sect Grossularioidesand the Asian clade within sect Grossularia increasedrelative to support from ETS or ITS datasets analyzedindividually (Figs 2 5 Senters and Soltis 2003)

The most evident difference between chloroplast and

2004] 87SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 5 The strict consensus of 150 trees resulting from analyses of combined ETS and ITS sequence data (CI5077 070excluding uninformative characters RI5085) Data combinability determined by partition homogeneity tests (p5004) Num-bers above the branches indicate the percentage of bootstrap replicates in which the clade appeared

88 [Volume 29SYSTEMATIC BOTANY

FIG 6 The strict consensus of four trees resulting from analyses of the four datasets combined (ETS ITS psbA-trnHchloroplast restriction sites) Data combinability was determined by partition homogeneity tests (p5075) Numbers above thebranches indicate the percentage of bootstrap replicates in which the clade appeared

rDNA trees was the position of sect GrossularioidesSubgenus Grossularia is monophyletic in rDNA treeswith sect Grossularioides placed weakly as sister (Fig5) In contrast subg Grossularia is polyphyletic in chlo-roplast trees with sect Grossularia nested within sectGrossulariodes and sect Calobotrya sister to that group-ing (Fig 4) Analyses of the combined chloroplast andrDNA datasets (p5075 excluded R glandulosum Rlacustre R montigenum) generated four trees (length556 CI5088 069 excluding uninformative charactersRI5076) (Fig 6) Taxon sampling was limited due tothe limited overlap among datasets but trees showedstrong resolution of sect Calobotrya sect Grossulariaand the glabrous-styled gooseberries (Hesperia Lobbia

Robsonia) These groups again formed a well-support-ed clade nested within Ribes (Fig 6) The strongly sup-ported sister-group relationship between the true andglabrous-styled gooseberries (Fig 6) is consistent withthe monophyly of subg Grossularia but could changewith the inclusion of sect Grossularioides

ETS and psbA-trnH combined analyses (p5004 ex-cluded R oxyacanthoides subsp irriguum) generated 329trees (length 372 CI5084 077 excluding uninforma-tive characters RI5090) (Fig 7) Subgenus Grossulariawas resolved as monophyletic within which both theglabrous-styled and the true gooseberries were strong-ly supported the latter including R watsonianum(subg Lobbia) The Asian clade was well supported

2004] 89SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 7 The strict consensus of 329 trees resulting from analyses of combined ETS and psbA-trnH data (CI5084 077excluding uninformative characters RI5091) Dataset combinability was determined by partition-homogeneity tests (p5 004)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared

within sect Grossularia including the European R uva-crispa Both sect Calobotrya and sect Grossularioideswere strongly supported but neither was resolved assister to subg Grossularia The clade comprising subgGrossularia sect Grossularioides and sect Calobotryawas again evident nested within Ribes

Combined analyses of psbA-trnH and rDNA datasets(p5002 excluded R oxyacanthoides subsp irriguum andtaxa excluded from ETS1ITS analysis) generated 3080trees (length 5 719 CI5080 074 excluding uninfor-mative characters RI5085) Sects Grossularioides Calo-botrya Grossularia and the glabrous-styled gooseberries

90 [Volume 29SYSTEMATIC BOTANY

(Hesperia Lobbia Robsonia) were each strongly support-ed and again formed a strongly supported clade nestedin Ribes (Fig 8) Support for the monophyly of subgGrossularia was increased relative to support seen withany individual dataset (Figs 2 3 8)

Combinability (p5012) of all datasets for those taxarepresented in three of the four datasets required ex-clusion of composite taxa problematic within therDNA dataset as well as exclusion of taxa problematicfor the chloroplast versus rDNA datasets Combinedanalyses generated 4802 trees (length5768 CI5080074 excluding uninformative characters RI5085)Sec-tion Calobotrya sect Grossularia and the glabrous-styled gooseberries (Hesperia Lobbia Robsonia) exclud-ing R watsonianum were each well supported and to-gether formed a strongly supported clade (Fig 9) Sub-genus Grossularia was resolved as monophyleticbearing in mind that sect Grossularioides was excludedfrom the analyses

While all combined datasets resolved the clade con-taining sects Calobotrya Grossularioides and subgGrossularia as nested within Ribes (Figs 4ndash9) relation-ships among other lineages were unclear as in theanalyses of individual datasets (Figs 2 3) Basal rela-tionships were unresolved in the analyses of combinedchloroplast data (Fig 4) The combined ETS and psbA-trnH analyses suggested basal positions for goldencurrants (sect Symphocalyx) (Fig 7) All remaininganalyses suggested basal positions for sects Berisiaand Ribes (Figs 5 6 8 9) Basal relationships were notwell-supported in any analysis

Kishino-Hasegawa Tests Trees generated fromanalyses constraining the monophyly of subg Gros-sularia versus trees constrained to resolve a sister re-lationship between sect Grossularioides and sect Gros-sularia were marginally but signicantly different inboth the chloroplast (p5003) and the rDNA (p5005)datasets

Ancestral Area Reconstructions DIVA reconstruc-tions of ancestral areas support a western North Amer-ican origin for a large segment of Ribes beginningwith node 2 in Fig 8 Within this clade it is also thecase that subg Grossularia is inferred to have diversi-ed rst within western North America (Fig 8 node6) Subsequent movement to eastern Asia is inferred tohave occurred somewhere within sect Grossularia butthe ancestral area for the true gooseberries is equivo-cal and can include virtually any combination of areasdepending on the exact resolution of the large poly-tomy at the base of this clade (Fig 8 node 8) Impor-tantly our results indicate that the Asian species with-in sect Grossularia form a clade implying a single mi-gration from North America to Asia The ancestralarea for Ribes is reconstructed to be western NorthAmerica and western Eurasia or western North Amer-ica and all of Eurasia (Fig 8 node 1) However this

result hinges on resolution at the base which remainshighly uncertain and requires more intensive samplingof Ribes lineages outside of subg Grossularia

DISCUSSION

Gooseberry Monophyly Results from previousphylogenetic analyses based on nuclear 18Sndash26S rDNAITS data (Senters and Soltis 2003) and chloroplast re-striction site data (Messinger et al 1999) differed re-garding gooseberry monophyly Adding the additionalnuclear 18Sndash26S rDNA ETS and chloroplast psbA-trnHdatasets could increase support and resolution in re-sulting topologies or could reinforce the differencesbetween the nuclear and chloroplast topologies witheach reecting accurate but separate histories

Initial examination of the trees produced with theadditional datasets reinforced the apparent conict be-tween nuclear and chloroplast genomes ITS ETS andcombined rDNA datasets supported the monophyly ofsubg Grossularia (Figs 1 2 5) In contrast the com-bined chloroplast datasets (restriction sites plus psbA-trnH) suggested a closer relationship between the trueand glabrous-styled gooseberries than did the restric-tion site data alone (Fig 1 Messinger et al 1999) butstill resolved subg Grossularia as non-monophyleticwith sect Grossularioidies forming a grade at the baseof sect Grossularia (Fig 4) The increase in tree lengthwhen combined chloroplast data was constrained toresolve a monophyletic subg Grossularia (p5003) orwhen combined rDNA data was constrained to resolvesects Grossularioides and Grossularia as a clade(p5005) also indicated dataset incongruence

The discrepancy between nuclear and chloroplast to-pologies primarily involved the restriction sites datasetand not the psbA-trnH dataset The psbA-trnH datasetprovided little resolution (Fig 3) conicting with nei-ther the rDNA nor the restriction sites topologiesAnalyses combining the psbA-trnH data with either theETS data (p5004 Fig 7) or the rDNA data (p5002Fig 8) produced trees resolving subg Grossularia asmonophyletic with increased support relative to ETSor rDNA data alone (Figs 2 5) Section Grossularioideswas either sister to subg Grossularia (psbA-trnH 1rDNA Fig 8) or was unresolved in a polytomy withsubg Grossularia and sect Calobotrya (psbA-trnH 1ETS Fig 7) The monophyly of subg Grossularia wasalso supported by analyses of all datasets combinedwhether including taxa represented in all four datasets(p5075 Fig 6) or in three of the four datasets(p5012 Fig 9) Analyses combining all datasets re-quired exclusion of sect Grossularioides thus leavingsubg Grossularia monophyly uncertain However in-cluding sect Grossulariodes in spite of dataset incon-gruence (p5001) produced trees resolving a mono-phyletic subg Grossularia sister to a monophyletic sectGrossularioides (not shown)

2004] 91SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 8 The strict consensus of 3080 trees resulting from analyses of combined psbA-trnH and rDNA data (CI 5 080 074excluding uninformative characters RI 5 085) Dataset combinability was determined by partition homogeneity tests (p5002)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared DIVA (Ronquist 1996)was used to infer ancestral areas at the numbered nodes The ancestral areas at nodes two through seven were reconstructedas western North America Node one was reconstructed as western North America plus either western Eurasia or all of EurasiaThere were multiple possible reconstructions at node 8 including (1) western North America and eastern Eurasia (2) NorthAmerica and eastern Eurasia (3) North America or (4) western North America

92 [Volume 29SYSTEMATIC BOTANY

FIG 9 The strict consensus of 4802 trees resulting from analyses of all four datasets (ITS ETS psbA-trnH chloroplastrestriction sites) including taxa represented in at least three datasets (CI5080 074 excluding uninformative charactersRI5085) Dataset combinability was determined using partition homogeneity tests (p5012) Numbers above the branchesindicate the percentage of bootstrap replicates in which the clade appeared

2004] 93SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

The general picture that emerges from these analy-ses suggests that subg Grossularia is monophyletic(Figs 2 5ndash9) rDNA data supported gooseberry mono-phyly (Figs 2 5) psbA-trnH data while lacking suf-cient variation to resolve gooseberry monophyly ornon-monophyly supported gooseberry monophyly incombination with rDNA data (Figs 7 8) Finally anal-yses of all datasets combined supported gooseberrymonophyly although these analyses excluded thespiny currants (sect Grossularioides) (Figs 6 9) Whatrequires further investigation is the role hybridizationmay have played in the history of the spiny currants(sect Grossularioides) and the true gooseberries (sectGrossularia) Messinger et al (1999) encouraged furtherexploration of this possibility in Ribes in which theynoted potential chloroplast capture of the sect Gros-sularia chloroplast type by sect Grossularioides Crosseshave not been successful between species of sect Gros-sularioides and other sections within Ribes and are usu-ally unsuccessful between sections or subgenera (Keep1962) Conrmation of the pattern seen in trees gen-erated from the chloroplast restriction site data (Mes-singer et al 1999) is needed from additional chloro-plast datasets that provide greater resolution than didthe psbA-trnH dataset

Relationships Within the Gooseberries SubgenusGrossularia comprises two main lineages (Figs 2 5ndash9)the true gooseberries (sect Grossularia) and a clade ofglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) The four gooseberry sections are traditionally dis-tinguished from each other by basally pubescent stylesin sect Grossularia (with the exception of some Asianspecies) by four versus ve parted owers in sect Rob-sonia by anthers broader at the base in subg Hesperiaand by the absence of the above set of features in subgLobbia The glabrous-styled gooseberry lineage com-prising 27 species distributed through western NorthAmerica into Mexico (Berger 1924) was well-support-ed given our sampling but sections within this lineagewere not resolved Ribes watsonianum (subg Lobbia)was surprisingly placed outside of the glabrous-styledgooseberry lineage as sister to the true gooseberries(Figs 2 5 7ndash9) ITS data resolved R watsonianum with-in the glabrous-styled gooseberry lineage (Senters andSoltis 2003) but ETS data strongly resolved the specieswithin the true gooseberry lineage (sect Grossularia)(Fig 2) This conict within the rDNA data may reecthybridization between R watsonianum and a memberof sect Grossularia followed by xation within the Rwatsonianum genome of a recombinant rDNA repeattype Accounts of Ribes hybrids in the eld are rela-tively rare (Messler et al 1991) and do not implicateR watsonianum but fertile hybrids can be obtainedfrom articial crosses between glabrous-styled goose-berries and true gooseberries (Keep 1962 citing R lob-bii 3 R divaricatum) Alternatively R watsonianum may

posses multiple rDNA repeat types with different re-peat types sampled in our ITS versus ETS datasetsEach of these possibilities has been reported in otherplant taxa (Wendel et al 1995a Campbell et al 1997for potential recombinant rDNA repeat types Suh etal 1993 Wendel et al 1995b for incomplete homoge-nization of rDNA repeat types)

The true gooseberries (sect Grossularia) have a broadrange throughout the northern hemisphere with ninespecies in North America (Sinnott 1985) and seven spe-cies in Eurasia (Berger 1924) In his treatment of NorthAmerican gooseberries Sinnott (1985) divided his ninespecies into ve groups based on phenetic analysesThe groups consisted of (1) R cynosbati with spinyfruits (2) R niveum R curvatum and R missouriensewith highly exserted stamens and long sepals (3) Rrotundifolium and R divaricatum with medium lengthstamens and purple sepals (4) R inerme and R hirtel-lum with intermediate length stamens and small oralfeatures and (5) the ve subspecies of R oxyacanthoi-des with short stamens Sinnott (1985) recommendedthat R echinellum be excluded from the true gooseber-ries and aligned with the glabrous-styled gooseberriesof western North America (Hesperia Lobbia Robsonia)The analyses presented here showed strong supportfor the inclusion of R echinellum as well as the Eurasianspecies within the true gooseberry lineage (Figs 2ndash35 7ndash9) Resolution among the North American specieswas lacking or not well-supported (Figs 2ndash9) and thusneither supported nor conicted with Sinnottrsquos hy-pothesized relationships

The seven Eurasian species of sect Grossularia (Ber-ger 1924) include R uvacrispa in Europe R alpestre andR aciculare in the Himalayan region R stenocarpumand R formosanum in southern and eastern Asia andR burejense and R grossularioides in northern and east-ern Asia A clade of Asian species is well-supported(Figs 2 5 7ndash9) with possible inclusion of R uvacrispa(Figs 2 7) The psbA-trnH dataset includes R oxyacan-thoides subsp irriguum within the Asian clade (Fig 3)but this is weakly supported (Fig 3) and requires fur-ther substantiation particularly since R oxyacanthoidessubsp irriguum is restricted to northwestern NorthAmerica and may itself be of hybrid origin from cross-es between R oxyacanthoides subsp setosum and R in-erme (Sinnott 1985) both distributed in western NorthAmerica Resolution within the clade of Asian speciessuggests a correspondance to geographic and oristicregions within Asia Whether the Asian and NorthAmerican true gooseberries represent divergent line-ages or a monophyletic Asian clade nested within aNorth American grade is unclear given the availabledata

Other Groups within Ribes Since this study fo-cused on the gooseberries sampling within other sec-tions of Ribes was sometimes limited Nevertheless the

94 [Volume 29SYSTEMATIC BOTANY

data did support the monophyly of sects CalobotryaParilla Symphocalyx and Berisia Section Calobotrya is agroup of 21 western North American species (Berger1924) known as the ornamental currants The mono-phyly of sect Calobotrya was well-supported with theinclusion of some dwarf currants (sect Heritieria) (Figs2ndash9 Messinger et al 1999 Senters and Soltis 2003)Sampling was limited in sect Parilla a group of 41dioecious South American species (Janczewski 1907)but the group was supported in ITS trees excludingthe east Asian R fasciculatum the sectionrsquos only non-South American species (Senters and Soltis 2003) Apossible sister relationship between sect Parilla andsect Calobotrya (unpubl data cited in Weigend andBinder 2001) is consistent with the position of sect Pa-rilla seen with ITS data (Senters and Soltis 2003) Sec-tion Symphocalyx the golden currants includes vespecies distributed through northern Mexico and cen-tral and western North America (Berger 1924) Thegolden currants were well-supported given the avail-able sampling (Fig 2 4 9) The alpine currants sectBerisia are a group of 17 dioecious species distributedthrough Eurasia (Janczewski 1907) The monophyly ofsect Berisia was well-supported (Figs 2ndash9 Messingeret al 1999) but with the inclusion of some red currants(sect Ribes) in ITS trees (Senters and Soltis 2003)

The monophyly of sects Ribes and Coreosma wasquestionable (Figs 2 3 5) The red currants (sect Ri-bes) are a group of 15 Eurasian species with one spe-cies R triste also distributed in North America Sec-tion Coreosma the black currants includes six speciesin North America and six in Eurasia (Berger 1924) Sec-tion Heritiera the dwarf currants appeared to be poly-phyletic as seen in Messinger et al (1999) and Sentersand Soltis (2003) This group of six species (Berger1924) is dened primarily by a prostrate habit and assuggested by Messinger et al (1999) is likely a case ofconvergence

Biogeography The spread of taxa around theNorthern Hemisphere has been facilitated by the avail-ability at various times of two major migrationroutesmdashthe Beringian and the North Atlantic landbridges (Tiffney 1985a 1985b Donoghue et al 2001SanmartDaggern et al 2001) Especially in large and relative-ly old clades which have become widespread aroundthe Northern Hemisphere it is possible (perhaps evenlikely) that both pathways were used Information onthe timing of key divergences and on the direction ofmovement within subclades will be critical in sortingout the possibilities in particular cases Ribes providesan excellent example of such a group being represent-ed in Eurasia by six sections (Berisia Ribes and somespecies from Heritiera Coreosma Grossularioides andGrossularia) in western North America by nine (Sym-phocalyx Calobotrya Robsonia Hesperia Lobbia andsome species of Coreosma Heritiera Grossularioides and

Grossularia) and in eastern North America by three(some species of Heritiera Ribes and Grossularia) Oneapproach for sorting through a complex biogeographichistory as might be expected in Ribes is to examinephylogenetic patterns in component clades and ide-ally to date divergences

Our analyses indicate that subg Grossularia is nestedwithin a predominantly western North Americanclade (Figs 2 5ndash9) and that it diversied initially inthat region (Fig 8 node 6) Subsequently within sectGrossularia it appears that movement occurred fromwestern North America to eastern Asia presumablythrough Beringia followed by vicariance and the ori-gin and diversication of the well-supported Asiangooseberry clade Donoghue et al (2001) and Xiangand Soltis (2001) highlighted cases of movement out ofAsia into North America through the Bering LandBridge Ribes appears to provide a case of movementin the opposite direction Movement in both directionsis of course to be expected What remains to be de-termined in future studies of disjunct taxa is exactlywhich groups moved in which directions and whetherthere are any signicant generalizations that can bemade about these different patterns

Elsewhere in Ribes there are other possible cases ofmovement between North America and Asia One caseinvolves R lacustre of sect Grossularioides which is dis-tributed in eastern Asia as well as in North AmericaOther possible cases relate to resolution at the base ofRibes where relationships remain uncertain The basalpositions of sect Symphocalyx in trees resulting frompsbA-trnH data and from the combination of psbA-trnHand ETS data suggest a western North American ori-gin for the entire clade (Figs 2 7) This would implyearly dispersion to Asia giving rise to sects Berisiaand Ribes However all other datasets and dataset com-binations suggested a broader Eurasian plus westernNorth American distribution at the base (Fig 8 node1) owing to the basal positions of sects Berisia andRibes This would imply early vicariance involvingAsia and North America and movement back to Asiawithin the western North American clade Future stud-ies should include more sampling of sects Berisia Ri-bes Coreosma and Symphocalyx to help resolve basal re-lationships and biogeographic patterns in Ribes

The fossil record for Ribes consists largely of leaveswith few reports of seeds (Kremenetski 1998) fruits(Cevallos-Ferriz 1995) and owers (Gandolfo et al1998) The leaf record for Ribes in North America mayextend from approximately 2 mya (Hannibal 1911Dorf 1930 Axelrod 1966) to at least 345 mya (Mac-Ginitie 1953 Manchester 2001) and possibly to 45 or50 mya (Axelrod 1998 Wehr and Hopkins 1994) Al-though leaf features are seldom used to distinguishextant taxa of Ribes Wolfe (1964) used leaf serrationand venation features to distinguish between fossil

2004] 95SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

leaves of subg Ribes and subg Grossularia from Ne-vada If these features are reliable this dates subgGrossularia to at least 14 mya (Fig 9 node 6) A criticalnext step in understanding Ribes biogeography will beto accurately assign Ribes fossils to particular sub-clades so as to infer the timing of intercontinental di-vergences

ACKNOWLEDGEMENTS We thank the following individuals andinstitutions for providing plant material B Alverson D BouffordR Mitchell Arnold Arboretum of Harvard University Universityof California Botanical Garden Royal Botanic Garden EdinburghNew York Botanical Garden and the USDA-ARS National PlantGermplasm Repository A Senters and D Soltis graciously pro-vided numerous DNA aliquots DNA sequences and access to ear-ly manuscripts H Schorn and D Erwin provided assistance withpaleobotanical literature M Lavin P Herendeen and two anon-ymous reviewers provided numerous helpful comments This proj-ect was supported in part by a Putnam Fellowship through theArnold Arboretum of Harvard University

LITERATURE CITED

AVISE J C 1994 Molecular markers natural history and evolutionNew York Chapman amp Hall

AXELROD D I 1966 The Pleistocene Soboba ora of southern Califor-nia University of California Publications in Geological Sci-ences 60

mdashmdashmdash 1998 Thunder Mountain Idaho University of CaliforniaPublications in Geological Sciences 142

BALDWIN B G and S MARKOS 1998 Phylogenetic utility of theexternal transcribed spacer (ETS) of 18Sndash26S rDNA Congru-ence of ETS and ITS trees of Calycadenia (Compositae) Mo-lecular Phylogenetics and Evolution 10 449ndash463

mdashmdashmdash M J SANDERSON J M PORTER M F WOJCIECHOWSKI CS CAMPBELL and M J DONOGHUE 1995 The ITS region ofnuclear ribosomal DNA a valuable source of evidence onangiosperm phylogeny Annals of the Missouri Botanical Garden82 247ndash277

BEARD K H 1998 East of Eden Asia as an important center oftaxonomic origination in mammalian evolution Bulletin of theCarnegie Museum of Natural History 34 5ndash39

BENA G M F JUBIER I OLIVIERI and B LEJEUNE 1998 Ribosom-al external and internal transcribed spacers combined use inthe phylogenetic analysis of Medicago (Leguminosae) Journal ofMolecular Evolution 46 299ndash306

BERGER A 1924 A taxonomic review of currants and gooseberriesNew York Agricultural Experimental Station Technical Bulletin109 1ndash118

BOUFFORD D E and S A SPONGBERG 1983 Eastern Asia-EasternNorth American phytogeographical relationships-a historyfrom the time of Linnaeus to the twentieth century Annalsof the Missouri Botanical Garden 70 423ndash439

CAMPBELL C S M F WOJCIECHOWSKI B G BALDWIN L A AL-ICE and M J DONOGHUE 1997 Persistent nuclear ribosomalDNA sequence polymorphism in the Amelanchier agamiccomplex (Rosaceae) Molecular Biology and Evolution 14 81ndash90

CEVALLOS-FERRIZ S R S 1995 Fruits of Ribes from the Princetonchert British Columbia Canada American Journal of Botany82(6 supplement) 84

COVILLE F V and N L BRITTON 1908 Grossulariaceae NorthAmer-ican Flora 22 193ndash225

CUNNINGHAM C W 1997 Can three incongruence tests predictwhen data shold be combined Molecular Biology and Evolution14 733ndash740

DEQUEIROZ A M J DONOGHUE and J KIM 1995 Separate versuscombined analysis of phylogenetic evidence Annual Review ofEcology and Systematics 26 657ndash681

DONOGHUE M J C D BELL and J LI 2001 Phylogenetic patternsin northern hemisphere plant geography International Journalof Plant Sciences 162 S41ndashS52

DORF E 1930 Pliocene oras of California Carnegie Institution ofWashington Publication 412

FARRIS J S M KALLERSJO A G KLUGE and C BULT 1995 Test-ing signicance of incongruence Cladistics 10 315ndash319

FELSENSTEIN J 1985 Condence limits on phylogenies an ap-proach using the bootstrap Evolution 39 783ndash791

FENTON B A N E BIRCH G MALLOCH P G LANHAM and RM BRENNAN 2000 Gall mite molecular phylogeny and itsrelationship to the evolution of plant host specicity AppliedAcarology 24 831ndash861

FRITSCH P W C M MORTON T CHEN and C MELDRUM 2001Phylogeny and biogeography of the Styracaceae InternationalJournal of Plant Sciences 162 S95ndashS116

GANDOLFO M A P HOC S N SANTILLANA and S A MARENSSI1998 Una or fosil morfologicamente afDaggern a las Grossulari-aceae (orden Rosales) de la Formacion la Meseta (Eoceno me-dio) Isla Marambio Antartida Asociacion Paleontologica Argen-tina Publicacion Especial 5 Paleogeno de America del Sur y de laPenDaggernsula Antartica 147ndash153

GOLDMAN N J P ANDERSON and A G RODRIGO 2000 Likeli-hood-based tests of topologies in phylogenetics SystematicBiology 49 652ndash670

HANNIBAL H 1911 A Pliocene ora from the Coast Ranges ofCalifornia Bulletin of the Torrey Botanical Club 38 329ndash342

HUELSENBECK J P J J BULL and C W CUNNINGHAM 1996 Com-binined data in phylogenetic analysis Trends in Ecology andEvolution 11 152ndash158

JANCZEWSKI M E 1907 Monographies des groseilliers Ribes LMemoires Societe de Physique et DrsquoHistoire Naturelle de Geneve35 199ndash517

KEEP E 1962 Interspecic hybridization in Ribes Genetica 33 1ndash23

KISHINO H and M HASEGAWA 1989 Evaluation of the maximumlikelihood estimate of the evolutionary tree topologies fromDNA sequence data and the branching order in HominoideaJournal of Molecular Evolution 29 170ndash179

KREMENETSKI C V 1998 Holocene history of the northern rangelimits of some trees and shrubs in Russia Arctic and AlpineResearch 30 317ndash333

LINDER C R L R GOERTZEN B V HEUVEL J FRANCISCO-OR-TEGA and R K JANSEN 2000 The complete external tran-scribed spacer of 18Sndash26S rDNA amplication and phylo-genetic utility at low taxonomic levels in Asteraceae andclosely allied families Molecular Phylogenetics and Evolution 14285ndash303

MACGINITIE D 1953 Fossil plants of the Florissant beds ColoradoCarnegie Institution of Washington Publication 599

MADDISON D R and W P MADDISON 2000 MacClade 4 Sun-derland Sinauer Associates

MANCHESTER S R 1999 Biogeographical relationships of NorthAmerican Tertiary oras Annals of the Missouri Botanical Gar-den 86 472ndash522

mdashmdashmdash 2001 Update on the megafossil ora of Florissant Colo-rado Proceedings of the Denver Museum of Nature amp ScienceSeries 4 No1 137

MANOS P S and M J DONOGHUE 2001 Progress in northernhemisphere phytogeography an introduction InternationalJournal of Plant Sciences 162 S1ndashS2

mdashmdashmdash and A M STANFORD 2001 The historical biogeography ofFagaceae tracking the tertiary history of temperate and sub-tropical forests of the northern hemisphere International Jour-nal of Plant Sciences 162 S77ndashS93

MAST A R and T J GIVNISH 2002 Historical biogeography andthe origin of stomatal distributions in Banksia and Dryandra(Proteaceae) based on their cpDNA phylogeny American Jour-nal of Botany 89 1311ndash1323

MESSINGER W K HUMMER and A LISTON 1999 Ribes (Grossu-

82 [Volume 29SYSTEMATIC BOTANY

TABLE 1 Continued

OutgroupsItea virginica L New York Botanic Garden 7698C ETS AY138045 psbA-trnH AY138110 Messinger 337 (OSC) restriction sites

Ware 94 (WS) ITS AY231368I ilicifolia Oliver UCBG 860414 ETS AY138046 psbA-trnH AY138111 ITS AY138058

from Senters and Soltis 2003) It is possible that incongruence be-tween ETS and ITS datasets was due to intraspecic variation anas yet unexplored issue within Ribes that may limit future use ofcomposite accessions The presence of ETS and ITS regions on thesame transcript similar GC contents (ETS5 mean 049 ITS5mean058) similar proportions of invariant characters (ETS5 297462ITS5438700) and similar levels of rate heterogeneity across sites(ETS gamma 5 065 ITS gamma5 057) argued against differentevolutionary processes of sequence evolution as an explanation forincongruence

In order to maximize taxon sampling and data tests were alsoused to assess combinability of taxa represented in three of thefour available datasets While this required the inclusion of taxafor which one dataset was coded as missing the decrease in phy-logenetic accuracy was expected to be insignicant (Weins andReeder 1995)

Phylogenetic Analysis of Sequence Data Analyses of single(ITS ETS and psbA-trnH) and combined datasets were performedusing a parsimony criterion in PAUP 40 All sites and all changeswere equally weighted in contrast to the 13 gains10 loss weight-ing scheme used by Messinger et al (1999) in their analyses ofrestriction site data psbA-trnH data were analyzed both with in-dels treated as missing data and with seven large indels includedas binary characters Positions 309ndash327 and 448ndash465 of the alignedpsbA-trnH dataset were excluded from all analyses due to ambig-uous alignments

Analyses of the ITS ETS and psbA-trnH datasets consisted ofheuristic searches with 100 replicates of random addition and TBRbranch swapping No more than 400 trees greater than a speciedlength (234 for ETS 556 for ITS 137 for psbA-trnH) were savedper replicate or in the case of psbA-trnH with indels no more than250 trees greater than length 144 The limiting tree length wasdetermined based on the shortest trees found in prior incompletesearches and was imposed to prevent computational overloadsearching sub-optimal trees Analyses of all datasets combined orof combined chloroplast datasets were conducted with the branch-and-bound algorithm with taxa excluded based on partition ho-mogeneity test results For datasets combining ETS1ITSETS1psbA-trnH psbA-trnH1rDNA or all data for those taxa rep-resented in three of the four datasets analyses consisted of heu-ristic searches with 100 replicates of random addition TBR branchswapping and maxtrees set to 40000

Clade support was assessed using bootstrap analyses (Felsen-stein 1985) as implemented in PAUP 40 with 300 replicates ofheuristic searches each with 5 replicates of random taxon additionand Nearest Neighbor Interchange (NNI) branch swapping Forthe combination of all four datasets and for the combined chlo-roplast datasets clade support was assessed using 100 bootstrapreplicates each with branch and bound searches

Kishino-Hasegawa Tests The parsimony implementation of theKishino-Hasegawa test (Kishino and Hasegawa 1989) in PAUP 40was used to compare the hypothesis of subg Grossularia monophylyto that of subg Grossularia non-monophyly in which sect Grossu-larioides and sect Grossularia form a clade The parsimony version ofthe test was used because comparisons included restriction site dataAs recommended by Goldman et al (2000) comparisons were be-tween a priori hypotheses based on previously published phyloge-nies (Messinger et al 1999 Senters and Soltis 2003)

Analyses were run enforcing each of two constraint trees Therst constraint tree resolved subg Grossularia as monophyletic butleft relationships within subg Grossularia and among all remain-ing species unresolved The second constraint tree enforced res-olution of a clade containing sect Grossularioides plus sect Gros-

sularia but relationships within this clade were left unresolved aswere relationships among all remaining species Comparisonswere between trees from constrained branch and bound searchesfor the chloroplast data and from constrained heuristic searchesfor the rDNA data

Ancestral Area Reconstruction Ancestral areas were inferredusing DIVA which assigns areas to internal nodes such that dis-persal and extinction events are minimized (Ronquist 1996 1997)Default costs were used (vicariance 5 0 dispersal 5 1 extinction51) and the number of inferred areas per node was left uncon-strained These analyses used trees from the combined psbA-trnHand rDNA datasets (Fig 8) with species assigned to one or moreof four areas (eastern North America western North Americaeastern Eurasia and western Eurasia) Geographic distributionsfollowed Berger (1924) Janczewski (1907) and Sinnott (1985) SectCalobotrya R aureum R bracteosum R watsonianum and the cladecontaining the remaining glabrous-styled gooseberries (HesperiaLobbia Robsonia) were all coded with western North American dis-tributions Sect Grossularioides was coded for both North Americaand eastern Eurasia Subg Berisia was coded for both eastern andwestern Eurasia Ribes triste was coded for all areas except westernEurasia Itea was coded for both eastern North America and east-ern Eurasia

Because DIVA analyses do not permit polytomies we treated Raureum and R bracteosum as sister taxa Within sect Grossulariamembers of the Asian gooseberry clade were all coded as easternEurasia The remaining species of the large polytomy all live inwestern or eastern North America We resolved this polytomy inseveral different ways so as to explore some of the possibilitiesFor example in some analyses we created one eastern NorthAmerican and one western North American clade In others theNorth American species were arranged pectinately in relation tothe Asian clade

RESULTS

Sequence Characteristics and Analyses The aligned18ndash26S rDNA ITS dataset including 58S(positions 283ndash452) was 700 bp (282bp5ITS1 248bp5ITS2) with 28of the data matrix coded as missing data For the regionas a whole sequences ranged from 438ndash662bp (varia-tion due in part to missing terminal sequence data)uncorrected pairwise distances within Ribes rangedfrom 00ndash008 distances with Itea ranged from 027(with R missouriense) to 032 (with R malvaceum) andmean GC content was 058 Of the 700 aligned base-pairs 528 were constant within Ribes and 183 wereparsimony informative ITS1 displayed higher levels ofdivergence and a higher proportion of informativecharacters than did ITS2 (ITS1 5 00ndash015 65282 in-formative ITS2 5 00ndash011 25248 informative) In-cluded ITS1 sequences ranged from 34ndash258bpwith thelower limit due to taxa for which much of ITS1 se-quence data was missing ITS2 sequences ranged from216ndash241bp 58S ranged from 161ndash164bp but was only142bp in R sanguineum due to a large deletion

2004] 83SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

Lengths and GC contents fell within the ranges re-ported for a survey of angiosperm taxa (Baldwin et al1995) Analyses of the ITS and 58S regions generated36400 trees (length5556 CI5065 058 excluding un-informative characters RI5084)

Amplied products from the 18ndash26S rDNA inter-genic spacer region were approximately 2kb in R odor-atum (sect Symphocalyx) and 3kb in R hirtellum (sectGrossularia) the two species used to design internalprimers for amplifying 39 ETS Only 406bp of the 39end of the ETS region and 56bp of the 59 end of 18Swere sequenced in this study Included sequencesranged from 299ndash462bp in size with some variationdue to missing terminal sequence data and had amean GC content of 049 Uncorrected pairwise dis-tances among ETS sequences within Ribes ranged from00 to 007 Pairwise distances between Ribes and Itearanged from 026 (with R oxyacanthoides accession 2)to 032 (with R triste accession 1) Of the 462 alignedbasepairs 388 were constant within Ribes 60 were par-simony informative and 2 were coded as missingdata ETS analyses generated 34005 trees (length5234CI5080 074 excluding uninformative charactersRI5093 Fig 2)

The aligned psbA-trnH intergenic spacer dataset was502bp including a 39 portion of psbA (positions 1ndash37)and a 59 portion of trnH (position 484ndash502) One per-cent of the matrix was coded as missing data Includedsequences ranged from 355ndash445bp in length withsome variation due to missing terminal sequence dataand had a mean GC content of 029 The spacer regionalone ranged from 352ndash378bp within Ribes and was369bp in Itea based on complete sequences Uncor-rected pairwise distances (including psbA and trnHterminals) within Ribes ranged from 00 to 004 Dis-tances between Ribes and Itea ranged from 015 (withR odoratum accession 2) to 021 (with R bracteosum)Within Ribes 405465 included characters were con-stant and 34465 were parsimony informative Ex-cluded characters represented a polyA region rangingfrom 4ndash13bp and a 16ndash18bp insertion in Itea (relativeto Ribes) with which 5ndash6bp segments of Ribes could bealigned in various ways Analyses of sequence datafrom the psbA-trnH intergenic spacer produced 34000trees with little homoplasy (length5137 CI5092 088excluding uninformative characters RI5094 Fig 3)Analyses including indels coded as binary charactersproduced 18001 trees (length5144 CI5092 090 ex-cluding uninformative characters RI5095)

Trees Generated by Analyses of IndividualDatasets Results from the expanded ITS datasetconcur with those presented by Senters and Soltis(2003) and are not illustrated here Subg Grossulariawas resolved as monophyletic in ITS and ETS treeswith weak to moderate bootstrap support (Figs 1 2)psbA-trnH trees showed little resolution but did not

conict with a monophyletic subg Grossularia (Fig 3trees from analyses including indels are not shown)

Two main lineages may be identied within subgGrossularia the true gooseberries (sect Grossularia) andthe glabrous-styled gooseberries (Hesperia Lobbia Rob-sonia) The glabrous-styled gooseberries are resolved asa clade in ITS restriction site and psbA-trnH trees(Figs 1 3 Messinger et al 1999) ETS trees also resolvethe glabrous-styled gooseberries (Hesperia Lobbia Rob-sonia) as a clade with the exception of R watsonianum(subg Lobbia) placed with strong support in the truegooseberry clade (sect Grossularia) (Fig 2) The integ-rity of the individual sections comprising the glabrous-styled gooseberries (Hesperia Lobbia Robsonia) is un-clear The true gooseberries (sect Grossularia) are re-solved as a clade in restriction site ITS and ETS trees(including R watsonianum in the latter) and in psbA-trnH trees when indels are included (Figs 1 2 Mes-singer et al 1999 Senters and Soltis 2003) If indels areignored psbA-trnH trees resolve the majority of truegooseberries as a clade and are consistent with amonophyletic sect Grossularia (Fig 3) Within sectGrossularia the ETS dataset provided strong supportfor an Asian clade including the European R uvacris-pa ITS trees were consistent with an Asian clade butexcluded R uvacrispa psbA-trnH trees were also con-sistent with an Asian clade with the weakly support-ed inclusion of the North American R oxyacanthoidessubsp irriguum Restriction site trees had limited sam-pling in sect Grossularia but were consistent with anAsian versus North American divergence (Messingeret al 1999)

All datasets except the restriction sites resolved aclade comprising sect Calobotrya sect Grossularioidesand subg Grossularia (sect Grossularia sect Robsoniasubg Lobbia Hesperia) Members of this clade are large-ly from western North America with sect Grossulariahaving a wider distribution ETS trees included theblack currant Ribes bracteosum (sect Coreosma) withinthis clade in an unresolved position (Fig 2) ITS treesincluded the South American sect Parilla in this cladein an unresolved position (Senters and Soltis 2003) Inall trees sect Calobotrya was resolved as monophyleticincluding some members of sect Heritiera in restrictionsite and ITS trees (only one species of sect Heritierawas included in ETS and psbA-trnH analyses and fallselsewhere) Section Grossularioides was resolved withstrong support in ETS and ITS trees (Figs 1 2 Sentersand Soltis 2003) but is unresolved or strongly para-phyletic in the psbA-trnH and restriction site trees re-spectively (Figs 1 3 Messinger et al 1999)

The clade containing sects Calobotrya Grossularioidesand subg Grossularia was clearly nested within Ribesin ITS ETS and psbA-trnH trees (Figs 2 3 Senters andSoltis 2003) Among the remaining sections of Ribesall datasets provided strong support for sect Berisia

84 [Volume 29SYSTEMATIC BOTANY

FIG 2 The majority-rule consensus of 34005 trees resulting from analyses of ETS sequence data (CI5080 074 excludinguninformative characters RI5093) Numbers above the branches indicate the percentage of bootstrap replicates in which theclade appeared Numbers in parentheses below the branches indicate the percentage of trees in which the clade appearedwhen less than 100

2004] 85SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 3 The majority-rule consensus of 34000 trees resulting from analyses of psbA-trnH sequence data (CI5092 088excluding uninformative characters RI5094) Numbers above the branches indicate the percentage of bootstrap replicates inwhich the clade appeared Numbers in parentheses below the branches indicate the percentage of trees in which the cladeappeared when less than 100

86 [Volume 29SYSTEMATIC BOTANY

FIG 4 The strict consensus of six trees resulting fromanalyses of psbA-trnH sequence data combined with chloro-plast restriction site data (Messinger et al 1999) (CI5090 079excluding uninformative characters RI5087) Data combina-bility determined by partition homogeneity tests (p5066)Numbers above the branches indicate the percentage of boot-strap replicates in which the clade appeared

with the inclusion of some species of sect Ribes in ITStrees (Senters and Soltis 2003) Section Symphocalyxwasstrongly resolved in ETS and restriction site trees (Fig2 Messinger et al 1999) but was unresolved in psbA-trnH trees (Fig 3) (ITS trees included only one species)Section Heritiera appeared to be polyphyletic in ITSand restriction site trees (only one species of sect Her-itiera is included in ETS or psbA-trnH analyses) (Mes-singer et al 1999 Senters and Soltis 2003) The mono-phyly of sects Ribes and Coreosma remain unclear Forthose species sampled sect Ribes was resolved asmonophyletic in restriction site trees (Messinger et al1999) as monophyletic excluding R triste in ETS andpsbA-trnH trees (Figs 2 3) and as polyphyletic in ITStrees with some species clearly related to sect Berisia(Senters and Soltis 2003) Section Coreosma was re-solved as polyphyletic in ETS and restriction site trees(Fig 2 Messinger et al 1999) and as para- or poly-phyletic in ITS trees (Senters and Soltis 2003) (only onespecies was included in the psbA-trnH dataset) Previ-ous restriction site analyses of 18ndash26S rDNA suggestedthat members of sect Coreosma were divergent fromone another and from other Ribes species (Messingeret al 1993) Sampling from sect Parilla was too limitedto draw strong conclusions but the ITS trees support-ed its monophyly to the exclusion of R fasciculatumthe only non-South American member of the section(Senters and Soltis 2003) Relationships among the sec-tions outside of the predominantly western NorthAmerican clade (sects Calobotrya Grossularioides subgGrossularia) varied markedly among datasets with lit-tle support for any one resolution (Figs 2 3)

Trees Generated from Analyses of CombinedDatasets Dataset combinability is typically based ona critical value of p 5 005 (ie datasets are incongru-ent when p 005) However studies suggest that acritical value of p 5 005 may be too strict such thatthe null hypothesis of dataset congruence will be false-ly rejected (Huelsenbeck et al 1996 Sullivan 1996Cunningham 1997) and that a value such as p 5 001may be more appropriate (Cunningham 1997) Manyof the datasets reported here were not combinablebased on intitial partition homogeneity tests but theincongruence was generally eliminated when problem-atic taxa were excluded

Analyses of the readily combinable chloroplast psbA-trnH and restriction site data (p5066) generated sixtrees (length 144 CI5090 079 excluding uninforma-tive characters RI5087) In agreement with analysesof restriction site data alone true gooseberries (sectGrossularia) were not placed as sister to the remainingglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) suggesting that subg Grossularia is not monophy-letic (Figs 1 4) The true gooseberries were nested ina paraphyletic sect Grossularioides as in the restrictionsite trees with sect Calobotrya weakly placed as sister

Support for sect Grossularia sect Calobotrya and theglabrous-styled gooseberries (Hesperia Lobbia Robsonia)increased relative to analyses of either dataset alone(Fig 3 Messinger et al 1999) Support for a paraphy-letic sect Grossularioides decreased slightly relative tothe restriction site analyses (Fig 4 Messinger et al1999)

Analyses of the combined ETS and ITS rDNA data(p5004 excluded R fasciculatum R glandulosum Rhimalense R manshuricum R nevadense R rubrum Roxyacanthoides subsp oxycanthoides R uvacripsa) gener-ated 150 trees (length 614 CI5077 070 excluding un-informative characters RI5085) (Fig 5) Subg Gros-sularia was monophyletic as were the true gooseber-ries (sect Grossularia) (Fig 5) The glabrous-styledgooseberries (Hesperia Lobbia Robsonia) were stronglyresolved as monophyletic with the exception of R wat-sonianum (sect Lobbia) placed strongly as sister to thetrue gooseberries Within sect Grossularia only theAsian clade was resolved with strong support Theclade containing subg Grossularia sect Grossularioi-dies and sect Calobotrya was again evident with sectGrossularioides resolved as sister to subg GrossulariaSupport for the glabrous-styled gooseberries (HesperiaLobbia Robsonia) sect Calobotrya sect Grossularioidesand the Asian clade within sect Grossularia increasedrelative to support from ETS or ITS datasets analyzedindividually (Figs 2 5 Senters and Soltis 2003)

The most evident difference between chloroplast and

2004] 87SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 5 The strict consensus of 150 trees resulting from analyses of combined ETS and ITS sequence data (CI5077 070excluding uninformative characters RI5085) Data combinability determined by partition homogeneity tests (p5004) Num-bers above the branches indicate the percentage of bootstrap replicates in which the clade appeared

88 [Volume 29SYSTEMATIC BOTANY

FIG 6 The strict consensus of four trees resulting from analyses of the four datasets combined (ETS ITS psbA-trnHchloroplast restriction sites) Data combinability was determined by partition homogeneity tests (p5075) Numbers above thebranches indicate the percentage of bootstrap replicates in which the clade appeared

rDNA trees was the position of sect GrossularioidesSubgenus Grossularia is monophyletic in rDNA treeswith sect Grossularioides placed weakly as sister (Fig5) In contrast subg Grossularia is polyphyletic in chlo-roplast trees with sect Grossularia nested within sectGrossulariodes and sect Calobotrya sister to that group-ing (Fig 4) Analyses of the combined chloroplast andrDNA datasets (p5075 excluded R glandulosum Rlacustre R montigenum) generated four trees (length556 CI5088 069 excluding uninformative charactersRI5076) (Fig 6) Taxon sampling was limited due tothe limited overlap among datasets but trees showedstrong resolution of sect Calobotrya sect Grossulariaand the glabrous-styled gooseberries (Hesperia Lobbia

Robsonia) These groups again formed a well-support-ed clade nested within Ribes (Fig 6) The strongly sup-ported sister-group relationship between the true andglabrous-styled gooseberries (Fig 6) is consistent withthe monophyly of subg Grossularia but could changewith the inclusion of sect Grossularioides

ETS and psbA-trnH combined analyses (p5004 ex-cluded R oxyacanthoides subsp irriguum) generated 329trees (length 372 CI5084 077 excluding uninforma-tive characters RI5090) (Fig 7) Subgenus Grossulariawas resolved as monophyletic within which both theglabrous-styled and the true gooseberries were strong-ly supported the latter including R watsonianum(subg Lobbia) The Asian clade was well supported

2004] 89SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 7 The strict consensus of 329 trees resulting from analyses of combined ETS and psbA-trnH data (CI5084 077excluding uninformative characters RI5091) Dataset combinability was determined by partition-homogeneity tests (p5 004)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared

within sect Grossularia including the European R uva-crispa Both sect Calobotrya and sect Grossularioideswere strongly supported but neither was resolved assister to subg Grossularia The clade comprising subgGrossularia sect Grossularioides and sect Calobotryawas again evident nested within Ribes

Combined analyses of psbA-trnH and rDNA datasets(p5002 excluded R oxyacanthoides subsp irriguum andtaxa excluded from ETS1ITS analysis) generated 3080trees (length 5 719 CI5080 074 excluding uninfor-mative characters RI5085) Sects Grossularioides Calo-botrya Grossularia and the glabrous-styled gooseberries

90 [Volume 29SYSTEMATIC BOTANY

(Hesperia Lobbia Robsonia) were each strongly support-ed and again formed a strongly supported clade nestedin Ribes (Fig 8) Support for the monophyly of subgGrossularia was increased relative to support seen withany individual dataset (Figs 2 3 8)

Combinability (p5012) of all datasets for those taxarepresented in three of the four datasets required ex-clusion of composite taxa problematic within therDNA dataset as well as exclusion of taxa problematicfor the chloroplast versus rDNA datasets Combinedanalyses generated 4802 trees (length5768 CI5080074 excluding uninformative characters RI5085)Sec-tion Calobotrya sect Grossularia and the glabrous-styled gooseberries (Hesperia Lobbia Robsonia) exclud-ing R watsonianum were each well supported and to-gether formed a strongly supported clade (Fig 9) Sub-genus Grossularia was resolved as monophyleticbearing in mind that sect Grossularioides was excludedfrom the analyses

While all combined datasets resolved the clade con-taining sects Calobotrya Grossularioides and subgGrossularia as nested within Ribes (Figs 4ndash9) relation-ships among other lineages were unclear as in theanalyses of individual datasets (Figs 2 3) Basal rela-tionships were unresolved in the analyses of combinedchloroplast data (Fig 4) The combined ETS and psbA-trnH analyses suggested basal positions for goldencurrants (sect Symphocalyx) (Fig 7) All remaininganalyses suggested basal positions for sects Berisiaand Ribes (Figs 5 6 8 9) Basal relationships were notwell-supported in any analysis

Kishino-Hasegawa Tests Trees generated fromanalyses constraining the monophyly of subg Gros-sularia versus trees constrained to resolve a sister re-lationship between sect Grossularioides and sect Gros-sularia were marginally but signicantly different inboth the chloroplast (p5003) and the rDNA (p5005)datasets

Ancestral Area Reconstructions DIVA reconstruc-tions of ancestral areas support a western North Amer-ican origin for a large segment of Ribes beginningwith node 2 in Fig 8 Within this clade it is also thecase that subg Grossularia is inferred to have diversi-ed rst within western North America (Fig 8 node6) Subsequent movement to eastern Asia is inferred tohave occurred somewhere within sect Grossularia butthe ancestral area for the true gooseberries is equivo-cal and can include virtually any combination of areasdepending on the exact resolution of the large poly-tomy at the base of this clade (Fig 8 node 8) Impor-tantly our results indicate that the Asian species with-in sect Grossularia form a clade implying a single mi-gration from North America to Asia The ancestralarea for Ribes is reconstructed to be western NorthAmerica and western Eurasia or western North Amer-ica and all of Eurasia (Fig 8 node 1) However this

result hinges on resolution at the base which remainshighly uncertain and requires more intensive samplingof Ribes lineages outside of subg Grossularia

DISCUSSION

Gooseberry Monophyly Results from previousphylogenetic analyses based on nuclear 18Sndash26S rDNAITS data (Senters and Soltis 2003) and chloroplast re-striction site data (Messinger et al 1999) differed re-garding gooseberry monophyly Adding the additionalnuclear 18Sndash26S rDNA ETS and chloroplast psbA-trnHdatasets could increase support and resolution in re-sulting topologies or could reinforce the differencesbetween the nuclear and chloroplast topologies witheach reecting accurate but separate histories

Initial examination of the trees produced with theadditional datasets reinforced the apparent conict be-tween nuclear and chloroplast genomes ITS ETS andcombined rDNA datasets supported the monophyly ofsubg Grossularia (Figs 1 2 5) In contrast the com-bined chloroplast datasets (restriction sites plus psbA-trnH) suggested a closer relationship between the trueand glabrous-styled gooseberries than did the restric-tion site data alone (Fig 1 Messinger et al 1999) butstill resolved subg Grossularia as non-monophyleticwith sect Grossularioidies forming a grade at the baseof sect Grossularia (Fig 4) The increase in tree lengthwhen combined chloroplast data was constrained toresolve a monophyletic subg Grossularia (p5003) orwhen combined rDNA data was constrained to resolvesects Grossularioides and Grossularia as a clade(p5005) also indicated dataset incongruence

The discrepancy between nuclear and chloroplast to-pologies primarily involved the restriction sites datasetand not the psbA-trnH dataset The psbA-trnH datasetprovided little resolution (Fig 3) conicting with nei-ther the rDNA nor the restriction sites topologiesAnalyses combining the psbA-trnH data with either theETS data (p5004 Fig 7) or the rDNA data (p5002Fig 8) produced trees resolving subg Grossularia asmonophyletic with increased support relative to ETSor rDNA data alone (Figs 2 5) Section Grossularioideswas either sister to subg Grossularia (psbA-trnH 1rDNA Fig 8) or was unresolved in a polytomy withsubg Grossularia and sect Calobotrya (psbA-trnH 1ETS Fig 7) The monophyly of subg Grossularia wasalso supported by analyses of all datasets combinedwhether including taxa represented in all four datasets(p5075 Fig 6) or in three of the four datasets(p5012 Fig 9) Analyses combining all datasets re-quired exclusion of sect Grossularioides thus leavingsubg Grossularia monophyly uncertain However in-cluding sect Grossulariodes in spite of dataset incon-gruence (p5001) produced trees resolving a mono-phyletic subg Grossularia sister to a monophyletic sectGrossularioides (not shown)

2004] 91SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 8 The strict consensus of 3080 trees resulting from analyses of combined psbA-trnH and rDNA data (CI 5 080 074excluding uninformative characters RI 5 085) Dataset combinability was determined by partition homogeneity tests (p5002)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared DIVA (Ronquist 1996)was used to infer ancestral areas at the numbered nodes The ancestral areas at nodes two through seven were reconstructedas western North America Node one was reconstructed as western North America plus either western Eurasia or all of EurasiaThere were multiple possible reconstructions at node 8 including (1) western North America and eastern Eurasia (2) NorthAmerica and eastern Eurasia (3) North America or (4) western North America

92 [Volume 29SYSTEMATIC BOTANY

FIG 9 The strict consensus of 4802 trees resulting from analyses of all four datasets (ITS ETS psbA-trnH chloroplastrestriction sites) including taxa represented in at least three datasets (CI5080 074 excluding uninformative charactersRI5085) Dataset combinability was determined using partition homogeneity tests (p5012) Numbers above the branchesindicate the percentage of bootstrap replicates in which the clade appeared

2004] 93SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

The general picture that emerges from these analy-ses suggests that subg Grossularia is monophyletic(Figs 2 5ndash9) rDNA data supported gooseberry mono-phyly (Figs 2 5) psbA-trnH data while lacking suf-cient variation to resolve gooseberry monophyly ornon-monophyly supported gooseberry monophyly incombination with rDNA data (Figs 7 8) Finally anal-yses of all datasets combined supported gooseberrymonophyly although these analyses excluded thespiny currants (sect Grossularioides) (Figs 6 9) Whatrequires further investigation is the role hybridizationmay have played in the history of the spiny currants(sect Grossularioides) and the true gooseberries (sectGrossularia) Messinger et al (1999) encouraged furtherexploration of this possibility in Ribes in which theynoted potential chloroplast capture of the sect Gros-sularia chloroplast type by sect Grossularioides Crosseshave not been successful between species of sect Gros-sularioides and other sections within Ribes and are usu-ally unsuccessful between sections or subgenera (Keep1962) Conrmation of the pattern seen in trees gen-erated from the chloroplast restriction site data (Mes-singer et al 1999) is needed from additional chloro-plast datasets that provide greater resolution than didthe psbA-trnH dataset

Relationships Within the Gooseberries SubgenusGrossularia comprises two main lineages (Figs 2 5ndash9)the true gooseberries (sect Grossularia) and a clade ofglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) The four gooseberry sections are traditionally dis-tinguished from each other by basally pubescent stylesin sect Grossularia (with the exception of some Asianspecies) by four versus ve parted owers in sect Rob-sonia by anthers broader at the base in subg Hesperiaand by the absence of the above set of features in subgLobbia The glabrous-styled gooseberry lineage com-prising 27 species distributed through western NorthAmerica into Mexico (Berger 1924) was well-support-ed given our sampling but sections within this lineagewere not resolved Ribes watsonianum (subg Lobbia)was surprisingly placed outside of the glabrous-styledgooseberry lineage as sister to the true gooseberries(Figs 2 5 7ndash9) ITS data resolved R watsonianum with-in the glabrous-styled gooseberry lineage (Senters andSoltis 2003) but ETS data strongly resolved the specieswithin the true gooseberry lineage (sect Grossularia)(Fig 2) This conict within the rDNA data may reecthybridization between R watsonianum and a memberof sect Grossularia followed by xation within the Rwatsonianum genome of a recombinant rDNA repeattype Accounts of Ribes hybrids in the eld are rela-tively rare (Messler et al 1991) and do not implicateR watsonianum but fertile hybrids can be obtainedfrom articial crosses between glabrous-styled goose-berries and true gooseberries (Keep 1962 citing R lob-bii 3 R divaricatum) Alternatively R watsonianum may

posses multiple rDNA repeat types with different re-peat types sampled in our ITS versus ETS datasetsEach of these possibilities has been reported in otherplant taxa (Wendel et al 1995a Campbell et al 1997for potential recombinant rDNA repeat types Suh etal 1993 Wendel et al 1995b for incomplete homoge-nization of rDNA repeat types)

The true gooseberries (sect Grossularia) have a broadrange throughout the northern hemisphere with ninespecies in North America (Sinnott 1985) and seven spe-cies in Eurasia (Berger 1924) In his treatment of NorthAmerican gooseberries Sinnott (1985) divided his ninespecies into ve groups based on phenetic analysesThe groups consisted of (1) R cynosbati with spinyfruits (2) R niveum R curvatum and R missouriensewith highly exserted stamens and long sepals (3) Rrotundifolium and R divaricatum with medium lengthstamens and purple sepals (4) R inerme and R hirtel-lum with intermediate length stamens and small oralfeatures and (5) the ve subspecies of R oxyacanthoi-des with short stamens Sinnott (1985) recommendedthat R echinellum be excluded from the true gooseber-ries and aligned with the glabrous-styled gooseberriesof western North America (Hesperia Lobbia Robsonia)The analyses presented here showed strong supportfor the inclusion of R echinellum as well as the Eurasianspecies within the true gooseberry lineage (Figs 2ndash35 7ndash9) Resolution among the North American specieswas lacking or not well-supported (Figs 2ndash9) and thusneither supported nor conicted with Sinnottrsquos hy-pothesized relationships

The seven Eurasian species of sect Grossularia (Ber-ger 1924) include R uvacrispa in Europe R alpestre andR aciculare in the Himalayan region R stenocarpumand R formosanum in southern and eastern Asia andR burejense and R grossularioides in northern and east-ern Asia A clade of Asian species is well-supported(Figs 2 5 7ndash9) with possible inclusion of R uvacrispa(Figs 2 7) The psbA-trnH dataset includes R oxyacan-thoides subsp irriguum within the Asian clade (Fig 3)but this is weakly supported (Fig 3) and requires fur-ther substantiation particularly since R oxyacanthoidessubsp irriguum is restricted to northwestern NorthAmerica and may itself be of hybrid origin from cross-es between R oxyacanthoides subsp setosum and R in-erme (Sinnott 1985) both distributed in western NorthAmerica Resolution within the clade of Asian speciessuggests a correspondance to geographic and oristicregions within Asia Whether the Asian and NorthAmerican true gooseberries represent divergent line-ages or a monophyletic Asian clade nested within aNorth American grade is unclear given the availabledata

Other Groups within Ribes Since this study fo-cused on the gooseberries sampling within other sec-tions of Ribes was sometimes limited Nevertheless the

94 [Volume 29SYSTEMATIC BOTANY

data did support the monophyly of sects CalobotryaParilla Symphocalyx and Berisia Section Calobotrya is agroup of 21 western North American species (Berger1924) known as the ornamental currants The mono-phyly of sect Calobotrya was well-supported with theinclusion of some dwarf currants (sect Heritieria) (Figs2ndash9 Messinger et al 1999 Senters and Soltis 2003)Sampling was limited in sect Parilla a group of 41dioecious South American species (Janczewski 1907)but the group was supported in ITS trees excludingthe east Asian R fasciculatum the sectionrsquos only non-South American species (Senters and Soltis 2003) Apossible sister relationship between sect Parilla andsect Calobotrya (unpubl data cited in Weigend andBinder 2001) is consistent with the position of sect Pa-rilla seen with ITS data (Senters and Soltis 2003) Sec-tion Symphocalyx the golden currants includes vespecies distributed through northern Mexico and cen-tral and western North America (Berger 1924) Thegolden currants were well-supported given the avail-able sampling (Fig 2 4 9) The alpine currants sectBerisia are a group of 17 dioecious species distributedthrough Eurasia (Janczewski 1907) The monophyly ofsect Berisia was well-supported (Figs 2ndash9 Messingeret al 1999) but with the inclusion of some red currants(sect Ribes) in ITS trees (Senters and Soltis 2003)

The monophyly of sects Ribes and Coreosma wasquestionable (Figs 2 3 5) The red currants (sect Ri-bes) are a group of 15 Eurasian species with one spe-cies R triste also distributed in North America Sec-tion Coreosma the black currants includes six speciesin North America and six in Eurasia (Berger 1924) Sec-tion Heritiera the dwarf currants appeared to be poly-phyletic as seen in Messinger et al (1999) and Sentersand Soltis (2003) This group of six species (Berger1924) is dened primarily by a prostrate habit and assuggested by Messinger et al (1999) is likely a case ofconvergence

Biogeography The spread of taxa around theNorthern Hemisphere has been facilitated by the avail-ability at various times of two major migrationroutesmdashthe Beringian and the North Atlantic landbridges (Tiffney 1985a 1985b Donoghue et al 2001SanmartDaggern et al 2001) Especially in large and relative-ly old clades which have become widespread aroundthe Northern Hemisphere it is possible (perhaps evenlikely) that both pathways were used Information onthe timing of key divergences and on the direction ofmovement within subclades will be critical in sortingout the possibilities in particular cases Ribes providesan excellent example of such a group being represent-ed in Eurasia by six sections (Berisia Ribes and somespecies from Heritiera Coreosma Grossularioides andGrossularia) in western North America by nine (Sym-phocalyx Calobotrya Robsonia Hesperia Lobbia andsome species of Coreosma Heritiera Grossularioides and

Grossularia) and in eastern North America by three(some species of Heritiera Ribes and Grossularia) Oneapproach for sorting through a complex biogeographichistory as might be expected in Ribes is to examinephylogenetic patterns in component clades and ide-ally to date divergences

Our analyses indicate that subg Grossularia is nestedwithin a predominantly western North Americanclade (Figs 2 5ndash9) and that it diversied initially inthat region (Fig 8 node 6) Subsequently within sectGrossularia it appears that movement occurred fromwestern North America to eastern Asia presumablythrough Beringia followed by vicariance and the ori-gin and diversication of the well-supported Asiangooseberry clade Donoghue et al (2001) and Xiangand Soltis (2001) highlighted cases of movement out ofAsia into North America through the Bering LandBridge Ribes appears to provide a case of movementin the opposite direction Movement in both directionsis of course to be expected What remains to be de-termined in future studies of disjunct taxa is exactlywhich groups moved in which directions and whetherthere are any signicant generalizations that can bemade about these different patterns

Elsewhere in Ribes there are other possible cases ofmovement between North America and Asia One caseinvolves R lacustre of sect Grossularioides which is dis-tributed in eastern Asia as well as in North AmericaOther possible cases relate to resolution at the base ofRibes where relationships remain uncertain The basalpositions of sect Symphocalyx in trees resulting frompsbA-trnH data and from the combination of psbA-trnHand ETS data suggest a western North American ori-gin for the entire clade (Figs 2 7) This would implyearly dispersion to Asia giving rise to sects Berisiaand Ribes However all other datasets and dataset com-binations suggested a broader Eurasian plus westernNorth American distribution at the base (Fig 8 node1) owing to the basal positions of sects Berisia andRibes This would imply early vicariance involvingAsia and North America and movement back to Asiawithin the western North American clade Future stud-ies should include more sampling of sects Berisia Ri-bes Coreosma and Symphocalyx to help resolve basal re-lationships and biogeographic patterns in Ribes

The fossil record for Ribes consists largely of leaveswith few reports of seeds (Kremenetski 1998) fruits(Cevallos-Ferriz 1995) and owers (Gandolfo et al1998) The leaf record for Ribes in North America mayextend from approximately 2 mya (Hannibal 1911Dorf 1930 Axelrod 1966) to at least 345 mya (Mac-Ginitie 1953 Manchester 2001) and possibly to 45 or50 mya (Axelrod 1998 Wehr and Hopkins 1994) Al-though leaf features are seldom used to distinguishextant taxa of Ribes Wolfe (1964) used leaf serrationand venation features to distinguish between fossil

2004] 95SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

leaves of subg Ribes and subg Grossularia from Ne-vada If these features are reliable this dates subgGrossularia to at least 14 mya (Fig 9 node 6) A criticalnext step in understanding Ribes biogeography will beto accurately assign Ribes fossils to particular sub-clades so as to infer the timing of intercontinental di-vergences

ACKNOWLEDGEMENTS We thank the following individuals andinstitutions for providing plant material B Alverson D BouffordR Mitchell Arnold Arboretum of Harvard University Universityof California Botanical Garden Royal Botanic Garden EdinburghNew York Botanical Garden and the USDA-ARS National PlantGermplasm Repository A Senters and D Soltis graciously pro-vided numerous DNA aliquots DNA sequences and access to ear-ly manuscripts H Schorn and D Erwin provided assistance withpaleobotanical literature M Lavin P Herendeen and two anon-ymous reviewers provided numerous helpful comments This proj-ect was supported in part by a Putnam Fellowship through theArnold Arboretum of Harvard University

LITERATURE CITED

AVISE J C 1994 Molecular markers natural history and evolutionNew York Chapman amp Hall

AXELROD D I 1966 The Pleistocene Soboba ora of southern Califor-nia University of California Publications in Geological Sci-ences 60

mdashmdashmdash 1998 Thunder Mountain Idaho University of CaliforniaPublications in Geological Sciences 142

BALDWIN B G and S MARKOS 1998 Phylogenetic utility of theexternal transcribed spacer (ETS) of 18Sndash26S rDNA Congru-ence of ETS and ITS trees of Calycadenia (Compositae) Mo-lecular Phylogenetics and Evolution 10 449ndash463

mdashmdashmdash M J SANDERSON J M PORTER M F WOJCIECHOWSKI CS CAMPBELL and M J DONOGHUE 1995 The ITS region ofnuclear ribosomal DNA a valuable source of evidence onangiosperm phylogeny Annals of the Missouri Botanical Garden82 247ndash277

BEARD K H 1998 East of Eden Asia as an important center oftaxonomic origination in mammalian evolution Bulletin of theCarnegie Museum of Natural History 34 5ndash39

BENA G M F JUBIER I OLIVIERI and B LEJEUNE 1998 Ribosom-al external and internal transcribed spacers combined use inthe phylogenetic analysis of Medicago (Leguminosae) Journal ofMolecular Evolution 46 299ndash306

BERGER A 1924 A taxonomic review of currants and gooseberriesNew York Agricultural Experimental Station Technical Bulletin109 1ndash118

BOUFFORD D E and S A SPONGBERG 1983 Eastern Asia-EasternNorth American phytogeographical relationships-a historyfrom the time of Linnaeus to the twentieth century Annalsof the Missouri Botanical Garden 70 423ndash439

CAMPBELL C S M F WOJCIECHOWSKI B G BALDWIN L A AL-ICE and M J DONOGHUE 1997 Persistent nuclear ribosomalDNA sequence polymorphism in the Amelanchier agamiccomplex (Rosaceae) Molecular Biology and Evolution 14 81ndash90

CEVALLOS-FERRIZ S R S 1995 Fruits of Ribes from the Princetonchert British Columbia Canada American Journal of Botany82(6 supplement) 84

COVILLE F V and N L BRITTON 1908 Grossulariaceae NorthAmer-ican Flora 22 193ndash225

CUNNINGHAM C W 1997 Can three incongruence tests predictwhen data shold be combined Molecular Biology and Evolution14 733ndash740

DEQUEIROZ A M J DONOGHUE and J KIM 1995 Separate versuscombined analysis of phylogenetic evidence Annual Review ofEcology and Systematics 26 657ndash681

DONOGHUE M J C D BELL and J LI 2001 Phylogenetic patternsin northern hemisphere plant geography International Journalof Plant Sciences 162 S41ndashS52

DORF E 1930 Pliocene oras of California Carnegie Institution ofWashington Publication 412

FARRIS J S M KALLERSJO A G KLUGE and C BULT 1995 Test-ing signicance of incongruence Cladistics 10 315ndash319

FELSENSTEIN J 1985 Condence limits on phylogenies an ap-proach using the bootstrap Evolution 39 783ndash791

FENTON B A N E BIRCH G MALLOCH P G LANHAM and RM BRENNAN 2000 Gall mite molecular phylogeny and itsrelationship to the evolution of plant host specicity AppliedAcarology 24 831ndash861

FRITSCH P W C M MORTON T CHEN and C MELDRUM 2001Phylogeny and biogeography of the Styracaceae InternationalJournal of Plant Sciences 162 S95ndashS116

GANDOLFO M A P HOC S N SANTILLANA and S A MARENSSI1998 Una or fosil morfologicamente afDaggern a las Grossulari-aceae (orden Rosales) de la Formacion la Meseta (Eoceno me-dio) Isla Marambio Antartida Asociacion Paleontologica Argen-tina Publicacion Especial 5 Paleogeno de America del Sur y de laPenDaggernsula Antartica 147ndash153

GOLDMAN N J P ANDERSON and A G RODRIGO 2000 Likeli-hood-based tests of topologies in phylogenetics SystematicBiology 49 652ndash670

HANNIBAL H 1911 A Pliocene ora from the Coast Ranges ofCalifornia Bulletin of the Torrey Botanical Club 38 329ndash342

HUELSENBECK J P J J BULL and C W CUNNINGHAM 1996 Com-binined data in phylogenetic analysis Trends in Ecology andEvolution 11 152ndash158

JANCZEWSKI M E 1907 Monographies des groseilliers Ribes LMemoires Societe de Physique et DrsquoHistoire Naturelle de Geneve35 199ndash517

KEEP E 1962 Interspecic hybridization in Ribes Genetica 33 1ndash23

KISHINO H and M HASEGAWA 1989 Evaluation of the maximumlikelihood estimate of the evolutionary tree topologies fromDNA sequence data and the branching order in HominoideaJournal of Molecular Evolution 29 170ndash179

KREMENETSKI C V 1998 Holocene history of the northern rangelimits of some trees and shrubs in Russia Arctic and AlpineResearch 30 317ndash333

LINDER C R L R GOERTZEN B V HEUVEL J FRANCISCO-OR-TEGA and R K JANSEN 2000 The complete external tran-scribed spacer of 18Sndash26S rDNA amplication and phylo-genetic utility at low taxonomic levels in Asteraceae andclosely allied families Molecular Phylogenetics and Evolution 14285ndash303

MACGINITIE D 1953 Fossil plants of the Florissant beds ColoradoCarnegie Institution of Washington Publication 599

MADDISON D R and W P MADDISON 2000 MacClade 4 Sun-derland Sinauer Associates

MANCHESTER S R 1999 Biogeographical relationships of NorthAmerican Tertiary oras Annals of the Missouri Botanical Gar-den 86 472ndash522

mdashmdashmdash 2001 Update on the megafossil ora of Florissant Colo-rado Proceedings of the Denver Museum of Nature amp ScienceSeries 4 No1 137

MANOS P S and M J DONOGHUE 2001 Progress in northernhemisphere phytogeography an introduction InternationalJournal of Plant Sciences 162 S1ndashS2

mdashmdashmdash and A M STANFORD 2001 The historical biogeography ofFagaceae tracking the tertiary history of temperate and sub-tropical forests of the northern hemisphere International Jour-nal of Plant Sciences 162 S77ndashS93

MAST A R and T J GIVNISH 2002 Historical biogeography andthe origin of stomatal distributions in Banksia and Dryandra(Proteaceae) based on their cpDNA phylogeny American Jour-nal of Botany 89 1311ndash1323

MESSINGER W K HUMMER and A LISTON 1999 Ribes (Grossu-

2004] 83SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

Lengths and GC contents fell within the ranges re-ported for a survey of angiosperm taxa (Baldwin et al1995) Analyses of the ITS and 58S regions generated36400 trees (length5556 CI5065 058 excluding un-informative characters RI5084)

Amplied products from the 18ndash26S rDNA inter-genic spacer region were approximately 2kb in R odor-atum (sect Symphocalyx) and 3kb in R hirtellum (sectGrossularia) the two species used to design internalprimers for amplifying 39 ETS Only 406bp of the 39end of the ETS region and 56bp of the 59 end of 18Swere sequenced in this study Included sequencesranged from 299ndash462bp in size with some variationdue to missing terminal sequence data and had amean GC content of 049 Uncorrected pairwise dis-tances among ETS sequences within Ribes ranged from00 to 007 Pairwise distances between Ribes and Itearanged from 026 (with R oxyacanthoides accession 2)to 032 (with R triste accession 1) Of the 462 alignedbasepairs 388 were constant within Ribes 60 were par-simony informative and 2 were coded as missingdata ETS analyses generated 34005 trees (length5234CI5080 074 excluding uninformative charactersRI5093 Fig 2)

The aligned psbA-trnH intergenic spacer dataset was502bp including a 39 portion of psbA (positions 1ndash37)and a 59 portion of trnH (position 484ndash502) One per-cent of the matrix was coded as missing data Includedsequences ranged from 355ndash445bp in length withsome variation due to missing terminal sequence dataand had a mean GC content of 029 The spacer regionalone ranged from 352ndash378bp within Ribes and was369bp in Itea based on complete sequences Uncor-rected pairwise distances (including psbA and trnHterminals) within Ribes ranged from 00 to 004 Dis-tances between Ribes and Itea ranged from 015 (withR odoratum accession 2) to 021 (with R bracteosum)Within Ribes 405465 included characters were con-stant and 34465 were parsimony informative Ex-cluded characters represented a polyA region rangingfrom 4ndash13bp and a 16ndash18bp insertion in Itea (relativeto Ribes) with which 5ndash6bp segments of Ribes could bealigned in various ways Analyses of sequence datafrom the psbA-trnH intergenic spacer produced 34000trees with little homoplasy (length5137 CI5092 088excluding uninformative characters RI5094 Fig 3)Analyses including indels coded as binary charactersproduced 18001 trees (length5144 CI5092 090 ex-cluding uninformative characters RI5095)

Trees Generated by Analyses of IndividualDatasets Results from the expanded ITS datasetconcur with those presented by Senters and Soltis(2003) and are not illustrated here Subg Grossulariawas resolved as monophyletic in ITS and ETS treeswith weak to moderate bootstrap support (Figs 1 2)psbA-trnH trees showed little resolution but did not

conict with a monophyletic subg Grossularia (Fig 3trees from analyses including indels are not shown)

Two main lineages may be identied within subgGrossularia the true gooseberries (sect Grossularia) andthe glabrous-styled gooseberries (Hesperia Lobbia Rob-sonia) The glabrous-styled gooseberries are resolved asa clade in ITS restriction site and psbA-trnH trees(Figs 1 3 Messinger et al 1999) ETS trees also resolvethe glabrous-styled gooseberries (Hesperia Lobbia Rob-sonia) as a clade with the exception of R watsonianum(subg Lobbia) placed with strong support in the truegooseberry clade (sect Grossularia) (Fig 2) The integ-rity of the individual sections comprising the glabrous-styled gooseberries (Hesperia Lobbia Robsonia) is un-clear The true gooseberries (sect Grossularia) are re-solved as a clade in restriction site ITS and ETS trees(including R watsonianum in the latter) and in psbA-trnH trees when indels are included (Figs 1 2 Mes-singer et al 1999 Senters and Soltis 2003) If indels areignored psbA-trnH trees resolve the majority of truegooseberries as a clade and are consistent with amonophyletic sect Grossularia (Fig 3) Within sectGrossularia the ETS dataset provided strong supportfor an Asian clade including the European R uvacris-pa ITS trees were consistent with an Asian clade butexcluded R uvacrispa psbA-trnH trees were also con-sistent with an Asian clade with the weakly support-ed inclusion of the North American R oxyacanthoidessubsp irriguum Restriction site trees had limited sam-pling in sect Grossularia but were consistent with anAsian versus North American divergence (Messingeret al 1999)

All datasets except the restriction sites resolved aclade comprising sect Calobotrya sect Grossularioidesand subg Grossularia (sect Grossularia sect Robsoniasubg Lobbia Hesperia) Members of this clade are large-ly from western North America with sect Grossulariahaving a wider distribution ETS trees included theblack currant Ribes bracteosum (sect Coreosma) withinthis clade in an unresolved position (Fig 2) ITS treesincluded the South American sect Parilla in this cladein an unresolved position (Senters and Soltis 2003) Inall trees sect Calobotrya was resolved as monophyleticincluding some members of sect Heritiera in restrictionsite and ITS trees (only one species of sect Heritierawas included in ETS and psbA-trnH analyses and fallselsewhere) Section Grossularioides was resolved withstrong support in ETS and ITS trees (Figs 1 2 Sentersand Soltis 2003) but is unresolved or strongly para-phyletic in the psbA-trnH and restriction site trees re-spectively (Figs 1 3 Messinger et al 1999)

The clade containing sects Calobotrya Grossularioidesand subg Grossularia was clearly nested within Ribesin ITS ETS and psbA-trnH trees (Figs 2 3 Senters andSoltis 2003) Among the remaining sections of Ribesall datasets provided strong support for sect Berisia

84 [Volume 29SYSTEMATIC BOTANY

FIG 2 The majority-rule consensus of 34005 trees resulting from analyses of ETS sequence data (CI5080 074 excludinguninformative characters RI5093) Numbers above the branches indicate the percentage of bootstrap replicates in which theclade appeared Numbers in parentheses below the branches indicate the percentage of trees in which the clade appearedwhen less than 100

2004] 85SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 3 The majority-rule consensus of 34000 trees resulting from analyses of psbA-trnH sequence data (CI5092 088excluding uninformative characters RI5094) Numbers above the branches indicate the percentage of bootstrap replicates inwhich the clade appeared Numbers in parentheses below the branches indicate the percentage of trees in which the cladeappeared when less than 100

86 [Volume 29SYSTEMATIC BOTANY

FIG 4 The strict consensus of six trees resulting fromanalyses of psbA-trnH sequence data combined with chloro-plast restriction site data (Messinger et al 1999) (CI5090 079excluding uninformative characters RI5087) Data combina-bility determined by partition homogeneity tests (p5066)Numbers above the branches indicate the percentage of boot-strap replicates in which the clade appeared

with the inclusion of some species of sect Ribes in ITStrees (Senters and Soltis 2003) Section Symphocalyxwasstrongly resolved in ETS and restriction site trees (Fig2 Messinger et al 1999) but was unresolved in psbA-trnH trees (Fig 3) (ITS trees included only one species)Section Heritiera appeared to be polyphyletic in ITSand restriction site trees (only one species of sect Her-itiera is included in ETS or psbA-trnH analyses) (Mes-singer et al 1999 Senters and Soltis 2003) The mono-phyly of sects Ribes and Coreosma remain unclear Forthose species sampled sect Ribes was resolved asmonophyletic in restriction site trees (Messinger et al1999) as monophyletic excluding R triste in ETS andpsbA-trnH trees (Figs 2 3) and as polyphyletic in ITStrees with some species clearly related to sect Berisia(Senters and Soltis 2003) Section Coreosma was re-solved as polyphyletic in ETS and restriction site trees(Fig 2 Messinger et al 1999) and as para- or poly-phyletic in ITS trees (Senters and Soltis 2003) (only onespecies was included in the psbA-trnH dataset) Previ-ous restriction site analyses of 18ndash26S rDNA suggestedthat members of sect Coreosma were divergent fromone another and from other Ribes species (Messingeret al 1993) Sampling from sect Parilla was too limitedto draw strong conclusions but the ITS trees support-ed its monophyly to the exclusion of R fasciculatumthe only non-South American member of the section(Senters and Soltis 2003) Relationships among the sec-tions outside of the predominantly western NorthAmerican clade (sects Calobotrya Grossularioides subgGrossularia) varied markedly among datasets with lit-tle support for any one resolution (Figs 2 3)

Trees Generated from Analyses of CombinedDatasets Dataset combinability is typically based ona critical value of p 5 005 (ie datasets are incongru-ent when p 005) However studies suggest that acritical value of p 5 005 may be too strict such thatthe null hypothesis of dataset congruence will be false-ly rejected (Huelsenbeck et al 1996 Sullivan 1996Cunningham 1997) and that a value such as p 5 001may be more appropriate (Cunningham 1997) Manyof the datasets reported here were not combinablebased on intitial partition homogeneity tests but theincongruence was generally eliminated when problem-atic taxa were excluded

Analyses of the readily combinable chloroplast psbA-trnH and restriction site data (p5066) generated sixtrees (length 144 CI5090 079 excluding uninforma-tive characters RI5087) In agreement with analysesof restriction site data alone true gooseberries (sectGrossularia) were not placed as sister to the remainingglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) suggesting that subg Grossularia is not monophy-letic (Figs 1 4) The true gooseberries were nested ina paraphyletic sect Grossularioides as in the restrictionsite trees with sect Calobotrya weakly placed as sister

Support for sect Grossularia sect Calobotrya and theglabrous-styled gooseberries (Hesperia Lobbia Robsonia)increased relative to analyses of either dataset alone(Fig 3 Messinger et al 1999) Support for a paraphy-letic sect Grossularioides decreased slightly relative tothe restriction site analyses (Fig 4 Messinger et al1999)

Analyses of the combined ETS and ITS rDNA data(p5004 excluded R fasciculatum R glandulosum Rhimalense R manshuricum R nevadense R rubrum Roxyacanthoides subsp oxycanthoides R uvacripsa) gener-ated 150 trees (length 614 CI5077 070 excluding un-informative characters RI5085) (Fig 5) Subg Gros-sularia was monophyletic as were the true gooseber-ries (sect Grossularia) (Fig 5) The glabrous-styledgooseberries (Hesperia Lobbia Robsonia) were stronglyresolved as monophyletic with the exception of R wat-sonianum (sect Lobbia) placed strongly as sister to thetrue gooseberries Within sect Grossularia only theAsian clade was resolved with strong support Theclade containing subg Grossularia sect Grossularioi-dies and sect Calobotrya was again evident with sectGrossularioides resolved as sister to subg GrossulariaSupport for the glabrous-styled gooseberries (HesperiaLobbia Robsonia) sect Calobotrya sect Grossularioidesand the Asian clade within sect Grossularia increasedrelative to support from ETS or ITS datasets analyzedindividually (Figs 2 5 Senters and Soltis 2003)

The most evident difference between chloroplast and

2004] 87SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 5 The strict consensus of 150 trees resulting from analyses of combined ETS and ITS sequence data (CI5077 070excluding uninformative characters RI5085) Data combinability determined by partition homogeneity tests (p5004) Num-bers above the branches indicate the percentage of bootstrap replicates in which the clade appeared

88 [Volume 29SYSTEMATIC BOTANY

FIG 6 The strict consensus of four trees resulting from analyses of the four datasets combined (ETS ITS psbA-trnHchloroplast restriction sites) Data combinability was determined by partition homogeneity tests (p5075) Numbers above thebranches indicate the percentage of bootstrap replicates in which the clade appeared

rDNA trees was the position of sect GrossularioidesSubgenus Grossularia is monophyletic in rDNA treeswith sect Grossularioides placed weakly as sister (Fig5) In contrast subg Grossularia is polyphyletic in chlo-roplast trees with sect Grossularia nested within sectGrossulariodes and sect Calobotrya sister to that group-ing (Fig 4) Analyses of the combined chloroplast andrDNA datasets (p5075 excluded R glandulosum Rlacustre R montigenum) generated four trees (length556 CI5088 069 excluding uninformative charactersRI5076) (Fig 6) Taxon sampling was limited due tothe limited overlap among datasets but trees showedstrong resolution of sect Calobotrya sect Grossulariaand the glabrous-styled gooseberries (Hesperia Lobbia

Robsonia) These groups again formed a well-support-ed clade nested within Ribes (Fig 6) The strongly sup-ported sister-group relationship between the true andglabrous-styled gooseberries (Fig 6) is consistent withthe monophyly of subg Grossularia but could changewith the inclusion of sect Grossularioides

ETS and psbA-trnH combined analyses (p5004 ex-cluded R oxyacanthoides subsp irriguum) generated 329trees (length 372 CI5084 077 excluding uninforma-tive characters RI5090) (Fig 7) Subgenus Grossulariawas resolved as monophyletic within which both theglabrous-styled and the true gooseberries were strong-ly supported the latter including R watsonianum(subg Lobbia) The Asian clade was well supported

2004] 89SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 7 The strict consensus of 329 trees resulting from analyses of combined ETS and psbA-trnH data (CI5084 077excluding uninformative characters RI5091) Dataset combinability was determined by partition-homogeneity tests (p5 004)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared

within sect Grossularia including the European R uva-crispa Both sect Calobotrya and sect Grossularioideswere strongly supported but neither was resolved assister to subg Grossularia The clade comprising subgGrossularia sect Grossularioides and sect Calobotryawas again evident nested within Ribes

Combined analyses of psbA-trnH and rDNA datasets(p5002 excluded R oxyacanthoides subsp irriguum andtaxa excluded from ETS1ITS analysis) generated 3080trees (length 5 719 CI5080 074 excluding uninfor-mative characters RI5085) Sects Grossularioides Calo-botrya Grossularia and the glabrous-styled gooseberries

90 [Volume 29SYSTEMATIC BOTANY

(Hesperia Lobbia Robsonia) were each strongly support-ed and again formed a strongly supported clade nestedin Ribes (Fig 8) Support for the monophyly of subgGrossularia was increased relative to support seen withany individual dataset (Figs 2 3 8)

Combinability (p5012) of all datasets for those taxarepresented in three of the four datasets required ex-clusion of composite taxa problematic within therDNA dataset as well as exclusion of taxa problematicfor the chloroplast versus rDNA datasets Combinedanalyses generated 4802 trees (length5768 CI5080074 excluding uninformative characters RI5085)Sec-tion Calobotrya sect Grossularia and the glabrous-styled gooseberries (Hesperia Lobbia Robsonia) exclud-ing R watsonianum were each well supported and to-gether formed a strongly supported clade (Fig 9) Sub-genus Grossularia was resolved as monophyleticbearing in mind that sect Grossularioides was excludedfrom the analyses

While all combined datasets resolved the clade con-taining sects Calobotrya Grossularioides and subgGrossularia as nested within Ribes (Figs 4ndash9) relation-ships among other lineages were unclear as in theanalyses of individual datasets (Figs 2 3) Basal rela-tionships were unresolved in the analyses of combinedchloroplast data (Fig 4) The combined ETS and psbA-trnH analyses suggested basal positions for goldencurrants (sect Symphocalyx) (Fig 7) All remaininganalyses suggested basal positions for sects Berisiaand Ribes (Figs 5 6 8 9) Basal relationships were notwell-supported in any analysis

Kishino-Hasegawa Tests Trees generated fromanalyses constraining the monophyly of subg Gros-sularia versus trees constrained to resolve a sister re-lationship between sect Grossularioides and sect Gros-sularia were marginally but signicantly different inboth the chloroplast (p5003) and the rDNA (p5005)datasets

Ancestral Area Reconstructions DIVA reconstruc-tions of ancestral areas support a western North Amer-ican origin for a large segment of Ribes beginningwith node 2 in Fig 8 Within this clade it is also thecase that subg Grossularia is inferred to have diversi-ed rst within western North America (Fig 8 node6) Subsequent movement to eastern Asia is inferred tohave occurred somewhere within sect Grossularia butthe ancestral area for the true gooseberries is equivo-cal and can include virtually any combination of areasdepending on the exact resolution of the large poly-tomy at the base of this clade (Fig 8 node 8) Impor-tantly our results indicate that the Asian species with-in sect Grossularia form a clade implying a single mi-gration from North America to Asia The ancestralarea for Ribes is reconstructed to be western NorthAmerica and western Eurasia or western North Amer-ica and all of Eurasia (Fig 8 node 1) However this

result hinges on resolution at the base which remainshighly uncertain and requires more intensive samplingof Ribes lineages outside of subg Grossularia

DISCUSSION

Gooseberry Monophyly Results from previousphylogenetic analyses based on nuclear 18Sndash26S rDNAITS data (Senters and Soltis 2003) and chloroplast re-striction site data (Messinger et al 1999) differed re-garding gooseberry monophyly Adding the additionalnuclear 18Sndash26S rDNA ETS and chloroplast psbA-trnHdatasets could increase support and resolution in re-sulting topologies or could reinforce the differencesbetween the nuclear and chloroplast topologies witheach reecting accurate but separate histories

Initial examination of the trees produced with theadditional datasets reinforced the apparent conict be-tween nuclear and chloroplast genomes ITS ETS andcombined rDNA datasets supported the monophyly ofsubg Grossularia (Figs 1 2 5) In contrast the com-bined chloroplast datasets (restriction sites plus psbA-trnH) suggested a closer relationship between the trueand glabrous-styled gooseberries than did the restric-tion site data alone (Fig 1 Messinger et al 1999) butstill resolved subg Grossularia as non-monophyleticwith sect Grossularioidies forming a grade at the baseof sect Grossularia (Fig 4) The increase in tree lengthwhen combined chloroplast data was constrained toresolve a monophyletic subg Grossularia (p5003) orwhen combined rDNA data was constrained to resolvesects Grossularioides and Grossularia as a clade(p5005) also indicated dataset incongruence

The discrepancy between nuclear and chloroplast to-pologies primarily involved the restriction sites datasetand not the psbA-trnH dataset The psbA-trnH datasetprovided little resolution (Fig 3) conicting with nei-ther the rDNA nor the restriction sites topologiesAnalyses combining the psbA-trnH data with either theETS data (p5004 Fig 7) or the rDNA data (p5002Fig 8) produced trees resolving subg Grossularia asmonophyletic with increased support relative to ETSor rDNA data alone (Figs 2 5) Section Grossularioideswas either sister to subg Grossularia (psbA-trnH 1rDNA Fig 8) or was unresolved in a polytomy withsubg Grossularia and sect Calobotrya (psbA-trnH 1ETS Fig 7) The monophyly of subg Grossularia wasalso supported by analyses of all datasets combinedwhether including taxa represented in all four datasets(p5075 Fig 6) or in three of the four datasets(p5012 Fig 9) Analyses combining all datasets re-quired exclusion of sect Grossularioides thus leavingsubg Grossularia monophyly uncertain However in-cluding sect Grossulariodes in spite of dataset incon-gruence (p5001) produced trees resolving a mono-phyletic subg Grossularia sister to a monophyletic sectGrossularioides (not shown)

2004] 91SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 8 The strict consensus of 3080 trees resulting from analyses of combined psbA-trnH and rDNA data (CI 5 080 074excluding uninformative characters RI 5 085) Dataset combinability was determined by partition homogeneity tests (p5002)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared DIVA (Ronquist 1996)was used to infer ancestral areas at the numbered nodes The ancestral areas at nodes two through seven were reconstructedas western North America Node one was reconstructed as western North America plus either western Eurasia or all of EurasiaThere were multiple possible reconstructions at node 8 including (1) western North America and eastern Eurasia (2) NorthAmerica and eastern Eurasia (3) North America or (4) western North America

92 [Volume 29SYSTEMATIC BOTANY

FIG 9 The strict consensus of 4802 trees resulting from analyses of all four datasets (ITS ETS psbA-trnH chloroplastrestriction sites) including taxa represented in at least three datasets (CI5080 074 excluding uninformative charactersRI5085) Dataset combinability was determined using partition homogeneity tests (p5012) Numbers above the branchesindicate the percentage of bootstrap replicates in which the clade appeared

2004] 93SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

The general picture that emerges from these analy-ses suggests that subg Grossularia is monophyletic(Figs 2 5ndash9) rDNA data supported gooseberry mono-phyly (Figs 2 5) psbA-trnH data while lacking suf-cient variation to resolve gooseberry monophyly ornon-monophyly supported gooseberry monophyly incombination with rDNA data (Figs 7 8) Finally anal-yses of all datasets combined supported gooseberrymonophyly although these analyses excluded thespiny currants (sect Grossularioides) (Figs 6 9) Whatrequires further investigation is the role hybridizationmay have played in the history of the spiny currants(sect Grossularioides) and the true gooseberries (sectGrossularia) Messinger et al (1999) encouraged furtherexploration of this possibility in Ribes in which theynoted potential chloroplast capture of the sect Gros-sularia chloroplast type by sect Grossularioides Crosseshave not been successful between species of sect Gros-sularioides and other sections within Ribes and are usu-ally unsuccessful between sections or subgenera (Keep1962) Conrmation of the pattern seen in trees gen-erated from the chloroplast restriction site data (Mes-singer et al 1999) is needed from additional chloro-plast datasets that provide greater resolution than didthe psbA-trnH dataset

Relationships Within the Gooseberries SubgenusGrossularia comprises two main lineages (Figs 2 5ndash9)the true gooseberries (sect Grossularia) and a clade ofglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) The four gooseberry sections are traditionally dis-tinguished from each other by basally pubescent stylesin sect Grossularia (with the exception of some Asianspecies) by four versus ve parted owers in sect Rob-sonia by anthers broader at the base in subg Hesperiaand by the absence of the above set of features in subgLobbia The glabrous-styled gooseberry lineage com-prising 27 species distributed through western NorthAmerica into Mexico (Berger 1924) was well-support-ed given our sampling but sections within this lineagewere not resolved Ribes watsonianum (subg Lobbia)was surprisingly placed outside of the glabrous-styledgooseberry lineage as sister to the true gooseberries(Figs 2 5 7ndash9) ITS data resolved R watsonianum with-in the glabrous-styled gooseberry lineage (Senters andSoltis 2003) but ETS data strongly resolved the specieswithin the true gooseberry lineage (sect Grossularia)(Fig 2) This conict within the rDNA data may reecthybridization between R watsonianum and a memberof sect Grossularia followed by xation within the Rwatsonianum genome of a recombinant rDNA repeattype Accounts of Ribes hybrids in the eld are rela-tively rare (Messler et al 1991) and do not implicateR watsonianum but fertile hybrids can be obtainedfrom articial crosses between glabrous-styled goose-berries and true gooseberries (Keep 1962 citing R lob-bii 3 R divaricatum) Alternatively R watsonianum may

posses multiple rDNA repeat types with different re-peat types sampled in our ITS versus ETS datasetsEach of these possibilities has been reported in otherplant taxa (Wendel et al 1995a Campbell et al 1997for potential recombinant rDNA repeat types Suh etal 1993 Wendel et al 1995b for incomplete homoge-nization of rDNA repeat types)

The true gooseberries (sect Grossularia) have a broadrange throughout the northern hemisphere with ninespecies in North America (Sinnott 1985) and seven spe-cies in Eurasia (Berger 1924) In his treatment of NorthAmerican gooseberries Sinnott (1985) divided his ninespecies into ve groups based on phenetic analysesThe groups consisted of (1) R cynosbati with spinyfruits (2) R niveum R curvatum and R missouriensewith highly exserted stamens and long sepals (3) Rrotundifolium and R divaricatum with medium lengthstamens and purple sepals (4) R inerme and R hirtel-lum with intermediate length stamens and small oralfeatures and (5) the ve subspecies of R oxyacanthoi-des with short stamens Sinnott (1985) recommendedthat R echinellum be excluded from the true gooseber-ries and aligned with the glabrous-styled gooseberriesof western North America (Hesperia Lobbia Robsonia)The analyses presented here showed strong supportfor the inclusion of R echinellum as well as the Eurasianspecies within the true gooseberry lineage (Figs 2ndash35 7ndash9) Resolution among the North American specieswas lacking or not well-supported (Figs 2ndash9) and thusneither supported nor conicted with Sinnottrsquos hy-pothesized relationships

The seven Eurasian species of sect Grossularia (Ber-ger 1924) include R uvacrispa in Europe R alpestre andR aciculare in the Himalayan region R stenocarpumand R formosanum in southern and eastern Asia andR burejense and R grossularioides in northern and east-ern Asia A clade of Asian species is well-supported(Figs 2 5 7ndash9) with possible inclusion of R uvacrispa(Figs 2 7) The psbA-trnH dataset includes R oxyacan-thoides subsp irriguum within the Asian clade (Fig 3)but this is weakly supported (Fig 3) and requires fur-ther substantiation particularly since R oxyacanthoidessubsp irriguum is restricted to northwestern NorthAmerica and may itself be of hybrid origin from cross-es between R oxyacanthoides subsp setosum and R in-erme (Sinnott 1985) both distributed in western NorthAmerica Resolution within the clade of Asian speciessuggests a correspondance to geographic and oristicregions within Asia Whether the Asian and NorthAmerican true gooseberries represent divergent line-ages or a monophyletic Asian clade nested within aNorth American grade is unclear given the availabledata

Other Groups within Ribes Since this study fo-cused on the gooseberries sampling within other sec-tions of Ribes was sometimes limited Nevertheless the

94 [Volume 29SYSTEMATIC BOTANY

data did support the monophyly of sects CalobotryaParilla Symphocalyx and Berisia Section Calobotrya is agroup of 21 western North American species (Berger1924) known as the ornamental currants The mono-phyly of sect Calobotrya was well-supported with theinclusion of some dwarf currants (sect Heritieria) (Figs2ndash9 Messinger et al 1999 Senters and Soltis 2003)Sampling was limited in sect Parilla a group of 41dioecious South American species (Janczewski 1907)but the group was supported in ITS trees excludingthe east Asian R fasciculatum the sectionrsquos only non-South American species (Senters and Soltis 2003) Apossible sister relationship between sect Parilla andsect Calobotrya (unpubl data cited in Weigend andBinder 2001) is consistent with the position of sect Pa-rilla seen with ITS data (Senters and Soltis 2003) Sec-tion Symphocalyx the golden currants includes vespecies distributed through northern Mexico and cen-tral and western North America (Berger 1924) Thegolden currants were well-supported given the avail-able sampling (Fig 2 4 9) The alpine currants sectBerisia are a group of 17 dioecious species distributedthrough Eurasia (Janczewski 1907) The monophyly ofsect Berisia was well-supported (Figs 2ndash9 Messingeret al 1999) but with the inclusion of some red currants(sect Ribes) in ITS trees (Senters and Soltis 2003)

The monophyly of sects Ribes and Coreosma wasquestionable (Figs 2 3 5) The red currants (sect Ri-bes) are a group of 15 Eurasian species with one spe-cies R triste also distributed in North America Sec-tion Coreosma the black currants includes six speciesin North America and six in Eurasia (Berger 1924) Sec-tion Heritiera the dwarf currants appeared to be poly-phyletic as seen in Messinger et al (1999) and Sentersand Soltis (2003) This group of six species (Berger1924) is dened primarily by a prostrate habit and assuggested by Messinger et al (1999) is likely a case ofconvergence

Biogeography The spread of taxa around theNorthern Hemisphere has been facilitated by the avail-ability at various times of two major migrationroutesmdashthe Beringian and the North Atlantic landbridges (Tiffney 1985a 1985b Donoghue et al 2001SanmartDaggern et al 2001) Especially in large and relative-ly old clades which have become widespread aroundthe Northern Hemisphere it is possible (perhaps evenlikely) that both pathways were used Information onthe timing of key divergences and on the direction ofmovement within subclades will be critical in sortingout the possibilities in particular cases Ribes providesan excellent example of such a group being represent-ed in Eurasia by six sections (Berisia Ribes and somespecies from Heritiera Coreosma Grossularioides andGrossularia) in western North America by nine (Sym-phocalyx Calobotrya Robsonia Hesperia Lobbia andsome species of Coreosma Heritiera Grossularioides and

Grossularia) and in eastern North America by three(some species of Heritiera Ribes and Grossularia) Oneapproach for sorting through a complex biogeographichistory as might be expected in Ribes is to examinephylogenetic patterns in component clades and ide-ally to date divergences

Our analyses indicate that subg Grossularia is nestedwithin a predominantly western North Americanclade (Figs 2 5ndash9) and that it diversied initially inthat region (Fig 8 node 6) Subsequently within sectGrossularia it appears that movement occurred fromwestern North America to eastern Asia presumablythrough Beringia followed by vicariance and the ori-gin and diversication of the well-supported Asiangooseberry clade Donoghue et al (2001) and Xiangand Soltis (2001) highlighted cases of movement out ofAsia into North America through the Bering LandBridge Ribes appears to provide a case of movementin the opposite direction Movement in both directionsis of course to be expected What remains to be de-termined in future studies of disjunct taxa is exactlywhich groups moved in which directions and whetherthere are any signicant generalizations that can bemade about these different patterns

Elsewhere in Ribes there are other possible cases ofmovement between North America and Asia One caseinvolves R lacustre of sect Grossularioides which is dis-tributed in eastern Asia as well as in North AmericaOther possible cases relate to resolution at the base ofRibes where relationships remain uncertain The basalpositions of sect Symphocalyx in trees resulting frompsbA-trnH data and from the combination of psbA-trnHand ETS data suggest a western North American ori-gin for the entire clade (Figs 2 7) This would implyearly dispersion to Asia giving rise to sects Berisiaand Ribes However all other datasets and dataset com-binations suggested a broader Eurasian plus westernNorth American distribution at the base (Fig 8 node1) owing to the basal positions of sects Berisia andRibes This would imply early vicariance involvingAsia and North America and movement back to Asiawithin the western North American clade Future stud-ies should include more sampling of sects Berisia Ri-bes Coreosma and Symphocalyx to help resolve basal re-lationships and biogeographic patterns in Ribes

The fossil record for Ribes consists largely of leaveswith few reports of seeds (Kremenetski 1998) fruits(Cevallos-Ferriz 1995) and owers (Gandolfo et al1998) The leaf record for Ribes in North America mayextend from approximately 2 mya (Hannibal 1911Dorf 1930 Axelrod 1966) to at least 345 mya (Mac-Ginitie 1953 Manchester 2001) and possibly to 45 or50 mya (Axelrod 1998 Wehr and Hopkins 1994) Al-though leaf features are seldom used to distinguishextant taxa of Ribes Wolfe (1964) used leaf serrationand venation features to distinguish between fossil

2004] 95SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

leaves of subg Ribes and subg Grossularia from Ne-vada If these features are reliable this dates subgGrossularia to at least 14 mya (Fig 9 node 6) A criticalnext step in understanding Ribes biogeography will beto accurately assign Ribes fossils to particular sub-clades so as to infer the timing of intercontinental di-vergences

ACKNOWLEDGEMENTS We thank the following individuals andinstitutions for providing plant material B Alverson D BouffordR Mitchell Arnold Arboretum of Harvard University Universityof California Botanical Garden Royal Botanic Garden EdinburghNew York Botanical Garden and the USDA-ARS National PlantGermplasm Repository A Senters and D Soltis graciously pro-vided numerous DNA aliquots DNA sequences and access to ear-ly manuscripts H Schorn and D Erwin provided assistance withpaleobotanical literature M Lavin P Herendeen and two anon-ymous reviewers provided numerous helpful comments This proj-ect was supported in part by a Putnam Fellowship through theArnold Arboretum of Harvard University

LITERATURE CITED

AVISE J C 1994 Molecular markers natural history and evolutionNew York Chapman amp Hall

AXELROD D I 1966 The Pleistocene Soboba ora of southern Califor-nia University of California Publications in Geological Sci-ences 60

mdashmdashmdash 1998 Thunder Mountain Idaho University of CaliforniaPublications in Geological Sciences 142

BALDWIN B G and S MARKOS 1998 Phylogenetic utility of theexternal transcribed spacer (ETS) of 18Sndash26S rDNA Congru-ence of ETS and ITS trees of Calycadenia (Compositae) Mo-lecular Phylogenetics and Evolution 10 449ndash463

mdashmdashmdash M J SANDERSON J M PORTER M F WOJCIECHOWSKI CS CAMPBELL and M J DONOGHUE 1995 The ITS region ofnuclear ribosomal DNA a valuable source of evidence onangiosperm phylogeny Annals of the Missouri Botanical Garden82 247ndash277

BEARD K H 1998 East of Eden Asia as an important center oftaxonomic origination in mammalian evolution Bulletin of theCarnegie Museum of Natural History 34 5ndash39

BENA G M F JUBIER I OLIVIERI and B LEJEUNE 1998 Ribosom-al external and internal transcribed spacers combined use inthe phylogenetic analysis of Medicago (Leguminosae) Journal ofMolecular Evolution 46 299ndash306

BERGER A 1924 A taxonomic review of currants and gooseberriesNew York Agricultural Experimental Station Technical Bulletin109 1ndash118

BOUFFORD D E and S A SPONGBERG 1983 Eastern Asia-EasternNorth American phytogeographical relationships-a historyfrom the time of Linnaeus to the twentieth century Annalsof the Missouri Botanical Garden 70 423ndash439

CAMPBELL C S M F WOJCIECHOWSKI B G BALDWIN L A AL-ICE and M J DONOGHUE 1997 Persistent nuclear ribosomalDNA sequence polymorphism in the Amelanchier agamiccomplex (Rosaceae) Molecular Biology and Evolution 14 81ndash90

CEVALLOS-FERRIZ S R S 1995 Fruits of Ribes from the Princetonchert British Columbia Canada American Journal of Botany82(6 supplement) 84

COVILLE F V and N L BRITTON 1908 Grossulariaceae NorthAmer-ican Flora 22 193ndash225

CUNNINGHAM C W 1997 Can three incongruence tests predictwhen data shold be combined Molecular Biology and Evolution14 733ndash740

DEQUEIROZ A M J DONOGHUE and J KIM 1995 Separate versuscombined analysis of phylogenetic evidence Annual Review ofEcology and Systematics 26 657ndash681

DONOGHUE M J C D BELL and J LI 2001 Phylogenetic patternsin northern hemisphere plant geography International Journalof Plant Sciences 162 S41ndashS52

DORF E 1930 Pliocene oras of California Carnegie Institution ofWashington Publication 412

FARRIS J S M KALLERSJO A G KLUGE and C BULT 1995 Test-ing signicance of incongruence Cladistics 10 315ndash319

FELSENSTEIN J 1985 Condence limits on phylogenies an ap-proach using the bootstrap Evolution 39 783ndash791

FENTON B A N E BIRCH G MALLOCH P G LANHAM and RM BRENNAN 2000 Gall mite molecular phylogeny and itsrelationship to the evolution of plant host specicity AppliedAcarology 24 831ndash861

FRITSCH P W C M MORTON T CHEN and C MELDRUM 2001Phylogeny and biogeography of the Styracaceae InternationalJournal of Plant Sciences 162 S95ndashS116

GANDOLFO M A P HOC S N SANTILLANA and S A MARENSSI1998 Una or fosil morfologicamente afDaggern a las Grossulari-aceae (orden Rosales) de la Formacion la Meseta (Eoceno me-dio) Isla Marambio Antartida Asociacion Paleontologica Argen-tina Publicacion Especial 5 Paleogeno de America del Sur y de laPenDaggernsula Antartica 147ndash153

GOLDMAN N J P ANDERSON and A G RODRIGO 2000 Likeli-hood-based tests of topologies in phylogenetics SystematicBiology 49 652ndash670

HANNIBAL H 1911 A Pliocene ora from the Coast Ranges ofCalifornia Bulletin of the Torrey Botanical Club 38 329ndash342

HUELSENBECK J P J J BULL and C W CUNNINGHAM 1996 Com-binined data in phylogenetic analysis Trends in Ecology andEvolution 11 152ndash158

JANCZEWSKI M E 1907 Monographies des groseilliers Ribes LMemoires Societe de Physique et DrsquoHistoire Naturelle de Geneve35 199ndash517

KEEP E 1962 Interspecic hybridization in Ribes Genetica 33 1ndash23

KISHINO H and M HASEGAWA 1989 Evaluation of the maximumlikelihood estimate of the evolutionary tree topologies fromDNA sequence data and the branching order in HominoideaJournal of Molecular Evolution 29 170ndash179

KREMENETSKI C V 1998 Holocene history of the northern rangelimits of some trees and shrubs in Russia Arctic and AlpineResearch 30 317ndash333

LINDER C R L R GOERTZEN B V HEUVEL J FRANCISCO-OR-TEGA and R K JANSEN 2000 The complete external tran-scribed spacer of 18Sndash26S rDNA amplication and phylo-genetic utility at low taxonomic levels in Asteraceae andclosely allied families Molecular Phylogenetics and Evolution 14285ndash303

MACGINITIE D 1953 Fossil plants of the Florissant beds ColoradoCarnegie Institution of Washington Publication 599

MADDISON D R and W P MADDISON 2000 MacClade 4 Sun-derland Sinauer Associates

MANCHESTER S R 1999 Biogeographical relationships of NorthAmerican Tertiary oras Annals of the Missouri Botanical Gar-den 86 472ndash522

mdashmdashmdash 2001 Update on the megafossil ora of Florissant Colo-rado Proceedings of the Denver Museum of Nature amp ScienceSeries 4 No1 137

MANOS P S and M J DONOGHUE 2001 Progress in northernhemisphere phytogeography an introduction InternationalJournal of Plant Sciences 162 S1ndashS2

mdashmdashmdash and A M STANFORD 2001 The historical biogeography ofFagaceae tracking the tertiary history of temperate and sub-tropical forests of the northern hemisphere International Jour-nal of Plant Sciences 162 S77ndashS93

MAST A R and T J GIVNISH 2002 Historical biogeography andthe origin of stomatal distributions in Banksia and Dryandra(Proteaceae) based on their cpDNA phylogeny American Jour-nal of Botany 89 1311ndash1323

MESSINGER W K HUMMER and A LISTON 1999 Ribes (Grossu-

84 [Volume 29SYSTEMATIC BOTANY

FIG 2 The majority-rule consensus of 34005 trees resulting from analyses of ETS sequence data (CI5080 074 excludinguninformative characters RI5093) Numbers above the branches indicate the percentage of bootstrap replicates in which theclade appeared Numbers in parentheses below the branches indicate the percentage of trees in which the clade appearedwhen less than 100

2004] 85SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 3 The majority-rule consensus of 34000 trees resulting from analyses of psbA-trnH sequence data (CI5092 088excluding uninformative characters RI5094) Numbers above the branches indicate the percentage of bootstrap replicates inwhich the clade appeared Numbers in parentheses below the branches indicate the percentage of trees in which the cladeappeared when less than 100

86 [Volume 29SYSTEMATIC BOTANY

FIG 4 The strict consensus of six trees resulting fromanalyses of psbA-trnH sequence data combined with chloro-plast restriction site data (Messinger et al 1999) (CI5090 079excluding uninformative characters RI5087) Data combina-bility determined by partition homogeneity tests (p5066)Numbers above the branches indicate the percentage of boot-strap replicates in which the clade appeared

with the inclusion of some species of sect Ribes in ITStrees (Senters and Soltis 2003) Section Symphocalyxwasstrongly resolved in ETS and restriction site trees (Fig2 Messinger et al 1999) but was unresolved in psbA-trnH trees (Fig 3) (ITS trees included only one species)Section Heritiera appeared to be polyphyletic in ITSand restriction site trees (only one species of sect Her-itiera is included in ETS or psbA-trnH analyses) (Mes-singer et al 1999 Senters and Soltis 2003) The mono-phyly of sects Ribes and Coreosma remain unclear Forthose species sampled sect Ribes was resolved asmonophyletic in restriction site trees (Messinger et al1999) as monophyletic excluding R triste in ETS andpsbA-trnH trees (Figs 2 3) and as polyphyletic in ITStrees with some species clearly related to sect Berisia(Senters and Soltis 2003) Section Coreosma was re-solved as polyphyletic in ETS and restriction site trees(Fig 2 Messinger et al 1999) and as para- or poly-phyletic in ITS trees (Senters and Soltis 2003) (only onespecies was included in the psbA-trnH dataset) Previ-ous restriction site analyses of 18ndash26S rDNA suggestedthat members of sect Coreosma were divergent fromone another and from other Ribes species (Messingeret al 1993) Sampling from sect Parilla was too limitedto draw strong conclusions but the ITS trees support-ed its monophyly to the exclusion of R fasciculatumthe only non-South American member of the section(Senters and Soltis 2003) Relationships among the sec-tions outside of the predominantly western NorthAmerican clade (sects Calobotrya Grossularioides subgGrossularia) varied markedly among datasets with lit-tle support for any one resolution (Figs 2 3)

Trees Generated from Analyses of CombinedDatasets Dataset combinability is typically based ona critical value of p 5 005 (ie datasets are incongru-ent when p 005) However studies suggest that acritical value of p 5 005 may be too strict such thatthe null hypothesis of dataset congruence will be false-ly rejected (Huelsenbeck et al 1996 Sullivan 1996Cunningham 1997) and that a value such as p 5 001may be more appropriate (Cunningham 1997) Manyof the datasets reported here were not combinablebased on intitial partition homogeneity tests but theincongruence was generally eliminated when problem-atic taxa were excluded

Analyses of the readily combinable chloroplast psbA-trnH and restriction site data (p5066) generated sixtrees (length 144 CI5090 079 excluding uninforma-tive characters RI5087) In agreement with analysesof restriction site data alone true gooseberries (sectGrossularia) were not placed as sister to the remainingglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) suggesting that subg Grossularia is not monophy-letic (Figs 1 4) The true gooseberries were nested ina paraphyletic sect Grossularioides as in the restrictionsite trees with sect Calobotrya weakly placed as sister

Support for sect Grossularia sect Calobotrya and theglabrous-styled gooseberries (Hesperia Lobbia Robsonia)increased relative to analyses of either dataset alone(Fig 3 Messinger et al 1999) Support for a paraphy-letic sect Grossularioides decreased slightly relative tothe restriction site analyses (Fig 4 Messinger et al1999)

Analyses of the combined ETS and ITS rDNA data(p5004 excluded R fasciculatum R glandulosum Rhimalense R manshuricum R nevadense R rubrum Roxyacanthoides subsp oxycanthoides R uvacripsa) gener-ated 150 trees (length 614 CI5077 070 excluding un-informative characters RI5085) (Fig 5) Subg Gros-sularia was monophyletic as were the true gooseber-ries (sect Grossularia) (Fig 5) The glabrous-styledgooseberries (Hesperia Lobbia Robsonia) were stronglyresolved as monophyletic with the exception of R wat-sonianum (sect Lobbia) placed strongly as sister to thetrue gooseberries Within sect Grossularia only theAsian clade was resolved with strong support Theclade containing subg Grossularia sect Grossularioi-dies and sect Calobotrya was again evident with sectGrossularioides resolved as sister to subg GrossulariaSupport for the glabrous-styled gooseberries (HesperiaLobbia Robsonia) sect Calobotrya sect Grossularioidesand the Asian clade within sect Grossularia increasedrelative to support from ETS or ITS datasets analyzedindividually (Figs 2 5 Senters and Soltis 2003)

The most evident difference between chloroplast and

2004] 87SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 5 The strict consensus of 150 trees resulting from analyses of combined ETS and ITS sequence data (CI5077 070excluding uninformative characters RI5085) Data combinability determined by partition homogeneity tests (p5004) Num-bers above the branches indicate the percentage of bootstrap replicates in which the clade appeared

88 [Volume 29SYSTEMATIC BOTANY

FIG 6 The strict consensus of four trees resulting from analyses of the four datasets combined (ETS ITS psbA-trnHchloroplast restriction sites) Data combinability was determined by partition homogeneity tests (p5075) Numbers above thebranches indicate the percentage of bootstrap replicates in which the clade appeared

rDNA trees was the position of sect GrossularioidesSubgenus Grossularia is monophyletic in rDNA treeswith sect Grossularioides placed weakly as sister (Fig5) In contrast subg Grossularia is polyphyletic in chlo-roplast trees with sect Grossularia nested within sectGrossulariodes and sect Calobotrya sister to that group-ing (Fig 4) Analyses of the combined chloroplast andrDNA datasets (p5075 excluded R glandulosum Rlacustre R montigenum) generated four trees (length556 CI5088 069 excluding uninformative charactersRI5076) (Fig 6) Taxon sampling was limited due tothe limited overlap among datasets but trees showedstrong resolution of sect Calobotrya sect Grossulariaand the glabrous-styled gooseberries (Hesperia Lobbia

Robsonia) These groups again formed a well-support-ed clade nested within Ribes (Fig 6) The strongly sup-ported sister-group relationship between the true andglabrous-styled gooseberries (Fig 6) is consistent withthe monophyly of subg Grossularia but could changewith the inclusion of sect Grossularioides

ETS and psbA-trnH combined analyses (p5004 ex-cluded R oxyacanthoides subsp irriguum) generated 329trees (length 372 CI5084 077 excluding uninforma-tive characters RI5090) (Fig 7) Subgenus Grossulariawas resolved as monophyletic within which both theglabrous-styled and the true gooseberries were strong-ly supported the latter including R watsonianum(subg Lobbia) The Asian clade was well supported

2004] 89SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 7 The strict consensus of 329 trees resulting from analyses of combined ETS and psbA-trnH data (CI5084 077excluding uninformative characters RI5091) Dataset combinability was determined by partition-homogeneity tests (p5 004)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared

within sect Grossularia including the European R uva-crispa Both sect Calobotrya and sect Grossularioideswere strongly supported but neither was resolved assister to subg Grossularia The clade comprising subgGrossularia sect Grossularioides and sect Calobotryawas again evident nested within Ribes

Combined analyses of psbA-trnH and rDNA datasets(p5002 excluded R oxyacanthoides subsp irriguum andtaxa excluded from ETS1ITS analysis) generated 3080trees (length 5 719 CI5080 074 excluding uninfor-mative characters RI5085) Sects Grossularioides Calo-botrya Grossularia and the glabrous-styled gooseberries

90 [Volume 29SYSTEMATIC BOTANY

(Hesperia Lobbia Robsonia) were each strongly support-ed and again formed a strongly supported clade nestedin Ribes (Fig 8) Support for the monophyly of subgGrossularia was increased relative to support seen withany individual dataset (Figs 2 3 8)

Combinability (p5012) of all datasets for those taxarepresented in three of the four datasets required ex-clusion of composite taxa problematic within therDNA dataset as well as exclusion of taxa problematicfor the chloroplast versus rDNA datasets Combinedanalyses generated 4802 trees (length5768 CI5080074 excluding uninformative characters RI5085)Sec-tion Calobotrya sect Grossularia and the glabrous-styled gooseberries (Hesperia Lobbia Robsonia) exclud-ing R watsonianum were each well supported and to-gether formed a strongly supported clade (Fig 9) Sub-genus Grossularia was resolved as monophyleticbearing in mind that sect Grossularioides was excludedfrom the analyses

While all combined datasets resolved the clade con-taining sects Calobotrya Grossularioides and subgGrossularia as nested within Ribes (Figs 4ndash9) relation-ships among other lineages were unclear as in theanalyses of individual datasets (Figs 2 3) Basal rela-tionships were unresolved in the analyses of combinedchloroplast data (Fig 4) The combined ETS and psbA-trnH analyses suggested basal positions for goldencurrants (sect Symphocalyx) (Fig 7) All remaininganalyses suggested basal positions for sects Berisiaand Ribes (Figs 5 6 8 9) Basal relationships were notwell-supported in any analysis

Kishino-Hasegawa Tests Trees generated fromanalyses constraining the monophyly of subg Gros-sularia versus trees constrained to resolve a sister re-lationship between sect Grossularioides and sect Gros-sularia were marginally but signicantly different inboth the chloroplast (p5003) and the rDNA (p5005)datasets

Ancestral Area Reconstructions DIVA reconstruc-tions of ancestral areas support a western North Amer-ican origin for a large segment of Ribes beginningwith node 2 in Fig 8 Within this clade it is also thecase that subg Grossularia is inferred to have diversi-ed rst within western North America (Fig 8 node6) Subsequent movement to eastern Asia is inferred tohave occurred somewhere within sect Grossularia butthe ancestral area for the true gooseberries is equivo-cal and can include virtually any combination of areasdepending on the exact resolution of the large poly-tomy at the base of this clade (Fig 8 node 8) Impor-tantly our results indicate that the Asian species with-in sect Grossularia form a clade implying a single mi-gration from North America to Asia The ancestralarea for Ribes is reconstructed to be western NorthAmerica and western Eurasia or western North Amer-ica and all of Eurasia (Fig 8 node 1) However this

result hinges on resolution at the base which remainshighly uncertain and requires more intensive samplingof Ribes lineages outside of subg Grossularia

DISCUSSION

Gooseberry Monophyly Results from previousphylogenetic analyses based on nuclear 18Sndash26S rDNAITS data (Senters and Soltis 2003) and chloroplast re-striction site data (Messinger et al 1999) differed re-garding gooseberry monophyly Adding the additionalnuclear 18Sndash26S rDNA ETS and chloroplast psbA-trnHdatasets could increase support and resolution in re-sulting topologies or could reinforce the differencesbetween the nuclear and chloroplast topologies witheach reecting accurate but separate histories

Initial examination of the trees produced with theadditional datasets reinforced the apparent conict be-tween nuclear and chloroplast genomes ITS ETS andcombined rDNA datasets supported the monophyly ofsubg Grossularia (Figs 1 2 5) In contrast the com-bined chloroplast datasets (restriction sites plus psbA-trnH) suggested a closer relationship between the trueand glabrous-styled gooseberries than did the restric-tion site data alone (Fig 1 Messinger et al 1999) butstill resolved subg Grossularia as non-monophyleticwith sect Grossularioidies forming a grade at the baseof sect Grossularia (Fig 4) The increase in tree lengthwhen combined chloroplast data was constrained toresolve a monophyletic subg Grossularia (p5003) orwhen combined rDNA data was constrained to resolvesects Grossularioides and Grossularia as a clade(p5005) also indicated dataset incongruence

The discrepancy between nuclear and chloroplast to-pologies primarily involved the restriction sites datasetand not the psbA-trnH dataset The psbA-trnH datasetprovided little resolution (Fig 3) conicting with nei-ther the rDNA nor the restriction sites topologiesAnalyses combining the psbA-trnH data with either theETS data (p5004 Fig 7) or the rDNA data (p5002Fig 8) produced trees resolving subg Grossularia asmonophyletic with increased support relative to ETSor rDNA data alone (Figs 2 5) Section Grossularioideswas either sister to subg Grossularia (psbA-trnH 1rDNA Fig 8) or was unresolved in a polytomy withsubg Grossularia and sect Calobotrya (psbA-trnH 1ETS Fig 7) The monophyly of subg Grossularia wasalso supported by analyses of all datasets combinedwhether including taxa represented in all four datasets(p5075 Fig 6) or in three of the four datasets(p5012 Fig 9) Analyses combining all datasets re-quired exclusion of sect Grossularioides thus leavingsubg Grossularia monophyly uncertain However in-cluding sect Grossulariodes in spite of dataset incon-gruence (p5001) produced trees resolving a mono-phyletic subg Grossularia sister to a monophyletic sectGrossularioides (not shown)

2004] 91SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 8 The strict consensus of 3080 trees resulting from analyses of combined psbA-trnH and rDNA data (CI 5 080 074excluding uninformative characters RI 5 085) Dataset combinability was determined by partition homogeneity tests (p5002)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared DIVA (Ronquist 1996)was used to infer ancestral areas at the numbered nodes The ancestral areas at nodes two through seven were reconstructedas western North America Node one was reconstructed as western North America plus either western Eurasia or all of EurasiaThere were multiple possible reconstructions at node 8 including (1) western North America and eastern Eurasia (2) NorthAmerica and eastern Eurasia (3) North America or (4) western North America

92 [Volume 29SYSTEMATIC BOTANY

FIG 9 The strict consensus of 4802 trees resulting from analyses of all four datasets (ITS ETS psbA-trnH chloroplastrestriction sites) including taxa represented in at least three datasets (CI5080 074 excluding uninformative charactersRI5085) Dataset combinability was determined using partition homogeneity tests (p5012) Numbers above the branchesindicate the percentage of bootstrap replicates in which the clade appeared

2004] 93SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

The general picture that emerges from these analy-ses suggests that subg Grossularia is monophyletic(Figs 2 5ndash9) rDNA data supported gooseberry mono-phyly (Figs 2 5) psbA-trnH data while lacking suf-cient variation to resolve gooseberry monophyly ornon-monophyly supported gooseberry monophyly incombination with rDNA data (Figs 7 8) Finally anal-yses of all datasets combined supported gooseberrymonophyly although these analyses excluded thespiny currants (sect Grossularioides) (Figs 6 9) Whatrequires further investigation is the role hybridizationmay have played in the history of the spiny currants(sect Grossularioides) and the true gooseberries (sectGrossularia) Messinger et al (1999) encouraged furtherexploration of this possibility in Ribes in which theynoted potential chloroplast capture of the sect Gros-sularia chloroplast type by sect Grossularioides Crosseshave not been successful between species of sect Gros-sularioides and other sections within Ribes and are usu-ally unsuccessful between sections or subgenera (Keep1962) Conrmation of the pattern seen in trees gen-erated from the chloroplast restriction site data (Mes-singer et al 1999) is needed from additional chloro-plast datasets that provide greater resolution than didthe psbA-trnH dataset

Relationships Within the Gooseberries SubgenusGrossularia comprises two main lineages (Figs 2 5ndash9)the true gooseberries (sect Grossularia) and a clade ofglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) The four gooseberry sections are traditionally dis-tinguished from each other by basally pubescent stylesin sect Grossularia (with the exception of some Asianspecies) by four versus ve parted owers in sect Rob-sonia by anthers broader at the base in subg Hesperiaand by the absence of the above set of features in subgLobbia The glabrous-styled gooseberry lineage com-prising 27 species distributed through western NorthAmerica into Mexico (Berger 1924) was well-support-ed given our sampling but sections within this lineagewere not resolved Ribes watsonianum (subg Lobbia)was surprisingly placed outside of the glabrous-styledgooseberry lineage as sister to the true gooseberries(Figs 2 5 7ndash9) ITS data resolved R watsonianum with-in the glabrous-styled gooseberry lineage (Senters andSoltis 2003) but ETS data strongly resolved the specieswithin the true gooseberry lineage (sect Grossularia)(Fig 2) This conict within the rDNA data may reecthybridization between R watsonianum and a memberof sect Grossularia followed by xation within the Rwatsonianum genome of a recombinant rDNA repeattype Accounts of Ribes hybrids in the eld are rela-tively rare (Messler et al 1991) and do not implicateR watsonianum but fertile hybrids can be obtainedfrom articial crosses between glabrous-styled goose-berries and true gooseberries (Keep 1962 citing R lob-bii 3 R divaricatum) Alternatively R watsonianum may

posses multiple rDNA repeat types with different re-peat types sampled in our ITS versus ETS datasetsEach of these possibilities has been reported in otherplant taxa (Wendel et al 1995a Campbell et al 1997for potential recombinant rDNA repeat types Suh etal 1993 Wendel et al 1995b for incomplete homoge-nization of rDNA repeat types)

The true gooseberries (sect Grossularia) have a broadrange throughout the northern hemisphere with ninespecies in North America (Sinnott 1985) and seven spe-cies in Eurasia (Berger 1924) In his treatment of NorthAmerican gooseberries Sinnott (1985) divided his ninespecies into ve groups based on phenetic analysesThe groups consisted of (1) R cynosbati with spinyfruits (2) R niveum R curvatum and R missouriensewith highly exserted stamens and long sepals (3) Rrotundifolium and R divaricatum with medium lengthstamens and purple sepals (4) R inerme and R hirtel-lum with intermediate length stamens and small oralfeatures and (5) the ve subspecies of R oxyacanthoi-des with short stamens Sinnott (1985) recommendedthat R echinellum be excluded from the true gooseber-ries and aligned with the glabrous-styled gooseberriesof western North America (Hesperia Lobbia Robsonia)The analyses presented here showed strong supportfor the inclusion of R echinellum as well as the Eurasianspecies within the true gooseberry lineage (Figs 2ndash35 7ndash9) Resolution among the North American specieswas lacking or not well-supported (Figs 2ndash9) and thusneither supported nor conicted with Sinnottrsquos hy-pothesized relationships

The seven Eurasian species of sect Grossularia (Ber-ger 1924) include R uvacrispa in Europe R alpestre andR aciculare in the Himalayan region R stenocarpumand R formosanum in southern and eastern Asia andR burejense and R grossularioides in northern and east-ern Asia A clade of Asian species is well-supported(Figs 2 5 7ndash9) with possible inclusion of R uvacrispa(Figs 2 7) The psbA-trnH dataset includes R oxyacan-thoides subsp irriguum within the Asian clade (Fig 3)but this is weakly supported (Fig 3) and requires fur-ther substantiation particularly since R oxyacanthoidessubsp irriguum is restricted to northwestern NorthAmerica and may itself be of hybrid origin from cross-es between R oxyacanthoides subsp setosum and R in-erme (Sinnott 1985) both distributed in western NorthAmerica Resolution within the clade of Asian speciessuggests a correspondance to geographic and oristicregions within Asia Whether the Asian and NorthAmerican true gooseberries represent divergent line-ages or a monophyletic Asian clade nested within aNorth American grade is unclear given the availabledata

Other Groups within Ribes Since this study fo-cused on the gooseberries sampling within other sec-tions of Ribes was sometimes limited Nevertheless the

94 [Volume 29SYSTEMATIC BOTANY

data did support the monophyly of sects CalobotryaParilla Symphocalyx and Berisia Section Calobotrya is agroup of 21 western North American species (Berger1924) known as the ornamental currants The mono-phyly of sect Calobotrya was well-supported with theinclusion of some dwarf currants (sect Heritieria) (Figs2ndash9 Messinger et al 1999 Senters and Soltis 2003)Sampling was limited in sect Parilla a group of 41dioecious South American species (Janczewski 1907)but the group was supported in ITS trees excludingthe east Asian R fasciculatum the sectionrsquos only non-South American species (Senters and Soltis 2003) Apossible sister relationship between sect Parilla andsect Calobotrya (unpubl data cited in Weigend andBinder 2001) is consistent with the position of sect Pa-rilla seen with ITS data (Senters and Soltis 2003) Sec-tion Symphocalyx the golden currants includes vespecies distributed through northern Mexico and cen-tral and western North America (Berger 1924) Thegolden currants were well-supported given the avail-able sampling (Fig 2 4 9) The alpine currants sectBerisia are a group of 17 dioecious species distributedthrough Eurasia (Janczewski 1907) The monophyly ofsect Berisia was well-supported (Figs 2ndash9 Messingeret al 1999) but with the inclusion of some red currants(sect Ribes) in ITS trees (Senters and Soltis 2003)

The monophyly of sects Ribes and Coreosma wasquestionable (Figs 2 3 5) The red currants (sect Ri-bes) are a group of 15 Eurasian species with one spe-cies R triste also distributed in North America Sec-tion Coreosma the black currants includes six speciesin North America and six in Eurasia (Berger 1924) Sec-tion Heritiera the dwarf currants appeared to be poly-phyletic as seen in Messinger et al (1999) and Sentersand Soltis (2003) This group of six species (Berger1924) is dened primarily by a prostrate habit and assuggested by Messinger et al (1999) is likely a case ofconvergence

Biogeography The spread of taxa around theNorthern Hemisphere has been facilitated by the avail-ability at various times of two major migrationroutesmdashthe Beringian and the North Atlantic landbridges (Tiffney 1985a 1985b Donoghue et al 2001SanmartDaggern et al 2001) Especially in large and relative-ly old clades which have become widespread aroundthe Northern Hemisphere it is possible (perhaps evenlikely) that both pathways were used Information onthe timing of key divergences and on the direction ofmovement within subclades will be critical in sortingout the possibilities in particular cases Ribes providesan excellent example of such a group being represent-ed in Eurasia by six sections (Berisia Ribes and somespecies from Heritiera Coreosma Grossularioides andGrossularia) in western North America by nine (Sym-phocalyx Calobotrya Robsonia Hesperia Lobbia andsome species of Coreosma Heritiera Grossularioides and

Grossularia) and in eastern North America by three(some species of Heritiera Ribes and Grossularia) Oneapproach for sorting through a complex biogeographichistory as might be expected in Ribes is to examinephylogenetic patterns in component clades and ide-ally to date divergences

Our analyses indicate that subg Grossularia is nestedwithin a predominantly western North Americanclade (Figs 2 5ndash9) and that it diversied initially inthat region (Fig 8 node 6) Subsequently within sectGrossularia it appears that movement occurred fromwestern North America to eastern Asia presumablythrough Beringia followed by vicariance and the ori-gin and diversication of the well-supported Asiangooseberry clade Donoghue et al (2001) and Xiangand Soltis (2001) highlighted cases of movement out ofAsia into North America through the Bering LandBridge Ribes appears to provide a case of movementin the opposite direction Movement in both directionsis of course to be expected What remains to be de-termined in future studies of disjunct taxa is exactlywhich groups moved in which directions and whetherthere are any signicant generalizations that can bemade about these different patterns

Elsewhere in Ribes there are other possible cases ofmovement between North America and Asia One caseinvolves R lacustre of sect Grossularioides which is dis-tributed in eastern Asia as well as in North AmericaOther possible cases relate to resolution at the base ofRibes where relationships remain uncertain The basalpositions of sect Symphocalyx in trees resulting frompsbA-trnH data and from the combination of psbA-trnHand ETS data suggest a western North American ori-gin for the entire clade (Figs 2 7) This would implyearly dispersion to Asia giving rise to sects Berisiaand Ribes However all other datasets and dataset com-binations suggested a broader Eurasian plus westernNorth American distribution at the base (Fig 8 node1) owing to the basal positions of sects Berisia andRibes This would imply early vicariance involvingAsia and North America and movement back to Asiawithin the western North American clade Future stud-ies should include more sampling of sects Berisia Ri-bes Coreosma and Symphocalyx to help resolve basal re-lationships and biogeographic patterns in Ribes

The fossil record for Ribes consists largely of leaveswith few reports of seeds (Kremenetski 1998) fruits(Cevallos-Ferriz 1995) and owers (Gandolfo et al1998) The leaf record for Ribes in North America mayextend from approximately 2 mya (Hannibal 1911Dorf 1930 Axelrod 1966) to at least 345 mya (Mac-Ginitie 1953 Manchester 2001) and possibly to 45 or50 mya (Axelrod 1998 Wehr and Hopkins 1994) Al-though leaf features are seldom used to distinguishextant taxa of Ribes Wolfe (1964) used leaf serrationand venation features to distinguish between fossil

2004] 95SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

leaves of subg Ribes and subg Grossularia from Ne-vada If these features are reliable this dates subgGrossularia to at least 14 mya (Fig 9 node 6) A criticalnext step in understanding Ribes biogeography will beto accurately assign Ribes fossils to particular sub-clades so as to infer the timing of intercontinental di-vergences

ACKNOWLEDGEMENTS We thank the following individuals andinstitutions for providing plant material B Alverson D BouffordR Mitchell Arnold Arboretum of Harvard University Universityof California Botanical Garden Royal Botanic Garden EdinburghNew York Botanical Garden and the USDA-ARS National PlantGermplasm Repository A Senters and D Soltis graciously pro-vided numerous DNA aliquots DNA sequences and access to ear-ly manuscripts H Schorn and D Erwin provided assistance withpaleobotanical literature M Lavin P Herendeen and two anon-ymous reviewers provided numerous helpful comments This proj-ect was supported in part by a Putnam Fellowship through theArnold Arboretum of Harvard University

LITERATURE CITED

AVISE J C 1994 Molecular markers natural history and evolutionNew York Chapman amp Hall

AXELROD D I 1966 The Pleistocene Soboba ora of southern Califor-nia University of California Publications in Geological Sci-ences 60

mdashmdashmdash 1998 Thunder Mountain Idaho University of CaliforniaPublications in Geological Sciences 142

BALDWIN B G and S MARKOS 1998 Phylogenetic utility of theexternal transcribed spacer (ETS) of 18Sndash26S rDNA Congru-ence of ETS and ITS trees of Calycadenia (Compositae) Mo-lecular Phylogenetics and Evolution 10 449ndash463

mdashmdashmdash M J SANDERSON J M PORTER M F WOJCIECHOWSKI CS CAMPBELL and M J DONOGHUE 1995 The ITS region ofnuclear ribosomal DNA a valuable source of evidence onangiosperm phylogeny Annals of the Missouri Botanical Garden82 247ndash277

BEARD K H 1998 East of Eden Asia as an important center oftaxonomic origination in mammalian evolution Bulletin of theCarnegie Museum of Natural History 34 5ndash39

BENA G M F JUBIER I OLIVIERI and B LEJEUNE 1998 Ribosom-al external and internal transcribed spacers combined use inthe phylogenetic analysis of Medicago (Leguminosae) Journal ofMolecular Evolution 46 299ndash306

BERGER A 1924 A taxonomic review of currants and gooseberriesNew York Agricultural Experimental Station Technical Bulletin109 1ndash118

BOUFFORD D E and S A SPONGBERG 1983 Eastern Asia-EasternNorth American phytogeographical relationships-a historyfrom the time of Linnaeus to the twentieth century Annalsof the Missouri Botanical Garden 70 423ndash439

CAMPBELL C S M F WOJCIECHOWSKI B G BALDWIN L A AL-ICE and M J DONOGHUE 1997 Persistent nuclear ribosomalDNA sequence polymorphism in the Amelanchier agamiccomplex (Rosaceae) Molecular Biology and Evolution 14 81ndash90

CEVALLOS-FERRIZ S R S 1995 Fruits of Ribes from the Princetonchert British Columbia Canada American Journal of Botany82(6 supplement) 84

COVILLE F V and N L BRITTON 1908 Grossulariaceae NorthAmer-ican Flora 22 193ndash225

CUNNINGHAM C W 1997 Can three incongruence tests predictwhen data shold be combined Molecular Biology and Evolution14 733ndash740

DEQUEIROZ A M J DONOGHUE and J KIM 1995 Separate versuscombined analysis of phylogenetic evidence Annual Review ofEcology and Systematics 26 657ndash681

DONOGHUE M J C D BELL and J LI 2001 Phylogenetic patternsin northern hemisphere plant geography International Journalof Plant Sciences 162 S41ndashS52

DORF E 1930 Pliocene oras of California Carnegie Institution ofWashington Publication 412

FARRIS J S M KALLERSJO A G KLUGE and C BULT 1995 Test-ing signicance of incongruence Cladistics 10 315ndash319

FELSENSTEIN J 1985 Condence limits on phylogenies an ap-proach using the bootstrap Evolution 39 783ndash791

FENTON B A N E BIRCH G MALLOCH P G LANHAM and RM BRENNAN 2000 Gall mite molecular phylogeny and itsrelationship to the evolution of plant host specicity AppliedAcarology 24 831ndash861

FRITSCH P W C M MORTON T CHEN and C MELDRUM 2001Phylogeny and biogeography of the Styracaceae InternationalJournal of Plant Sciences 162 S95ndashS116

GANDOLFO M A P HOC S N SANTILLANA and S A MARENSSI1998 Una or fosil morfologicamente afDaggern a las Grossulari-aceae (orden Rosales) de la Formacion la Meseta (Eoceno me-dio) Isla Marambio Antartida Asociacion Paleontologica Argen-tina Publicacion Especial 5 Paleogeno de America del Sur y de laPenDaggernsula Antartica 147ndash153

GOLDMAN N J P ANDERSON and A G RODRIGO 2000 Likeli-hood-based tests of topologies in phylogenetics SystematicBiology 49 652ndash670

HANNIBAL H 1911 A Pliocene ora from the Coast Ranges ofCalifornia Bulletin of the Torrey Botanical Club 38 329ndash342

HUELSENBECK J P J J BULL and C W CUNNINGHAM 1996 Com-binined data in phylogenetic analysis Trends in Ecology andEvolution 11 152ndash158

JANCZEWSKI M E 1907 Monographies des groseilliers Ribes LMemoires Societe de Physique et DrsquoHistoire Naturelle de Geneve35 199ndash517

KEEP E 1962 Interspecic hybridization in Ribes Genetica 33 1ndash23

KISHINO H and M HASEGAWA 1989 Evaluation of the maximumlikelihood estimate of the evolutionary tree topologies fromDNA sequence data and the branching order in HominoideaJournal of Molecular Evolution 29 170ndash179

KREMENETSKI C V 1998 Holocene history of the northern rangelimits of some trees and shrubs in Russia Arctic and AlpineResearch 30 317ndash333

LINDER C R L R GOERTZEN B V HEUVEL J FRANCISCO-OR-TEGA and R K JANSEN 2000 The complete external tran-scribed spacer of 18Sndash26S rDNA amplication and phylo-genetic utility at low taxonomic levels in Asteraceae andclosely allied families Molecular Phylogenetics and Evolution 14285ndash303

MACGINITIE D 1953 Fossil plants of the Florissant beds ColoradoCarnegie Institution of Washington Publication 599

MADDISON D R and W P MADDISON 2000 MacClade 4 Sun-derland Sinauer Associates

MANCHESTER S R 1999 Biogeographical relationships of NorthAmerican Tertiary oras Annals of the Missouri Botanical Gar-den 86 472ndash522

mdashmdashmdash 2001 Update on the megafossil ora of Florissant Colo-rado Proceedings of the Denver Museum of Nature amp ScienceSeries 4 No1 137

MANOS P S and M J DONOGHUE 2001 Progress in northernhemisphere phytogeography an introduction InternationalJournal of Plant Sciences 162 S1ndashS2

mdashmdashmdash and A M STANFORD 2001 The historical biogeography ofFagaceae tracking the tertiary history of temperate and sub-tropical forests of the northern hemisphere International Jour-nal of Plant Sciences 162 S77ndashS93

MAST A R and T J GIVNISH 2002 Historical biogeography andthe origin of stomatal distributions in Banksia and Dryandra(Proteaceae) based on their cpDNA phylogeny American Jour-nal of Botany 89 1311ndash1323

MESSINGER W K HUMMER and A LISTON 1999 Ribes (Grossu-

2004] 85SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 3 The majority-rule consensus of 34000 trees resulting from analyses of psbA-trnH sequence data (CI5092 088excluding uninformative characters RI5094) Numbers above the branches indicate the percentage of bootstrap replicates inwhich the clade appeared Numbers in parentheses below the branches indicate the percentage of trees in which the cladeappeared when less than 100

86 [Volume 29SYSTEMATIC BOTANY

FIG 4 The strict consensus of six trees resulting fromanalyses of psbA-trnH sequence data combined with chloro-plast restriction site data (Messinger et al 1999) (CI5090 079excluding uninformative characters RI5087) Data combina-bility determined by partition homogeneity tests (p5066)Numbers above the branches indicate the percentage of boot-strap replicates in which the clade appeared

with the inclusion of some species of sect Ribes in ITStrees (Senters and Soltis 2003) Section Symphocalyxwasstrongly resolved in ETS and restriction site trees (Fig2 Messinger et al 1999) but was unresolved in psbA-trnH trees (Fig 3) (ITS trees included only one species)Section Heritiera appeared to be polyphyletic in ITSand restriction site trees (only one species of sect Her-itiera is included in ETS or psbA-trnH analyses) (Mes-singer et al 1999 Senters and Soltis 2003) The mono-phyly of sects Ribes and Coreosma remain unclear Forthose species sampled sect Ribes was resolved asmonophyletic in restriction site trees (Messinger et al1999) as monophyletic excluding R triste in ETS andpsbA-trnH trees (Figs 2 3) and as polyphyletic in ITStrees with some species clearly related to sect Berisia(Senters and Soltis 2003) Section Coreosma was re-solved as polyphyletic in ETS and restriction site trees(Fig 2 Messinger et al 1999) and as para- or poly-phyletic in ITS trees (Senters and Soltis 2003) (only onespecies was included in the psbA-trnH dataset) Previ-ous restriction site analyses of 18ndash26S rDNA suggestedthat members of sect Coreosma were divergent fromone another and from other Ribes species (Messingeret al 1993) Sampling from sect Parilla was too limitedto draw strong conclusions but the ITS trees support-ed its monophyly to the exclusion of R fasciculatumthe only non-South American member of the section(Senters and Soltis 2003) Relationships among the sec-tions outside of the predominantly western NorthAmerican clade (sects Calobotrya Grossularioides subgGrossularia) varied markedly among datasets with lit-tle support for any one resolution (Figs 2 3)

Trees Generated from Analyses of CombinedDatasets Dataset combinability is typically based ona critical value of p 5 005 (ie datasets are incongru-ent when p 005) However studies suggest that acritical value of p 5 005 may be too strict such thatthe null hypothesis of dataset congruence will be false-ly rejected (Huelsenbeck et al 1996 Sullivan 1996Cunningham 1997) and that a value such as p 5 001may be more appropriate (Cunningham 1997) Manyof the datasets reported here were not combinablebased on intitial partition homogeneity tests but theincongruence was generally eliminated when problem-atic taxa were excluded

Analyses of the readily combinable chloroplast psbA-trnH and restriction site data (p5066) generated sixtrees (length 144 CI5090 079 excluding uninforma-tive characters RI5087) In agreement with analysesof restriction site data alone true gooseberries (sectGrossularia) were not placed as sister to the remainingglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) suggesting that subg Grossularia is not monophy-letic (Figs 1 4) The true gooseberries were nested ina paraphyletic sect Grossularioides as in the restrictionsite trees with sect Calobotrya weakly placed as sister

Support for sect Grossularia sect Calobotrya and theglabrous-styled gooseberries (Hesperia Lobbia Robsonia)increased relative to analyses of either dataset alone(Fig 3 Messinger et al 1999) Support for a paraphy-letic sect Grossularioides decreased slightly relative tothe restriction site analyses (Fig 4 Messinger et al1999)

Analyses of the combined ETS and ITS rDNA data(p5004 excluded R fasciculatum R glandulosum Rhimalense R manshuricum R nevadense R rubrum Roxyacanthoides subsp oxycanthoides R uvacripsa) gener-ated 150 trees (length 614 CI5077 070 excluding un-informative characters RI5085) (Fig 5) Subg Gros-sularia was monophyletic as were the true gooseber-ries (sect Grossularia) (Fig 5) The glabrous-styledgooseberries (Hesperia Lobbia Robsonia) were stronglyresolved as monophyletic with the exception of R wat-sonianum (sect Lobbia) placed strongly as sister to thetrue gooseberries Within sect Grossularia only theAsian clade was resolved with strong support Theclade containing subg Grossularia sect Grossularioi-dies and sect Calobotrya was again evident with sectGrossularioides resolved as sister to subg GrossulariaSupport for the glabrous-styled gooseberries (HesperiaLobbia Robsonia) sect Calobotrya sect Grossularioidesand the Asian clade within sect Grossularia increasedrelative to support from ETS or ITS datasets analyzedindividually (Figs 2 5 Senters and Soltis 2003)

The most evident difference between chloroplast and

2004] 87SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 5 The strict consensus of 150 trees resulting from analyses of combined ETS and ITS sequence data (CI5077 070excluding uninformative characters RI5085) Data combinability determined by partition homogeneity tests (p5004) Num-bers above the branches indicate the percentage of bootstrap replicates in which the clade appeared

88 [Volume 29SYSTEMATIC BOTANY

FIG 6 The strict consensus of four trees resulting from analyses of the four datasets combined (ETS ITS psbA-trnHchloroplast restriction sites) Data combinability was determined by partition homogeneity tests (p5075) Numbers above thebranches indicate the percentage of bootstrap replicates in which the clade appeared

rDNA trees was the position of sect GrossularioidesSubgenus Grossularia is monophyletic in rDNA treeswith sect Grossularioides placed weakly as sister (Fig5) In contrast subg Grossularia is polyphyletic in chlo-roplast trees with sect Grossularia nested within sectGrossulariodes and sect Calobotrya sister to that group-ing (Fig 4) Analyses of the combined chloroplast andrDNA datasets (p5075 excluded R glandulosum Rlacustre R montigenum) generated four trees (length556 CI5088 069 excluding uninformative charactersRI5076) (Fig 6) Taxon sampling was limited due tothe limited overlap among datasets but trees showedstrong resolution of sect Calobotrya sect Grossulariaand the glabrous-styled gooseberries (Hesperia Lobbia

Robsonia) These groups again formed a well-support-ed clade nested within Ribes (Fig 6) The strongly sup-ported sister-group relationship between the true andglabrous-styled gooseberries (Fig 6) is consistent withthe monophyly of subg Grossularia but could changewith the inclusion of sect Grossularioides

ETS and psbA-trnH combined analyses (p5004 ex-cluded R oxyacanthoides subsp irriguum) generated 329trees (length 372 CI5084 077 excluding uninforma-tive characters RI5090) (Fig 7) Subgenus Grossulariawas resolved as monophyletic within which both theglabrous-styled and the true gooseberries were strong-ly supported the latter including R watsonianum(subg Lobbia) The Asian clade was well supported

2004] 89SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 7 The strict consensus of 329 trees resulting from analyses of combined ETS and psbA-trnH data (CI5084 077excluding uninformative characters RI5091) Dataset combinability was determined by partition-homogeneity tests (p5 004)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared

within sect Grossularia including the European R uva-crispa Both sect Calobotrya and sect Grossularioideswere strongly supported but neither was resolved assister to subg Grossularia The clade comprising subgGrossularia sect Grossularioides and sect Calobotryawas again evident nested within Ribes

Combined analyses of psbA-trnH and rDNA datasets(p5002 excluded R oxyacanthoides subsp irriguum andtaxa excluded from ETS1ITS analysis) generated 3080trees (length 5 719 CI5080 074 excluding uninfor-mative characters RI5085) Sects Grossularioides Calo-botrya Grossularia and the glabrous-styled gooseberries

90 [Volume 29SYSTEMATIC BOTANY

(Hesperia Lobbia Robsonia) were each strongly support-ed and again formed a strongly supported clade nestedin Ribes (Fig 8) Support for the monophyly of subgGrossularia was increased relative to support seen withany individual dataset (Figs 2 3 8)

Combinability (p5012) of all datasets for those taxarepresented in three of the four datasets required ex-clusion of composite taxa problematic within therDNA dataset as well as exclusion of taxa problematicfor the chloroplast versus rDNA datasets Combinedanalyses generated 4802 trees (length5768 CI5080074 excluding uninformative characters RI5085)Sec-tion Calobotrya sect Grossularia and the glabrous-styled gooseberries (Hesperia Lobbia Robsonia) exclud-ing R watsonianum were each well supported and to-gether formed a strongly supported clade (Fig 9) Sub-genus Grossularia was resolved as monophyleticbearing in mind that sect Grossularioides was excludedfrom the analyses

While all combined datasets resolved the clade con-taining sects Calobotrya Grossularioides and subgGrossularia as nested within Ribes (Figs 4ndash9) relation-ships among other lineages were unclear as in theanalyses of individual datasets (Figs 2 3) Basal rela-tionships were unresolved in the analyses of combinedchloroplast data (Fig 4) The combined ETS and psbA-trnH analyses suggested basal positions for goldencurrants (sect Symphocalyx) (Fig 7) All remaininganalyses suggested basal positions for sects Berisiaand Ribes (Figs 5 6 8 9) Basal relationships were notwell-supported in any analysis

Kishino-Hasegawa Tests Trees generated fromanalyses constraining the monophyly of subg Gros-sularia versus trees constrained to resolve a sister re-lationship between sect Grossularioides and sect Gros-sularia were marginally but signicantly different inboth the chloroplast (p5003) and the rDNA (p5005)datasets

Ancestral Area Reconstructions DIVA reconstruc-tions of ancestral areas support a western North Amer-ican origin for a large segment of Ribes beginningwith node 2 in Fig 8 Within this clade it is also thecase that subg Grossularia is inferred to have diversi-ed rst within western North America (Fig 8 node6) Subsequent movement to eastern Asia is inferred tohave occurred somewhere within sect Grossularia butthe ancestral area for the true gooseberries is equivo-cal and can include virtually any combination of areasdepending on the exact resolution of the large poly-tomy at the base of this clade (Fig 8 node 8) Impor-tantly our results indicate that the Asian species with-in sect Grossularia form a clade implying a single mi-gration from North America to Asia The ancestralarea for Ribes is reconstructed to be western NorthAmerica and western Eurasia or western North Amer-ica and all of Eurasia (Fig 8 node 1) However this

result hinges on resolution at the base which remainshighly uncertain and requires more intensive samplingof Ribes lineages outside of subg Grossularia

DISCUSSION

Gooseberry Monophyly Results from previousphylogenetic analyses based on nuclear 18Sndash26S rDNAITS data (Senters and Soltis 2003) and chloroplast re-striction site data (Messinger et al 1999) differed re-garding gooseberry monophyly Adding the additionalnuclear 18Sndash26S rDNA ETS and chloroplast psbA-trnHdatasets could increase support and resolution in re-sulting topologies or could reinforce the differencesbetween the nuclear and chloroplast topologies witheach reecting accurate but separate histories

Initial examination of the trees produced with theadditional datasets reinforced the apparent conict be-tween nuclear and chloroplast genomes ITS ETS andcombined rDNA datasets supported the monophyly ofsubg Grossularia (Figs 1 2 5) In contrast the com-bined chloroplast datasets (restriction sites plus psbA-trnH) suggested a closer relationship between the trueand glabrous-styled gooseberries than did the restric-tion site data alone (Fig 1 Messinger et al 1999) butstill resolved subg Grossularia as non-monophyleticwith sect Grossularioidies forming a grade at the baseof sect Grossularia (Fig 4) The increase in tree lengthwhen combined chloroplast data was constrained toresolve a monophyletic subg Grossularia (p5003) orwhen combined rDNA data was constrained to resolvesects Grossularioides and Grossularia as a clade(p5005) also indicated dataset incongruence

The discrepancy between nuclear and chloroplast to-pologies primarily involved the restriction sites datasetand not the psbA-trnH dataset The psbA-trnH datasetprovided little resolution (Fig 3) conicting with nei-ther the rDNA nor the restriction sites topologiesAnalyses combining the psbA-trnH data with either theETS data (p5004 Fig 7) or the rDNA data (p5002Fig 8) produced trees resolving subg Grossularia asmonophyletic with increased support relative to ETSor rDNA data alone (Figs 2 5) Section Grossularioideswas either sister to subg Grossularia (psbA-trnH 1rDNA Fig 8) or was unresolved in a polytomy withsubg Grossularia and sect Calobotrya (psbA-trnH 1ETS Fig 7) The monophyly of subg Grossularia wasalso supported by analyses of all datasets combinedwhether including taxa represented in all four datasets(p5075 Fig 6) or in three of the four datasets(p5012 Fig 9) Analyses combining all datasets re-quired exclusion of sect Grossularioides thus leavingsubg Grossularia monophyly uncertain However in-cluding sect Grossulariodes in spite of dataset incon-gruence (p5001) produced trees resolving a mono-phyletic subg Grossularia sister to a monophyletic sectGrossularioides (not shown)

2004] 91SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 8 The strict consensus of 3080 trees resulting from analyses of combined psbA-trnH and rDNA data (CI 5 080 074excluding uninformative characters RI 5 085) Dataset combinability was determined by partition homogeneity tests (p5002)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared DIVA (Ronquist 1996)was used to infer ancestral areas at the numbered nodes The ancestral areas at nodes two through seven were reconstructedas western North America Node one was reconstructed as western North America plus either western Eurasia or all of EurasiaThere were multiple possible reconstructions at node 8 including (1) western North America and eastern Eurasia (2) NorthAmerica and eastern Eurasia (3) North America or (4) western North America

92 [Volume 29SYSTEMATIC BOTANY

FIG 9 The strict consensus of 4802 trees resulting from analyses of all four datasets (ITS ETS psbA-trnH chloroplastrestriction sites) including taxa represented in at least three datasets (CI5080 074 excluding uninformative charactersRI5085) Dataset combinability was determined using partition homogeneity tests (p5012) Numbers above the branchesindicate the percentage of bootstrap replicates in which the clade appeared

2004] 93SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

The general picture that emerges from these analy-ses suggests that subg Grossularia is monophyletic(Figs 2 5ndash9) rDNA data supported gooseberry mono-phyly (Figs 2 5) psbA-trnH data while lacking suf-cient variation to resolve gooseberry monophyly ornon-monophyly supported gooseberry monophyly incombination with rDNA data (Figs 7 8) Finally anal-yses of all datasets combined supported gooseberrymonophyly although these analyses excluded thespiny currants (sect Grossularioides) (Figs 6 9) Whatrequires further investigation is the role hybridizationmay have played in the history of the spiny currants(sect Grossularioides) and the true gooseberries (sectGrossularia) Messinger et al (1999) encouraged furtherexploration of this possibility in Ribes in which theynoted potential chloroplast capture of the sect Gros-sularia chloroplast type by sect Grossularioides Crosseshave not been successful between species of sect Gros-sularioides and other sections within Ribes and are usu-ally unsuccessful between sections or subgenera (Keep1962) Conrmation of the pattern seen in trees gen-erated from the chloroplast restriction site data (Mes-singer et al 1999) is needed from additional chloro-plast datasets that provide greater resolution than didthe psbA-trnH dataset

Relationships Within the Gooseberries SubgenusGrossularia comprises two main lineages (Figs 2 5ndash9)the true gooseberries (sect Grossularia) and a clade ofglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) The four gooseberry sections are traditionally dis-tinguished from each other by basally pubescent stylesin sect Grossularia (with the exception of some Asianspecies) by four versus ve parted owers in sect Rob-sonia by anthers broader at the base in subg Hesperiaand by the absence of the above set of features in subgLobbia The glabrous-styled gooseberry lineage com-prising 27 species distributed through western NorthAmerica into Mexico (Berger 1924) was well-support-ed given our sampling but sections within this lineagewere not resolved Ribes watsonianum (subg Lobbia)was surprisingly placed outside of the glabrous-styledgooseberry lineage as sister to the true gooseberries(Figs 2 5 7ndash9) ITS data resolved R watsonianum with-in the glabrous-styled gooseberry lineage (Senters andSoltis 2003) but ETS data strongly resolved the specieswithin the true gooseberry lineage (sect Grossularia)(Fig 2) This conict within the rDNA data may reecthybridization between R watsonianum and a memberof sect Grossularia followed by xation within the Rwatsonianum genome of a recombinant rDNA repeattype Accounts of Ribes hybrids in the eld are rela-tively rare (Messler et al 1991) and do not implicateR watsonianum but fertile hybrids can be obtainedfrom articial crosses between glabrous-styled goose-berries and true gooseberries (Keep 1962 citing R lob-bii 3 R divaricatum) Alternatively R watsonianum may

posses multiple rDNA repeat types with different re-peat types sampled in our ITS versus ETS datasetsEach of these possibilities has been reported in otherplant taxa (Wendel et al 1995a Campbell et al 1997for potential recombinant rDNA repeat types Suh etal 1993 Wendel et al 1995b for incomplete homoge-nization of rDNA repeat types)

The true gooseberries (sect Grossularia) have a broadrange throughout the northern hemisphere with ninespecies in North America (Sinnott 1985) and seven spe-cies in Eurasia (Berger 1924) In his treatment of NorthAmerican gooseberries Sinnott (1985) divided his ninespecies into ve groups based on phenetic analysesThe groups consisted of (1) R cynosbati with spinyfruits (2) R niveum R curvatum and R missouriensewith highly exserted stamens and long sepals (3) Rrotundifolium and R divaricatum with medium lengthstamens and purple sepals (4) R inerme and R hirtel-lum with intermediate length stamens and small oralfeatures and (5) the ve subspecies of R oxyacanthoi-des with short stamens Sinnott (1985) recommendedthat R echinellum be excluded from the true gooseber-ries and aligned with the glabrous-styled gooseberriesof western North America (Hesperia Lobbia Robsonia)The analyses presented here showed strong supportfor the inclusion of R echinellum as well as the Eurasianspecies within the true gooseberry lineage (Figs 2ndash35 7ndash9) Resolution among the North American specieswas lacking or not well-supported (Figs 2ndash9) and thusneither supported nor conicted with Sinnottrsquos hy-pothesized relationships

The seven Eurasian species of sect Grossularia (Ber-ger 1924) include R uvacrispa in Europe R alpestre andR aciculare in the Himalayan region R stenocarpumand R formosanum in southern and eastern Asia andR burejense and R grossularioides in northern and east-ern Asia A clade of Asian species is well-supported(Figs 2 5 7ndash9) with possible inclusion of R uvacrispa(Figs 2 7) The psbA-trnH dataset includes R oxyacan-thoides subsp irriguum within the Asian clade (Fig 3)but this is weakly supported (Fig 3) and requires fur-ther substantiation particularly since R oxyacanthoidessubsp irriguum is restricted to northwestern NorthAmerica and may itself be of hybrid origin from cross-es between R oxyacanthoides subsp setosum and R in-erme (Sinnott 1985) both distributed in western NorthAmerica Resolution within the clade of Asian speciessuggests a correspondance to geographic and oristicregions within Asia Whether the Asian and NorthAmerican true gooseberries represent divergent line-ages or a monophyletic Asian clade nested within aNorth American grade is unclear given the availabledata

Other Groups within Ribes Since this study fo-cused on the gooseberries sampling within other sec-tions of Ribes was sometimes limited Nevertheless the

94 [Volume 29SYSTEMATIC BOTANY

data did support the monophyly of sects CalobotryaParilla Symphocalyx and Berisia Section Calobotrya is agroup of 21 western North American species (Berger1924) known as the ornamental currants The mono-phyly of sect Calobotrya was well-supported with theinclusion of some dwarf currants (sect Heritieria) (Figs2ndash9 Messinger et al 1999 Senters and Soltis 2003)Sampling was limited in sect Parilla a group of 41dioecious South American species (Janczewski 1907)but the group was supported in ITS trees excludingthe east Asian R fasciculatum the sectionrsquos only non-South American species (Senters and Soltis 2003) Apossible sister relationship between sect Parilla andsect Calobotrya (unpubl data cited in Weigend andBinder 2001) is consistent with the position of sect Pa-rilla seen with ITS data (Senters and Soltis 2003) Sec-tion Symphocalyx the golden currants includes vespecies distributed through northern Mexico and cen-tral and western North America (Berger 1924) Thegolden currants were well-supported given the avail-able sampling (Fig 2 4 9) The alpine currants sectBerisia are a group of 17 dioecious species distributedthrough Eurasia (Janczewski 1907) The monophyly ofsect Berisia was well-supported (Figs 2ndash9 Messingeret al 1999) but with the inclusion of some red currants(sect Ribes) in ITS trees (Senters and Soltis 2003)

The monophyly of sects Ribes and Coreosma wasquestionable (Figs 2 3 5) The red currants (sect Ri-bes) are a group of 15 Eurasian species with one spe-cies R triste also distributed in North America Sec-tion Coreosma the black currants includes six speciesin North America and six in Eurasia (Berger 1924) Sec-tion Heritiera the dwarf currants appeared to be poly-phyletic as seen in Messinger et al (1999) and Sentersand Soltis (2003) This group of six species (Berger1924) is dened primarily by a prostrate habit and assuggested by Messinger et al (1999) is likely a case ofconvergence

Biogeography The spread of taxa around theNorthern Hemisphere has been facilitated by the avail-ability at various times of two major migrationroutesmdashthe Beringian and the North Atlantic landbridges (Tiffney 1985a 1985b Donoghue et al 2001SanmartDaggern et al 2001) Especially in large and relative-ly old clades which have become widespread aroundthe Northern Hemisphere it is possible (perhaps evenlikely) that both pathways were used Information onthe timing of key divergences and on the direction ofmovement within subclades will be critical in sortingout the possibilities in particular cases Ribes providesan excellent example of such a group being represent-ed in Eurasia by six sections (Berisia Ribes and somespecies from Heritiera Coreosma Grossularioides andGrossularia) in western North America by nine (Sym-phocalyx Calobotrya Robsonia Hesperia Lobbia andsome species of Coreosma Heritiera Grossularioides and

Grossularia) and in eastern North America by three(some species of Heritiera Ribes and Grossularia) Oneapproach for sorting through a complex biogeographichistory as might be expected in Ribes is to examinephylogenetic patterns in component clades and ide-ally to date divergences

Our analyses indicate that subg Grossularia is nestedwithin a predominantly western North Americanclade (Figs 2 5ndash9) and that it diversied initially inthat region (Fig 8 node 6) Subsequently within sectGrossularia it appears that movement occurred fromwestern North America to eastern Asia presumablythrough Beringia followed by vicariance and the ori-gin and diversication of the well-supported Asiangooseberry clade Donoghue et al (2001) and Xiangand Soltis (2001) highlighted cases of movement out ofAsia into North America through the Bering LandBridge Ribes appears to provide a case of movementin the opposite direction Movement in both directionsis of course to be expected What remains to be de-termined in future studies of disjunct taxa is exactlywhich groups moved in which directions and whetherthere are any signicant generalizations that can bemade about these different patterns

Elsewhere in Ribes there are other possible cases ofmovement between North America and Asia One caseinvolves R lacustre of sect Grossularioides which is dis-tributed in eastern Asia as well as in North AmericaOther possible cases relate to resolution at the base ofRibes where relationships remain uncertain The basalpositions of sect Symphocalyx in trees resulting frompsbA-trnH data and from the combination of psbA-trnHand ETS data suggest a western North American ori-gin for the entire clade (Figs 2 7) This would implyearly dispersion to Asia giving rise to sects Berisiaand Ribes However all other datasets and dataset com-binations suggested a broader Eurasian plus westernNorth American distribution at the base (Fig 8 node1) owing to the basal positions of sects Berisia andRibes This would imply early vicariance involvingAsia and North America and movement back to Asiawithin the western North American clade Future stud-ies should include more sampling of sects Berisia Ri-bes Coreosma and Symphocalyx to help resolve basal re-lationships and biogeographic patterns in Ribes

The fossil record for Ribes consists largely of leaveswith few reports of seeds (Kremenetski 1998) fruits(Cevallos-Ferriz 1995) and owers (Gandolfo et al1998) The leaf record for Ribes in North America mayextend from approximately 2 mya (Hannibal 1911Dorf 1930 Axelrod 1966) to at least 345 mya (Mac-Ginitie 1953 Manchester 2001) and possibly to 45 or50 mya (Axelrod 1998 Wehr and Hopkins 1994) Al-though leaf features are seldom used to distinguishextant taxa of Ribes Wolfe (1964) used leaf serrationand venation features to distinguish between fossil

2004] 95SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

leaves of subg Ribes and subg Grossularia from Ne-vada If these features are reliable this dates subgGrossularia to at least 14 mya (Fig 9 node 6) A criticalnext step in understanding Ribes biogeography will beto accurately assign Ribes fossils to particular sub-clades so as to infer the timing of intercontinental di-vergences

ACKNOWLEDGEMENTS We thank the following individuals andinstitutions for providing plant material B Alverson D BouffordR Mitchell Arnold Arboretum of Harvard University Universityof California Botanical Garden Royal Botanic Garden EdinburghNew York Botanical Garden and the USDA-ARS National PlantGermplasm Repository A Senters and D Soltis graciously pro-vided numerous DNA aliquots DNA sequences and access to ear-ly manuscripts H Schorn and D Erwin provided assistance withpaleobotanical literature M Lavin P Herendeen and two anon-ymous reviewers provided numerous helpful comments This proj-ect was supported in part by a Putnam Fellowship through theArnold Arboretum of Harvard University

LITERATURE CITED

AVISE J C 1994 Molecular markers natural history and evolutionNew York Chapman amp Hall

AXELROD D I 1966 The Pleistocene Soboba ora of southern Califor-nia University of California Publications in Geological Sci-ences 60

mdashmdashmdash 1998 Thunder Mountain Idaho University of CaliforniaPublications in Geological Sciences 142

BALDWIN B G and S MARKOS 1998 Phylogenetic utility of theexternal transcribed spacer (ETS) of 18Sndash26S rDNA Congru-ence of ETS and ITS trees of Calycadenia (Compositae) Mo-lecular Phylogenetics and Evolution 10 449ndash463

mdashmdashmdash M J SANDERSON J M PORTER M F WOJCIECHOWSKI CS CAMPBELL and M J DONOGHUE 1995 The ITS region ofnuclear ribosomal DNA a valuable source of evidence onangiosperm phylogeny Annals of the Missouri Botanical Garden82 247ndash277

BEARD K H 1998 East of Eden Asia as an important center oftaxonomic origination in mammalian evolution Bulletin of theCarnegie Museum of Natural History 34 5ndash39

BENA G M F JUBIER I OLIVIERI and B LEJEUNE 1998 Ribosom-al external and internal transcribed spacers combined use inthe phylogenetic analysis of Medicago (Leguminosae) Journal ofMolecular Evolution 46 299ndash306

BERGER A 1924 A taxonomic review of currants and gooseberriesNew York Agricultural Experimental Station Technical Bulletin109 1ndash118

BOUFFORD D E and S A SPONGBERG 1983 Eastern Asia-EasternNorth American phytogeographical relationships-a historyfrom the time of Linnaeus to the twentieth century Annalsof the Missouri Botanical Garden 70 423ndash439

CAMPBELL C S M F WOJCIECHOWSKI B G BALDWIN L A AL-ICE and M J DONOGHUE 1997 Persistent nuclear ribosomalDNA sequence polymorphism in the Amelanchier agamiccomplex (Rosaceae) Molecular Biology and Evolution 14 81ndash90

CEVALLOS-FERRIZ S R S 1995 Fruits of Ribes from the Princetonchert British Columbia Canada American Journal of Botany82(6 supplement) 84

COVILLE F V and N L BRITTON 1908 Grossulariaceae NorthAmer-ican Flora 22 193ndash225

CUNNINGHAM C W 1997 Can three incongruence tests predictwhen data shold be combined Molecular Biology and Evolution14 733ndash740

DEQUEIROZ A M J DONOGHUE and J KIM 1995 Separate versuscombined analysis of phylogenetic evidence Annual Review ofEcology and Systematics 26 657ndash681

DONOGHUE M J C D BELL and J LI 2001 Phylogenetic patternsin northern hemisphere plant geography International Journalof Plant Sciences 162 S41ndashS52

DORF E 1930 Pliocene oras of California Carnegie Institution ofWashington Publication 412

FARRIS J S M KALLERSJO A G KLUGE and C BULT 1995 Test-ing signicance of incongruence Cladistics 10 315ndash319

FELSENSTEIN J 1985 Condence limits on phylogenies an ap-proach using the bootstrap Evolution 39 783ndash791

FENTON B A N E BIRCH G MALLOCH P G LANHAM and RM BRENNAN 2000 Gall mite molecular phylogeny and itsrelationship to the evolution of plant host specicity AppliedAcarology 24 831ndash861

FRITSCH P W C M MORTON T CHEN and C MELDRUM 2001Phylogeny and biogeography of the Styracaceae InternationalJournal of Plant Sciences 162 S95ndashS116

GANDOLFO M A P HOC S N SANTILLANA and S A MARENSSI1998 Una or fosil morfologicamente afDaggern a las Grossulari-aceae (orden Rosales) de la Formacion la Meseta (Eoceno me-dio) Isla Marambio Antartida Asociacion Paleontologica Argen-tina Publicacion Especial 5 Paleogeno de America del Sur y de laPenDaggernsula Antartica 147ndash153

GOLDMAN N J P ANDERSON and A G RODRIGO 2000 Likeli-hood-based tests of topologies in phylogenetics SystematicBiology 49 652ndash670

HANNIBAL H 1911 A Pliocene ora from the Coast Ranges ofCalifornia Bulletin of the Torrey Botanical Club 38 329ndash342

HUELSENBECK J P J J BULL and C W CUNNINGHAM 1996 Com-binined data in phylogenetic analysis Trends in Ecology andEvolution 11 152ndash158

JANCZEWSKI M E 1907 Monographies des groseilliers Ribes LMemoires Societe de Physique et DrsquoHistoire Naturelle de Geneve35 199ndash517

KEEP E 1962 Interspecic hybridization in Ribes Genetica 33 1ndash23

KISHINO H and M HASEGAWA 1989 Evaluation of the maximumlikelihood estimate of the evolutionary tree topologies fromDNA sequence data and the branching order in HominoideaJournal of Molecular Evolution 29 170ndash179

KREMENETSKI C V 1998 Holocene history of the northern rangelimits of some trees and shrubs in Russia Arctic and AlpineResearch 30 317ndash333

LINDER C R L R GOERTZEN B V HEUVEL J FRANCISCO-OR-TEGA and R K JANSEN 2000 The complete external tran-scribed spacer of 18Sndash26S rDNA amplication and phylo-genetic utility at low taxonomic levels in Asteraceae andclosely allied families Molecular Phylogenetics and Evolution 14285ndash303

MACGINITIE D 1953 Fossil plants of the Florissant beds ColoradoCarnegie Institution of Washington Publication 599

MADDISON D R and W P MADDISON 2000 MacClade 4 Sun-derland Sinauer Associates

MANCHESTER S R 1999 Biogeographical relationships of NorthAmerican Tertiary oras Annals of the Missouri Botanical Gar-den 86 472ndash522

mdashmdashmdash 2001 Update on the megafossil ora of Florissant Colo-rado Proceedings of the Denver Museum of Nature amp ScienceSeries 4 No1 137

MANOS P S and M J DONOGHUE 2001 Progress in northernhemisphere phytogeography an introduction InternationalJournal of Plant Sciences 162 S1ndashS2

mdashmdashmdash and A M STANFORD 2001 The historical biogeography ofFagaceae tracking the tertiary history of temperate and sub-tropical forests of the northern hemisphere International Jour-nal of Plant Sciences 162 S77ndashS93

MAST A R and T J GIVNISH 2002 Historical biogeography andthe origin of stomatal distributions in Banksia and Dryandra(Proteaceae) based on their cpDNA phylogeny American Jour-nal of Botany 89 1311ndash1323

MESSINGER W K HUMMER and A LISTON 1999 Ribes (Grossu-

86 [Volume 29SYSTEMATIC BOTANY

FIG 4 The strict consensus of six trees resulting fromanalyses of psbA-trnH sequence data combined with chloro-plast restriction site data (Messinger et al 1999) (CI5090 079excluding uninformative characters RI5087) Data combina-bility determined by partition homogeneity tests (p5066)Numbers above the branches indicate the percentage of boot-strap replicates in which the clade appeared

with the inclusion of some species of sect Ribes in ITStrees (Senters and Soltis 2003) Section Symphocalyxwasstrongly resolved in ETS and restriction site trees (Fig2 Messinger et al 1999) but was unresolved in psbA-trnH trees (Fig 3) (ITS trees included only one species)Section Heritiera appeared to be polyphyletic in ITSand restriction site trees (only one species of sect Her-itiera is included in ETS or psbA-trnH analyses) (Mes-singer et al 1999 Senters and Soltis 2003) The mono-phyly of sects Ribes and Coreosma remain unclear Forthose species sampled sect Ribes was resolved asmonophyletic in restriction site trees (Messinger et al1999) as monophyletic excluding R triste in ETS andpsbA-trnH trees (Figs 2 3) and as polyphyletic in ITStrees with some species clearly related to sect Berisia(Senters and Soltis 2003) Section Coreosma was re-solved as polyphyletic in ETS and restriction site trees(Fig 2 Messinger et al 1999) and as para- or poly-phyletic in ITS trees (Senters and Soltis 2003) (only onespecies was included in the psbA-trnH dataset) Previ-ous restriction site analyses of 18ndash26S rDNA suggestedthat members of sect Coreosma were divergent fromone another and from other Ribes species (Messingeret al 1993) Sampling from sect Parilla was too limitedto draw strong conclusions but the ITS trees support-ed its monophyly to the exclusion of R fasciculatumthe only non-South American member of the section(Senters and Soltis 2003) Relationships among the sec-tions outside of the predominantly western NorthAmerican clade (sects Calobotrya Grossularioides subgGrossularia) varied markedly among datasets with lit-tle support for any one resolution (Figs 2 3)

Trees Generated from Analyses of CombinedDatasets Dataset combinability is typically based ona critical value of p 5 005 (ie datasets are incongru-ent when p 005) However studies suggest that acritical value of p 5 005 may be too strict such thatthe null hypothesis of dataset congruence will be false-ly rejected (Huelsenbeck et al 1996 Sullivan 1996Cunningham 1997) and that a value such as p 5 001may be more appropriate (Cunningham 1997) Manyof the datasets reported here were not combinablebased on intitial partition homogeneity tests but theincongruence was generally eliminated when problem-atic taxa were excluded

Analyses of the readily combinable chloroplast psbA-trnH and restriction site data (p5066) generated sixtrees (length 144 CI5090 079 excluding uninforma-tive characters RI5087) In agreement with analysesof restriction site data alone true gooseberries (sectGrossularia) were not placed as sister to the remainingglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) suggesting that subg Grossularia is not monophy-letic (Figs 1 4) The true gooseberries were nested ina paraphyletic sect Grossularioides as in the restrictionsite trees with sect Calobotrya weakly placed as sister

Support for sect Grossularia sect Calobotrya and theglabrous-styled gooseberries (Hesperia Lobbia Robsonia)increased relative to analyses of either dataset alone(Fig 3 Messinger et al 1999) Support for a paraphy-letic sect Grossularioides decreased slightly relative tothe restriction site analyses (Fig 4 Messinger et al1999)

Analyses of the combined ETS and ITS rDNA data(p5004 excluded R fasciculatum R glandulosum Rhimalense R manshuricum R nevadense R rubrum Roxyacanthoides subsp oxycanthoides R uvacripsa) gener-ated 150 trees (length 614 CI5077 070 excluding un-informative characters RI5085) (Fig 5) Subg Gros-sularia was monophyletic as were the true gooseber-ries (sect Grossularia) (Fig 5) The glabrous-styledgooseberries (Hesperia Lobbia Robsonia) were stronglyresolved as monophyletic with the exception of R wat-sonianum (sect Lobbia) placed strongly as sister to thetrue gooseberries Within sect Grossularia only theAsian clade was resolved with strong support Theclade containing subg Grossularia sect Grossularioi-dies and sect Calobotrya was again evident with sectGrossularioides resolved as sister to subg GrossulariaSupport for the glabrous-styled gooseberries (HesperiaLobbia Robsonia) sect Calobotrya sect Grossularioidesand the Asian clade within sect Grossularia increasedrelative to support from ETS or ITS datasets analyzedindividually (Figs 2 5 Senters and Soltis 2003)

The most evident difference between chloroplast and

2004] 87SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 5 The strict consensus of 150 trees resulting from analyses of combined ETS and ITS sequence data (CI5077 070excluding uninformative characters RI5085) Data combinability determined by partition homogeneity tests (p5004) Num-bers above the branches indicate the percentage of bootstrap replicates in which the clade appeared

88 [Volume 29SYSTEMATIC BOTANY

FIG 6 The strict consensus of four trees resulting from analyses of the four datasets combined (ETS ITS psbA-trnHchloroplast restriction sites) Data combinability was determined by partition homogeneity tests (p5075) Numbers above thebranches indicate the percentage of bootstrap replicates in which the clade appeared

rDNA trees was the position of sect GrossularioidesSubgenus Grossularia is monophyletic in rDNA treeswith sect Grossularioides placed weakly as sister (Fig5) In contrast subg Grossularia is polyphyletic in chlo-roplast trees with sect Grossularia nested within sectGrossulariodes and sect Calobotrya sister to that group-ing (Fig 4) Analyses of the combined chloroplast andrDNA datasets (p5075 excluded R glandulosum Rlacustre R montigenum) generated four trees (length556 CI5088 069 excluding uninformative charactersRI5076) (Fig 6) Taxon sampling was limited due tothe limited overlap among datasets but trees showedstrong resolution of sect Calobotrya sect Grossulariaand the glabrous-styled gooseberries (Hesperia Lobbia

Robsonia) These groups again formed a well-support-ed clade nested within Ribes (Fig 6) The strongly sup-ported sister-group relationship between the true andglabrous-styled gooseberries (Fig 6) is consistent withthe monophyly of subg Grossularia but could changewith the inclusion of sect Grossularioides

ETS and psbA-trnH combined analyses (p5004 ex-cluded R oxyacanthoides subsp irriguum) generated 329trees (length 372 CI5084 077 excluding uninforma-tive characters RI5090) (Fig 7) Subgenus Grossulariawas resolved as monophyletic within which both theglabrous-styled and the true gooseberries were strong-ly supported the latter including R watsonianum(subg Lobbia) The Asian clade was well supported

2004] 89SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 7 The strict consensus of 329 trees resulting from analyses of combined ETS and psbA-trnH data (CI5084 077excluding uninformative characters RI5091) Dataset combinability was determined by partition-homogeneity tests (p5 004)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared

within sect Grossularia including the European R uva-crispa Both sect Calobotrya and sect Grossularioideswere strongly supported but neither was resolved assister to subg Grossularia The clade comprising subgGrossularia sect Grossularioides and sect Calobotryawas again evident nested within Ribes

Combined analyses of psbA-trnH and rDNA datasets(p5002 excluded R oxyacanthoides subsp irriguum andtaxa excluded from ETS1ITS analysis) generated 3080trees (length 5 719 CI5080 074 excluding uninfor-mative characters RI5085) Sects Grossularioides Calo-botrya Grossularia and the glabrous-styled gooseberries

90 [Volume 29SYSTEMATIC BOTANY

(Hesperia Lobbia Robsonia) were each strongly support-ed and again formed a strongly supported clade nestedin Ribes (Fig 8) Support for the monophyly of subgGrossularia was increased relative to support seen withany individual dataset (Figs 2 3 8)

Combinability (p5012) of all datasets for those taxarepresented in three of the four datasets required ex-clusion of composite taxa problematic within therDNA dataset as well as exclusion of taxa problematicfor the chloroplast versus rDNA datasets Combinedanalyses generated 4802 trees (length5768 CI5080074 excluding uninformative characters RI5085)Sec-tion Calobotrya sect Grossularia and the glabrous-styled gooseberries (Hesperia Lobbia Robsonia) exclud-ing R watsonianum were each well supported and to-gether formed a strongly supported clade (Fig 9) Sub-genus Grossularia was resolved as monophyleticbearing in mind that sect Grossularioides was excludedfrom the analyses

While all combined datasets resolved the clade con-taining sects Calobotrya Grossularioides and subgGrossularia as nested within Ribes (Figs 4ndash9) relation-ships among other lineages were unclear as in theanalyses of individual datasets (Figs 2 3) Basal rela-tionships were unresolved in the analyses of combinedchloroplast data (Fig 4) The combined ETS and psbA-trnH analyses suggested basal positions for goldencurrants (sect Symphocalyx) (Fig 7) All remaininganalyses suggested basal positions for sects Berisiaand Ribes (Figs 5 6 8 9) Basal relationships were notwell-supported in any analysis

Kishino-Hasegawa Tests Trees generated fromanalyses constraining the monophyly of subg Gros-sularia versus trees constrained to resolve a sister re-lationship between sect Grossularioides and sect Gros-sularia were marginally but signicantly different inboth the chloroplast (p5003) and the rDNA (p5005)datasets

Ancestral Area Reconstructions DIVA reconstruc-tions of ancestral areas support a western North Amer-ican origin for a large segment of Ribes beginningwith node 2 in Fig 8 Within this clade it is also thecase that subg Grossularia is inferred to have diversi-ed rst within western North America (Fig 8 node6) Subsequent movement to eastern Asia is inferred tohave occurred somewhere within sect Grossularia butthe ancestral area for the true gooseberries is equivo-cal and can include virtually any combination of areasdepending on the exact resolution of the large poly-tomy at the base of this clade (Fig 8 node 8) Impor-tantly our results indicate that the Asian species with-in sect Grossularia form a clade implying a single mi-gration from North America to Asia The ancestralarea for Ribes is reconstructed to be western NorthAmerica and western Eurasia or western North Amer-ica and all of Eurasia (Fig 8 node 1) However this

result hinges on resolution at the base which remainshighly uncertain and requires more intensive samplingof Ribes lineages outside of subg Grossularia

DISCUSSION

Gooseberry Monophyly Results from previousphylogenetic analyses based on nuclear 18Sndash26S rDNAITS data (Senters and Soltis 2003) and chloroplast re-striction site data (Messinger et al 1999) differed re-garding gooseberry monophyly Adding the additionalnuclear 18Sndash26S rDNA ETS and chloroplast psbA-trnHdatasets could increase support and resolution in re-sulting topologies or could reinforce the differencesbetween the nuclear and chloroplast topologies witheach reecting accurate but separate histories

Initial examination of the trees produced with theadditional datasets reinforced the apparent conict be-tween nuclear and chloroplast genomes ITS ETS andcombined rDNA datasets supported the monophyly ofsubg Grossularia (Figs 1 2 5) In contrast the com-bined chloroplast datasets (restriction sites plus psbA-trnH) suggested a closer relationship between the trueand glabrous-styled gooseberries than did the restric-tion site data alone (Fig 1 Messinger et al 1999) butstill resolved subg Grossularia as non-monophyleticwith sect Grossularioidies forming a grade at the baseof sect Grossularia (Fig 4) The increase in tree lengthwhen combined chloroplast data was constrained toresolve a monophyletic subg Grossularia (p5003) orwhen combined rDNA data was constrained to resolvesects Grossularioides and Grossularia as a clade(p5005) also indicated dataset incongruence

The discrepancy between nuclear and chloroplast to-pologies primarily involved the restriction sites datasetand not the psbA-trnH dataset The psbA-trnH datasetprovided little resolution (Fig 3) conicting with nei-ther the rDNA nor the restriction sites topologiesAnalyses combining the psbA-trnH data with either theETS data (p5004 Fig 7) or the rDNA data (p5002Fig 8) produced trees resolving subg Grossularia asmonophyletic with increased support relative to ETSor rDNA data alone (Figs 2 5) Section Grossularioideswas either sister to subg Grossularia (psbA-trnH 1rDNA Fig 8) or was unresolved in a polytomy withsubg Grossularia and sect Calobotrya (psbA-trnH 1ETS Fig 7) The monophyly of subg Grossularia wasalso supported by analyses of all datasets combinedwhether including taxa represented in all four datasets(p5075 Fig 6) or in three of the four datasets(p5012 Fig 9) Analyses combining all datasets re-quired exclusion of sect Grossularioides thus leavingsubg Grossularia monophyly uncertain However in-cluding sect Grossulariodes in spite of dataset incon-gruence (p5001) produced trees resolving a mono-phyletic subg Grossularia sister to a monophyletic sectGrossularioides (not shown)

2004] 91SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 8 The strict consensus of 3080 trees resulting from analyses of combined psbA-trnH and rDNA data (CI 5 080 074excluding uninformative characters RI 5 085) Dataset combinability was determined by partition homogeneity tests (p5002)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared DIVA (Ronquist 1996)was used to infer ancestral areas at the numbered nodes The ancestral areas at nodes two through seven were reconstructedas western North America Node one was reconstructed as western North America plus either western Eurasia or all of EurasiaThere were multiple possible reconstructions at node 8 including (1) western North America and eastern Eurasia (2) NorthAmerica and eastern Eurasia (3) North America or (4) western North America

92 [Volume 29SYSTEMATIC BOTANY

FIG 9 The strict consensus of 4802 trees resulting from analyses of all four datasets (ITS ETS psbA-trnH chloroplastrestriction sites) including taxa represented in at least three datasets (CI5080 074 excluding uninformative charactersRI5085) Dataset combinability was determined using partition homogeneity tests (p5012) Numbers above the branchesindicate the percentage of bootstrap replicates in which the clade appeared

2004] 93SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

The general picture that emerges from these analy-ses suggests that subg Grossularia is monophyletic(Figs 2 5ndash9) rDNA data supported gooseberry mono-phyly (Figs 2 5) psbA-trnH data while lacking suf-cient variation to resolve gooseberry monophyly ornon-monophyly supported gooseberry monophyly incombination with rDNA data (Figs 7 8) Finally anal-yses of all datasets combined supported gooseberrymonophyly although these analyses excluded thespiny currants (sect Grossularioides) (Figs 6 9) Whatrequires further investigation is the role hybridizationmay have played in the history of the spiny currants(sect Grossularioides) and the true gooseberries (sectGrossularia) Messinger et al (1999) encouraged furtherexploration of this possibility in Ribes in which theynoted potential chloroplast capture of the sect Gros-sularia chloroplast type by sect Grossularioides Crosseshave not been successful between species of sect Gros-sularioides and other sections within Ribes and are usu-ally unsuccessful between sections or subgenera (Keep1962) Conrmation of the pattern seen in trees gen-erated from the chloroplast restriction site data (Mes-singer et al 1999) is needed from additional chloro-plast datasets that provide greater resolution than didthe psbA-trnH dataset

Relationships Within the Gooseberries SubgenusGrossularia comprises two main lineages (Figs 2 5ndash9)the true gooseberries (sect Grossularia) and a clade ofglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) The four gooseberry sections are traditionally dis-tinguished from each other by basally pubescent stylesin sect Grossularia (with the exception of some Asianspecies) by four versus ve parted owers in sect Rob-sonia by anthers broader at the base in subg Hesperiaand by the absence of the above set of features in subgLobbia The glabrous-styled gooseberry lineage com-prising 27 species distributed through western NorthAmerica into Mexico (Berger 1924) was well-support-ed given our sampling but sections within this lineagewere not resolved Ribes watsonianum (subg Lobbia)was surprisingly placed outside of the glabrous-styledgooseberry lineage as sister to the true gooseberries(Figs 2 5 7ndash9) ITS data resolved R watsonianum with-in the glabrous-styled gooseberry lineage (Senters andSoltis 2003) but ETS data strongly resolved the specieswithin the true gooseberry lineage (sect Grossularia)(Fig 2) This conict within the rDNA data may reecthybridization between R watsonianum and a memberof sect Grossularia followed by xation within the Rwatsonianum genome of a recombinant rDNA repeattype Accounts of Ribes hybrids in the eld are rela-tively rare (Messler et al 1991) and do not implicateR watsonianum but fertile hybrids can be obtainedfrom articial crosses between glabrous-styled goose-berries and true gooseberries (Keep 1962 citing R lob-bii 3 R divaricatum) Alternatively R watsonianum may

posses multiple rDNA repeat types with different re-peat types sampled in our ITS versus ETS datasetsEach of these possibilities has been reported in otherplant taxa (Wendel et al 1995a Campbell et al 1997for potential recombinant rDNA repeat types Suh etal 1993 Wendel et al 1995b for incomplete homoge-nization of rDNA repeat types)

The true gooseberries (sect Grossularia) have a broadrange throughout the northern hemisphere with ninespecies in North America (Sinnott 1985) and seven spe-cies in Eurasia (Berger 1924) In his treatment of NorthAmerican gooseberries Sinnott (1985) divided his ninespecies into ve groups based on phenetic analysesThe groups consisted of (1) R cynosbati with spinyfruits (2) R niveum R curvatum and R missouriensewith highly exserted stamens and long sepals (3) Rrotundifolium and R divaricatum with medium lengthstamens and purple sepals (4) R inerme and R hirtel-lum with intermediate length stamens and small oralfeatures and (5) the ve subspecies of R oxyacanthoi-des with short stamens Sinnott (1985) recommendedthat R echinellum be excluded from the true gooseber-ries and aligned with the glabrous-styled gooseberriesof western North America (Hesperia Lobbia Robsonia)The analyses presented here showed strong supportfor the inclusion of R echinellum as well as the Eurasianspecies within the true gooseberry lineage (Figs 2ndash35 7ndash9) Resolution among the North American specieswas lacking or not well-supported (Figs 2ndash9) and thusneither supported nor conicted with Sinnottrsquos hy-pothesized relationships

The seven Eurasian species of sect Grossularia (Ber-ger 1924) include R uvacrispa in Europe R alpestre andR aciculare in the Himalayan region R stenocarpumand R formosanum in southern and eastern Asia andR burejense and R grossularioides in northern and east-ern Asia A clade of Asian species is well-supported(Figs 2 5 7ndash9) with possible inclusion of R uvacrispa(Figs 2 7) The psbA-trnH dataset includes R oxyacan-thoides subsp irriguum within the Asian clade (Fig 3)but this is weakly supported (Fig 3) and requires fur-ther substantiation particularly since R oxyacanthoidessubsp irriguum is restricted to northwestern NorthAmerica and may itself be of hybrid origin from cross-es between R oxyacanthoides subsp setosum and R in-erme (Sinnott 1985) both distributed in western NorthAmerica Resolution within the clade of Asian speciessuggests a correspondance to geographic and oristicregions within Asia Whether the Asian and NorthAmerican true gooseberries represent divergent line-ages or a monophyletic Asian clade nested within aNorth American grade is unclear given the availabledata

Other Groups within Ribes Since this study fo-cused on the gooseberries sampling within other sec-tions of Ribes was sometimes limited Nevertheless the

94 [Volume 29SYSTEMATIC BOTANY

data did support the monophyly of sects CalobotryaParilla Symphocalyx and Berisia Section Calobotrya is agroup of 21 western North American species (Berger1924) known as the ornamental currants The mono-phyly of sect Calobotrya was well-supported with theinclusion of some dwarf currants (sect Heritieria) (Figs2ndash9 Messinger et al 1999 Senters and Soltis 2003)Sampling was limited in sect Parilla a group of 41dioecious South American species (Janczewski 1907)but the group was supported in ITS trees excludingthe east Asian R fasciculatum the sectionrsquos only non-South American species (Senters and Soltis 2003) Apossible sister relationship between sect Parilla andsect Calobotrya (unpubl data cited in Weigend andBinder 2001) is consistent with the position of sect Pa-rilla seen with ITS data (Senters and Soltis 2003) Sec-tion Symphocalyx the golden currants includes vespecies distributed through northern Mexico and cen-tral and western North America (Berger 1924) Thegolden currants were well-supported given the avail-able sampling (Fig 2 4 9) The alpine currants sectBerisia are a group of 17 dioecious species distributedthrough Eurasia (Janczewski 1907) The monophyly ofsect Berisia was well-supported (Figs 2ndash9 Messingeret al 1999) but with the inclusion of some red currants(sect Ribes) in ITS trees (Senters and Soltis 2003)

The monophyly of sects Ribes and Coreosma wasquestionable (Figs 2 3 5) The red currants (sect Ri-bes) are a group of 15 Eurasian species with one spe-cies R triste also distributed in North America Sec-tion Coreosma the black currants includes six speciesin North America and six in Eurasia (Berger 1924) Sec-tion Heritiera the dwarf currants appeared to be poly-phyletic as seen in Messinger et al (1999) and Sentersand Soltis (2003) This group of six species (Berger1924) is dened primarily by a prostrate habit and assuggested by Messinger et al (1999) is likely a case ofconvergence

Biogeography The spread of taxa around theNorthern Hemisphere has been facilitated by the avail-ability at various times of two major migrationroutesmdashthe Beringian and the North Atlantic landbridges (Tiffney 1985a 1985b Donoghue et al 2001SanmartDaggern et al 2001) Especially in large and relative-ly old clades which have become widespread aroundthe Northern Hemisphere it is possible (perhaps evenlikely) that both pathways were used Information onthe timing of key divergences and on the direction ofmovement within subclades will be critical in sortingout the possibilities in particular cases Ribes providesan excellent example of such a group being represent-ed in Eurasia by six sections (Berisia Ribes and somespecies from Heritiera Coreosma Grossularioides andGrossularia) in western North America by nine (Sym-phocalyx Calobotrya Robsonia Hesperia Lobbia andsome species of Coreosma Heritiera Grossularioides and

Grossularia) and in eastern North America by three(some species of Heritiera Ribes and Grossularia) Oneapproach for sorting through a complex biogeographichistory as might be expected in Ribes is to examinephylogenetic patterns in component clades and ide-ally to date divergences

Our analyses indicate that subg Grossularia is nestedwithin a predominantly western North Americanclade (Figs 2 5ndash9) and that it diversied initially inthat region (Fig 8 node 6) Subsequently within sectGrossularia it appears that movement occurred fromwestern North America to eastern Asia presumablythrough Beringia followed by vicariance and the ori-gin and diversication of the well-supported Asiangooseberry clade Donoghue et al (2001) and Xiangand Soltis (2001) highlighted cases of movement out ofAsia into North America through the Bering LandBridge Ribes appears to provide a case of movementin the opposite direction Movement in both directionsis of course to be expected What remains to be de-termined in future studies of disjunct taxa is exactlywhich groups moved in which directions and whetherthere are any signicant generalizations that can bemade about these different patterns

Elsewhere in Ribes there are other possible cases ofmovement between North America and Asia One caseinvolves R lacustre of sect Grossularioides which is dis-tributed in eastern Asia as well as in North AmericaOther possible cases relate to resolution at the base ofRibes where relationships remain uncertain The basalpositions of sect Symphocalyx in trees resulting frompsbA-trnH data and from the combination of psbA-trnHand ETS data suggest a western North American ori-gin for the entire clade (Figs 2 7) This would implyearly dispersion to Asia giving rise to sects Berisiaand Ribes However all other datasets and dataset com-binations suggested a broader Eurasian plus westernNorth American distribution at the base (Fig 8 node1) owing to the basal positions of sects Berisia andRibes This would imply early vicariance involvingAsia and North America and movement back to Asiawithin the western North American clade Future stud-ies should include more sampling of sects Berisia Ri-bes Coreosma and Symphocalyx to help resolve basal re-lationships and biogeographic patterns in Ribes

The fossil record for Ribes consists largely of leaveswith few reports of seeds (Kremenetski 1998) fruits(Cevallos-Ferriz 1995) and owers (Gandolfo et al1998) The leaf record for Ribes in North America mayextend from approximately 2 mya (Hannibal 1911Dorf 1930 Axelrod 1966) to at least 345 mya (Mac-Ginitie 1953 Manchester 2001) and possibly to 45 or50 mya (Axelrod 1998 Wehr and Hopkins 1994) Al-though leaf features are seldom used to distinguishextant taxa of Ribes Wolfe (1964) used leaf serrationand venation features to distinguish between fossil

2004] 95SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

leaves of subg Ribes and subg Grossularia from Ne-vada If these features are reliable this dates subgGrossularia to at least 14 mya (Fig 9 node 6) A criticalnext step in understanding Ribes biogeography will beto accurately assign Ribes fossils to particular sub-clades so as to infer the timing of intercontinental di-vergences

ACKNOWLEDGEMENTS We thank the following individuals andinstitutions for providing plant material B Alverson D BouffordR Mitchell Arnold Arboretum of Harvard University Universityof California Botanical Garden Royal Botanic Garden EdinburghNew York Botanical Garden and the USDA-ARS National PlantGermplasm Repository A Senters and D Soltis graciously pro-vided numerous DNA aliquots DNA sequences and access to ear-ly manuscripts H Schorn and D Erwin provided assistance withpaleobotanical literature M Lavin P Herendeen and two anon-ymous reviewers provided numerous helpful comments This proj-ect was supported in part by a Putnam Fellowship through theArnold Arboretum of Harvard University

LITERATURE CITED

AVISE J C 1994 Molecular markers natural history and evolutionNew York Chapman amp Hall

AXELROD D I 1966 The Pleistocene Soboba ora of southern Califor-nia University of California Publications in Geological Sci-ences 60

mdashmdashmdash 1998 Thunder Mountain Idaho University of CaliforniaPublications in Geological Sciences 142

BALDWIN B G and S MARKOS 1998 Phylogenetic utility of theexternal transcribed spacer (ETS) of 18Sndash26S rDNA Congru-ence of ETS and ITS trees of Calycadenia (Compositae) Mo-lecular Phylogenetics and Evolution 10 449ndash463

mdashmdashmdash M J SANDERSON J M PORTER M F WOJCIECHOWSKI CS CAMPBELL and M J DONOGHUE 1995 The ITS region ofnuclear ribosomal DNA a valuable source of evidence onangiosperm phylogeny Annals of the Missouri Botanical Garden82 247ndash277

BEARD K H 1998 East of Eden Asia as an important center oftaxonomic origination in mammalian evolution Bulletin of theCarnegie Museum of Natural History 34 5ndash39

BENA G M F JUBIER I OLIVIERI and B LEJEUNE 1998 Ribosom-al external and internal transcribed spacers combined use inthe phylogenetic analysis of Medicago (Leguminosae) Journal ofMolecular Evolution 46 299ndash306

BERGER A 1924 A taxonomic review of currants and gooseberriesNew York Agricultural Experimental Station Technical Bulletin109 1ndash118

BOUFFORD D E and S A SPONGBERG 1983 Eastern Asia-EasternNorth American phytogeographical relationships-a historyfrom the time of Linnaeus to the twentieth century Annalsof the Missouri Botanical Garden 70 423ndash439

CAMPBELL C S M F WOJCIECHOWSKI B G BALDWIN L A AL-ICE and M J DONOGHUE 1997 Persistent nuclear ribosomalDNA sequence polymorphism in the Amelanchier agamiccomplex (Rosaceae) Molecular Biology and Evolution 14 81ndash90

CEVALLOS-FERRIZ S R S 1995 Fruits of Ribes from the Princetonchert British Columbia Canada American Journal of Botany82(6 supplement) 84

COVILLE F V and N L BRITTON 1908 Grossulariaceae NorthAmer-ican Flora 22 193ndash225

CUNNINGHAM C W 1997 Can three incongruence tests predictwhen data shold be combined Molecular Biology and Evolution14 733ndash740

DEQUEIROZ A M J DONOGHUE and J KIM 1995 Separate versuscombined analysis of phylogenetic evidence Annual Review ofEcology and Systematics 26 657ndash681

DONOGHUE M J C D BELL and J LI 2001 Phylogenetic patternsin northern hemisphere plant geography International Journalof Plant Sciences 162 S41ndashS52

DORF E 1930 Pliocene oras of California Carnegie Institution ofWashington Publication 412

FARRIS J S M KALLERSJO A G KLUGE and C BULT 1995 Test-ing signicance of incongruence Cladistics 10 315ndash319

FELSENSTEIN J 1985 Condence limits on phylogenies an ap-proach using the bootstrap Evolution 39 783ndash791

FENTON B A N E BIRCH G MALLOCH P G LANHAM and RM BRENNAN 2000 Gall mite molecular phylogeny and itsrelationship to the evolution of plant host specicity AppliedAcarology 24 831ndash861

FRITSCH P W C M MORTON T CHEN and C MELDRUM 2001Phylogeny and biogeography of the Styracaceae InternationalJournal of Plant Sciences 162 S95ndashS116

GANDOLFO M A P HOC S N SANTILLANA and S A MARENSSI1998 Una or fosil morfologicamente afDaggern a las Grossulari-aceae (orden Rosales) de la Formacion la Meseta (Eoceno me-dio) Isla Marambio Antartida Asociacion Paleontologica Argen-tina Publicacion Especial 5 Paleogeno de America del Sur y de laPenDaggernsula Antartica 147ndash153

GOLDMAN N J P ANDERSON and A G RODRIGO 2000 Likeli-hood-based tests of topologies in phylogenetics SystematicBiology 49 652ndash670

HANNIBAL H 1911 A Pliocene ora from the Coast Ranges ofCalifornia Bulletin of the Torrey Botanical Club 38 329ndash342

HUELSENBECK J P J J BULL and C W CUNNINGHAM 1996 Com-binined data in phylogenetic analysis Trends in Ecology andEvolution 11 152ndash158

JANCZEWSKI M E 1907 Monographies des groseilliers Ribes LMemoires Societe de Physique et DrsquoHistoire Naturelle de Geneve35 199ndash517

KEEP E 1962 Interspecic hybridization in Ribes Genetica 33 1ndash23

KISHINO H and M HASEGAWA 1989 Evaluation of the maximumlikelihood estimate of the evolutionary tree topologies fromDNA sequence data and the branching order in HominoideaJournal of Molecular Evolution 29 170ndash179

KREMENETSKI C V 1998 Holocene history of the northern rangelimits of some trees and shrubs in Russia Arctic and AlpineResearch 30 317ndash333

LINDER C R L R GOERTZEN B V HEUVEL J FRANCISCO-OR-TEGA and R K JANSEN 2000 The complete external tran-scribed spacer of 18Sndash26S rDNA amplication and phylo-genetic utility at low taxonomic levels in Asteraceae andclosely allied families Molecular Phylogenetics and Evolution 14285ndash303

MACGINITIE D 1953 Fossil plants of the Florissant beds ColoradoCarnegie Institution of Washington Publication 599

MADDISON D R and W P MADDISON 2000 MacClade 4 Sun-derland Sinauer Associates

MANCHESTER S R 1999 Biogeographical relationships of NorthAmerican Tertiary oras Annals of the Missouri Botanical Gar-den 86 472ndash522

mdashmdashmdash 2001 Update on the megafossil ora of Florissant Colo-rado Proceedings of the Denver Museum of Nature amp ScienceSeries 4 No1 137

MANOS P S and M J DONOGHUE 2001 Progress in northernhemisphere phytogeography an introduction InternationalJournal of Plant Sciences 162 S1ndashS2

mdashmdashmdash and A M STANFORD 2001 The historical biogeography ofFagaceae tracking the tertiary history of temperate and sub-tropical forests of the northern hemisphere International Jour-nal of Plant Sciences 162 S77ndashS93

MAST A R and T J GIVNISH 2002 Historical biogeography andthe origin of stomatal distributions in Banksia and Dryandra(Proteaceae) based on their cpDNA phylogeny American Jour-nal of Botany 89 1311ndash1323

MESSINGER W K HUMMER and A LISTON 1999 Ribes (Grossu-

2004] 87SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 5 The strict consensus of 150 trees resulting from analyses of combined ETS and ITS sequence data (CI5077 070excluding uninformative characters RI5085) Data combinability determined by partition homogeneity tests (p5004) Num-bers above the branches indicate the percentage of bootstrap replicates in which the clade appeared

88 [Volume 29SYSTEMATIC BOTANY

FIG 6 The strict consensus of four trees resulting from analyses of the four datasets combined (ETS ITS psbA-trnHchloroplast restriction sites) Data combinability was determined by partition homogeneity tests (p5075) Numbers above thebranches indicate the percentage of bootstrap replicates in which the clade appeared

rDNA trees was the position of sect GrossularioidesSubgenus Grossularia is monophyletic in rDNA treeswith sect Grossularioides placed weakly as sister (Fig5) In contrast subg Grossularia is polyphyletic in chlo-roplast trees with sect Grossularia nested within sectGrossulariodes and sect Calobotrya sister to that group-ing (Fig 4) Analyses of the combined chloroplast andrDNA datasets (p5075 excluded R glandulosum Rlacustre R montigenum) generated four trees (length556 CI5088 069 excluding uninformative charactersRI5076) (Fig 6) Taxon sampling was limited due tothe limited overlap among datasets but trees showedstrong resolution of sect Calobotrya sect Grossulariaand the glabrous-styled gooseberries (Hesperia Lobbia

Robsonia) These groups again formed a well-support-ed clade nested within Ribes (Fig 6) The strongly sup-ported sister-group relationship between the true andglabrous-styled gooseberries (Fig 6) is consistent withthe monophyly of subg Grossularia but could changewith the inclusion of sect Grossularioides

ETS and psbA-trnH combined analyses (p5004 ex-cluded R oxyacanthoides subsp irriguum) generated 329trees (length 372 CI5084 077 excluding uninforma-tive characters RI5090) (Fig 7) Subgenus Grossulariawas resolved as monophyletic within which both theglabrous-styled and the true gooseberries were strong-ly supported the latter including R watsonianum(subg Lobbia) The Asian clade was well supported

2004] 89SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 7 The strict consensus of 329 trees resulting from analyses of combined ETS and psbA-trnH data (CI5084 077excluding uninformative characters RI5091) Dataset combinability was determined by partition-homogeneity tests (p5 004)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared

within sect Grossularia including the European R uva-crispa Both sect Calobotrya and sect Grossularioideswere strongly supported but neither was resolved assister to subg Grossularia The clade comprising subgGrossularia sect Grossularioides and sect Calobotryawas again evident nested within Ribes

Combined analyses of psbA-trnH and rDNA datasets(p5002 excluded R oxyacanthoides subsp irriguum andtaxa excluded from ETS1ITS analysis) generated 3080trees (length 5 719 CI5080 074 excluding uninfor-mative characters RI5085) Sects Grossularioides Calo-botrya Grossularia and the glabrous-styled gooseberries

90 [Volume 29SYSTEMATIC BOTANY

(Hesperia Lobbia Robsonia) were each strongly support-ed and again formed a strongly supported clade nestedin Ribes (Fig 8) Support for the monophyly of subgGrossularia was increased relative to support seen withany individual dataset (Figs 2 3 8)

Combinability (p5012) of all datasets for those taxarepresented in three of the four datasets required ex-clusion of composite taxa problematic within therDNA dataset as well as exclusion of taxa problematicfor the chloroplast versus rDNA datasets Combinedanalyses generated 4802 trees (length5768 CI5080074 excluding uninformative characters RI5085)Sec-tion Calobotrya sect Grossularia and the glabrous-styled gooseberries (Hesperia Lobbia Robsonia) exclud-ing R watsonianum were each well supported and to-gether formed a strongly supported clade (Fig 9) Sub-genus Grossularia was resolved as monophyleticbearing in mind that sect Grossularioides was excludedfrom the analyses

While all combined datasets resolved the clade con-taining sects Calobotrya Grossularioides and subgGrossularia as nested within Ribes (Figs 4ndash9) relation-ships among other lineages were unclear as in theanalyses of individual datasets (Figs 2 3) Basal rela-tionships were unresolved in the analyses of combinedchloroplast data (Fig 4) The combined ETS and psbA-trnH analyses suggested basal positions for goldencurrants (sect Symphocalyx) (Fig 7) All remaininganalyses suggested basal positions for sects Berisiaand Ribes (Figs 5 6 8 9) Basal relationships were notwell-supported in any analysis

Kishino-Hasegawa Tests Trees generated fromanalyses constraining the monophyly of subg Gros-sularia versus trees constrained to resolve a sister re-lationship between sect Grossularioides and sect Gros-sularia were marginally but signicantly different inboth the chloroplast (p5003) and the rDNA (p5005)datasets

Ancestral Area Reconstructions DIVA reconstruc-tions of ancestral areas support a western North Amer-ican origin for a large segment of Ribes beginningwith node 2 in Fig 8 Within this clade it is also thecase that subg Grossularia is inferred to have diversi-ed rst within western North America (Fig 8 node6) Subsequent movement to eastern Asia is inferred tohave occurred somewhere within sect Grossularia butthe ancestral area for the true gooseberries is equivo-cal and can include virtually any combination of areasdepending on the exact resolution of the large poly-tomy at the base of this clade (Fig 8 node 8) Impor-tantly our results indicate that the Asian species with-in sect Grossularia form a clade implying a single mi-gration from North America to Asia The ancestralarea for Ribes is reconstructed to be western NorthAmerica and western Eurasia or western North Amer-ica and all of Eurasia (Fig 8 node 1) However this

result hinges on resolution at the base which remainshighly uncertain and requires more intensive samplingof Ribes lineages outside of subg Grossularia

DISCUSSION

Gooseberry Monophyly Results from previousphylogenetic analyses based on nuclear 18Sndash26S rDNAITS data (Senters and Soltis 2003) and chloroplast re-striction site data (Messinger et al 1999) differed re-garding gooseberry monophyly Adding the additionalnuclear 18Sndash26S rDNA ETS and chloroplast psbA-trnHdatasets could increase support and resolution in re-sulting topologies or could reinforce the differencesbetween the nuclear and chloroplast topologies witheach reecting accurate but separate histories

Initial examination of the trees produced with theadditional datasets reinforced the apparent conict be-tween nuclear and chloroplast genomes ITS ETS andcombined rDNA datasets supported the monophyly ofsubg Grossularia (Figs 1 2 5) In contrast the com-bined chloroplast datasets (restriction sites plus psbA-trnH) suggested a closer relationship between the trueand glabrous-styled gooseberries than did the restric-tion site data alone (Fig 1 Messinger et al 1999) butstill resolved subg Grossularia as non-monophyleticwith sect Grossularioidies forming a grade at the baseof sect Grossularia (Fig 4) The increase in tree lengthwhen combined chloroplast data was constrained toresolve a monophyletic subg Grossularia (p5003) orwhen combined rDNA data was constrained to resolvesects Grossularioides and Grossularia as a clade(p5005) also indicated dataset incongruence

The discrepancy between nuclear and chloroplast to-pologies primarily involved the restriction sites datasetand not the psbA-trnH dataset The psbA-trnH datasetprovided little resolution (Fig 3) conicting with nei-ther the rDNA nor the restriction sites topologiesAnalyses combining the psbA-trnH data with either theETS data (p5004 Fig 7) or the rDNA data (p5002Fig 8) produced trees resolving subg Grossularia asmonophyletic with increased support relative to ETSor rDNA data alone (Figs 2 5) Section Grossularioideswas either sister to subg Grossularia (psbA-trnH 1rDNA Fig 8) or was unresolved in a polytomy withsubg Grossularia and sect Calobotrya (psbA-trnH 1ETS Fig 7) The monophyly of subg Grossularia wasalso supported by analyses of all datasets combinedwhether including taxa represented in all four datasets(p5075 Fig 6) or in three of the four datasets(p5012 Fig 9) Analyses combining all datasets re-quired exclusion of sect Grossularioides thus leavingsubg Grossularia monophyly uncertain However in-cluding sect Grossulariodes in spite of dataset incon-gruence (p5001) produced trees resolving a mono-phyletic subg Grossularia sister to a monophyletic sectGrossularioides (not shown)

2004] 91SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 8 The strict consensus of 3080 trees resulting from analyses of combined psbA-trnH and rDNA data (CI 5 080 074excluding uninformative characters RI 5 085) Dataset combinability was determined by partition homogeneity tests (p5002)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared DIVA (Ronquist 1996)was used to infer ancestral areas at the numbered nodes The ancestral areas at nodes two through seven were reconstructedas western North America Node one was reconstructed as western North America plus either western Eurasia or all of EurasiaThere were multiple possible reconstructions at node 8 including (1) western North America and eastern Eurasia (2) NorthAmerica and eastern Eurasia (3) North America or (4) western North America

92 [Volume 29SYSTEMATIC BOTANY

FIG 9 The strict consensus of 4802 trees resulting from analyses of all four datasets (ITS ETS psbA-trnH chloroplastrestriction sites) including taxa represented in at least three datasets (CI5080 074 excluding uninformative charactersRI5085) Dataset combinability was determined using partition homogeneity tests (p5012) Numbers above the branchesindicate the percentage of bootstrap replicates in which the clade appeared

2004] 93SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

The general picture that emerges from these analy-ses suggests that subg Grossularia is monophyletic(Figs 2 5ndash9) rDNA data supported gooseberry mono-phyly (Figs 2 5) psbA-trnH data while lacking suf-cient variation to resolve gooseberry monophyly ornon-monophyly supported gooseberry monophyly incombination with rDNA data (Figs 7 8) Finally anal-yses of all datasets combined supported gooseberrymonophyly although these analyses excluded thespiny currants (sect Grossularioides) (Figs 6 9) Whatrequires further investigation is the role hybridizationmay have played in the history of the spiny currants(sect Grossularioides) and the true gooseberries (sectGrossularia) Messinger et al (1999) encouraged furtherexploration of this possibility in Ribes in which theynoted potential chloroplast capture of the sect Gros-sularia chloroplast type by sect Grossularioides Crosseshave not been successful between species of sect Gros-sularioides and other sections within Ribes and are usu-ally unsuccessful between sections or subgenera (Keep1962) Conrmation of the pattern seen in trees gen-erated from the chloroplast restriction site data (Mes-singer et al 1999) is needed from additional chloro-plast datasets that provide greater resolution than didthe psbA-trnH dataset

Relationships Within the Gooseberries SubgenusGrossularia comprises two main lineages (Figs 2 5ndash9)the true gooseberries (sect Grossularia) and a clade ofglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) The four gooseberry sections are traditionally dis-tinguished from each other by basally pubescent stylesin sect Grossularia (with the exception of some Asianspecies) by four versus ve parted owers in sect Rob-sonia by anthers broader at the base in subg Hesperiaand by the absence of the above set of features in subgLobbia The glabrous-styled gooseberry lineage com-prising 27 species distributed through western NorthAmerica into Mexico (Berger 1924) was well-support-ed given our sampling but sections within this lineagewere not resolved Ribes watsonianum (subg Lobbia)was surprisingly placed outside of the glabrous-styledgooseberry lineage as sister to the true gooseberries(Figs 2 5 7ndash9) ITS data resolved R watsonianum with-in the glabrous-styled gooseberry lineage (Senters andSoltis 2003) but ETS data strongly resolved the specieswithin the true gooseberry lineage (sect Grossularia)(Fig 2) This conict within the rDNA data may reecthybridization between R watsonianum and a memberof sect Grossularia followed by xation within the Rwatsonianum genome of a recombinant rDNA repeattype Accounts of Ribes hybrids in the eld are rela-tively rare (Messler et al 1991) and do not implicateR watsonianum but fertile hybrids can be obtainedfrom articial crosses between glabrous-styled goose-berries and true gooseberries (Keep 1962 citing R lob-bii 3 R divaricatum) Alternatively R watsonianum may

posses multiple rDNA repeat types with different re-peat types sampled in our ITS versus ETS datasetsEach of these possibilities has been reported in otherplant taxa (Wendel et al 1995a Campbell et al 1997for potential recombinant rDNA repeat types Suh etal 1993 Wendel et al 1995b for incomplete homoge-nization of rDNA repeat types)

The true gooseberries (sect Grossularia) have a broadrange throughout the northern hemisphere with ninespecies in North America (Sinnott 1985) and seven spe-cies in Eurasia (Berger 1924) In his treatment of NorthAmerican gooseberries Sinnott (1985) divided his ninespecies into ve groups based on phenetic analysesThe groups consisted of (1) R cynosbati with spinyfruits (2) R niveum R curvatum and R missouriensewith highly exserted stamens and long sepals (3) Rrotundifolium and R divaricatum with medium lengthstamens and purple sepals (4) R inerme and R hirtel-lum with intermediate length stamens and small oralfeatures and (5) the ve subspecies of R oxyacanthoi-des with short stamens Sinnott (1985) recommendedthat R echinellum be excluded from the true gooseber-ries and aligned with the glabrous-styled gooseberriesof western North America (Hesperia Lobbia Robsonia)The analyses presented here showed strong supportfor the inclusion of R echinellum as well as the Eurasianspecies within the true gooseberry lineage (Figs 2ndash35 7ndash9) Resolution among the North American specieswas lacking or not well-supported (Figs 2ndash9) and thusneither supported nor conicted with Sinnottrsquos hy-pothesized relationships

The seven Eurasian species of sect Grossularia (Ber-ger 1924) include R uvacrispa in Europe R alpestre andR aciculare in the Himalayan region R stenocarpumand R formosanum in southern and eastern Asia andR burejense and R grossularioides in northern and east-ern Asia A clade of Asian species is well-supported(Figs 2 5 7ndash9) with possible inclusion of R uvacrispa(Figs 2 7) The psbA-trnH dataset includes R oxyacan-thoides subsp irriguum within the Asian clade (Fig 3)but this is weakly supported (Fig 3) and requires fur-ther substantiation particularly since R oxyacanthoidessubsp irriguum is restricted to northwestern NorthAmerica and may itself be of hybrid origin from cross-es between R oxyacanthoides subsp setosum and R in-erme (Sinnott 1985) both distributed in western NorthAmerica Resolution within the clade of Asian speciessuggests a correspondance to geographic and oristicregions within Asia Whether the Asian and NorthAmerican true gooseberries represent divergent line-ages or a monophyletic Asian clade nested within aNorth American grade is unclear given the availabledata

Other Groups within Ribes Since this study fo-cused on the gooseberries sampling within other sec-tions of Ribes was sometimes limited Nevertheless the

94 [Volume 29SYSTEMATIC BOTANY

data did support the monophyly of sects CalobotryaParilla Symphocalyx and Berisia Section Calobotrya is agroup of 21 western North American species (Berger1924) known as the ornamental currants The mono-phyly of sect Calobotrya was well-supported with theinclusion of some dwarf currants (sect Heritieria) (Figs2ndash9 Messinger et al 1999 Senters and Soltis 2003)Sampling was limited in sect Parilla a group of 41dioecious South American species (Janczewski 1907)but the group was supported in ITS trees excludingthe east Asian R fasciculatum the sectionrsquos only non-South American species (Senters and Soltis 2003) Apossible sister relationship between sect Parilla andsect Calobotrya (unpubl data cited in Weigend andBinder 2001) is consistent with the position of sect Pa-rilla seen with ITS data (Senters and Soltis 2003) Sec-tion Symphocalyx the golden currants includes vespecies distributed through northern Mexico and cen-tral and western North America (Berger 1924) Thegolden currants were well-supported given the avail-able sampling (Fig 2 4 9) The alpine currants sectBerisia are a group of 17 dioecious species distributedthrough Eurasia (Janczewski 1907) The monophyly ofsect Berisia was well-supported (Figs 2ndash9 Messingeret al 1999) but with the inclusion of some red currants(sect Ribes) in ITS trees (Senters and Soltis 2003)

The monophyly of sects Ribes and Coreosma wasquestionable (Figs 2 3 5) The red currants (sect Ri-bes) are a group of 15 Eurasian species with one spe-cies R triste also distributed in North America Sec-tion Coreosma the black currants includes six speciesin North America and six in Eurasia (Berger 1924) Sec-tion Heritiera the dwarf currants appeared to be poly-phyletic as seen in Messinger et al (1999) and Sentersand Soltis (2003) This group of six species (Berger1924) is dened primarily by a prostrate habit and assuggested by Messinger et al (1999) is likely a case ofconvergence

Biogeography The spread of taxa around theNorthern Hemisphere has been facilitated by the avail-ability at various times of two major migrationroutesmdashthe Beringian and the North Atlantic landbridges (Tiffney 1985a 1985b Donoghue et al 2001SanmartDaggern et al 2001) Especially in large and relative-ly old clades which have become widespread aroundthe Northern Hemisphere it is possible (perhaps evenlikely) that both pathways were used Information onthe timing of key divergences and on the direction ofmovement within subclades will be critical in sortingout the possibilities in particular cases Ribes providesan excellent example of such a group being represent-ed in Eurasia by six sections (Berisia Ribes and somespecies from Heritiera Coreosma Grossularioides andGrossularia) in western North America by nine (Sym-phocalyx Calobotrya Robsonia Hesperia Lobbia andsome species of Coreosma Heritiera Grossularioides and

Grossularia) and in eastern North America by three(some species of Heritiera Ribes and Grossularia) Oneapproach for sorting through a complex biogeographichistory as might be expected in Ribes is to examinephylogenetic patterns in component clades and ide-ally to date divergences

Our analyses indicate that subg Grossularia is nestedwithin a predominantly western North Americanclade (Figs 2 5ndash9) and that it diversied initially inthat region (Fig 8 node 6) Subsequently within sectGrossularia it appears that movement occurred fromwestern North America to eastern Asia presumablythrough Beringia followed by vicariance and the ori-gin and diversication of the well-supported Asiangooseberry clade Donoghue et al (2001) and Xiangand Soltis (2001) highlighted cases of movement out ofAsia into North America through the Bering LandBridge Ribes appears to provide a case of movementin the opposite direction Movement in both directionsis of course to be expected What remains to be de-termined in future studies of disjunct taxa is exactlywhich groups moved in which directions and whetherthere are any signicant generalizations that can bemade about these different patterns

Elsewhere in Ribes there are other possible cases ofmovement between North America and Asia One caseinvolves R lacustre of sect Grossularioides which is dis-tributed in eastern Asia as well as in North AmericaOther possible cases relate to resolution at the base ofRibes where relationships remain uncertain The basalpositions of sect Symphocalyx in trees resulting frompsbA-trnH data and from the combination of psbA-trnHand ETS data suggest a western North American ori-gin for the entire clade (Figs 2 7) This would implyearly dispersion to Asia giving rise to sects Berisiaand Ribes However all other datasets and dataset com-binations suggested a broader Eurasian plus westernNorth American distribution at the base (Fig 8 node1) owing to the basal positions of sects Berisia andRibes This would imply early vicariance involvingAsia and North America and movement back to Asiawithin the western North American clade Future stud-ies should include more sampling of sects Berisia Ri-bes Coreosma and Symphocalyx to help resolve basal re-lationships and biogeographic patterns in Ribes

The fossil record for Ribes consists largely of leaveswith few reports of seeds (Kremenetski 1998) fruits(Cevallos-Ferriz 1995) and owers (Gandolfo et al1998) The leaf record for Ribes in North America mayextend from approximately 2 mya (Hannibal 1911Dorf 1930 Axelrod 1966) to at least 345 mya (Mac-Ginitie 1953 Manchester 2001) and possibly to 45 or50 mya (Axelrod 1998 Wehr and Hopkins 1994) Al-though leaf features are seldom used to distinguishextant taxa of Ribes Wolfe (1964) used leaf serrationand venation features to distinguish between fossil

2004] 95SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

leaves of subg Ribes and subg Grossularia from Ne-vada If these features are reliable this dates subgGrossularia to at least 14 mya (Fig 9 node 6) A criticalnext step in understanding Ribes biogeography will beto accurately assign Ribes fossils to particular sub-clades so as to infer the timing of intercontinental di-vergences

ACKNOWLEDGEMENTS We thank the following individuals andinstitutions for providing plant material B Alverson D BouffordR Mitchell Arnold Arboretum of Harvard University Universityof California Botanical Garden Royal Botanic Garden EdinburghNew York Botanical Garden and the USDA-ARS National PlantGermplasm Repository A Senters and D Soltis graciously pro-vided numerous DNA aliquots DNA sequences and access to ear-ly manuscripts H Schorn and D Erwin provided assistance withpaleobotanical literature M Lavin P Herendeen and two anon-ymous reviewers provided numerous helpful comments This proj-ect was supported in part by a Putnam Fellowship through theArnold Arboretum of Harvard University

LITERATURE CITED

AVISE J C 1994 Molecular markers natural history and evolutionNew York Chapman amp Hall

AXELROD D I 1966 The Pleistocene Soboba ora of southern Califor-nia University of California Publications in Geological Sci-ences 60

mdashmdashmdash 1998 Thunder Mountain Idaho University of CaliforniaPublications in Geological Sciences 142

BALDWIN B G and S MARKOS 1998 Phylogenetic utility of theexternal transcribed spacer (ETS) of 18Sndash26S rDNA Congru-ence of ETS and ITS trees of Calycadenia (Compositae) Mo-lecular Phylogenetics and Evolution 10 449ndash463

mdashmdashmdash M J SANDERSON J M PORTER M F WOJCIECHOWSKI CS CAMPBELL and M J DONOGHUE 1995 The ITS region ofnuclear ribosomal DNA a valuable source of evidence onangiosperm phylogeny Annals of the Missouri Botanical Garden82 247ndash277

BEARD K H 1998 East of Eden Asia as an important center oftaxonomic origination in mammalian evolution Bulletin of theCarnegie Museum of Natural History 34 5ndash39

BENA G M F JUBIER I OLIVIERI and B LEJEUNE 1998 Ribosom-al external and internal transcribed spacers combined use inthe phylogenetic analysis of Medicago (Leguminosae) Journal ofMolecular Evolution 46 299ndash306

BERGER A 1924 A taxonomic review of currants and gooseberriesNew York Agricultural Experimental Station Technical Bulletin109 1ndash118

BOUFFORD D E and S A SPONGBERG 1983 Eastern Asia-EasternNorth American phytogeographical relationships-a historyfrom the time of Linnaeus to the twentieth century Annalsof the Missouri Botanical Garden 70 423ndash439

CAMPBELL C S M F WOJCIECHOWSKI B G BALDWIN L A AL-ICE and M J DONOGHUE 1997 Persistent nuclear ribosomalDNA sequence polymorphism in the Amelanchier agamiccomplex (Rosaceae) Molecular Biology and Evolution 14 81ndash90

CEVALLOS-FERRIZ S R S 1995 Fruits of Ribes from the Princetonchert British Columbia Canada American Journal of Botany82(6 supplement) 84

COVILLE F V and N L BRITTON 1908 Grossulariaceae NorthAmer-ican Flora 22 193ndash225

CUNNINGHAM C W 1997 Can three incongruence tests predictwhen data shold be combined Molecular Biology and Evolution14 733ndash740

DEQUEIROZ A M J DONOGHUE and J KIM 1995 Separate versuscombined analysis of phylogenetic evidence Annual Review ofEcology and Systematics 26 657ndash681

DONOGHUE M J C D BELL and J LI 2001 Phylogenetic patternsin northern hemisphere plant geography International Journalof Plant Sciences 162 S41ndashS52

DORF E 1930 Pliocene oras of California Carnegie Institution ofWashington Publication 412

FARRIS J S M KALLERSJO A G KLUGE and C BULT 1995 Test-ing signicance of incongruence Cladistics 10 315ndash319

FELSENSTEIN J 1985 Condence limits on phylogenies an ap-proach using the bootstrap Evolution 39 783ndash791

FENTON B A N E BIRCH G MALLOCH P G LANHAM and RM BRENNAN 2000 Gall mite molecular phylogeny and itsrelationship to the evolution of plant host specicity AppliedAcarology 24 831ndash861

FRITSCH P W C M MORTON T CHEN and C MELDRUM 2001Phylogeny and biogeography of the Styracaceae InternationalJournal of Plant Sciences 162 S95ndashS116

GANDOLFO M A P HOC S N SANTILLANA and S A MARENSSI1998 Una or fosil morfologicamente afDaggern a las Grossulari-aceae (orden Rosales) de la Formacion la Meseta (Eoceno me-dio) Isla Marambio Antartida Asociacion Paleontologica Argen-tina Publicacion Especial 5 Paleogeno de America del Sur y de laPenDaggernsula Antartica 147ndash153

GOLDMAN N J P ANDERSON and A G RODRIGO 2000 Likeli-hood-based tests of topologies in phylogenetics SystematicBiology 49 652ndash670

HANNIBAL H 1911 A Pliocene ora from the Coast Ranges ofCalifornia Bulletin of the Torrey Botanical Club 38 329ndash342

HUELSENBECK J P J J BULL and C W CUNNINGHAM 1996 Com-binined data in phylogenetic analysis Trends in Ecology andEvolution 11 152ndash158

JANCZEWSKI M E 1907 Monographies des groseilliers Ribes LMemoires Societe de Physique et DrsquoHistoire Naturelle de Geneve35 199ndash517

KEEP E 1962 Interspecic hybridization in Ribes Genetica 33 1ndash23

KISHINO H and M HASEGAWA 1989 Evaluation of the maximumlikelihood estimate of the evolutionary tree topologies fromDNA sequence data and the branching order in HominoideaJournal of Molecular Evolution 29 170ndash179

KREMENETSKI C V 1998 Holocene history of the northern rangelimits of some trees and shrubs in Russia Arctic and AlpineResearch 30 317ndash333

LINDER C R L R GOERTZEN B V HEUVEL J FRANCISCO-OR-TEGA and R K JANSEN 2000 The complete external tran-scribed spacer of 18Sndash26S rDNA amplication and phylo-genetic utility at low taxonomic levels in Asteraceae andclosely allied families Molecular Phylogenetics and Evolution 14285ndash303

MACGINITIE D 1953 Fossil plants of the Florissant beds ColoradoCarnegie Institution of Washington Publication 599

MADDISON D R and W P MADDISON 2000 MacClade 4 Sun-derland Sinauer Associates

MANCHESTER S R 1999 Biogeographical relationships of NorthAmerican Tertiary oras Annals of the Missouri Botanical Gar-den 86 472ndash522

mdashmdashmdash 2001 Update on the megafossil ora of Florissant Colo-rado Proceedings of the Denver Museum of Nature amp ScienceSeries 4 No1 137

MANOS P S and M J DONOGHUE 2001 Progress in northernhemisphere phytogeography an introduction InternationalJournal of Plant Sciences 162 S1ndashS2

mdashmdashmdash and A M STANFORD 2001 The historical biogeography ofFagaceae tracking the tertiary history of temperate and sub-tropical forests of the northern hemisphere International Jour-nal of Plant Sciences 162 S77ndashS93

MAST A R and T J GIVNISH 2002 Historical biogeography andthe origin of stomatal distributions in Banksia and Dryandra(Proteaceae) based on their cpDNA phylogeny American Jour-nal of Botany 89 1311ndash1323

MESSINGER W K HUMMER and A LISTON 1999 Ribes (Grossu-

88 [Volume 29SYSTEMATIC BOTANY

FIG 6 The strict consensus of four trees resulting from analyses of the four datasets combined (ETS ITS psbA-trnHchloroplast restriction sites) Data combinability was determined by partition homogeneity tests (p5075) Numbers above thebranches indicate the percentage of bootstrap replicates in which the clade appeared

rDNA trees was the position of sect GrossularioidesSubgenus Grossularia is monophyletic in rDNA treeswith sect Grossularioides placed weakly as sister (Fig5) In contrast subg Grossularia is polyphyletic in chlo-roplast trees with sect Grossularia nested within sectGrossulariodes and sect Calobotrya sister to that group-ing (Fig 4) Analyses of the combined chloroplast andrDNA datasets (p5075 excluded R glandulosum Rlacustre R montigenum) generated four trees (length556 CI5088 069 excluding uninformative charactersRI5076) (Fig 6) Taxon sampling was limited due tothe limited overlap among datasets but trees showedstrong resolution of sect Calobotrya sect Grossulariaand the glabrous-styled gooseberries (Hesperia Lobbia

Robsonia) These groups again formed a well-support-ed clade nested within Ribes (Fig 6) The strongly sup-ported sister-group relationship between the true andglabrous-styled gooseberries (Fig 6) is consistent withthe monophyly of subg Grossularia but could changewith the inclusion of sect Grossularioides

ETS and psbA-trnH combined analyses (p5004 ex-cluded R oxyacanthoides subsp irriguum) generated 329trees (length 372 CI5084 077 excluding uninforma-tive characters RI5090) (Fig 7) Subgenus Grossulariawas resolved as monophyletic within which both theglabrous-styled and the true gooseberries were strong-ly supported the latter including R watsonianum(subg Lobbia) The Asian clade was well supported

2004] 89SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 7 The strict consensus of 329 trees resulting from analyses of combined ETS and psbA-trnH data (CI5084 077excluding uninformative characters RI5091) Dataset combinability was determined by partition-homogeneity tests (p5 004)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared

within sect Grossularia including the European R uva-crispa Both sect Calobotrya and sect Grossularioideswere strongly supported but neither was resolved assister to subg Grossularia The clade comprising subgGrossularia sect Grossularioides and sect Calobotryawas again evident nested within Ribes

Combined analyses of psbA-trnH and rDNA datasets(p5002 excluded R oxyacanthoides subsp irriguum andtaxa excluded from ETS1ITS analysis) generated 3080trees (length 5 719 CI5080 074 excluding uninfor-mative characters RI5085) Sects Grossularioides Calo-botrya Grossularia and the glabrous-styled gooseberries

90 [Volume 29SYSTEMATIC BOTANY

(Hesperia Lobbia Robsonia) were each strongly support-ed and again formed a strongly supported clade nestedin Ribes (Fig 8) Support for the monophyly of subgGrossularia was increased relative to support seen withany individual dataset (Figs 2 3 8)

Combinability (p5012) of all datasets for those taxarepresented in three of the four datasets required ex-clusion of composite taxa problematic within therDNA dataset as well as exclusion of taxa problematicfor the chloroplast versus rDNA datasets Combinedanalyses generated 4802 trees (length5768 CI5080074 excluding uninformative characters RI5085)Sec-tion Calobotrya sect Grossularia and the glabrous-styled gooseberries (Hesperia Lobbia Robsonia) exclud-ing R watsonianum were each well supported and to-gether formed a strongly supported clade (Fig 9) Sub-genus Grossularia was resolved as monophyleticbearing in mind that sect Grossularioides was excludedfrom the analyses

While all combined datasets resolved the clade con-taining sects Calobotrya Grossularioides and subgGrossularia as nested within Ribes (Figs 4ndash9) relation-ships among other lineages were unclear as in theanalyses of individual datasets (Figs 2 3) Basal rela-tionships were unresolved in the analyses of combinedchloroplast data (Fig 4) The combined ETS and psbA-trnH analyses suggested basal positions for goldencurrants (sect Symphocalyx) (Fig 7) All remaininganalyses suggested basal positions for sects Berisiaand Ribes (Figs 5 6 8 9) Basal relationships were notwell-supported in any analysis

Kishino-Hasegawa Tests Trees generated fromanalyses constraining the monophyly of subg Gros-sularia versus trees constrained to resolve a sister re-lationship between sect Grossularioides and sect Gros-sularia were marginally but signicantly different inboth the chloroplast (p5003) and the rDNA (p5005)datasets

Ancestral Area Reconstructions DIVA reconstruc-tions of ancestral areas support a western North Amer-ican origin for a large segment of Ribes beginningwith node 2 in Fig 8 Within this clade it is also thecase that subg Grossularia is inferred to have diversi-ed rst within western North America (Fig 8 node6) Subsequent movement to eastern Asia is inferred tohave occurred somewhere within sect Grossularia butthe ancestral area for the true gooseberries is equivo-cal and can include virtually any combination of areasdepending on the exact resolution of the large poly-tomy at the base of this clade (Fig 8 node 8) Impor-tantly our results indicate that the Asian species with-in sect Grossularia form a clade implying a single mi-gration from North America to Asia The ancestralarea for Ribes is reconstructed to be western NorthAmerica and western Eurasia or western North Amer-ica and all of Eurasia (Fig 8 node 1) However this

result hinges on resolution at the base which remainshighly uncertain and requires more intensive samplingof Ribes lineages outside of subg Grossularia

DISCUSSION

Gooseberry Monophyly Results from previousphylogenetic analyses based on nuclear 18Sndash26S rDNAITS data (Senters and Soltis 2003) and chloroplast re-striction site data (Messinger et al 1999) differed re-garding gooseberry monophyly Adding the additionalnuclear 18Sndash26S rDNA ETS and chloroplast psbA-trnHdatasets could increase support and resolution in re-sulting topologies or could reinforce the differencesbetween the nuclear and chloroplast topologies witheach reecting accurate but separate histories

Initial examination of the trees produced with theadditional datasets reinforced the apparent conict be-tween nuclear and chloroplast genomes ITS ETS andcombined rDNA datasets supported the monophyly ofsubg Grossularia (Figs 1 2 5) In contrast the com-bined chloroplast datasets (restriction sites plus psbA-trnH) suggested a closer relationship between the trueand glabrous-styled gooseberries than did the restric-tion site data alone (Fig 1 Messinger et al 1999) butstill resolved subg Grossularia as non-monophyleticwith sect Grossularioidies forming a grade at the baseof sect Grossularia (Fig 4) The increase in tree lengthwhen combined chloroplast data was constrained toresolve a monophyletic subg Grossularia (p5003) orwhen combined rDNA data was constrained to resolvesects Grossularioides and Grossularia as a clade(p5005) also indicated dataset incongruence

The discrepancy between nuclear and chloroplast to-pologies primarily involved the restriction sites datasetand not the psbA-trnH dataset The psbA-trnH datasetprovided little resolution (Fig 3) conicting with nei-ther the rDNA nor the restriction sites topologiesAnalyses combining the psbA-trnH data with either theETS data (p5004 Fig 7) or the rDNA data (p5002Fig 8) produced trees resolving subg Grossularia asmonophyletic with increased support relative to ETSor rDNA data alone (Figs 2 5) Section Grossularioideswas either sister to subg Grossularia (psbA-trnH 1rDNA Fig 8) or was unresolved in a polytomy withsubg Grossularia and sect Calobotrya (psbA-trnH 1ETS Fig 7) The monophyly of subg Grossularia wasalso supported by analyses of all datasets combinedwhether including taxa represented in all four datasets(p5075 Fig 6) or in three of the four datasets(p5012 Fig 9) Analyses combining all datasets re-quired exclusion of sect Grossularioides thus leavingsubg Grossularia monophyly uncertain However in-cluding sect Grossulariodes in spite of dataset incon-gruence (p5001) produced trees resolving a mono-phyletic subg Grossularia sister to a monophyletic sectGrossularioides (not shown)

2004] 91SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 8 The strict consensus of 3080 trees resulting from analyses of combined psbA-trnH and rDNA data (CI 5 080 074excluding uninformative characters RI 5 085) Dataset combinability was determined by partition homogeneity tests (p5002)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared DIVA (Ronquist 1996)was used to infer ancestral areas at the numbered nodes The ancestral areas at nodes two through seven were reconstructedas western North America Node one was reconstructed as western North America plus either western Eurasia or all of EurasiaThere were multiple possible reconstructions at node 8 including (1) western North America and eastern Eurasia (2) NorthAmerica and eastern Eurasia (3) North America or (4) western North America

92 [Volume 29SYSTEMATIC BOTANY

FIG 9 The strict consensus of 4802 trees resulting from analyses of all four datasets (ITS ETS psbA-trnH chloroplastrestriction sites) including taxa represented in at least three datasets (CI5080 074 excluding uninformative charactersRI5085) Dataset combinability was determined using partition homogeneity tests (p5012) Numbers above the branchesindicate the percentage of bootstrap replicates in which the clade appeared

2004] 93SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

The general picture that emerges from these analy-ses suggests that subg Grossularia is monophyletic(Figs 2 5ndash9) rDNA data supported gooseberry mono-phyly (Figs 2 5) psbA-trnH data while lacking suf-cient variation to resolve gooseberry monophyly ornon-monophyly supported gooseberry monophyly incombination with rDNA data (Figs 7 8) Finally anal-yses of all datasets combined supported gooseberrymonophyly although these analyses excluded thespiny currants (sect Grossularioides) (Figs 6 9) Whatrequires further investigation is the role hybridizationmay have played in the history of the spiny currants(sect Grossularioides) and the true gooseberries (sectGrossularia) Messinger et al (1999) encouraged furtherexploration of this possibility in Ribes in which theynoted potential chloroplast capture of the sect Gros-sularia chloroplast type by sect Grossularioides Crosseshave not been successful between species of sect Gros-sularioides and other sections within Ribes and are usu-ally unsuccessful between sections or subgenera (Keep1962) Conrmation of the pattern seen in trees gen-erated from the chloroplast restriction site data (Mes-singer et al 1999) is needed from additional chloro-plast datasets that provide greater resolution than didthe psbA-trnH dataset

Relationships Within the Gooseberries SubgenusGrossularia comprises two main lineages (Figs 2 5ndash9)the true gooseberries (sect Grossularia) and a clade ofglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) The four gooseberry sections are traditionally dis-tinguished from each other by basally pubescent stylesin sect Grossularia (with the exception of some Asianspecies) by four versus ve parted owers in sect Rob-sonia by anthers broader at the base in subg Hesperiaand by the absence of the above set of features in subgLobbia The glabrous-styled gooseberry lineage com-prising 27 species distributed through western NorthAmerica into Mexico (Berger 1924) was well-support-ed given our sampling but sections within this lineagewere not resolved Ribes watsonianum (subg Lobbia)was surprisingly placed outside of the glabrous-styledgooseberry lineage as sister to the true gooseberries(Figs 2 5 7ndash9) ITS data resolved R watsonianum with-in the glabrous-styled gooseberry lineage (Senters andSoltis 2003) but ETS data strongly resolved the specieswithin the true gooseberry lineage (sect Grossularia)(Fig 2) This conict within the rDNA data may reecthybridization between R watsonianum and a memberof sect Grossularia followed by xation within the Rwatsonianum genome of a recombinant rDNA repeattype Accounts of Ribes hybrids in the eld are rela-tively rare (Messler et al 1991) and do not implicateR watsonianum but fertile hybrids can be obtainedfrom articial crosses between glabrous-styled goose-berries and true gooseberries (Keep 1962 citing R lob-bii 3 R divaricatum) Alternatively R watsonianum may

posses multiple rDNA repeat types with different re-peat types sampled in our ITS versus ETS datasetsEach of these possibilities has been reported in otherplant taxa (Wendel et al 1995a Campbell et al 1997for potential recombinant rDNA repeat types Suh etal 1993 Wendel et al 1995b for incomplete homoge-nization of rDNA repeat types)

The true gooseberries (sect Grossularia) have a broadrange throughout the northern hemisphere with ninespecies in North America (Sinnott 1985) and seven spe-cies in Eurasia (Berger 1924) In his treatment of NorthAmerican gooseberries Sinnott (1985) divided his ninespecies into ve groups based on phenetic analysesThe groups consisted of (1) R cynosbati with spinyfruits (2) R niveum R curvatum and R missouriensewith highly exserted stamens and long sepals (3) Rrotundifolium and R divaricatum with medium lengthstamens and purple sepals (4) R inerme and R hirtel-lum with intermediate length stamens and small oralfeatures and (5) the ve subspecies of R oxyacanthoi-des with short stamens Sinnott (1985) recommendedthat R echinellum be excluded from the true gooseber-ries and aligned with the glabrous-styled gooseberriesof western North America (Hesperia Lobbia Robsonia)The analyses presented here showed strong supportfor the inclusion of R echinellum as well as the Eurasianspecies within the true gooseberry lineage (Figs 2ndash35 7ndash9) Resolution among the North American specieswas lacking or not well-supported (Figs 2ndash9) and thusneither supported nor conicted with Sinnottrsquos hy-pothesized relationships

The seven Eurasian species of sect Grossularia (Ber-ger 1924) include R uvacrispa in Europe R alpestre andR aciculare in the Himalayan region R stenocarpumand R formosanum in southern and eastern Asia andR burejense and R grossularioides in northern and east-ern Asia A clade of Asian species is well-supported(Figs 2 5 7ndash9) with possible inclusion of R uvacrispa(Figs 2 7) The psbA-trnH dataset includes R oxyacan-thoides subsp irriguum within the Asian clade (Fig 3)but this is weakly supported (Fig 3) and requires fur-ther substantiation particularly since R oxyacanthoidessubsp irriguum is restricted to northwestern NorthAmerica and may itself be of hybrid origin from cross-es between R oxyacanthoides subsp setosum and R in-erme (Sinnott 1985) both distributed in western NorthAmerica Resolution within the clade of Asian speciessuggests a correspondance to geographic and oristicregions within Asia Whether the Asian and NorthAmerican true gooseberries represent divergent line-ages or a monophyletic Asian clade nested within aNorth American grade is unclear given the availabledata

Other Groups within Ribes Since this study fo-cused on the gooseberries sampling within other sec-tions of Ribes was sometimes limited Nevertheless the

94 [Volume 29SYSTEMATIC BOTANY

data did support the monophyly of sects CalobotryaParilla Symphocalyx and Berisia Section Calobotrya is agroup of 21 western North American species (Berger1924) known as the ornamental currants The mono-phyly of sect Calobotrya was well-supported with theinclusion of some dwarf currants (sect Heritieria) (Figs2ndash9 Messinger et al 1999 Senters and Soltis 2003)Sampling was limited in sect Parilla a group of 41dioecious South American species (Janczewski 1907)but the group was supported in ITS trees excludingthe east Asian R fasciculatum the sectionrsquos only non-South American species (Senters and Soltis 2003) Apossible sister relationship between sect Parilla andsect Calobotrya (unpubl data cited in Weigend andBinder 2001) is consistent with the position of sect Pa-rilla seen with ITS data (Senters and Soltis 2003) Sec-tion Symphocalyx the golden currants includes vespecies distributed through northern Mexico and cen-tral and western North America (Berger 1924) Thegolden currants were well-supported given the avail-able sampling (Fig 2 4 9) The alpine currants sectBerisia are a group of 17 dioecious species distributedthrough Eurasia (Janczewski 1907) The monophyly ofsect Berisia was well-supported (Figs 2ndash9 Messingeret al 1999) but with the inclusion of some red currants(sect Ribes) in ITS trees (Senters and Soltis 2003)

The monophyly of sects Ribes and Coreosma wasquestionable (Figs 2 3 5) The red currants (sect Ri-bes) are a group of 15 Eurasian species with one spe-cies R triste also distributed in North America Sec-tion Coreosma the black currants includes six speciesin North America and six in Eurasia (Berger 1924) Sec-tion Heritiera the dwarf currants appeared to be poly-phyletic as seen in Messinger et al (1999) and Sentersand Soltis (2003) This group of six species (Berger1924) is dened primarily by a prostrate habit and assuggested by Messinger et al (1999) is likely a case ofconvergence

Biogeography The spread of taxa around theNorthern Hemisphere has been facilitated by the avail-ability at various times of two major migrationroutesmdashthe Beringian and the North Atlantic landbridges (Tiffney 1985a 1985b Donoghue et al 2001SanmartDaggern et al 2001) Especially in large and relative-ly old clades which have become widespread aroundthe Northern Hemisphere it is possible (perhaps evenlikely) that both pathways were used Information onthe timing of key divergences and on the direction ofmovement within subclades will be critical in sortingout the possibilities in particular cases Ribes providesan excellent example of such a group being represent-ed in Eurasia by six sections (Berisia Ribes and somespecies from Heritiera Coreosma Grossularioides andGrossularia) in western North America by nine (Sym-phocalyx Calobotrya Robsonia Hesperia Lobbia andsome species of Coreosma Heritiera Grossularioides and

Grossularia) and in eastern North America by three(some species of Heritiera Ribes and Grossularia) Oneapproach for sorting through a complex biogeographichistory as might be expected in Ribes is to examinephylogenetic patterns in component clades and ide-ally to date divergences

Our analyses indicate that subg Grossularia is nestedwithin a predominantly western North Americanclade (Figs 2 5ndash9) and that it diversied initially inthat region (Fig 8 node 6) Subsequently within sectGrossularia it appears that movement occurred fromwestern North America to eastern Asia presumablythrough Beringia followed by vicariance and the ori-gin and diversication of the well-supported Asiangooseberry clade Donoghue et al (2001) and Xiangand Soltis (2001) highlighted cases of movement out ofAsia into North America through the Bering LandBridge Ribes appears to provide a case of movementin the opposite direction Movement in both directionsis of course to be expected What remains to be de-termined in future studies of disjunct taxa is exactlywhich groups moved in which directions and whetherthere are any signicant generalizations that can bemade about these different patterns

Elsewhere in Ribes there are other possible cases ofmovement between North America and Asia One caseinvolves R lacustre of sect Grossularioides which is dis-tributed in eastern Asia as well as in North AmericaOther possible cases relate to resolution at the base ofRibes where relationships remain uncertain The basalpositions of sect Symphocalyx in trees resulting frompsbA-trnH data and from the combination of psbA-trnHand ETS data suggest a western North American ori-gin for the entire clade (Figs 2 7) This would implyearly dispersion to Asia giving rise to sects Berisiaand Ribes However all other datasets and dataset com-binations suggested a broader Eurasian plus westernNorth American distribution at the base (Fig 8 node1) owing to the basal positions of sects Berisia andRibes This would imply early vicariance involvingAsia and North America and movement back to Asiawithin the western North American clade Future stud-ies should include more sampling of sects Berisia Ri-bes Coreosma and Symphocalyx to help resolve basal re-lationships and biogeographic patterns in Ribes

The fossil record for Ribes consists largely of leaveswith few reports of seeds (Kremenetski 1998) fruits(Cevallos-Ferriz 1995) and owers (Gandolfo et al1998) The leaf record for Ribes in North America mayextend from approximately 2 mya (Hannibal 1911Dorf 1930 Axelrod 1966) to at least 345 mya (Mac-Ginitie 1953 Manchester 2001) and possibly to 45 or50 mya (Axelrod 1998 Wehr and Hopkins 1994) Al-though leaf features are seldom used to distinguishextant taxa of Ribes Wolfe (1964) used leaf serrationand venation features to distinguish between fossil

2004] 95SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

leaves of subg Ribes and subg Grossularia from Ne-vada If these features are reliable this dates subgGrossularia to at least 14 mya (Fig 9 node 6) A criticalnext step in understanding Ribes biogeography will beto accurately assign Ribes fossils to particular sub-clades so as to infer the timing of intercontinental di-vergences

ACKNOWLEDGEMENTS We thank the following individuals andinstitutions for providing plant material B Alverson D BouffordR Mitchell Arnold Arboretum of Harvard University Universityof California Botanical Garden Royal Botanic Garden EdinburghNew York Botanical Garden and the USDA-ARS National PlantGermplasm Repository A Senters and D Soltis graciously pro-vided numerous DNA aliquots DNA sequences and access to ear-ly manuscripts H Schorn and D Erwin provided assistance withpaleobotanical literature M Lavin P Herendeen and two anon-ymous reviewers provided numerous helpful comments This proj-ect was supported in part by a Putnam Fellowship through theArnold Arboretum of Harvard University

LITERATURE CITED

AVISE J C 1994 Molecular markers natural history and evolutionNew York Chapman amp Hall

AXELROD D I 1966 The Pleistocene Soboba ora of southern Califor-nia University of California Publications in Geological Sci-ences 60

mdashmdashmdash 1998 Thunder Mountain Idaho University of CaliforniaPublications in Geological Sciences 142

BALDWIN B G and S MARKOS 1998 Phylogenetic utility of theexternal transcribed spacer (ETS) of 18Sndash26S rDNA Congru-ence of ETS and ITS trees of Calycadenia (Compositae) Mo-lecular Phylogenetics and Evolution 10 449ndash463

mdashmdashmdash M J SANDERSON J M PORTER M F WOJCIECHOWSKI CS CAMPBELL and M J DONOGHUE 1995 The ITS region ofnuclear ribosomal DNA a valuable source of evidence onangiosperm phylogeny Annals of the Missouri Botanical Garden82 247ndash277

BEARD K H 1998 East of Eden Asia as an important center oftaxonomic origination in mammalian evolution Bulletin of theCarnegie Museum of Natural History 34 5ndash39

BENA G M F JUBIER I OLIVIERI and B LEJEUNE 1998 Ribosom-al external and internal transcribed spacers combined use inthe phylogenetic analysis of Medicago (Leguminosae) Journal ofMolecular Evolution 46 299ndash306

BERGER A 1924 A taxonomic review of currants and gooseberriesNew York Agricultural Experimental Station Technical Bulletin109 1ndash118

BOUFFORD D E and S A SPONGBERG 1983 Eastern Asia-EasternNorth American phytogeographical relationships-a historyfrom the time of Linnaeus to the twentieth century Annalsof the Missouri Botanical Garden 70 423ndash439

CAMPBELL C S M F WOJCIECHOWSKI B G BALDWIN L A AL-ICE and M J DONOGHUE 1997 Persistent nuclear ribosomalDNA sequence polymorphism in the Amelanchier agamiccomplex (Rosaceae) Molecular Biology and Evolution 14 81ndash90

CEVALLOS-FERRIZ S R S 1995 Fruits of Ribes from the Princetonchert British Columbia Canada American Journal of Botany82(6 supplement) 84

COVILLE F V and N L BRITTON 1908 Grossulariaceae NorthAmer-ican Flora 22 193ndash225

CUNNINGHAM C W 1997 Can three incongruence tests predictwhen data shold be combined Molecular Biology and Evolution14 733ndash740

DEQUEIROZ A M J DONOGHUE and J KIM 1995 Separate versuscombined analysis of phylogenetic evidence Annual Review ofEcology and Systematics 26 657ndash681

DONOGHUE M J C D BELL and J LI 2001 Phylogenetic patternsin northern hemisphere plant geography International Journalof Plant Sciences 162 S41ndashS52

DORF E 1930 Pliocene oras of California Carnegie Institution ofWashington Publication 412

FARRIS J S M KALLERSJO A G KLUGE and C BULT 1995 Test-ing signicance of incongruence Cladistics 10 315ndash319

FELSENSTEIN J 1985 Condence limits on phylogenies an ap-proach using the bootstrap Evolution 39 783ndash791

FENTON B A N E BIRCH G MALLOCH P G LANHAM and RM BRENNAN 2000 Gall mite molecular phylogeny and itsrelationship to the evolution of plant host specicity AppliedAcarology 24 831ndash861

FRITSCH P W C M MORTON T CHEN and C MELDRUM 2001Phylogeny and biogeography of the Styracaceae InternationalJournal of Plant Sciences 162 S95ndashS116

GANDOLFO M A P HOC S N SANTILLANA and S A MARENSSI1998 Una or fosil morfologicamente afDaggern a las Grossulari-aceae (orden Rosales) de la Formacion la Meseta (Eoceno me-dio) Isla Marambio Antartida Asociacion Paleontologica Argen-tina Publicacion Especial 5 Paleogeno de America del Sur y de laPenDaggernsula Antartica 147ndash153

GOLDMAN N J P ANDERSON and A G RODRIGO 2000 Likeli-hood-based tests of topologies in phylogenetics SystematicBiology 49 652ndash670

HANNIBAL H 1911 A Pliocene ora from the Coast Ranges ofCalifornia Bulletin of the Torrey Botanical Club 38 329ndash342

HUELSENBECK J P J J BULL and C W CUNNINGHAM 1996 Com-binined data in phylogenetic analysis Trends in Ecology andEvolution 11 152ndash158

JANCZEWSKI M E 1907 Monographies des groseilliers Ribes LMemoires Societe de Physique et DrsquoHistoire Naturelle de Geneve35 199ndash517

KEEP E 1962 Interspecic hybridization in Ribes Genetica 33 1ndash23

KISHINO H and M HASEGAWA 1989 Evaluation of the maximumlikelihood estimate of the evolutionary tree topologies fromDNA sequence data and the branching order in HominoideaJournal of Molecular Evolution 29 170ndash179

KREMENETSKI C V 1998 Holocene history of the northern rangelimits of some trees and shrubs in Russia Arctic and AlpineResearch 30 317ndash333

LINDER C R L R GOERTZEN B V HEUVEL J FRANCISCO-OR-TEGA and R K JANSEN 2000 The complete external tran-scribed spacer of 18Sndash26S rDNA amplication and phylo-genetic utility at low taxonomic levels in Asteraceae andclosely allied families Molecular Phylogenetics and Evolution 14285ndash303

MACGINITIE D 1953 Fossil plants of the Florissant beds ColoradoCarnegie Institution of Washington Publication 599

MADDISON D R and W P MADDISON 2000 MacClade 4 Sun-derland Sinauer Associates

MANCHESTER S R 1999 Biogeographical relationships of NorthAmerican Tertiary oras Annals of the Missouri Botanical Gar-den 86 472ndash522

mdashmdashmdash 2001 Update on the megafossil ora of Florissant Colo-rado Proceedings of the Denver Museum of Nature amp ScienceSeries 4 No1 137

MANOS P S and M J DONOGHUE 2001 Progress in northernhemisphere phytogeography an introduction InternationalJournal of Plant Sciences 162 S1ndashS2

mdashmdashmdash and A M STANFORD 2001 The historical biogeography ofFagaceae tracking the tertiary history of temperate and sub-tropical forests of the northern hemisphere International Jour-nal of Plant Sciences 162 S77ndashS93

MAST A R and T J GIVNISH 2002 Historical biogeography andthe origin of stomatal distributions in Banksia and Dryandra(Proteaceae) based on their cpDNA phylogeny American Jour-nal of Botany 89 1311ndash1323

MESSINGER W K HUMMER and A LISTON 1999 Ribes (Grossu-

2004] 89SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 7 The strict consensus of 329 trees resulting from analyses of combined ETS and psbA-trnH data (CI5084 077excluding uninformative characters RI5091) Dataset combinability was determined by partition-homogeneity tests (p5 004)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared

within sect Grossularia including the European R uva-crispa Both sect Calobotrya and sect Grossularioideswere strongly supported but neither was resolved assister to subg Grossularia The clade comprising subgGrossularia sect Grossularioides and sect Calobotryawas again evident nested within Ribes

Combined analyses of psbA-trnH and rDNA datasets(p5002 excluded R oxyacanthoides subsp irriguum andtaxa excluded from ETS1ITS analysis) generated 3080trees (length 5 719 CI5080 074 excluding uninfor-mative characters RI5085) Sects Grossularioides Calo-botrya Grossularia and the glabrous-styled gooseberries

90 [Volume 29SYSTEMATIC BOTANY

(Hesperia Lobbia Robsonia) were each strongly support-ed and again formed a strongly supported clade nestedin Ribes (Fig 8) Support for the monophyly of subgGrossularia was increased relative to support seen withany individual dataset (Figs 2 3 8)

Combinability (p5012) of all datasets for those taxarepresented in three of the four datasets required ex-clusion of composite taxa problematic within therDNA dataset as well as exclusion of taxa problematicfor the chloroplast versus rDNA datasets Combinedanalyses generated 4802 trees (length5768 CI5080074 excluding uninformative characters RI5085)Sec-tion Calobotrya sect Grossularia and the glabrous-styled gooseberries (Hesperia Lobbia Robsonia) exclud-ing R watsonianum were each well supported and to-gether formed a strongly supported clade (Fig 9) Sub-genus Grossularia was resolved as monophyleticbearing in mind that sect Grossularioides was excludedfrom the analyses

While all combined datasets resolved the clade con-taining sects Calobotrya Grossularioides and subgGrossularia as nested within Ribes (Figs 4ndash9) relation-ships among other lineages were unclear as in theanalyses of individual datasets (Figs 2 3) Basal rela-tionships were unresolved in the analyses of combinedchloroplast data (Fig 4) The combined ETS and psbA-trnH analyses suggested basal positions for goldencurrants (sect Symphocalyx) (Fig 7) All remaininganalyses suggested basal positions for sects Berisiaand Ribes (Figs 5 6 8 9) Basal relationships were notwell-supported in any analysis

Kishino-Hasegawa Tests Trees generated fromanalyses constraining the monophyly of subg Gros-sularia versus trees constrained to resolve a sister re-lationship between sect Grossularioides and sect Gros-sularia were marginally but signicantly different inboth the chloroplast (p5003) and the rDNA (p5005)datasets

Ancestral Area Reconstructions DIVA reconstruc-tions of ancestral areas support a western North Amer-ican origin for a large segment of Ribes beginningwith node 2 in Fig 8 Within this clade it is also thecase that subg Grossularia is inferred to have diversi-ed rst within western North America (Fig 8 node6) Subsequent movement to eastern Asia is inferred tohave occurred somewhere within sect Grossularia butthe ancestral area for the true gooseberries is equivo-cal and can include virtually any combination of areasdepending on the exact resolution of the large poly-tomy at the base of this clade (Fig 8 node 8) Impor-tantly our results indicate that the Asian species with-in sect Grossularia form a clade implying a single mi-gration from North America to Asia The ancestralarea for Ribes is reconstructed to be western NorthAmerica and western Eurasia or western North Amer-ica and all of Eurasia (Fig 8 node 1) However this

result hinges on resolution at the base which remainshighly uncertain and requires more intensive samplingof Ribes lineages outside of subg Grossularia

DISCUSSION

Gooseberry Monophyly Results from previousphylogenetic analyses based on nuclear 18Sndash26S rDNAITS data (Senters and Soltis 2003) and chloroplast re-striction site data (Messinger et al 1999) differed re-garding gooseberry monophyly Adding the additionalnuclear 18Sndash26S rDNA ETS and chloroplast psbA-trnHdatasets could increase support and resolution in re-sulting topologies or could reinforce the differencesbetween the nuclear and chloroplast topologies witheach reecting accurate but separate histories

Initial examination of the trees produced with theadditional datasets reinforced the apparent conict be-tween nuclear and chloroplast genomes ITS ETS andcombined rDNA datasets supported the monophyly ofsubg Grossularia (Figs 1 2 5) In contrast the com-bined chloroplast datasets (restriction sites plus psbA-trnH) suggested a closer relationship between the trueand glabrous-styled gooseberries than did the restric-tion site data alone (Fig 1 Messinger et al 1999) butstill resolved subg Grossularia as non-monophyleticwith sect Grossularioidies forming a grade at the baseof sect Grossularia (Fig 4) The increase in tree lengthwhen combined chloroplast data was constrained toresolve a monophyletic subg Grossularia (p5003) orwhen combined rDNA data was constrained to resolvesects Grossularioides and Grossularia as a clade(p5005) also indicated dataset incongruence

The discrepancy between nuclear and chloroplast to-pologies primarily involved the restriction sites datasetand not the psbA-trnH dataset The psbA-trnH datasetprovided little resolution (Fig 3) conicting with nei-ther the rDNA nor the restriction sites topologiesAnalyses combining the psbA-trnH data with either theETS data (p5004 Fig 7) or the rDNA data (p5002Fig 8) produced trees resolving subg Grossularia asmonophyletic with increased support relative to ETSor rDNA data alone (Figs 2 5) Section Grossularioideswas either sister to subg Grossularia (psbA-trnH 1rDNA Fig 8) or was unresolved in a polytomy withsubg Grossularia and sect Calobotrya (psbA-trnH 1ETS Fig 7) The monophyly of subg Grossularia wasalso supported by analyses of all datasets combinedwhether including taxa represented in all four datasets(p5075 Fig 6) or in three of the four datasets(p5012 Fig 9) Analyses combining all datasets re-quired exclusion of sect Grossularioides thus leavingsubg Grossularia monophyly uncertain However in-cluding sect Grossulariodes in spite of dataset incon-gruence (p5001) produced trees resolving a mono-phyletic subg Grossularia sister to a monophyletic sectGrossularioides (not shown)

2004] 91SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 8 The strict consensus of 3080 trees resulting from analyses of combined psbA-trnH and rDNA data (CI 5 080 074excluding uninformative characters RI 5 085) Dataset combinability was determined by partition homogeneity tests (p5002)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared DIVA (Ronquist 1996)was used to infer ancestral areas at the numbered nodes The ancestral areas at nodes two through seven were reconstructedas western North America Node one was reconstructed as western North America plus either western Eurasia or all of EurasiaThere were multiple possible reconstructions at node 8 including (1) western North America and eastern Eurasia (2) NorthAmerica and eastern Eurasia (3) North America or (4) western North America

92 [Volume 29SYSTEMATIC BOTANY

FIG 9 The strict consensus of 4802 trees resulting from analyses of all four datasets (ITS ETS psbA-trnH chloroplastrestriction sites) including taxa represented in at least three datasets (CI5080 074 excluding uninformative charactersRI5085) Dataset combinability was determined using partition homogeneity tests (p5012) Numbers above the branchesindicate the percentage of bootstrap replicates in which the clade appeared

2004] 93SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

The general picture that emerges from these analy-ses suggests that subg Grossularia is monophyletic(Figs 2 5ndash9) rDNA data supported gooseberry mono-phyly (Figs 2 5) psbA-trnH data while lacking suf-cient variation to resolve gooseberry monophyly ornon-monophyly supported gooseberry monophyly incombination with rDNA data (Figs 7 8) Finally anal-yses of all datasets combined supported gooseberrymonophyly although these analyses excluded thespiny currants (sect Grossularioides) (Figs 6 9) Whatrequires further investigation is the role hybridizationmay have played in the history of the spiny currants(sect Grossularioides) and the true gooseberries (sectGrossularia) Messinger et al (1999) encouraged furtherexploration of this possibility in Ribes in which theynoted potential chloroplast capture of the sect Gros-sularia chloroplast type by sect Grossularioides Crosseshave not been successful between species of sect Gros-sularioides and other sections within Ribes and are usu-ally unsuccessful between sections or subgenera (Keep1962) Conrmation of the pattern seen in trees gen-erated from the chloroplast restriction site data (Mes-singer et al 1999) is needed from additional chloro-plast datasets that provide greater resolution than didthe psbA-trnH dataset

Relationships Within the Gooseberries SubgenusGrossularia comprises two main lineages (Figs 2 5ndash9)the true gooseberries (sect Grossularia) and a clade ofglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) The four gooseberry sections are traditionally dis-tinguished from each other by basally pubescent stylesin sect Grossularia (with the exception of some Asianspecies) by four versus ve parted owers in sect Rob-sonia by anthers broader at the base in subg Hesperiaand by the absence of the above set of features in subgLobbia The glabrous-styled gooseberry lineage com-prising 27 species distributed through western NorthAmerica into Mexico (Berger 1924) was well-support-ed given our sampling but sections within this lineagewere not resolved Ribes watsonianum (subg Lobbia)was surprisingly placed outside of the glabrous-styledgooseberry lineage as sister to the true gooseberries(Figs 2 5 7ndash9) ITS data resolved R watsonianum with-in the glabrous-styled gooseberry lineage (Senters andSoltis 2003) but ETS data strongly resolved the specieswithin the true gooseberry lineage (sect Grossularia)(Fig 2) This conict within the rDNA data may reecthybridization between R watsonianum and a memberof sect Grossularia followed by xation within the Rwatsonianum genome of a recombinant rDNA repeattype Accounts of Ribes hybrids in the eld are rela-tively rare (Messler et al 1991) and do not implicateR watsonianum but fertile hybrids can be obtainedfrom articial crosses between glabrous-styled goose-berries and true gooseberries (Keep 1962 citing R lob-bii 3 R divaricatum) Alternatively R watsonianum may

posses multiple rDNA repeat types with different re-peat types sampled in our ITS versus ETS datasetsEach of these possibilities has been reported in otherplant taxa (Wendel et al 1995a Campbell et al 1997for potential recombinant rDNA repeat types Suh etal 1993 Wendel et al 1995b for incomplete homoge-nization of rDNA repeat types)

The true gooseberries (sect Grossularia) have a broadrange throughout the northern hemisphere with ninespecies in North America (Sinnott 1985) and seven spe-cies in Eurasia (Berger 1924) In his treatment of NorthAmerican gooseberries Sinnott (1985) divided his ninespecies into ve groups based on phenetic analysesThe groups consisted of (1) R cynosbati with spinyfruits (2) R niveum R curvatum and R missouriensewith highly exserted stamens and long sepals (3) Rrotundifolium and R divaricatum with medium lengthstamens and purple sepals (4) R inerme and R hirtel-lum with intermediate length stamens and small oralfeatures and (5) the ve subspecies of R oxyacanthoi-des with short stamens Sinnott (1985) recommendedthat R echinellum be excluded from the true gooseber-ries and aligned with the glabrous-styled gooseberriesof western North America (Hesperia Lobbia Robsonia)The analyses presented here showed strong supportfor the inclusion of R echinellum as well as the Eurasianspecies within the true gooseberry lineage (Figs 2ndash35 7ndash9) Resolution among the North American specieswas lacking or not well-supported (Figs 2ndash9) and thusneither supported nor conicted with Sinnottrsquos hy-pothesized relationships

The seven Eurasian species of sect Grossularia (Ber-ger 1924) include R uvacrispa in Europe R alpestre andR aciculare in the Himalayan region R stenocarpumand R formosanum in southern and eastern Asia andR burejense and R grossularioides in northern and east-ern Asia A clade of Asian species is well-supported(Figs 2 5 7ndash9) with possible inclusion of R uvacrispa(Figs 2 7) The psbA-trnH dataset includes R oxyacan-thoides subsp irriguum within the Asian clade (Fig 3)but this is weakly supported (Fig 3) and requires fur-ther substantiation particularly since R oxyacanthoidessubsp irriguum is restricted to northwestern NorthAmerica and may itself be of hybrid origin from cross-es between R oxyacanthoides subsp setosum and R in-erme (Sinnott 1985) both distributed in western NorthAmerica Resolution within the clade of Asian speciessuggests a correspondance to geographic and oristicregions within Asia Whether the Asian and NorthAmerican true gooseberries represent divergent line-ages or a monophyletic Asian clade nested within aNorth American grade is unclear given the availabledata

Other Groups within Ribes Since this study fo-cused on the gooseberries sampling within other sec-tions of Ribes was sometimes limited Nevertheless the

94 [Volume 29SYSTEMATIC BOTANY

data did support the monophyly of sects CalobotryaParilla Symphocalyx and Berisia Section Calobotrya is agroup of 21 western North American species (Berger1924) known as the ornamental currants The mono-phyly of sect Calobotrya was well-supported with theinclusion of some dwarf currants (sect Heritieria) (Figs2ndash9 Messinger et al 1999 Senters and Soltis 2003)Sampling was limited in sect Parilla a group of 41dioecious South American species (Janczewski 1907)but the group was supported in ITS trees excludingthe east Asian R fasciculatum the sectionrsquos only non-South American species (Senters and Soltis 2003) Apossible sister relationship between sect Parilla andsect Calobotrya (unpubl data cited in Weigend andBinder 2001) is consistent with the position of sect Pa-rilla seen with ITS data (Senters and Soltis 2003) Sec-tion Symphocalyx the golden currants includes vespecies distributed through northern Mexico and cen-tral and western North America (Berger 1924) Thegolden currants were well-supported given the avail-able sampling (Fig 2 4 9) The alpine currants sectBerisia are a group of 17 dioecious species distributedthrough Eurasia (Janczewski 1907) The monophyly ofsect Berisia was well-supported (Figs 2ndash9 Messingeret al 1999) but with the inclusion of some red currants(sect Ribes) in ITS trees (Senters and Soltis 2003)

The monophyly of sects Ribes and Coreosma wasquestionable (Figs 2 3 5) The red currants (sect Ri-bes) are a group of 15 Eurasian species with one spe-cies R triste also distributed in North America Sec-tion Coreosma the black currants includes six speciesin North America and six in Eurasia (Berger 1924) Sec-tion Heritiera the dwarf currants appeared to be poly-phyletic as seen in Messinger et al (1999) and Sentersand Soltis (2003) This group of six species (Berger1924) is dened primarily by a prostrate habit and assuggested by Messinger et al (1999) is likely a case ofconvergence

Biogeography The spread of taxa around theNorthern Hemisphere has been facilitated by the avail-ability at various times of two major migrationroutesmdashthe Beringian and the North Atlantic landbridges (Tiffney 1985a 1985b Donoghue et al 2001SanmartDaggern et al 2001) Especially in large and relative-ly old clades which have become widespread aroundthe Northern Hemisphere it is possible (perhaps evenlikely) that both pathways were used Information onthe timing of key divergences and on the direction ofmovement within subclades will be critical in sortingout the possibilities in particular cases Ribes providesan excellent example of such a group being represent-ed in Eurasia by six sections (Berisia Ribes and somespecies from Heritiera Coreosma Grossularioides andGrossularia) in western North America by nine (Sym-phocalyx Calobotrya Robsonia Hesperia Lobbia andsome species of Coreosma Heritiera Grossularioides and

Grossularia) and in eastern North America by three(some species of Heritiera Ribes and Grossularia) Oneapproach for sorting through a complex biogeographichistory as might be expected in Ribes is to examinephylogenetic patterns in component clades and ide-ally to date divergences

Our analyses indicate that subg Grossularia is nestedwithin a predominantly western North Americanclade (Figs 2 5ndash9) and that it diversied initially inthat region (Fig 8 node 6) Subsequently within sectGrossularia it appears that movement occurred fromwestern North America to eastern Asia presumablythrough Beringia followed by vicariance and the ori-gin and diversication of the well-supported Asiangooseberry clade Donoghue et al (2001) and Xiangand Soltis (2001) highlighted cases of movement out ofAsia into North America through the Bering LandBridge Ribes appears to provide a case of movementin the opposite direction Movement in both directionsis of course to be expected What remains to be de-termined in future studies of disjunct taxa is exactlywhich groups moved in which directions and whetherthere are any signicant generalizations that can bemade about these different patterns

Elsewhere in Ribes there are other possible cases ofmovement between North America and Asia One caseinvolves R lacustre of sect Grossularioides which is dis-tributed in eastern Asia as well as in North AmericaOther possible cases relate to resolution at the base ofRibes where relationships remain uncertain The basalpositions of sect Symphocalyx in trees resulting frompsbA-trnH data and from the combination of psbA-trnHand ETS data suggest a western North American ori-gin for the entire clade (Figs 2 7) This would implyearly dispersion to Asia giving rise to sects Berisiaand Ribes However all other datasets and dataset com-binations suggested a broader Eurasian plus westernNorth American distribution at the base (Fig 8 node1) owing to the basal positions of sects Berisia andRibes This would imply early vicariance involvingAsia and North America and movement back to Asiawithin the western North American clade Future stud-ies should include more sampling of sects Berisia Ri-bes Coreosma and Symphocalyx to help resolve basal re-lationships and biogeographic patterns in Ribes

The fossil record for Ribes consists largely of leaveswith few reports of seeds (Kremenetski 1998) fruits(Cevallos-Ferriz 1995) and owers (Gandolfo et al1998) The leaf record for Ribes in North America mayextend from approximately 2 mya (Hannibal 1911Dorf 1930 Axelrod 1966) to at least 345 mya (Mac-Ginitie 1953 Manchester 2001) and possibly to 45 or50 mya (Axelrod 1998 Wehr and Hopkins 1994) Al-though leaf features are seldom used to distinguishextant taxa of Ribes Wolfe (1964) used leaf serrationand venation features to distinguish between fossil

2004] 95SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

leaves of subg Ribes and subg Grossularia from Ne-vada If these features are reliable this dates subgGrossularia to at least 14 mya (Fig 9 node 6) A criticalnext step in understanding Ribes biogeography will beto accurately assign Ribes fossils to particular sub-clades so as to infer the timing of intercontinental di-vergences

ACKNOWLEDGEMENTS We thank the following individuals andinstitutions for providing plant material B Alverson D BouffordR Mitchell Arnold Arboretum of Harvard University Universityof California Botanical Garden Royal Botanic Garden EdinburghNew York Botanical Garden and the USDA-ARS National PlantGermplasm Repository A Senters and D Soltis graciously pro-vided numerous DNA aliquots DNA sequences and access to ear-ly manuscripts H Schorn and D Erwin provided assistance withpaleobotanical literature M Lavin P Herendeen and two anon-ymous reviewers provided numerous helpful comments This proj-ect was supported in part by a Putnam Fellowship through theArnold Arboretum of Harvard University

LITERATURE CITED

AVISE J C 1994 Molecular markers natural history and evolutionNew York Chapman amp Hall

AXELROD D I 1966 The Pleistocene Soboba ora of southern Califor-nia University of California Publications in Geological Sci-ences 60

mdashmdashmdash 1998 Thunder Mountain Idaho University of CaliforniaPublications in Geological Sciences 142

BALDWIN B G and S MARKOS 1998 Phylogenetic utility of theexternal transcribed spacer (ETS) of 18Sndash26S rDNA Congru-ence of ETS and ITS trees of Calycadenia (Compositae) Mo-lecular Phylogenetics and Evolution 10 449ndash463

mdashmdashmdash M J SANDERSON J M PORTER M F WOJCIECHOWSKI CS CAMPBELL and M J DONOGHUE 1995 The ITS region ofnuclear ribosomal DNA a valuable source of evidence onangiosperm phylogeny Annals of the Missouri Botanical Garden82 247ndash277

BEARD K H 1998 East of Eden Asia as an important center oftaxonomic origination in mammalian evolution Bulletin of theCarnegie Museum of Natural History 34 5ndash39

BENA G M F JUBIER I OLIVIERI and B LEJEUNE 1998 Ribosom-al external and internal transcribed spacers combined use inthe phylogenetic analysis of Medicago (Leguminosae) Journal ofMolecular Evolution 46 299ndash306

BERGER A 1924 A taxonomic review of currants and gooseberriesNew York Agricultural Experimental Station Technical Bulletin109 1ndash118

BOUFFORD D E and S A SPONGBERG 1983 Eastern Asia-EasternNorth American phytogeographical relationships-a historyfrom the time of Linnaeus to the twentieth century Annalsof the Missouri Botanical Garden 70 423ndash439

CAMPBELL C S M F WOJCIECHOWSKI B G BALDWIN L A AL-ICE and M J DONOGHUE 1997 Persistent nuclear ribosomalDNA sequence polymorphism in the Amelanchier agamiccomplex (Rosaceae) Molecular Biology and Evolution 14 81ndash90

CEVALLOS-FERRIZ S R S 1995 Fruits of Ribes from the Princetonchert British Columbia Canada American Journal of Botany82(6 supplement) 84

COVILLE F V and N L BRITTON 1908 Grossulariaceae NorthAmer-ican Flora 22 193ndash225

CUNNINGHAM C W 1997 Can three incongruence tests predictwhen data shold be combined Molecular Biology and Evolution14 733ndash740

DEQUEIROZ A M J DONOGHUE and J KIM 1995 Separate versuscombined analysis of phylogenetic evidence Annual Review ofEcology and Systematics 26 657ndash681

DONOGHUE M J C D BELL and J LI 2001 Phylogenetic patternsin northern hemisphere plant geography International Journalof Plant Sciences 162 S41ndashS52

DORF E 1930 Pliocene oras of California Carnegie Institution ofWashington Publication 412

FARRIS J S M KALLERSJO A G KLUGE and C BULT 1995 Test-ing signicance of incongruence Cladistics 10 315ndash319

FELSENSTEIN J 1985 Condence limits on phylogenies an ap-proach using the bootstrap Evolution 39 783ndash791

FENTON B A N E BIRCH G MALLOCH P G LANHAM and RM BRENNAN 2000 Gall mite molecular phylogeny and itsrelationship to the evolution of plant host specicity AppliedAcarology 24 831ndash861

FRITSCH P W C M MORTON T CHEN and C MELDRUM 2001Phylogeny and biogeography of the Styracaceae InternationalJournal of Plant Sciences 162 S95ndashS116

GANDOLFO M A P HOC S N SANTILLANA and S A MARENSSI1998 Una or fosil morfologicamente afDaggern a las Grossulari-aceae (orden Rosales) de la Formacion la Meseta (Eoceno me-dio) Isla Marambio Antartida Asociacion Paleontologica Argen-tina Publicacion Especial 5 Paleogeno de America del Sur y de laPenDaggernsula Antartica 147ndash153

GOLDMAN N J P ANDERSON and A G RODRIGO 2000 Likeli-hood-based tests of topologies in phylogenetics SystematicBiology 49 652ndash670

HANNIBAL H 1911 A Pliocene ora from the Coast Ranges ofCalifornia Bulletin of the Torrey Botanical Club 38 329ndash342

HUELSENBECK J P J J BULL and C W CUNNINGHAM 1996 Com-binined data in phylogenetic analysis Trends in Ecology andEvolution 11 152ndash158

JANCZEWSKI M E 1907 Monographies des groseilliers Ribes LMemoires Societe de Physique et DrsquoHistoire Naturelle de Geneve35 199ndash517

KEEP E 1962 Interspecic hybridization in Ribes Genetica 33 1ndash23

KISHINO H and M HASEGAWA 1989 Evaluation of the maximumlikelihood estimate of the evolutionary tree topologies fromDNA sequence data and the branching order in HominoideaJournal of Molecular Evolution 29 170ndash179

KREMENETSKI C V 1998 Holocene history of the northern rangelimits of some trees and shrubs in Russia Arctic and AlpineResearch 30 317ndash333

LINDER C R L R GOERTZEN B V HEUVEL J FRANCISCO-OR-TEGA and R K JANSEN 2000 The complete external tran-scribed spacer of 18Sndash26S rDNA amplication and phylo-genetic utility at low taxonomic levels in Asteraceae andclosely allied families Molecular Phylogenetics and Evolution 14285ndash303

MACGINITIE D 1953 Fossil plants of the Florissant beds ColoradoCarnegie Institution of Washington Publication 599

MADDISON D R and W P MADDISON 2000 MacClade 4 Sun-derland Sinauer Associates

MANCHESTER S R 1999 Biogeographical relationships of NorthAmerican Tertiary oras Annals of the Missouri Botanical Gar-den 86 472ndash522

mdashmdashmdash 2001 Update on the megafossil ora of Florissant Colo-rado Proceedings of the Denver Museum of Nature amp ScienceSeries 4 No1 137

MANOS P S and M J DONOGHUE 2001 Progress in northernhemisphere phytogeography an introduction InternationalJournal of Plant Sciences 162 S1ndashS2

mdashmdashmdash and A M STANFORD 2001 The historical biogeography ofFagaceae tracking the tertiary history of temperate and sub-tropical forests of the northern hemisphere International Jour-nal of Plant Sciences 162 S77ndashS93

MAST A R and T J GIVNISH 2002 Historical biogeography andthe origin of stomatal distributions in Banksia and Dryandra(Proteaceae) based on their cpDNA phylogeny American Jour-nal of Botany 89 1311ndash1323

MESSINGER W K HUMMER and A LISTON 1999 Ribes (Grossu-

90 [Volume 29SYSTEMATIC BOTANY

(Hesperia Lobbia Robsonia) were each strongly support-ed and again formed a strongly supported clade nestedin Ribes (Fig 8) Support for the monophyly of subgGrossularia was increased relative to support seen withany individual dataset (Figs 2 3 8)

Combinability (p5012) of all datasets for those taxarepresented in three of the four datasets required ex-clusion of composite taxa problematic within therDNA dataset as well as exclusion of taxa problematicfor the chloroplast versus rDNA datasets Combinedanalyses generated 4802 trees (length5768 CI5080074 excluding uninformative characters RI5085)Sec-tion Calobotrya sect Grossularia and the glabrous-styled gooseberries (Hesperia Lobbia Robsonia) exclud-ing R watsonianum were each well supported and to-gether formed a strongly supported clade (Fig 9) Sub-genus Grossularia was resolved as monophyleticbearing in mind that sect Grossularioides was excludedfrom the analyses

While all combined datasets resolved the clade con-taining sects Calobotrya Grossularioides and subgGrossularia as nested within Ribes (Figs 4ndash9) relation-ships among other lineages were unclear as in theanalyses of individual datasets (Figs 2 3) Basal rela-tionships were unresolved in the analyses of combinedchloroplast data (Fig 4) The combined ETS and psbA-trnH analyses suggested basal positions for goldencurrants (sect Symphocalyx) (Fig 7) All remaininganalyses suggested basal positions for sects Berisiaand Ribes (Figs 5 6 8 9) Basal relationships were notwell-supported in any analysis

Kishino-Hasegawa Tests Trees generated fromanalyses constraining the monophyly of subg Gros-sularia versus trees constrained to resolve a sister re-lationship between sect Grossularioides and sect Gros-sularia were marginally but signicantly different inboth the chloroplast (p5003) and the rDNA (p5005)datasets

Ancestral Area Reconstructions DIVA reconstruc-tions of ancestral areas support a western North Amer-ican origin for a large segment of Ribes beginningwith node 2 in Fig 8 Within this clade it is also thecase that subg Grossularia is inferred to have diversi-ed rst within western North America (Fig 8 node6) Subsequent movement to eastern Asia is inferred tohave occurred somewhere within sect Grossularia butthe ancestral area for the true gooseberries is equivo-cal and can include virtually any combination of areasdepending on the exact resolution of the large poly-tomy at the base of this clade (Fig 8 node 8) Impor-tantly our results indicate that the Asian species with-in sect Grossularia form a clade implying a single mi-gration from North America to Asia The ancestralarea for Ribes is reconstructed to be western NorthAmerica and western Eurasia or western North Amer-ica and all of Eurasia (Fig 8 node 1) However this

result hinges on resolution at the base which remainshighly uncertain and requires more intensive samplingof Ribes lineages outside of subg Grossularia

DISCUSSION

Gooseberry Monophyly Results from previousphylogenetic analyses based on nuclear 18Sndash26S rDNAITS data (Senters and Soltis 2003) and chloroplast re-striction site data (Messinger et al 1999) differed re-garding gooseberry monophyly Adding the additionalnuclear 18Sndash26S rDNA ETS and chloroplast psbA-trnHdatasets could increase support and resolution in re-sulting topologies or could reinforce the differencesbetween the nuclear and chloroplast topologies witheach reecting accurate but separate histories

Initial examination of the trees produced with theadditional datasets reinforced the apparent conict be-tween nuclear and chloroplast genomes ITS ETS andcombined rDNA datasets supported the monophyly ofsubg Grossularia (Figs 1 2 5) In contrast the com-bined chloroplast datasets (restriction sites plus psbA-trnH) suggested a closer relationship between the trueand glabrous-styled gooseberries than did the restric-tion site data alone (Fig 1 Messinger et al 1999) butstill resolved subg Grossularia as non-monophyleticwith sect Grossularioidies forming a grade at the baseof sect Grossularia (Fig 4) The increase in tree lengthwhen combined chloroplast data was constrained toresolve a monophyletic subg Grossularia (p5003) orwhen combined rDNA data was constrained to resolvesects Grossularioides and Grossularia as a clade(p5005) also indicated dataset incongruence

The discrepancy between nuclear and chloroplast to-pologies primarily involved the restriction sites datasetand not the psbA-trnH dataset The psbA-trnH datasetprovided little resolution (Fig 3) conicting with nei-ther the rDNA nor the restriction sites topologiesAnalyses combining the psbA-trnH data with either theETS data (p5004 Fig 7) or the rDNA data (p5002Fig 8) produced trees resolving subg Grossularia asmonophyletic with increased support relative to ETSor rDNA data alone (Figs 2 5) Section Grossularioideswas either sister to subg Grossularia (psbA-trnH 1rDNA Fig 8) or was unresolved in a polytomy withsubg Grossularia and sect Calobotrya (psbA-trnH 1ETS Fig 7) The monophyly of subg Grossularia wasalso supported by analyses of all datasets combinedwhether including taxa represented in all four datasets(p5075 Fig 6) or in three of the four datasets(p5012 Fig 9) Analyses combining all datasets re-quired exclusion of sect Grossularioides thus leavingsubg Grossularia monophyly uncertain However in-cluding sect Grossulariodes in spite of dataset incon-gruence (p5001) produced trees resolving a mono-phyletic subg Grossularia sister to a monophyletic sectGrossularioides (not shown)

2004] 91SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 8 The strict consensus of 3080 trees resulting from analyses of combined psbA-trnH and rDNA data (CI 5 080 074excluding uninformative characters RI 5 085) Dataset combinability was determined by partition homogeneity tests (p5002)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared DIVA (Ronquist 1996)was used to infer ancestral areas at the numbered nodes The ancestral areas at nodes two through seven were reconstructedas western North America Node one was reconstructed as western North America plus either western Eurasia or all of EurasiaThere were multiple possible reconstructions at node 8 including (1) western North America and eastern Eurasia (2) NorthAmerica and eastern Eurasia (3) North America or (4) western North America

92 [Volume 29SYSTEMATIC BOTANY

FIG 9 The strict consensus of 4802 trees resulting from analyses of all four datasets (ITS ETS psbA-trnH chloroplastrestriction sites) including taxa represented in at least three datasets (CI5080 074 excluding uninformative charactersRI5085) Dataset combinability was determined using partition homogeneity tests (p5012) Numbers above the branchesindicate the percentage of bootstrap replicates in which the clade appeared

2004] 93SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

The general picture that emerges from these analy-ses suggests that subg Grossularia is monophyletic(Figs 2 5ndash9) rDNA data supported gooseberry mono-phyly (Figs 2 5) psbA-trnH data while lacking suf-cient variation to resolve gooseberry monophyly ornon-monophyly supported gooseberry monophyly incombination with rDNA data (Figs 7 8) Finally anal-yses of all datasets combined supported gooseberrymonophyly although these analyses excluded thespiny currants (sect Grossularioides) (Figs 6 9) Whatrequires further investigation is the role hybridizationmay have played in the history of the spiny currants(sect Grossularioides) and the true gooseberries (sectGrossularia) Messinger et al (1999) encouraged furtherexploration of this possibility in Ribes in which theynoted potential chloroplast capture of the sect Gros-sularia chloroplast type by sect Grossularioides Crosseshave not been successful between species of sect Gros-sularioides and other sections within Ribes and are usu-ally unsuccessful between sections or subgenera (Keep1962) Conrmation of the pattern seen in trees gen-erated from the chloroplast restriction site data (Mes-singer et al 1999) is needed from additional chloro-plast datasets that provide greater resolution than didthe psbA-trnH dataset

Relationships Within the Gooseberries SubgenusGrossularia comprises two main lineages (Figs 2 5ndash9)the true gooseberries (sect Grossularia) and a clade ofglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) The four gooseberry sections are traditionally dis-tinguished from each other by basally pubescent stylesin sect Grossularia (with the exception of some Asianspecies) by four versus ve parted owers in sect Rob-sonia by anthers broader at the base in subg Hesperiaand by the absence of the above set of features in subgLobbia The glabrous-styled gooseberry lineage com-prising 27 species distributed through western NorthAmerica into Mexico (Berger 1924) was well-support-ed given our sampling but sections within this lineagewere not resolved Ribes watsonianum (subg Lobbia)was surprisingly placed outside of the glabrous-styledgooseberry lineage as sister to the true gooseberries(Figs 2 5 7ndash9) ITS data resolved R watsonianum with-in the glabrous-styled gooseberry lineage (Senters andSoltis 2003) but ETS data strongly resolved the specieswithin the true gooseberry lineage (sect Grossularia)(Fig 2) This conict within the rDNA data may reecthybridization between R watsonianum and a memberof sect Grossularia followed by xation within the Rwatsonianum genome of a recombinant rDNA repeattype Accounts of Ribes hybrids in the eld are rela-tively rare (Messler et al 1991) and do not implicateR watsonianum but fertile hybrids can be obtainedfrom articial crosses between glabrous-styled goose-berries and true gooseberries (Keep 1962 citing R lob-bii 3 R divaricatum) Alternatively R watsonianum may

posses multiple rDNA repeat types with different re-peat types sampled in our ITS versus ETS datasetsEach of these possibilities has been reported in otherplant taxa (Wendel et al 1995a Campbell et al 1997for potential recombinant rDNA repeat types Suh etal 1993 Wendel et al 1995b for incomplete homoge-nization of rDNA repeat types)

The true gooseberries (sect Grossularia) have a broadrange throughout the northern hemisphere with ninespecies in North America (Sinnott 1985) and seven spe-cies in Eurasia (Berger 1924) In his treatment of NorthAmerican gooseberries Sinnott (1985) divided his ninespecies into ve groups based on phenetic analysesThe groups consisted of (1) R cynosbati with spinyfruits (2) R niveum R curvatum and R missouriensewith highly exserted stamens and long sepals (3) Rrotundifolium and R divaricatum with medium lengthstamens and purple sepals (4) R inerme and R hirtel-lum with intermediate length stamens and small oralfeatures and (5) the ve subspecies of R oxyacanthoi-des with short stamens Sinnott (1985) recommendedthat R echinellum be excluded from the true gooseber-ries and aligned with the glabrous-styled gooseberriesof western North America (Hesperia Lobbia Robsonia)The analyses presented here showed strong supportfor the inclusion of R echinellum as well as the Eurasianspecies within the true gooseberry lineage (Figs 2ndash35 7ndash9) Resolution among the North American specieswas lacking or not well-supported (Figs 2ndash9) and thusneither supported nor conicted with Sinnottrsquos hy-pothesized relationships

The seven Eurasian species of sect Grossularia (Ber-ger 1924) include R uvacrispa in Europe R alpestre andR aciculare in the Himalayan region R stenocarpumand R formosanum in southern and eastern Asia andR burejense and R grossularioides in northern and east-ern Asia A clade of Asian species is well-supported(Figs 2 5 7ndash9) with possible inclusion of R uvacrispa(Figs 2 7) The psbA-trnH dataset includes R oxyacan-thoides subsp irriguum within the Asian clade (Fig 3)but this is weakly supported (Fig 3) and requires fur-ther substantiation particularly since R oxyacanthoidessubsp irriguum is restricted to northwestern NorthAmerica and may itself be of hybrid origin from cross-es between R oxyacanthoides subsp setosum and R in-erme (Sinnott 1985) both distributed in western NorthAmerica Resolution within the clade of Asian speciessuggests a correspondance to geographic and oristicregions within Asia Whether the Asian and NorthAmerican true gooseberries represent divergent line-ages or a monophyletic Asian clade nested within aNorth American grade is unclear given the availabledata

Other Groups within Ribes Since this study fo-cused on the gooseberries sampling within other sec-tions of Ribes was sometimes limited Nevertheless the

94 [Volume 29SYSTEMATIC BOTANY

data did support the monophyly of sects CalobotryaParilla Symphocalyx and Berisia Section Calobotrya is agroup of 21 western North American species (Berger1924) known as the ornamental currants The mono-phyly of sect Calobotrya was well-supported with theinclusion of some dwarf currants (sect Heritieria) (Figs2ndash9 Messinger et al 1999 Senters and Soltis 2003)Sampling was limited in sect Parilla a group of 41dioecious South American species (Janczewski 1907)but the group was supported in ITS trees excludingthe east Asian R fasciculatum the sectionrsquos only non-South American species (Senters and Soltis 2003) Apossible sister relationship between sect Parilla andsect Calobotrya (unpubl data cited in Weigend andBinder 2001) is consistent with the position of sect Pa-rilla seen with ITS data (Senters and Soltis 2003) Sec-tion Symphocalyx the golden currants includes vespecies distributed through northern Mexico and cen-tral and western North America (Berger 1924) Thegolden currants were well-supported given the avail-able sampling (Fig 2 4 9) The alpine currants sectBerisia are a group of 17 dioecious species distributedthrough Eurasia (Janczewski 1907) The monophyly ofsect Berisia was well-supported (Figs 2ndash9 Messingeret al 1999) but with the inclusion of some red currants(sect Ribes) in ITS trees (Senters and Soltis 2003)

The monophyly of sects Ribes and Coreosma wasquestionable (Figs 2 3 5) The red currants (sect Ri-bes) are a group of 15 Eurasian species with one spe-cies R triste also distributed in North America Sec-tion Coreosma the black currants includes six speciesin North America and six in Eurasia (Berger 1924) Sec-tion Heritiera the dwarf currants appeared to be poly-phyletic as seen in Messinger et al (1999) and Sentersand Soltis (2003) This group of six species (Berger1924) is dened primarily by a prostrate habit and assuggested by Messinger et al (1999) is likely a case ofconvergence

Biogeography The spread of taxa around theNorthern Hemisphere has been facilitated by the avail-ability at various times of two major migrationroutesmdashthe Beringian and the North Atlantic landbridges (Tiffney 1985a 1985b Donoghue et al 2001SanmartDaggern et al 2001) Especially in large and relative-ly old clades which have become widespread aroundthe Northern Hemisphere it is possible (perhaps evenlikely) that both pathways were used Information onthe timing of key divergences and on the direction ofmovement within subclades will be critical in sortingout the possibilities in particular cases Ribes providesan excellent example of such a group being represent-ed in Eurasia by six sections (Berisia Ribes and somespecies from Heritiera Coreosma Grossularioides andGrossularia) in western North America by nine (Sym-phocalyx Calobotrya Robsonia Hesperia Lobbia andsome species of Coreosma Heritiera Grossularioides and

Grossularia) and in eastern North America by three(some species of Heritiera Ribes and Grossularia) Oneapproach for sorting through a complex biogeographichistory as might be expected in Ribes is to examinephylogenetic patterns in component clades and ide-ally to date divergences

Our analyses indicate that subg Grossularia is nestedwithin a predominantly western North Americanclade (Figs 2 5ndash9) and that it diversied initially inthat region (Fig 8 node 6) Subsequently within sectGrossularia it appears that movement occurred fromwestern North America to eastern Asia presumablythrough Beringia followed by vicariance and the ori-gin and diversication of the well-supported Asiangooseberry clade Donoghue et al (2001) and Xiangand Soltis (2001) highlighted cases of movement out ofAsia into North America through the Bering LandBridge Ribes appears to provide a case of movementin the opposite direction Movement in both directionsis of course to be expected What remains to be de-termined in future studies of disjunct taxa is exactlywhich groups moved in which directions and whetherthere are any signicant generalizations that can bemade about these different patterns

Elsewhere in Ribes there are other possible cases ofmovement between North America and Asia One caseinvolves R lacustre of sect Grossularioides which is dis-tributed in eastern Asia as well as in North AmericaOther possible cases relate to resolution at the base ofRibes where relationships remain uncertain The basalpositions of sect Symphocalyx in trees resulting frompsbA-trnH data and from the combination of psbA-trnHand ETS data suggest a western North American ori-gin for the entire clade (Figs 2 7) This would implyearly dispersion to Asia giving rise to sects Berisiaand Ribes However all other datasets and dataset com-binations suggested a broader Eurasian plus westernNorth American distribution at the base (Fig 8 node1) owing to the basal positions of sects Berisia andRibes This would imply early vicariance involvingAsia and North America and movement back to Asiawithin the western North American clade Future stud-ies should include more sampling of sects Berisia Ri-bes Coreosma and Symphocalyx to help resolve basal re-lationships and biogeographic patterns in Ribes

The fossil record for Ribes consists largely of leaveswith few reports of seeds (Kremenetski 1998) fruits(Cevallos-Ferriz 1995) and owers (Gandolfo et al1998) The leaf record for Ribes in North America mayextend from approximately 2 mya (Hannibal 1911Dorf 1930 Axelrod 1966) to at least 345 mya (Mac-Ginitie 1953 Manchester 2001) and possibly to 45 or50 mya (Axelrod 1998 Wehr and Hopkins 1994) Al-though leaf features are seldom used to distinguishextant taxa of Ribes Wolfe (1964) used leaf serrationand venation features to distinguish between fossil

2004] 95SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

leaves of subg Ribes and subg Grossularia from Ne-vada If these features are reliable this dates subgGrossularia to at least 14 mya (Fig 9 node 6) A criticalnext step in understanding Ribes biogeography will beto accurately assign Ribes fossils to particular sub-clades so as to infer the timing of intercontinental di-vergences

ACKNOWLEDGEMENTS We thank the following individuals andinstitutions for providing plant material B Alverson D BouffordR Mitchell Arnold Arboretum of Harvard University Universityof California Botanical Garden Royal Botanic Garden EdinburghNew York Botanical Garden and the USDA-ARS National PlantGermplasm Repository A Senters and D Soltis graciously pro-vided numerous DNA aliquots DNA sequences and access to ear-ly manuscripts H Schorn and D Erwin provided assistance withpaleobotanical literature M Lavin P Herendeen and two anon-ymous reviewers provided numerous helpful comments This proj-ect was supported in part by a Putnam Fellowship through theArnold Arboretum of Harvard University

LITERATURE CITED

AVISE J C 1994 Molecular markers natural history and evolutionNew York Chapman amp Hall

AXELROD D I 1966 The Pleistocene Soboba ora of southern Califor-nia University of California Publications in Geological Sci-ences 60

mdashmdashmdash 1998 Thunder Mountain Idaho University of CaliforniaPublications in Geological Sciences 142

BALDWIN B G and S MARKOS 1998 Phylogenetic utility of theexternal transcribed spacer (ETS) of 18Sndash26S rDNA Congru-ence of ETS and ITS trees of Calycadenia (Compositae) Mo-lecular Phylogenetics and Evolution 10 449ndash463

mdashmdashmdash M J SANDERSON J M PORTER M F WOJCIECHOWSKI CS CAMPBELL and M J DONOGHUE 1995 The ITS region ofnuclear ribosomal DNA a valuable source of evidence onangiosperm phylogeny Annals of the Missouri Botanical Garden82 247ndash277

BEARD K H 1998 East of Eden Asia as an important center oftaxonomic origination in mammalian evolution Bulletin of theCarnegie Museum of Natural History 34 5ndash39

BENA G M F JUBIER I OLIVIERI and B LEJEUNE 1998 Ribosom-al external and internal transcribed spacers combined use inthe phylogenetic analysis of Medicago (Leguminosae) Journal ofMolecular Evolution 46 299ndash306

BERGER A 1924 A taxonomic review of currants and gooseberriesNew York Agricultural Experimental Station Technical Bulletin109 1ndash118

BOUFFORD D E and S A SPONGBERG 1983 Eastern Asia-EasternNorth American phytogeographical relationships-a historyfrom the time of Linnaeus to the twentieth century Annalsof the Missouri Botanical Garden 70 423ndash439

CAMPBELL C S M F WOJCIECHOWSKI B G BALDWIN L A AL-ICE and M J DONOGHUE 1997 Persistent nuclear ribosomalDNA sequence polymorphism in the Amelanchier agamiccomplex (Rosaceae) Molecular Biology and Evolution 14 81ndash90

CEVALLOS-FERRIZ S R S 1995 Fruits of Ribes from the Princetonchert British Columbia Canada American Journal of Botany82(6 supplement) 84

COVILLE F V and N L BRITTON 1908 Grossulariaceae NorthAmer-ican Flora 22 193ndash225

CUNNINGHAM C W 1997 Can three incongruence tests predictwhen data shold be combined Molecular Biology and Evolution14 733ndash740

DEQUEIROZ A M J DONOGHUE and J KIM 1995 Separate versuscombined analysis of phylogenetic evidence Annual Review ofEcology and Systematics 26 657ndash681

DONOGHUE M J C D BELL and J LI 2001 Phylogenetic patternsin northern hemisphere plant geography International Journalof Plant Sciences 162 S41ndashS52

DORF E 1930 Pliocene oras of California Carnegie Institution ofWashington Publication 412

FARRIS J S M KALLERSJO A G KLUGE and C BULT 1995 Test-ing signicance of incongruence Cladistics 10 315ndash319

FELSENSTEIN J 1985 Condence limits on phylogenies an ap-proach using the bootstrap Evolution 39 783ndash791

FENTON B A N E BIRCH G MALLOCH P G LANHAM and RM BRENNAN 2000 Gall mite molecular phylogeny and itsrelationship to the evolution of plant host specicity AppliedAcarology 24 831ndash861

FRITSCH P W C M MORTON T CHEN and C MELDRUM 2001Phylogeny and biogeography of the Styracaceae InternationalJournal of Plant Sciences 162 S95ndashS116

GANDOLFO M A P HOC S N SANTILLANA and S A MARENSSI1998 Una or fosil morfologicamente afDaggern a las Grossulari-aceae (orden Rosales) de la Formacion la Meseta (Eoceno me-dio) Isla Marambio Antartida Asociacion Paleontologica Argen-tina Publicacion Especial 5 Paleogeno de America del Sur y de laPenDaggernsula Antartica 147ndash153

GOLDMAN N J P ANDERSON and A G RODRIGO 2000 Likeli-hood-based tests of topologies in phylogenetics SystematicBiology 49 652ndash670

HANNIBAL H 1911 A Pliocene ora from the Coast Ranges ofCalifornia Bulletin of the Torrey Botanical Club 38 329ndash342

HUELSENBECK J P J J BULL and C W CUNNINGHAM 1996 Com-binined data in phylogenetic analysis Trends in Ecology andEvolution 11 152ndash158

JANCZEWSKI M E 1907 Monographies des groseilliers Ribes LMemoires Societe de Physique et DrsquoHistoire Naturelle de Geneve35 199ndash517

KEEP E 1962 Interspecic hybridization in Ribes Genetica 33 1ndash23

KISHINO H and M HASEGAWA 1989 Evaluation of the maximumlikelihood estimate of the evolutionary tree topologies fromDNA sequence data and the branching order in HominoideaJournal of Molecular Evolution 29 170ndash179

KREMENETSKI C V 1998 Holocene history of the northern rangelimits of some trees and shrubs in Russia Arctic and AlpineResearch 30 317ndash333

LINDER C R L R GOERTZEN B V HEUVEL J FRANCISCO-OR-TEGA and R K JANSEN 2000 The complete external tran-scribed spacer of 18Sndash26S rDNA amplication and phylo-genetic utility at low taxonomic levels in Asteraceae andclosely allied families Molecular Phylogenetics and Evolution 14285ndash303

MACGINITIE D 1953 Fossil plants of the Florissant beds ColoradoCarnegie Institution of Washington Publication 599

MADDISON D R and W P MADDISON 2000 MacClade 4 Sun-derland Sinauer Associates

MANCHESTER S R 1999 Biogeographical relationships of NorthAmerican Tertiary oras Annals of the Missouri Botanical Gar-den 86 472ndash522

mdashmdashmdash 2001 Update on the megafossil ora of Florissant Colo-rado Proceedings of the Denver Museum of Nature amp ScienceSeries 4 No1 137

MANOS P S and M J DONOGHUE 2001 Progress in northernhemisphere phytogeography an introduction InternationalJournal of Plant Sciences 162 S1ndashS2

mdashmdashmdash and A M STANFORD 2001 The historical biogeography ofFagaceae tracking the tertiary history of temperate and sub-tropical forests of the northern hemisphere International Jour-nal of Plant Sciences 162 S77ndashS93

MAST A R and T J GIVNISH 2002 Historical biogeography andthe origin of stomatal distributions in Banksia and Dryandra(Proteaceae) based on their cpDNA phylogeny American Jour-nal of Botany 89 1311ndash1323

MESSINGER W K HUMMER and A LISTON 1999 Ribes (Grossu-

2004] 91SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

FIG 8 The strict consensus of 3080 trees resulting from analyses of combined psbA-trnH and rDNA data (CI 5 080 074excluding uninformative characters RI 5 085) Dataset combinability was determined by partition homogeneity tests (p5002)Numbers above the branches indicate the percentage of bootstrap replicates in which the clade appeared DIVA (Ronquist 1996)was used to infer ancestral areas at the numbered nodes The ancestral areas at nodes two through seven were reconstructedas western North America Node one was reconstructed as western North America plus either western Eurasia or all of EurasiaThere were multiple possible reconstructions at node 8 including (1) western North America and eastern Eurasia (2) NorthAmerica and eastern Eurasia (3) North America or (4) western North America

92 [Volume 29SYSTEMATIC BOTANY

FIG 9 The strict consensus of 4802 trees resulting from analyses of all four datasets (ITS ETS psbA-trnH chloroplastrestriction sites) including taxa represented in at least three datasets (CI5080 074 excluding uninformative charactersRI5085) Dataset combinability was determined using partition homogeneity tests (p5012) Numbers above the branchesindicate the percentage of bootstrap replicates in which the clade appeared

2004] 93SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

The general picture that emerges from these analy-ses suggests that subg Grossularia is monophyletic(Figs 2 5ndash9) rDNA data supported gooseberry mono-phyly (Figs 2 5) psbA-trnH data while lacking suf-cient variation to resolve gooseberry monophyly ornon-monophyly supported gooseberry monophyly incombination with rDNA data (Figs 7 8) Finally anal-yses of all datasets combined supported gooseberrymonophyly although these analyses excluded thespiny currants (sect Grossularioides) (Figs 6 9) Whatrequires further investigation is the role hybridizationmay have played in the history of the spiny currants(sect Grossularioides) and the true gooseberries (sectGrossularia) Messinger et al (1999) encouraged furtherexploration of this possibility in Ribes in which theynoted potential chloroplast capture of the sect Gros-sularia chloroplast type by sect Grossularioides Crosseshave not been successful between species of sect Gros-sularioides and other sections within Ribes and are usu-ally unsuccessful between sections or subgenera (Keep1962) Conrmation of the pattern seen in trees gen-erated from the chloroplast restriction site data (Mes-singer et al 1999) is needed from additional chloro-plast datasets that provide greater resolution than didthe psbA-trnH dataset

Relationships Within the Gooseberries SubgenusGrossularia comprises two main lineages (Figs 2 5ndash9)the true gooseberries (sect Grossularia) and a clade ofglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) The four gooseberry sections are traditionally dis-tinguished from each other by basally pubescent stylesin sect Grossularia (with the exception of some Asianspecies) by four versus ve parted owers in sect Rob-sonia by anthers broader at the base in subg Hesperiaand by the absence of the above set of features in subgLobbia The glabrous-styled gooseberry lineage com-prising 27 species distributed through western NorthAmerica into Mexico (Berger 1924) was well-support-ed given our sampling but sections within this lineagewere not resolved Ribes watsonianum (subg Lobbia)was surprisingly placed outside of the glabrous-styledgooseberry lineage as sister to the true gooseberries(Figs 2 5 7ndash9) ITS data resolved R watsonianum with-in the glabrous-styled gooseberry lineage (Senters andSoltis 2003) but ETS data strongly resolved the specieswithin the true gooseberry lineage (sect Grossularia)(Fig 2) This conict within the rDNA data may reecthybridization between R watsonianum and a memberof sect Grossularia followed by xation within the Rwatsonianum genome of a recombinant rDNA repeattype Accounts of Ribes hybrids in the eld are rela-tively rare (Messler et al 1991) and do not implicateR watsonianum but fertile hybrids can be obtainedfrom articial crosses between glabrous-styled goose-berries and true gooseberries (Keep 1962 citing R lob-bii 3 R divaricatum) Alternatively R watsonianum may

posses multiple rDNA repeat types with different re-peat types sampled in our ITS versus ETS datasetsEach of these possibilities has been reported in otherplant taxa (Wendel et al 1995a Campbell et al 1997for potential recombinant rDNA repeat types Suh etal 1993 Wendel et al 1995b for incomplete homoge-nization of rDNA repeat types)

The true gooseberries (sect Grossularia) have a broadrange throughout the northern hemisphere with ninespecies in North America (Sinnott 1985) and seven spe-cies in Eurasia (Berger 1924) In his treatment of NorthAmerican gooseberries Sinnott (1985) divided his ninespecies into ve groups based on phenetic analysesThe groups consisted of (1) R cynosbati with spinyfruits (2) R niveum R curvatum and R missouriensewith highly exserted stamens and long sepals (3) Rrotundifolium and R divaricatum with medium lengthstamens and purple sepals (4) R inerme and R hirtel-lum with intermediate length stamens and small oralfeatures and (5) the ve subspecies of R oxyacanthoi-des with short stamens Sinnott (1985) recommendedthat R echinellum be excluded from the true gooseber-ries and aligned with the glabrous-styled gooseberriesof western North America (Hesperia Lobbia Robsonia)The analyses presented here showed strong supportfor the inclusion of R echinellum as well as the Eurasianspecies within the true gooseberry lineage (Figs 2ndash35 7ndash9) Resolution among the North American specieswas lacking or not well-supported (Figs 2ndash9) and thusneither supported nor conicted with Sinnottrsquos hy-pothesized relationships

The seven Eurasian species of sect Grossularia (Ber-ger 1924) include R uvacrispa in Europe R alpestre andR aciculare in the Himalayan region R stenocarpumand R formosanum in southern and eastern Asia andR burejense and R grossularioides in northern and east-ern Asia A clade of Asian species is well-supported(Figs 2 5 7ndash9) with possible inclusion of R uvacrispa(Figs 2 7) The psbA-trnH dataset includes R oxyacan-thoides subsp irriguum within the Asian clade (Fig 3)but this is weakly supported (Fig 3) and requires fur-ther substantiation particularly since R oxyacanthoidessubsp irriguum is restricted to northwestern NorthAmerica and may itself be of hybrid origin from cross-es between R oxyacanthoides subsp setosum and R in-erme (Sinnott 1985) both distributed in western NorthAmerica Resolution within the clade of Asian speciessuggests a correspondance to geographic and oristicregions within Asia Whether the Asian and NorthAmerican true gooseberries represent divergent line-ages or a monophyletic Asian clade nested within aNorth American grade is unclear given the availabledata

Other Groups within Ribes Since this study fo-cused on the gooseberries sampling within other sec-tions of Ribes was sometimes limited Nevertheless the

94 [Volume 29SYSTEMATIC BOTANY

data did support the monophyly of sects CalobotryaParilla Symphocalyx and Berisia Section Calobotrya is agroup of 21 western North American species (Berger1924) known as the ornamental currants The mono-phyly of sect Calobotrya was well-supported with theinclusion of some dwarf currants (sect Heritieria) (Figs2ndash9 Messinger et al 1999 Senters and Soltis 2003)Sampling was limited in sect Parilla a group of 41dioecious South American species (Janczewski 1907)but the group was supported in ITS trees excludingthe east Asian R fasciculatum the sectionrsquos only non-South American species (Senters and Soltis 2003) Apossible sister relationship between sect Parilla andsect Calobotrya (unpubl data cited in Weigend andBinder 2001) is consistent with the position of sect Pa-rilla seen with ITS data (Senters and Soltis 2003) Sec-tion Symphocalyx the golden currants includes vespecies distributed through northern Mexico and cen-tral and western North America (Berger 1924) Thegolden currants were well-supported given the avail-able sampling (Fig 2 4 9) The alpine currants sectBerisia are a group of 17 dioecious species distributedthrough Eurasia (Janczewski 1907) The monophyly ofsect Berisia was well-supported (Figs 2ndash9 Messingeret al 1999) but with the inclusion of some red currants(sect Ribes) in ITS trees (Senters and Soltis 2003)

The monophyly of sects Ribes and Coreosma wasquestionable (Figs 2 3 5) The red currants (sect Ri-bes) are a group of 15 Eurasian species with one spe-cies R triste also distributed in North America Sec-tion Coreosma the black currants includes six speciesin North America and six in Eurasia (Berger 1924) Sec-tion Heritiera the dwarf currants appeared to be poly-phyletic as seen in Messinger et al (1999) and Sentersand Soltis (2003) This group of six species (Berger1924) is dened primarily by a prostrate habit and assuggested by Messinger et al (1999) is likely a case ofconvergence

Biogeography The spread of taxa around theNorthern Hemisphere has been facilitated by the avail-ability at various times of two major migrationroutesmdashthe Beringian and the North Atlantic landbridges (Tiffney 1985a 1985b Donoghue et al 2001SanmartDaggern et al 2001) Especially in large and relative-ly old clades which have become widespread aroundthe Northern Hemisphere it is possible (perhaps evenlikely) that both pathways were used Information onthe timing of key divergences and on the direction ofmovement within subclades will be critical in sortingout the possibilities in particular cases Ribes providesan excellent example of such a group being represent-ed in Eurasia by six sections (Berisia Ribes and somespecies from Heritiera Coreosma Grossularioides andGrossularia) in western North America by nine (Sym-phocalyx Calobotrya Robsonia Hesperia Lobbia andsome species of Coreosma Heritiera Grossularioides and

Grossularia) and in eastern North America by three(some species of Heritiera Ribes and Grossularia) Oneapproach for sorting through a complex biogeographichistory as might be expected in Ribes is to examinephylogenetic patterns in component clades and ide-ally to date divergences

Our analyses indicate that subg Grossularia is nestedwithin a predominantly western North Americanclade (Figs 2 5ndash9) and that it diversied initially inthat region (Fig 8 node 6) Subsequently within sectGrossularia it appears that movement occurred fromwestern North America to eastern Asia presumablythrough Beringia followed by vicariance and the ori-gin and diversication of the well-supported Asiangooseberry clade Donoghue et al (2001) and Xiangand Soltis (2001) highlighted cases of movement out ofAsia into North America through the Bering LandBridge Ribes appears to provide a case of movementin the opposite direction Movement in both directionsis of course to be expected What remains to be de-termined in future studies of disjunct taxa is exactlywhich groups moved in which directions and whetherthere are any signicant generalizations that can bemade about these different patterns

Elsewhere in Ribes there are other possible cases ofmovement between North America and Asia One caseinvolves R lacustre of sect Grossularioides which is dis-tributed in eastern Asia as well as in North AmericaOther possible cases relate to resolution at the base ofRibes where relationships remain uncertain The basalpositions of sect Symphocalyx in trees resulting frompsbA-trnH data and from the combination of psbA-trnHand ETS data suggest a western North American ori-gin for the entire clade (Figs 2 7) This would implyearly dispersion to Asia giving rise to sects Berisiaand Ribes However all other datasets and dataset com-binations suggested a broader Eurasian plus westernNorth American distribution at the base (Fig 8 node1) owing to the basal positions of sects Berisia andRibes This would imply early vicariance involvingAsia and North America and movement back to Asiawithin the western North American clade Future stud-ies should include more sampling of sects Berisia Ri-bes Coreosma and Symphocalyx to help resolve basal re-lationships and biogeographic patterns in Ribes

The fossil record for Ribes consists largely of leaveswith few reports of seeds (Kremenetski 1998) fruits(Cevallos-Ferriz 1995) and owers (Gandolfo et al1998) The leaf record for Ribes in North America mayextend from approximately 2 mya (Hannibal 1911Dorf 1930 Axelrod 1966) to at least 345 mya (Mac-Ginitie 1953 Manchester 2001) and possibly to 45 or50 mya (Axelrod 1998 Wehr and Hopkins 1994) Al-though leaf features are seldom used to distinguishextant taxa of Ribes Wolfe (1964) used leaf serrationand venation features to distinguish between fossil

2004] 95SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

leaves of subg Ribes and subg Grossularia from Ne-vada If these features are reliable this dates subgGrossularia to at least 14 mya (Fig 9 node 6) A criticalnext step in understanding Ribes biogeography will beto accurately assign Ribes fossils to particular sub-clades so as to infer the timing of intercontinental di-vergences

ACKNOWLEDGEMENTS We thank the following individuals andinstitutions for providing plant material B Alverson D BouffordR Mitchell Arnold Arboretum of Harvard University Universityof California Botanical Garden Royal Botanic Garden EdinburghNew York Botanical Garden and the USDA-ARS National PlantGermplasm Repository A Senters and D Soltis graciously pro-vided numerous DNA aliquots DNA sequences and access to ear-ly manuscripts H Schorn and D Erwin provided assistance withpaleobotanical literature M Lavin P Herendeen and two anon-ymous reviewers provided numerous helpful comments This proj-ect was supported in part by a Putnam Fellowship through theArnold Arboretum of Harvard University

LITERATURE CITED

AVISE J C 1994 Molecular markers natural history and evolutionNew York Chapman amp Hall

AXELROD D I 1966 The Pleistocene Soboba ora of southern Califor-nia University of California Publications in Geological Sci-ences 60

mdashmdashmdash 1998 Thunder Mountain Idaho University of CaliforniaPublications in Geological Sciences 142

BALDWIN B G and S MARKOS 1998 Phylogenetic utility of theexternal transcribed spacer (ETS) of 18Sndash26S rDNA Congru-ence of ETS and ITS trees of Calycadenia (Compositae) Mo-lecular Phylogenetics and Evolution 10 449ndash463

mdashmdashmdash M J SANDERSON J M PORTER M F WOJCIECHOWSKI CS CAMPBELL and M J DONOGHUE 1995 The ITS region ofnuclear ribosomal DNA a valuable source of evidence onangiosperm phylogeny Annals of the Missouri Botanical Garden82 247ndash277

BEARD K H 1998 East of Eden Asia as an important center oftaxonomic origination in mammalian evolution Bulletin of theCarnegie Museum of Natural History 34 5ndash39

BENA G M F JUBIER I OLIVIERI and B LEJEUNE 1998 Ribosom-al external and internal transcribed spacers combined use inthe phylogenetic analysis of Medicago (Leguminosae) Journal ofMolecular Evolution 46 299ndash306

BERGER A 1924 A taxonomic review of currants and gooseberriesNew York Agricultural Experimental Station Technical Bulletin109 1ndash118

BOUFFORD D E and S A SPONGBERG 1983 Eastern Asia-EasternNorth American phytogeographical relationships-a historyfrom the time of Linnaeus to the twentieth century Annalsof the Missouri Botanical Garden 70 423ndash439

CAMPBELL C S M F WOJCIECHOWSKI B G BALDWIN L A AL-ICE and M J DONOGHUE 1997 Persistent nuclear ribosomalDNA sequence polymorphism in the Amelanchier agamiccomplex (Rosaceae) Molecular Biology and Evolution 14 81ndash90

CEVALLOS-FERRIZ S R S 1995 Fruits of Ribes from the Princetonchert British Columbia Canada American Journal of Botany82(6 supplement) 84

COVILLE F V and N L BRITTON 1908 Grossulariaceae NorthAmer-ican Flora 22 193ndash225

CUNNINGHAM C W 1997 Can three incongruence tests predictwhen data shold be combined Molecular Biology and Evolution14 733ndash740

DEQUEIROZ A M J DONOGHUE and J KIM 1995 Separate versuscombined analysis of phylogenetic evidence Annual Review ofEcology and Systematics 26 657ndash681

DONOGHUE M J C D BELL and J LI 2001 Phylogenetic patternsin northern hemisphere plant geography International Journalof Plant Sciences 162 S41ndashS52

DORF E 1930 Pliocene oras of California Carnegie Institution ofWashington Publication 412

FARRIS J S M KALLERSJO A G KLUGE and C BULT 1995 Test-ing signicance of incongruence Cladistics 10 315ndash319

FELSENSTEIN J 1985 Condence limits on phylogenies an ap-proach using the bootstrap Evolution 39 783ndash791

FENTON B A N E BIRCH G MALLOCH P G LANHAM and RM BRENNAN 2000 Gall mite molecular phylogeny and itsrelationship to the evolution of plant host specicity AppliedAcarology 24 831ndash861

FRITSCH P W C M MORTON T CHEN and C MELDRUM 2001Phylogeny and biogeography of the Styracaceae InternationalJournal of Plant Sciences 162 S95ndashS116

GANDOLFO M A P HOC S N SANTILLANA and S A MARENSSI1998 Una or fosil morfologicamente afDaggern a las Grossulari-aceae (orden Rosales) de la Formacion la Meseta (Eoceno me-dio) Isla Marambio Antartida Asociacion Paleontologica Argen-tina Publicacion Especial 5 Paleogeno de America del Sur y de laPenDaggernsula Antartica 147ndash153

GOLDMAN N J P ANDERSON and A G RODRIGO 2000 Likeli-hood-based tests of topologies in phylogenetics SystematicBiology 49 652ndash670

HANNIBAL H 1911 A Pliocene ora from the Coast Ranges ofCalifornia Bulletin of the Torrey Botanical Club 38 329ndash342

HUELSENBECK J P J J BULL and C W CUNNINGHAM 1996 Com-binined data in phylogenetic analysis Trends in Ecology andEvolution 11 152ndash158

JANCZEWSKI M E 1907 Monographies des groseilliers Ribes LMemoires Societe de Physique et DrsquoHistoire Naturelle de Geneve35 199ndash517

KEEP E 1962 Interspecic hybridization in Ribes Genetica 33 1ndash23

KISHINO H and M HASEGAWA 1989 Evaluation of the maximumlikelihood estimate of the evolutionary tree topologies fromDNA sequence data and the branching order in HominoideaJournal of Molecular Evolution 29 170ndash179

KREMENETSKI C V 1998 Holocene history of the northern rangelimits of some trees and shrubs in Russia Arctic and AlpineResearch 30 317ndash333

LINDER C R L R GOERTZEN B V HEUVEL J FRANCISCO-OR-TEGA and R K JANSEN 2000 The complete external tran-scribed spacer of 18Sndash26S rDNA amplication and phylo-genetic utility at low taxonomic levels in Asteraceae andclosely allied families Molecular Phylogenetics and Evolution 14285ndash303

MACGINITIE D 1953 Fossil plants of the Florissant beds ColoradoCarnegie Institution of Washington Publication 599

MADDISON D R and W P MADDISON 2000 MacClade 4 Sun-derland Sinauer Associates

MANCHESTER S R 1999 Biogeographical relationships of NorthAmerican Tertiary oras Annals of the Missouri Botanical Gar-den 86 472ndash522

mdashmdashmdash 2001 Update on the megafossil ora of Florissant Colo-rado Proceedings of the Denver Museum of Nature amp ScienceSeries 4 No1 137

MANOS P S and M J DONOGHUE 2001 Progress in northernhemisphere phytogeography an introduction InternationalJournal of Plant Sciences 162 S1ndashS2

mdashmdashmdash and A M STANFORD 2001 The historical biogeography ofFagaceae tracking the tertiary history of temperate and sub-tropical forests of the northern hemisphere International Jour-nal of Plant Sciences 162 S77ndashS93

MAST A R and T J GIVNISH 2002 Historical biogeography andthe origin of stomatal distributions in Banksia and Dryandra(Proteaceae) based on their cpDNA phylogeny American Jour-nal of Botany 89 1311ndash1323

MESSINGER W K HUMMER and A LISTON 1999 Ribes (Grossu-

92 [Volume 29SYSTEMATIC BOTANY

FIG 9 The strict consensus of 4802 trees resulting from analyses of all four datasets (ITS ETS psbA-trnH chloroplastrestriction sites) including taxa represented in at least three datasets (CI5080 074 excluding uninformative charactersRI5085) Dataset combinability was determined using partition homogeneity tests (p5012) Numbers above the branchesindicate the percentage of bootstrap replicates in which the clade appeared

2004] 93SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

The general picture that emerges from these analy-ses suggests that subg Grossularia is monophyletic(Figs 2 5ndash9) rDNA data supported gooseberry mono-phyly (Figs 2 5) psbA-trnH data while lacking suf-cient variation to resolve gooseberry monophyly ornon-monophyly supported gooseberry monophyly incombination with rDNA data (Figs 7 8) Finally anal-yses of all datasets combined supported gooseberrymonophyly although these analyses excluded thespiny currants (sect Grossularioides) (Figs 6 9) Whatrequires further investigation is the role hybridizationmay have played in the history of the spiny currants(sect Grossularioides) and the true gooseberries (sectGrossularia) Messinger et al (1999) encouraged furtherexploration of this possibility in Ribes in which theynoted potential chloroplast capture of the sect Gros-sularia chloroplast type by sect Grossularioides Crosseshave not been successful between species of sect Gros-sularioides and other sections within Ribes and are usu-ally unsuccessful between sections or subgenera (Keep1962) Conrmation of the pattern seen in trees gen-erated from the chloroplast restriction site data (Mes-singer et al 1999) is needed from additional chloro-plast datasets that provide greater resolution than didthe psbA-trnH dataset

Relationships Within the Gooseberries SubgenusGrossularia comprises two main lineages (Figs 2 5ndash9)the true gooseberries (sect Grossularia) and a clade ofglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) The four gooseberry sections are traditionally dis-tinguished from each other by basally pubescent stylesin sect Grossularia (with the exception of some Asianspecies) by four versus ve parted owers in sect Rob-sonia by anthers broader at the base in subg Hesperiaand by the absence of the above set of features in subgLobbia The glabrous-styled gooseberry lineage com-prising 27 species distributed through western NorthAmerica into Mexico (Berger 1924) was well-support-ed given our sampling but sections within this lineagewere not resolved Ribes watsonianum (subg Lobbia)was surprisingly placed outside of the glabrous-styledgooseberry lineage as sister to the true gooseberries(Figs 2 5 7ndash9) ITS data resolved R watsonianum with-in the glabrous-styled gooseberry lineage (Senters andSoltis 2003) but ETS data strongly resolved the specieswithin the true gooseberry lineage (sect Grossularia)(Fig 2) This conict within the rDNA data may reecthybridization between R watsonianum and a memberof sect Grossularia followed by xation within the Rwatsonianum genome of a recombinant rDNA repeattype Accounts of Ribes hybrids in the eld are rela-tively rare (Messler et al 1991) and do not implicateR watsonianum but fertile hybrids can be obtainedfrom articial crosses between glabrous-styled goose-berries and true gooseberries (Keep 1962 citing R lob-bii 3 R divaricatum) Alternatively R watsonianum may

posses multiple rDNA repeat types with different re-peat types sampled in our ITS versus ETS datasetsEach of these possibilities has been reported in otherplant taxa (Wendel et al 1995a Campbell et al 1997for potential recombinant rDNA repeat types Suh etal 1993 Wendel et al 1995b for incomplete homoge-nization of rDNA repeat types)

The true gooseberries (sect Grossularia) have a broadrange throughout the northern hemisphere with ninespecies in North America (Sinnott 1985) and seven spe-cies in Eurasia (Berger 1924) In his treatment of NorthAmerican gooseberries Sinnott (1985) divided his ninespecies into ve groups based on phenetic analysesThe groups consisted of (1) R cynosbati with spinyfruits (2) R niveum R curvatum and R missouriensewith highly exserted stamens and long sepals (3) Rrotundifolium and R divaricatum with medium lengthstamens and purple sepals (4) R inerme and R hirtel-lum with intermediate length stamens and small oralfeatures and (5) the ve subspecies of R oxyacanthoi-des with short stamens Sinnott (1985) recommendedthat R echinellum be excluded from the true gooseber-ries and aligned with the glabrous-styled gooseberriesof western North America (Hesperia Lobbia Robsonia)The analyses presented here showed strong supportfor the inclusion of R echinellum as well as the Eurasianspecies within the true gooseberry lineage (Figs 2ndash35 7ndash9) Resolution among the North American specieswas lacking or not well-supported (Figs 2ndash9) and thusneither supported nor conicted with Sinnottrsquos hy-pothesized relationships

The seven Eurasian species of sect Grossularia (Ber-ger 1924) include R uvacrispa in Europe R alpestre andR aciculare in the Himalayan region R stenocarpumand R formosanum in southern and eastern Asia andR burejense and R grossularioides in northern and east-ern Asia A clade of Asian species is well-supported(Figs 2 5 7ndash9) with possible inclusion of R uvacrispa(Figs 2 7) The psbA-trnH dataset includes R oxyacan-thoides subsp irriguum within the Asian clade (Fig 3)but this is weakly supported (Fig 3) and requires fur-ther substantiation particularly since R oxyacanthoidessubsp irriguum is restricted to northwestern NorthAmerica and may itself be of hybrid origin from cross-es between R oxyacanthoides subsp setosum and R in-erme (Sinnott 1985) both distributed in western NorthAmerica Resolution within the clade of Asian speciessuggests a correspondance to geographic and oristicregions within Asia Whether the Asian and NorthAmerican true gooseberries represent divergent line-ages or a monophyletic Asian clade nested within aNorth American grade is unclear given the availabledata

Other Groups within Ribes Since this study fo-cused on the gooseberries sampling within other sec-tions of Ribes was sometimes limited Nevertheless the

94 [Volume 29SYSTEMATIC BOTANY

data did support the monophyly of sects CalobotryaParilla Symphocalyx and Berisia Section Calobotrya is agroup of 21 western North American species (Berger1924) known as the ornamental currants The mono-phyly of sect Calobotrya was well-supported with theinclusion of some dwarf currants (sect Heritieria) (Figs2ndash9 Messinger et al 1999 Senters and Soltis 2003)Sampling was limited in sect Parilla a group of 41dioecious South American species (Janczewski 1907)but the group was supported in ITS trees excludingthe east Asian R fasciculatum the sectionrsquos only non-South American species (Senters and Soltis 2003) Apossible sister relationship between sect Parilla andsect Calobotrya (unpubl data cited in Weigend andBinder 2001) is consistent with the position of sect Pa-rilla seen with ITS data (Senters and Soltis 2003) Sec-tion Symphocalyx the golden currants includes vespecies distributed through northern Mexico and cen-tral and western North America (Berger 1924) Thegolden currants were well-supported given the avail-able sampling (Fig 2 4 9) The alpine currants sectBerisia are a group of 17 dioecious species distributedthrough Eurasia (Janczewski 1907) The monophyly ofsect Berisia was well-supported (Figs 2ndash9 Messingeret al 1999) but with the inclusion of some red currants(sect Ribes) in ITS trees (Senters and Soltis 2003)

The monophyly of sects Ribes and Coreosma wasquestionable (Figs 2 3 5) The red currants (sect Ri-bes) are a group of 15 Eurasian species with one spe-cies R triste also distributed in North America Sec-tion Coreosma the black currants includes six speciesin North America and six in Eurasia (Berger 1924) Sec-tion Heritiera the dwarf currants appeared to be poly-phyletic as seen in Messinger et al (1999) and Sentersand Soltis (2003) This group of six species (Berger1924) is dened primarily by a prostrate habit and assuggested by Messinger et al (1999) is likely a case ofconvergence

Biogeography The spread of taxa around theNorthern Hemisphere has been facilitated by the avail-ability at various times of two major migrationroutesmdashthe Beringian and the North Atlantic landbridges (Tiffney 1985a 1985b Donoghue et al 2001SanmartDaggern et al 2001) Especially in large and relative-ly old clades which have become widespread aroundthe Northern Hemisphere it is possible (perhaps evenlikely) that both pathways were used Information onthe timing of key divergences and on the direction ofmovement within subclades will be critical in sortingout the possibilities in particular cases Ribes providesan excellent example of such a group being represent-ed in Eurasia by six sections (Berisia Ribes and somespecies from Heritiera Coreosma Grossularioides andGrossularia) in western North America by nine (Sym-phocalyx Calobotrya Robsonia Hesperia Lobbia andsome species of Coreosma Heritiera Grossularioides and

Grossularia) and in eastern North America by three(some species of Heritiera Ribes and Grossularia) Oneapproach for sorting through a complex biogeographichistory as might be expected in Ribes is to examinephylogenetic patterns in component clades and ide-ally to date divergences

Our analyses indicate that subg Grossularia is nestedwithin a predominantly western North Americanclade (Figs 2 5ndash9) and that it diversied initially inthat region (Fig 8 node 6) Subsequently within sectGrossularia it appears that movement occurred fromwestern North America to eastern Asia presumablythrough Beringia followed by vicariance and the ori-gin and diversication of the well-supported Asiangooseberry clade Donoghue et al (2001) and Xiangand Soltis (2001) highlighted cases of movement out ofAsia into North America through the Bering LandBridge Ribes appears to provide a case of movementin the opposite direction Movement in both directionsis of course to be expected What remains to be de-termined in future studies of disjunct taxa is exactlywhich groups moved in which directions and whetherthere are any signicant generalizations that can bemade about these different patterns

Elsewhere in Ribes there are other possible cases ofmovement between North America and Asia One caseinvolves R lacustre of sect Grossularioides which is dis-tributed in eastern Asia as well as in North AmericaOther possible cases relate to resolution at the base ofRibes where relationships remain uncertain The basalpositions of sect Symphocalyx in trees resulting frompsbA-trnH data and from the combination of psbA-trnHand ETS data suggest a western North American ori-gin for the entire clade (Figs 2 7) This would implyearly dispersion to Asia giving rise to sects Berisiaand Ribes However all other datasets and dataset com-binations suggested a broader Eurasian plus westernNorth American distribution at the base (Fig 8 node1) owing to the basal positions of sects Berisia andRibes This would imply early vicariance involvingAsia and North America and movement back to Asiawithin the western North American clade Future stud-ies should include more sampling of sects Berisia Ri-bes Coreosma and Symphocalyx to help resolve basal re-lationships and biogeographic patterns in Ribes

The fossil record for Ribes consists largely of leaveswith few reports of seeds (Kremenetski 1998) fruits(Cevallos-Ferriz 1995) and owers (Gandolfo et al1998) The leaf record for Ribes in North America mayextend from approximately 2 mya (Hannibal 1911Dorf 1930 Axelrod 1966) to at least 345 mya (Mac-Ginitie 1953 Manchester 2001) and possibly to 45 or50 mya (Axelrod 1998 Wehr and Hopkins 1994) Al-though leaf features are seldom used to distinguishextant taxa of Ribes Wolfe (1964) used leaf serrationand venation features to distinguish between fossil

2004] 95SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

leaves of subg Ribes and subg Grossularia from Ne-vada If these features are reliable this dates subgGrossularia to at least 14 mya (Fig 9 node 6) A criticalnext step in understanding Ribes biogeography will beto accurately assign Ribes fossils to particular sub-clades so as to infer the timing of intercontinental di-vergences

ACKNOWLEDGEMENTS We thank the following individuals andinstitutions for providing plant material B Alverson D BouffordR Mitchell Arnold Arboretum of Harvard University Universityof California Botanical Garden Royal Botanic Garden EdinburghNew York Botanical Garden and the USDA-ARS National PlantGermplasm Repository A Senters and D Soltis graciously pro-vided numerous DNA aliquots DNA sequences and access to ear-ly manuscripts H Schorn and D Erwin provided assistance withpaleobotanical literature M Lavin P Herendeen and two anon-ymous reviewers provided numerous helpful comments This proj-ect was supported in part by a Putnam Fellowship through theArnold Arboretum of Harvard University

LITERATURE CITED

AVISE J C 1994 Molecular markers natural history and evolutionNew York Chapman amp Hall

AXELROD D I 1966 The Pleistocene Soboba ora of southern Califor-nia University of California Publications in Geological Sci-ences 60

mdashmdashmdash 1998 Thunder Mountain Idaho University of CaliforniaPublications in Geological Sciences 142

BALDWIN B G and S MARKOS 1998 Phylogenetic utility of theexternal transcribed spacer (ETS) of 18Sndash26S rDNA Congru-ence of ETS and ITS trees of Calycadenia (Compositae) Mo-lecular Phylogenetics and Evolution 10 449ndash463

mdashmdashmdash M J SANDERSON J M PORTER M F WOJCIECHOWSKI CS CAMPBELL and M J DONOGHUE 1995 The ITS region ofnuclear ribosomal DNA a valuable source of evidence onangiosperm phylogeny Annals of the Missouri Botanical Garden82 247ndash277

BEARD K H 1998 East of Eden Asia as an important center oftaxonomic origination in mammalian evolution Bulletin of theCarnegie Museum of Natural History 34 5ndash39

BENA G M F JUBIER I OLIVIERI and B LEJEUNE 1998 Ribosom-al external and internal transcribed spacers combined use inthe phylogenetic analysis of Medicago (Leguminosae) Journal ofMolecular Evolution 46 299ndash306

BERGER A 1924 A taxonomic review of currants and gooseberriesNew York Agricultural Experimental Station Technical Bulletin109 1ndash118

BOUFFORD D E and S A SPONGBERG 1983 Eastern Asia-EasternNorth American phytogeographical relationships-a historyfrom the time of Linnaeus to the twentieth century Annalsof the Missouri Botanical Garden 70 423ndash439

CAMPBELL C S M F WOJCIECHOWSKI B G BALDWIN L A AL-ICE and M J DONOGHUE 1997 Persistent nuclear ribosomalDNA sequence polymorphism in the Amelanchier agamiccomplex (Rosaceae) Molecular Biology and Evolution 14 81ndash90

CEVALLOS-FERRIZ S R S 1995 Fruits of Ribes from the Princetonchert British Columbia Canada American Journal of Botany82(6 supplement) 84

COVILLE F V and N L BRITTON 1908 Grossulariaceae NorthAmer-ican Flora 22 193ndash225

CUNNINGHAM C W 1997 Can three incongruence tests predictwhen data shold be combined Molecular Biology and Evolution14 733ndash740

DEQUEIROZ A M J DONOGHUE and J KIM 1995 Separate versuscombined analysis of phylogenetic evidence Annual Review ofEcology and Systematics 26 657ndash681

DONOGHUE M J C D BELL and J LI 2001 Phylogenetic patternsin northern hemisphere plant geography International Journalof Plant Sciences 162 S41ndashS52

DORF E 1930 Pliocene oras of California Carnegie Institution ofWashington Publication 412

FARRIS J S M KALLERSJO A G KLUGE and C BULT 1995 Test-ing signicance of incongruence Cladistics 10 315ndash319

FELSENSTEIN J 1985 Condence limits on phylogenies an ap-proach using the bootstrap Evolution 39 783ndash791

FENTON B A N E BIRCH G MALLOCH P G LANHAM and RM BRENNAN 2000 Gall mite molecular phylogeny and itsrelationship to the evolution of plant host specicity AppliedAcarology 24 831ndash861

FRITSCH P W C M MORTON T CHEN and C MELDRUM 2001Phylogeny and biogeography of the Styracaceae InternationalJournal of Plant Sciences 162 S95ndashS116

GANDOLFO M A P HOC S N SANTILLANA and S A MARENSSI1998 Una or fosil morfologicamente afDaggern a las Grossulari-aceae (orden Rosales) de la Formacion la Meseta (Eoceno me-dio) Isla Marambio Antartida Asociacion Paleontologica Argen-tina Publicacion Especial 5 Paleogeno de America del Sur y de laPenDaggernsula Antartica 147ndash153

GOLDMAN N J P ANDERSON and A G RODRIGO 2000 Likeli-hood-based tests of topologies in phylogenetics SystematicBiology 49 652ndash670

HANNIBAL H 1911 A Pliocene ora from the Coast Ranges ofCalifornia Bulletin of the Torrey Botanical Club 38 329ndash342

HUELSENBECK J P J J BULL and C W CUNNINGHAM 1996 Com-binined data in phylogenetic analysis Trends in Ecology andEvolution 11 152ndash158

JANCZEWSKI M E 1907 Monographies des groseilliers Ribes LMemoires Societe de Physique et DrsquoHistoire Naturelle de Geneve35 199ndash517

KEEP E 1962 Interspecic hybridization in Ribes Genetica 33 1ndash23

KISHINO H and M HASEGAWA 1989 Evaluation of the maximumlikelihood estimate of the evolutionary tree topologies fromDNA sequence data and the branching order in HominoideaJournal of Molecular Evolution 29 170ndash179

KREMENETSKI C V 1998 Holocene history of the northern rangelimits of some trees and shrubs in Russia Arctic and AlpineResearch 30 317ndash333

LINDER C R L R GOERTZEN B V HEUVEL J FRANCISCO-OR-TEGA and R K JANSEN 2000 The complete external tran-scribed spacer of 18Sndash26S rDNA amplication and phylo-genetic utility at low taxonomic levels in Asteraceae andclosely allied families Molecular Phylogenetics and Evolution 14285ndash303

MACGINITIE D 1953 Fossil plants of the Florissant beds ColoradoCarnegie Institution of Washington Publication 599

MADDISON D R and W P MADDISON 2000 MacClade 4 Sun-derland Sinauer Associates

MANCHESTER S R 1999 Biogeographical relationships of NorthAmerican Tertiary oras Annals of the Missouri Botanical Gar-den 86 472ndash522

mdashmdashmdash 2001 Update on the megafossil ora of Florissant Colo-rado Proceedings of the Denver Museum of Nature amp ScienceSeries 4 No1 137

MANOS P S and M J DONOGHUE 2001 Progress in northernhemisphere phytogeography an introduction InternationalJournal of Plant Sciences 162 S1ndashS2

mdashmdashmdash and A M STANFORD 2001 The historical biogeography ofFagaceae tracking the tertiary history of temperate and sub-tropical forests of the northern hemisphere International Jour-nal of Plant Sciences 162 S77ndashS93

MAST A R and T J GIVNISH 2002 Historical biogeography andthe origin of stomatal distributions in Banksia and Dryandra(Proteaceae) based on their cpDNA phylogeny American Jour-nal of Botany 89 1311ndash1323

MESSINGER W K HUMMER and A LISTON 1999 Ribes (Grossu-

2004] 93SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

The general picture that emerges from these analy-ses suggests that subg Grossularia is monophyletic(Figs 2 5ndash9) rDNA data supported gooseberry mono-phyly (Figs 2 5) psbA-trnH data while lacking suf-cient variation to resolve gooseberry monophyly ornon-monophyly supported gooseberry monophyly incombination with rDNA data (Figs 7 8) Finally anal-yses of all datasets combined supported gooseberrymonophyly although these analyses excluded thespiny currants (sect Grossularioides) (Figs 6 9) Whatrequires further investigation is the role hybridizationmay have played in the history of the spiny currants(sect Grossularioides) and the true gooseberries (sectGrossularia) Messinger et al (1999) encouraged furtherexploration of this possibility in Ribes in which theynoted potential chloroplast capture of the sect Gros-sularia chloroplast type by sect Grossularioides Crosseshave not been successful between species of sect Gros-sularioides and other sections within Ribes and are usu-ally unsuccessful between sections or subgenera (Keep1962) Conrmation of the pattern seen in trees gen-erated from the chloroplast restriction site data (Mes-singer et al 1999) is needed from additional chloro-plast datasets that provide greater resolution than didthe psbA-trnH dataset

Relationships Within the Gooseberries SubgenusGrossularia comprises two main lineages (Figs 2 5ndash9)the true gooseberries (sect Grossularia) and a clade ofglabrous-styled gooseberries (Hesperia Lobbia Robson-ia) The four gooseberry sections are traditionally dis-tinguished from each other by basally pubescent stylesin sect Grossularia (with the exception of some Asianspecies) by four versus ve parted owers in sect Rob-sonia by anthers broader at the base in subg Hesperiaand by the absence of the above set of features in subgLobbia The glabrous-styled gooseberry lineage com-prising 27 species distributed through western NorthAmerica into Mexico (Berger 1924) was well-support-ed given our sampling but sections within this lineagewere not resolved Ribes watsonianum (subg Lobbia)was surprisingly placed outside of the glabrous-styledgooseberry lineage as sister to the true gooseberries(Figs 2 5 7ndash9) ITS data resolved R watsonianum with-in the glabrous-styled gooseberry lineage (Senters andSoltis 2003) but ETS data strongly resolved the specieswithin the true gooseberry lineage (sect Grossularia)(Fig 2) This conict within the rDNA data may reecthybridization between R watsonianum and a memberof sect Grossularia followed by xation within the Rwatsonianum genome of a recombinant rDNA repeattype Accounts of Ribes hybrids in the eld are rela-tively rare (Messler et al 1991) and do not implicateR watsonianum but fertile hybrids can be obtainedfrom articial crosses between glabrous-styled goose-berries and true gooseberries (Keep 1962 citing R lob-bii 3 R divaricatum) Alternatively R watsonianum may

posses multiple rDNA repeat types with different re-peat types sampled in our ITS versus ETS datasetsEach of these possibilities has been reported in otherplant taxa (Wendel et al 1995a Campbell et al 1997for potential recombinant rDNA repeat types Suh etal 1993 Wendel et al 1995b for incomplete homoge-nization of rDNA repeat types)

The true gooseberries (sect Grossularia) have a broadrange throughout the northern hemisphere with ninespecies in North America (Sinnott 1985) and seven spe-cies in Eurasia (Berger 1924) In his treatment of NorthAmerican gooseberries Sinnott (1985) divided his ninespecies into ve groups based on phenetic analysesThe groups consisted of (1) R cynosbati with spinyfruits (2) R niveum R curvatum and R missouriensewith highly exserted stamens and long sepals (3) Rrotundifolium and R divaricatum with medium lengthstamens and purple sepals (4) R inerme and R hirtel-lum with intermediate length stamens and small oralfeatures and (5) the ve subspecies of R oxyacanthoi-des with short stamens Sinnott (1985) recommendedthat R echinellum be excluded from the true gooseber-ries and aligned with the glabrous-styled gooseberriesof western North America (Hesperia Lobbia Robsonia)The analyses presented here showed strong supportfor the inclusion of R echinellum as well as the Eurasianspecies within the true gooseberry lineage (Figs 2ndash35 7ndash9) Resolution among the North American specieswas lacking or not well-supported (Figs 2ndash9) and thusneither supported nor conicted with Sinnottrsquos hy-pothesized relationships

The seven Eurasian species of sect Grossularia (Ber-ger 1924) include R uvacrispa in Europe R alpestre andR aciculare in the Himalayan region R stenocarpumand R formosanum in southern and eastern Asia andR burejense and R grossularioides in northern and east-ern Asia A clade of Asian species is well-supported(Figs 2 5 7ndash9) with possible inclusion of R uvacrispa(Figs 2 7) The psbA-trnH dataset includes R oxyacan-thoides subsp irriguum within the Asian clade (Fig 3)but this is weakly supported (Fig 3) and requires fur-ther substantiation particularly since R oxyacanthoidessubsp irriguum is restricted to northwestern NorthAmerica and may itself be of hybrid origin from cross-es between R oxyacanthoides subsp setosum and R in-erme (Sinnott 1985) both distributed in western NorthAmerica Resolution within the clade of Asian speciessuggests a correspondance to geographic and oristicregions within Asia Whether the Asian and NorthAmerican true gooseberries represent divergent line-ages or a monophyletic Asian clade nested within aNorth American grade is unclear given the availabledata

Other Groups within Ribes Since this study fo-cused on the gooseberries sampling within other sec-tions of Ribes was sometimes limited Nevertheless the

94 [Volume 29SYSTEMATIC BOTANY

data did support the monophyly of sects CalobotryaParilla Symphocalyx and Berisia Section Calobotrya is agroup of 21 western North American species (Berger1924) known as the ornamental currants The mono-phyly of sect Calobotrya was well-supported with theinclusion of some dwarf currants (sect Heritieria) (Figs2ndash9 Messinger et al 1999 Senters and Soltis 2003)Sampling was limited in sect Parilla a group of 41dioecious South American species (Janczewski 1907)but the group was supported in ITS trees excludingthe east Asian R fasciculatum the sectionrsquos only non-South American species (Senters and Soltis 2003) Apossible sister relationship between sect Parilla andsect Calobotrya (unpubl data cited in Weigend andBinder 2001) is consistent with the position of sect Pa-rilla seen with ITS data (Senters and Soltis 2003) Sec-tion Symphocalyx the golden currants includes vespecies distributed through northern Mexico and cen-tral and western North America (Berger 1924) Thegolden currants were well-supported given the avail-able sampling (Fig 2 4 9) The alpine currants sectBerisia are a group of 17 dioecious species distributedthrough Eurasia (Janczewski 1907) The monophyly ofsect Berisia was well-supported (Figs 2ndash9 Messingeret al 1999) but with the inclusion of some red currants(sect Ribes) in ITS trees (Senters and Soltis 2003)

The monophyly of sects Ribes and Coreosma wasquestionable (Figs 2 3 5) The red currants (sect Ri-bes) are a group of 15 Eurasian species with one spe-cies R triste also distributed in North America Sec-tion Coreosma the black currants includes six speciesin North America and six in Eurasia (Berger 1924) Sec-tion Heritiera the dwarf currants appeared to be poly-phyletic as seen in Messinger et al (1999) and Sentersand Soltis (2003) This group of six species (Berger1924) is dened primarily by a prostrate habit and assuggested by Messinger et al (1999) is likely a case ofconvergence

Biogeography The spread of taxa around theNorthern Hemisphere has been facilitated by the avail-ability at various times of two major migrationroutesmdashthe Beringian and the North Atlantic landbridges (Tiffney 1985a 1985b Donoghue et al 2001SanmartDaggern et al 2001) Especially in large and relative-ly old clades which have become widespread aroundthe Northern Hemisphere it is possible (perhaps evenlikely) that both pathways were used Information onthe timing of key divergences and on the direction ofmovement within subclades will be critical in sortingout the possibilities in particular cases Ribes providesan excellent example of such a group being represent-ed in Eurasia by six sections (Berisia Ribes and somespecies from Heritiera Coreosma Grossularioides andGrossularia) in western North America by nine (Sym-phocalyx Calobotrya Robsonia Hesperia Lobbia andsome species of Coreosma Heritiera Grossularioides and

Grossularia) and in eastern North America by three(some species of Heritiera Ribes and Grossularia) Oneapproach for sorting through a complex biogeographichistory as might be expected in Ribes is to examinephylogenetic patterns in component clades and ide-ally to date divergences

Our analyses indicate that subg Grossularia is nestedwithin a predominantly western North Americanclade (Figs 2 5ndash9) and that it diversied initially inthat region (Fig 8 node 6) Subsequently within sectGrossularia it appears that movement occurred fromwestern North America to eastern Asia presumablythrough Beringia followed by vicariance and the ori-gin and diversication of the well-supported Asiangooseberry clade Donoghue et al (2001) and Xiangand Soltis (2001) highlighted cases of movement out ofAsia into North America through the Bering LandBridge Ribes appears to provide a case of movementin the opposite direction Movement in both directionsis of course to be expected What remains to be de-termined in future studies of disjunct taxa is exactlywhich groups moved in which directions and whetherthere are any signicant generalizations that can bemade about these different patterns

Elsewhere in Ribes there are other possible cases ofmovement between North America and Asia One caseinvolves R lacustre of sect Grossularioides which is dis-tributed in eastern Asia as well as in North AmericaOther possible cases relate to resolution at the base ofRibes where relationships remain uncertain The basalpositions of sect Symphocalyx in trees resulting frompsbA-trnH data and from the combination of psbA-trnHand ETS data suggest a western North American ori-gin for the entire clade (Figs 2 7) This would implyearly dispersion to Asia giving rise to sects Berisiaand Ribes However all other datasets and dataset com-binations suggested a broader Eurasian plus westernNorth American distribution at the base (Fig 8 node1) owing to the basal positions of sects Berisia andRibes This would imply early vicariance involvingAsia and North America and movement back to Asiawithin the western North American clade Future stud-ies should include more sampling of sects Berisia Ri-bes Coreosma and Symphocalyx to help resolve basal re-lationships and biogeographic patterns in Ribes

The fossil record for Ribes consists largely of leaveswith few reports of seeds (Kremenetski 1998) fruits(Cevallos-Ferriz 1995) and owers (Gandolfo et al1998) The leaf record for Ribes in North America mayextend from approximately 2 mya (Hannibal 1911Dorf 1930 Axelrod 1966) to at least 345 mya (Mac-Ginitie 1953 Manchester 2001) and possibly to 45 or50 mya (Axelrod 1998 Wehr and Hopkins 1994) Al-though leaf features are seldom used to distinguishextant taxa of Ribes Wolfe (1964) used leaf serrationand venation features to distinguish between fossil

2004] 95SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

leaves of subg Ribes and subg Grossularia from Ne-vada If these features are reliable this dates subgGrossularia to at least 14 mya (Fig 9 node 6) A criticalnext step in understanding Ribes biogeography will beto accurately assign Ribes fossils to particular sub-clades so as to infer the timing of intercontinental di-vergences

ACKNOWLEDGEMENTS We thank the following individuals andinstitutions for providing plant material B Alverson D BouffordR Mitchell Arnold Arboretum of Harvard University Universityof California Botanical Garden Royal Botanic Garden EdinburghNew York Botanical Garden and the USDA-ARS National PlantGermplasm Repository A Senters and D Soltis graciously pro-vided numerous DNA aliquots DNA sequences and access to ear-ly manuscripts H Schorn and D Erwin provided assistance withpaleobotanical literature M Lavin P Herendeen and two anon-ymous reviewers provided numerous helpful comments This proj-ect was supported in part by a Putnam Fellowship through theArnold Arboretum of Harvard University

LITERATURE CITED

AVISE J C 1994 Molecular markers natural history and evolutionNew York Chapman amp Hall

AXELROD D I 1966 The Pleistocene Soboba ora of southern Califor-nia University of California Publications in Geological Sci-ences 60

mdashmdashmdash 1998 Thunder Mountain Idaho University of CaliforniaPublications in Geological Sciences 142

BALDWIN B G and S MARKOS 1998 Phylogenetic utility of theexternal transcribed spacer (ETS) of 18Sndash26S rDNA Congru-ence of ETS and ITS trees of Calycadenia (Compositae) Mo-lecular Phylogenetics and Evolution 10 449ndash463

mdashmdashmdash M J SANDERSON J M PORTER M F WOJCIECHOWSKI CS CAMPBELL and M J DONOGHUE 1995 The ITS region ofnuclear ribosomal DNA a valuable source of evidence onangiosperm phylogeny Annals of the Missouri Botanical Garden82 247ndash277

BEARD K H 1998 East of Eden Asia as an important center oftaxonomic origination in mammalian evolution Bulletin of theCarnegie Museum of Natural History 34 5ndash39

BENA G M F JUBIER I OLIVIERI and B LEJEUNE 1998 Ribosom-al external and internal transcribed spacers combined use inthe phylogenetic analysis of Medicago (Leguminosae) Journal ofMolecular Evolution 46 299ndash306

BERGER A 1924 A taxonomic review of currants and gooseberriesNew York Agricultural Experimental Station Technical Bulletin109 1ndash118

BOUFFORD D E and S A SPONGBERG 1983 Eastern Asia-EasternNorth American phytogeographical relationships-a historyfrom the time of Linnaeus to the twentieth century Annalsof the Missouri Botanical Garden 70 423ndash439

CAMPBELL C S M F WOJCIECHOWSKI B G BALDWIN L A AL-ICE and M J DONOGHUE 1997 Persistent nuclear ribosomalDNA sequence polymorphism in the Amelanchier agamiccomplex (Rosaceae) Molecular Biology and Evolution 14 81ndash90

CEVALLOS-FERRIZ S R S 1995 Fruits of Ribes from the Princetonchert British Columbia Canada American Journal of Botany82(6 supplement) 84

COVILLE F V and N L BRITTON 1908 Grossulariaceae NorthAmer-ican Flora 22 193ndash225

CUNNINGHAM C W 1997 Can three incongruence tests predictwhen data shold be combined Molecular Biology and Evolution14 733ndash740

DEQUEIROZ A M J DONOGHUE and J KIM 1995 Separate versuscombined analysis of phylogenetic evidence Annual Review ofEcology and Systematics 26 657ndash681

DONOGHUE M J C D BELL and J LI 2001 Phylogenetic patternsin northern hemisphere plant geography International Journalof Plant Sciences 162 S41ndashS52

DORF E 1930 Pliocene oras of California Carnegie Institution ofWashington Publication 412

FARRIS J S M KALLERSJO A G KLUGE and C BULT 1995 Test-ing signicance of incongruence Cladistics 10 315ndash319

FELSENSTEIN J 1985 Condence limits on phylogenies an ap-proach using the bootstrap Evolution 39 783ndash791

FENTON B A N E BIRCH G MALLOCH P G LANHAM and RM BRENNAN 2000 Gall mite molecular phylogeny and itsrelationship to the evolution of plant host specicity AppliedAcarology 24 831ndash861

FRITSCH P W C M MORTON T CHEN and C MELDRUM 2001Phylogeny and biogeography of the Styracaceae InternationalJournal of Plant Sciences 162 S95ndashS116

GANDOLFO M A P HOC S N SANTILLANA and S A MARENSSI1998 Una or fosil morfologicamente afDaggern a las Grossulari-aceae (orden Rosales) de la Formacion la Meseta (Eoceno me-dio) Isla Marambio Antartida Asociacion Paleontologica Argen-tina Publicacion Especial 5 Paleogeno de America del Sur y de laPenDaggernsula Antartica 147ndash153

GOLDMAN N J P ANDERSON and A G RODRIGO 2000 Likeli-hood-based tests of topologies in phylogenetics SystematicBiology 49 652ndash670

HANNIBAL H 1911 A Pliocene ora from the Coast Ranges ofCalifornia Bulletin of the Torrey Botanical Club 38 329ndash342

HUELSENBECK J P J J BULL and C W CUNNINGHAM 1996 Com-binined data in phylogenetic analysis Trends in Ecology andEvolution 11 152ndash158

JANCZEWSKI M E 1907 Monographies des groseilliers Ribes LMemoires Societe de Physique et DrsquoHistoire Naturelle de Geneve35 199ndash517

KEEP E 1962 Interspecic hybridization in Ribes Genetica 33 1ndash23

KISHINO H and M HASEGAWA 1989 Evaluation of the maximumlikelihood estimate of the evolutionary tree topologies fromDNA sequence data and the branching order in HominoideaJournal of Molecular Evolution 29 170ndash179

KREMENETSKI C V 1998 Holocene history of the northern rangelimits of some trees and shrubs in Russia Arctic and AlpineResearch 30 317ndash333

LINDER C R L R GOERTZEN B V HEUVEL J FRANCISCO-OR-TEGA and R K JANSEN 2000 The complete external tran-scribed spacer of 18Sndash26S rDNA amplication and phylo-genetic utility at low taxonomic levels in Asteraceae andclosely allied families Molecular Phylogenetics and Evolution 14285ndash303

MACGINITIE D 1953 Fossil plants of the Florissant beds ColoradoCarnegie Institution of Washington Publication 599

MADDISON D R and W P MADDISON 2000 MacClade 4 Sun-derland Sinauer Associates

MANCHESTER S R 1999 Biogeographical relationships of NorthAmerican Tertiary oras Annals of the Missouri Botanical Gar-den 86 472ndash522

mdashmdashmdash 2001 Update on the megafossil ora of Florissant Colo-rado Proceedings of the Denver Museum of Nature amp ScienceSeries 4 No1 137

MANOS P S and M J DONOGHUE 2001 Progress in northernhemisphere phytogeography an introduction InternationalJournal of Plant Sciences 162 S1ndashS2

mdashmdashmdash and A M STANFORD 2001 The historical biogeography ofFagaceae tracking the tertiary history of temperate and sub-tropical forests of the northern hemisphere International Jour-nal of Plant Sciences 162 S77ndashS93

MAST A R and T J GIVNISH 2002 Historical biogeography andthe origin of stomatal distributions in Banksia and Dryandra(Proteaceae) based on their cpDNA phylogeny American Jour-nal of Botany 89 1311ndash1323

MESSINGER W K HUMMER and A LISTON 1999 Ribes (Grossu-

94 [Volume 29SYSTEMATIC BOTANY

data did support the monophyly of sects CalobotryaParilla Symphocalyx and Berisia Section Calobotrya is agroup of 21 western North American species (Berger1924) known as the ornamental currants The mono-phyly of sect Calobotrya was well-supported with theinclusion of some dwarf currants (sect Heritieria) (Figs2ndash9 Messinger et al 1999 Senters and Soltis 2003)Sampling was limited in sect Parilla a group of 41dioecious South American species (Janczewski 1907)but the group was supported in ITS trees excludingthe east Asian R fasciculatum the sectionrsquos only non-South American species (Senters and Soltis 2003) Apossible sister relationship between sect Parilla andsect Calobotrya (unpubl data cited in Weigend andBinder 2001) is consistent with the position of sect Pa-rilla seen with ITS data (Senters and Soltis 2003) Sec-tion Symphocalyx the golden currants includes vespecies distributed through northern Mexico and cen-tral and western North America (Berger 1924) Thegolden currants were well-supported given the avail-able sampling (Fig 2 4 9) The alpine currants sectBerisia are a group of 17 dioecious species distributedthrough Eurasia (Janczewski 1907) The monophyly ofsect Berisia was well-supported (Figs 2ndash9 Messingeret al 1999) but with the inclusion of some red currants(sect Ribes) in ITS trees (Senters and Soltis 2003)

The monophyly of sects Ribes and Coreosma wasquestionable (Figs 2 3 5) The red currants (sect Ri-bes) are a group of 15 Eurasian species with one spe-cies R triste also distributed in North America Sec-tion Coreosma the black currants includes six speciesin North America and six in Eurasia (Berger 1924) Sec-tion Heritiera the dwarf currants appeared to be poly-phyletic as seen in Messinger et al (1999) and Sentersand Soltis (2003) This group of six species (Berger1924) is dened primarily by a prostrate habit and assuggested by Messinger et al (1999) is likely a case ofconvergence

Biogeography The spread of taxa around theNorthern Hemisphere has been facilitated by the avail-ability at various times of two major migrationroutesmdashthe Beringian and the North Atlantic landbridges (Tiffney 1985a 1985b Donoghue et al 2001SanmartDaggern et al 2001) Especially in large and relative-ly old clades which have become widespread aroundthe Northern Hemisphere it is possible (perhaps evenlikely) that both pathways were used Information onthe timing of key divergences and on the direction ofmovement within subclades will be critical in sortingout the possibilities in particular cases Ribes providesan excellent example of such a group being represent-ed in Eurasia by six sections (Berisia Ribes and somespecies from Heritiera Coreosma Grossularioides andGrossularia) in western North America by nine (Sym-phocalyx Calobotrya Robsonia Hesperia Lobbia andsome species of Coreosma Heritiera Grossularioides and

Grossularia) and in eastern North America by three(some species of Heritiera Ribes and Grossularia) Oneapproach for sorting through a complex biogeographichistory as might be expected in Ribes is to examinephylogenetic patterns in component clades and ide-ally to date divergences

Our analyses indicate that subg Grossularia is nestedwithin a predominantly western North Americanclade (Figs 2 5ndash9) and that it diversied initially inthat region (Fig 8 node 6) Subsequently within sectGrossularia it appears that movement occurred fromwestern North America to eastern Asia presumablythrough Beringia followed by vicariance and the ori-gin and diversication of the well-supported Asiangooseberry clade Donoghue et al (2001) and Xiangand Soltis (2001) highlighted cases of movement out ofAsia into North America through the Bering LandBridge Ribes appears to provide a case of movementin the opposite direction Movement in both directionsis of course to be expected What remains to be de-termined in future studies of disjunct taxa is exactlywhich groups moved in which directions and whetherthere are any signicant generalizations that can bemade about these different patterns

Elsewhere in Ribes there are other possible cases ofmovement between North America and Asia One caseinvolves R lacustre of sect Grossularioides which is dis-tributed in eastern Asia as well as in North AmericaOther possible cases relate to resolution at the base ofRibes where relationships remain uncertain The basalpositions of sect Symphocalyx in trees resulting frompsbA-trnH data and from the combination of psbA-trnHand ETS data suggest a western North American ori-gin for the entire clade (Figs 2 7) This would implyearly dispersion to Asia giving rise to sects Berisiaand Ribes However all other datasets and dataset com-binations suggested a broader Eurasian plus westernNorth American distribution at the base (Fig 8 node1) owing to the basal positions of sects Berisia andRibes This would imply early vicariance involvingAsia and North America and movement back to Asiawithin the western North American clade Future stud-ies should include more sampling of sects Berisia Ri-bes Coreosma and Symphocalyx to help resolve basal re-lationships and biogeographic patterns in Ribes

The fossil record for Ribes consists largely of leaveswith few reports of seeds (Kremenetski 1998) fruits(Cevallos-Ferriz 1995) and owers (Gandolfo et al1998) The leaf record for Ribes in North America mayextend from approximately 2 mya (Hannibal 1911Dorf 1930 Axelrod 1966) to at least 345 mya (Mac-Ginitie 1953 Manchester 2001) and possibly to 45 or50 mya (Axelrod 1998 Wehr and Hopkins 1994) Al-though leaf features are seldom used to distinguishextant taxa of Ribes Wolfe (1964) used leaf serrationand venation features to distinguish between fossil

2004] 95SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

leaves of subg Ribes and subg Grossularia from Ne-vada If these features are reliable this dates subgGrossularia to at least 14 mya (Fig 9 node 6) A criticalnext step in understanding Ribes biogeography will beto accurately assign Ribes fossils to particular sub-clades so as to infer the timing of intercontinental di-vergences

ACKNOWLEDGEMENTS We thank the following individuals andinstitutions for providing plant material B Alverson D BouffordR Mitchell Arnold Arboretum of Harvard University Universityof California Botanical Garden Royal Botanic Garden EdinburghNew York Botanical Garden and the USDA-ARS National PlantGermplasm Repository A Senters and D Soltis graciously pro-vided numerous DNA aliquots DNA sequences and access to ear-ly manuscripts H Schorn and D Erwin provided assistance withpaleobotanical literature M Lavin P Herendeen and two anon-ymous reviewers provided numerous helpful comments This proj-ect was supported in part by a Putnam Fellowship through theArnold Arboretum of Harvard University

LITERATURE CITED

AVISE J C 1994 Molecular markers natural history and evolutionNew York Chapman amp Hall

AXELROD D I 1966 The Pleistocene Soboba ora of southern Califor-nia University of California Publications in Geological Sci-ences 60

mdashmdashmdash 1998 Thunder Mountain Idaho University of CaliforniaPublications in Geological Sciences 142

BALDWIN B G and S MARKOS 1998 Phylogenetic utility of theexternal transcribed spacer (ETS) of 18Sndash26S rDNA Congru-ence of ETS and ITS trees of Calycadenia (Compositae) Mo-lecular Phylogenetics and Evolution 10 449ndash463

mdashmdashmdash M J SANDERSON J M PORTER M F WOJCIECHOWSKI CS CAMPBELL and M J DONOGHUE 1995 The ITS region ofnuclear ribosomal DNA a valuable source of evidence onangiosperm phylogeny Annals of the Missouri Botanical Garden82 247ndash277

BEARD K H 1998 East of Eden Asia as an important center oftaxonomic origination in mammalian evolution Bulletin of theCarnegie Museum of Natural History 34 5ndash39

BENA G M F JUBIER I OLIVIERI and B LEJEUNE 1998 Ribosom-al external and internal transcribed spacers combined use inthe phylogenetic analysis of Medicago (Leguminosae) Journal ofMolecular Evolution 46 299ndash306

BERGER A 1924 A taxonomic review of currants and gooseberriesNew York Agricultural Experimental Station Technical Bulletin109 1ndash118

BOUFFORD D E and S A SPONGBERG 1983 Eastern Asia-EasternNorth American phytogeographical relationships-a historyfrom the time of Linnaeus to the twentieth century Annalsof the Missouri Botanical Garden 70 423ndash439

CAMPBELL C S M F WOJCIECHOWSKI B G BALDWIN L A AL-ICE and M J DONOGHUE 1997 Persistent nuclear ribosomalDNA sequence polymorphism in the Amelanchier agamiccomplex (Rosaceae) Molecular Biology and Evolution 14 81ndash90

CEVALLOS-FERRIZ S R S 1995 Fruits of Ribes from the Princetonchert British Columbia Canada American Journal of Botany82(6 supplement) 84

COVILLE F V and N L BRITTON 1908 Grossulariaceae NorthAmer-ican Flora 22 193ndash225

CUNNINGHAM C W 1997 Can three incongruence tests predictwhen data shold be combined Molecular Biology and Evolution14 733ndash740

DEQUEIROZ A M J DONOGHUE and J KIM 1995 Separate versuscombined analysis of phylogenetic evidence Annual Review ofEcology and Systematics 26 657ndash681

DONOGHUE M J C D BELL and J LI 2001 Phylogenetic patternsin northern hemisphere plant geography International Journalof Plant Sciences 162 S41ndashS52

DORF E 1930 Pliocene oras of California Carnegie Institution ofWashington Publication 412

FARRIS J S M KALLERSJO A G KLUGE and C BULT 1995 Test-ing signicance of incongruence Cladistics 10 315ndash319

FELSENSTEIN J 1985 Condence limits on phylogenies an ap-proach using the bootstrap Evolution 39 783ndash791

FENTON B A N E BIRCH G MALLOCH P G LANHAM and RM BRENNAN 2000 Gall mite molecular phylogeny and itsrelationship to the evolution of plant host specicity AppliedAcarology 24 831ndash861

FRITSCH P W C M MORTON T CHEN and C MELDRUM 2001Phylogeny and biogeography of the Styracaceae InternationalJournal of Plant Sciences 162 S95ndashS116

GANDOLFO M A P HOC S N SANTILLANA and S A MARENSSI1998 Una or fosil morfologicamente afDaggern a las Grossulari-aceae (orden Rosales) de la Formacion la Meseta (Eoceno me-dio) Isla Marambio Antartida Asociacion Paleontologica Argen-tina Publicacion Especial 5 Paleogeno de America del Sur y de laPenDaggernsula Antartica 147ndash153

GOLDMAN N J P ANDERSON and A G RODRIGO 2000 Likeli-hood-based tests of topologies in phylogenetics SystematicBiology 49 652ndash670

HANNIBAL H 1911 A Pliocene ora from the Coast Ranges ofCalifornia Bulletin of the Torrey Botanical Club 38 329ndash342

HUELSENBECK J P J J BULL and C W CUNNINGHAM 1996 Com-binined data in phylogenetic analysis Trends in Ecology andEvolution 11 152ndash158

JANCZEWSKI M E 1907 Monographies des groseilliers Ribes LMemoires Societe de Physique et DrsquoHistoire Naturelle de Geneve35 199ndash517

KEEP E 1962 Interspecic hybridization in Ribes Genetica 33 1ndash23

KISHINO H and M HASEGAWA 1989 Evaluation of the maximumlikelihood estimate of the evolutionary tree topologies fromDNA sequence data and the branching order in HominoideaJournal of Molecular Evolution 29 170ndash179

KREMENETSKI C V 1998 Holocene history of the northern rangelimits of some trees and shrubs in Russia Arctic and AlpineResearch 30 317ndash333

LINDER C R L R GOERTZEN B V HEUVEL J FRANCISCO-OR-TEGA and R K JANSEN 2000 The complete external tran-scribed spacer of 18Sndash26S rDNA amplication and phylo-genetic utility at low taxonomic levels in Asteraceae andclosely allied families Molecular Phylogenetics and Evolution 14285ndash303

MACGINITIE D 1953 Fossil plants of the Florissant beds ColoradoCarnegie Institution of Washington Publication 599

MADDISON D R and W P MADDISON 2000 MacClade 4 Sun-derland Sinauer Associates

MANCHESTER S R 1999 Biogeographical relationships of NorthAmerican Tertiary oras Annals of the Missouri Botanical Gar-den 86 472ndash522

mdashmdashmdash 2001 Update on the megafossil ora of Florissant Colo-rado Proceedings of the Denver Museum of Nature amp ScienceSeries 4 No1 137

MANOS P S and M J DONOGHUE 2001 Progress in northernhemisphere phytogeography an introduction InternationalJournal of Plant Sciences 162 S1ndashS2

mdashmdashmdash and A M STANFORD 2001 The historical biogeography ofFagaceae tracking the tertiary history of temperate and sub-tropical forests of the northern hemisphere International Jour-nal of Plant Sciences 162 S77ndashS93

MAST A R and T J GIVNISH 2002 Historical biogeography andthe origin of stomatal distributions in Banksia and Dryandra(Proteaceae) based on their cpDNA phylogeny American Jour-nal of Botany 89 1311ndash1323

MESSINGER W K HUMMER and A LISTON 1999 Ribes (Grossu-

2004] 95SCHULTHEIS AND DONOGHUE PHYLOGENY AND BIOGEOGRAPHY OF RIBES

leaves of subg Ribes and subg Grossularia from Ne-vada If these features are reliable this dates subgGrossularia to at least 14 mya (Fig 9 node 6) A criticalnext step in understanding Ribes biogeography will beto accurately assign Ribes fossils to particular sub-clades so as to infer the timing of intercontinental di-vergences

ACKNOWLEDGEMENTS We thank the following individuals andinstitutions for providing plant material B Alverson D BouffordR Mitchell Arnold Arboretum of Harvard University Universityof California Botanical Garden Royal Botanic Garden EdinburghNew York Botanical Garden and the USDA-ARS National PlantGermplasm Repository A Senters and D Soltis graciously pro-vided numerous DNA aliquots DNA sequences and access to ear-ly manuscripts H Schorn and D Erwin provided assistance withpaleobotanical literature M Lavin P Herendeen and two anon-ymous reviewers provided numerous helpful comments This proj-ect was supported in part by a Putnam Fellowship through theArnold Arboretum of Harvard University

LITERATURE CITED

AVISE J C 1994 Molecular markers natural history and evolutionNew York Chapman amp Hall

AXELROD D I 1966 The Pleistocene Soboba ora of southern Califor-nia University of California Publications in Geological Sci-ences 60

mdashmdashmdash 1998 Thunder Mountain Idaho University of CaliforniaPublications in Geological Sciences 142

BALDWIN B G and S MARKOS 1998 Phylogenetic utility of theexternal transcribed spacer (ETS) of 18Sndash26S rDNA Congru-ence of ETS and ITS trees of Calycadenia (Compositae) Mo-lecular Phylogenetics and Evolution 10 449ndash463

mdashmdashmdash M J SANDERSON J M PORTER M F WOJCIECHOWSKI CS CAMPBELL and M J DONOGHUE 1995 The ITS region ofnuclear ribosomal DNA a valuable source of evidence onangiosperm phylogeny Annals of the Missouri Botanical Garden82 247ndash277

BEARD K H 1998 East of Eden Asia as an important center oftaxonomic origination in mammalian evolution Bulletin of theCarnegie Museum of Natural History 34 5ndash39

BENA G M F JUBIER I OLIVIERI and B LEJEUNE 1998 Ribosom-al external and internal transcribed spacers combined use inthe phylogenetic analysis of Medicago (Leguminosae) Journal ofMolecular Evolution 46 299ndash306

BERGER A 1924 A taxonomic review of currants and gooseberriesNew York Agricultural Experimental Station Technical Bulletin109 1ndash118

BOUFFORD D E and S A SPONGBERG 1983 Eastern Asia-EasternNorth American phytogeographical relationships-a historyfrom the time of Linnaeus to the twentieth century Annalsof the Missouri Botanical Garden 70 423ndash439

CAMPBELL C S M F WOJCIECHOWSKI B G BALDWIN L A AL-ICE and M J DONOGHUE 1997 Persistent nuclear ribosomalDNA sequence polymorphism in the Amelanchier agamiccomplex (Rosaceae) Molecular Biology and Evolution 14 81ndash90

CEVALLOS-FERRIZ S R S 1995 Fruits of Ribes from the Princetonchert British Columbia Canada American Journal of Botany82(6 supplement) 84

COVILLE F V and N L BRITTON 1908 Grossulariaceae NorthAmer-ican Flora 22 193ndash225

CUNNINGHAM C W 1997 Can three incongruence tests predictwhen data shold be combined Molecular Biology and Evolution14 733ndash740

DEQUEIROZ A M J DONOGHUE and J KIM 1995 Separate versuscombined analysis of phylogenetic evidence Annual Review ofEcology and Systematics 26 657ndash681

DONOGHUE M J C D BELL and J LI 2001 Phylogenetic patternsin northern hemisphere plant geography International Journalof Plant Sciences 162 S41ndashS52

DORF E 1930 Pliocene oras of California Carnegie Institution ofWashington Publication 412

FARRIS J S M KALLERSJO A G KLUGE and C BULT 1995 Test-ing signicance of incongruence Cladistics 10 315ndash319

FELSENSTEIN J 1985 Condence limits on phylogenies an ap-proach using the bootstrap Evolution 39 783ndash791

FENTON B A N E BIRCH G MALLOCH P G LANHAM and RM BRENNAN 2000 Gall mite molecular phylogeny and itsrelationship to the evolution of plant host specicity AppliedAcarology 24 831ndash861

FRITSCH P W C M MORTON T CHEN and C MELDRUM 2001Phylogeny and biogeography of the Styracaceae InternationalJournal of Plant Sciences 162 S95ndashS116

GANDOLFO M A P HOC S N SANTILLANA and S A MARENSSI1998 Una or fosil morfologicamente afDaggern a las Grossulari-aceae (orden Rosales) de la Formacion la Meseta (Eoceno me-dio) Isla Marambio Antartida Asociacion Paleontologica Argen-tina Publicacion Especial 5 Paleogeno de America del Sur y de laPenDaggernsula Antartica 147ndash153

GOLDMAN N J P ANDERSON and A G RODRIGO 2000 Likeli-hood-based tests of topologies in phylogenetics SystematicBiology 49 652ndash670

HANNIBAL H 1911 A Pliocene ora from the Coast Ranges ofCalifornia Bulletin of the Torrey Botanical Club 38 329ndash342

HUELSENBECK J P J J BULL and C W CUNNINGHAM 1996 Com-binined data in phylogenetic analysis Trends in Ecology andEvolution 11 152ndash158

JANCZEWSKI M E 1907 Monographies des groseilliers Ribes LMemoires Societe de Physique et DrsquoHistoire Naturelle de Geneve35 199ndash517

KEEP E 1962 Interspecic hybridization in Ribes Genetica 33 1ndash23

KISHINO H and M HASEGAWA 1989 Evaluation of the maximumlikelihood estimate of the evolutionary tree topologies fromDNA sequence data and the branching order in HominoideaJournal of Molecular Evolution 29 170ndash179

KREMENETSKI C V 1998 Holocene history of the northern rangelimits of some trees and shrubs in Russia Arctic and AlpineResearch 30 317ndash333

LINDER C R L R GOERTZEN B V HEUVEL J FRANCISCO-OR-TEGA and R K JANSEN 2000 The complete external tran-scribed spacer of 18Sndash26S rDNA amplication and phylo-genetic utility at low taxonomic levels in Asteraceae andclosely allied families Molecular Phylogenetics and Evolution 14285ndash303

MACGINITIE D 1953 Fossil plants of the Florissant beds ColoradoCarnegie Institution of Washington Publication 599

MADDISON D R and W P MADDISON 2000 MacClade 4 Sun-derland Sinauer Associates

MANCHESTER S R 1999 Biogeographical relationships of NorthAmerican Tertiary oras Annals of the Missouri Botanical Gar-den 86 472ndash522

mdashmdashmdash 2001 Update on the megafossil ora of Florissant Colo-rado Proceedings of the Denver Museum of Nature amp ScienceSeries 4 No1 137

MANOS P S and M J DONOGHUE 2001 Progress in northernhemisphere phytogeography an introduction InternationalJournal of Plant Sciences 162 S1ndashS2

mdashmdashmdash and A M STANFORD 2001 The historical biogeography ofFagaceae tracking the tertiary history of temperate and sub-tropical forests of the northern hemisphere International Jour-nal of Plant Sciences 162 S77ndashS93

MAST A R and T J GIVNISH 2002 Historical biogeography andthe origin of stomatal distributions in Banksia and Dryandra(Proteaceae) based on their cpDNA phylogeny American Jour-nal of Botany 89 1311ndash1323

MESSINGER W K HUMMER and A LISTON 1999 Ribes (Grossu-

96 [Volume 29SYSTEMATIC BOTANY

lariaceae) phylogeny as indicated by restriction-site polymor-phisms of PCR-amplied chloroplast DNA Plant Systematicsand Evolution 217 185ndash195

mdashmdashmdash A LISTON and K HUMMER 1993 Restriction site mappingof Ribes nuclear ribosomal DNA Acta Horticulturae 352 175ndash184

MESSLER M R R J COLD and P WILSON 1991 Natural hybrid-ization in western gooseberries (Ribes subgenus GrossulariaGrossulariaceae) Madrono 38 115ndash129

MORGAN D R and D E SOLTIS 1993 Phylogenetic relationshipsamong members of the Saxifragaceae sensu lato based onrbcL sequence data Annals of the Missouri Botanical Garden 80631ndash660

MORT M E D E SOLTIS P S SOLTIS J FRANCISCO-ORTEGA andA SANTOS-GUERRA 2002 Phylogenetics and evolution of theMacaronesian clade of Crassulaceae inferred from nuclearand chloroplast sequence data Systematic Botany 27 271ndash288

REHDER A 1940 Manual of cultivated trees and shrubs New YorkThe MacMillan Company

RIESEBERG L R and J F WENDEL 1993 Introgression and its con-sequences in plants Pp 70ndash109 in Hybrid zones and the evo-lutionary process ed R G Harrison New York Oxford Uni-versity Press

RONQUIST F 1996 DIVA version 11 Computer program andmanual available by anonymous FTP from Uppsala Univer-sity (httpftpuuse)

mdashmdashmdash 1997 Dispersal-vicariance analysis a new approach to thequantication of historical biogeography Systematic Biology46 195ndash203

SANG T D J CRAWFORD and T F STUESSY 1997 ChloroplastDNA phylogeny reticulate evolution and biogeography ofPaeonia (Paeoniaceae) American Journal of Botany 84 1120ndash1136

SANMARTDaggerN I H ENGHOFF and F RONQUIST 2001 Patterns ofanimal dispersal vicariance and diversication in the Hol-arctic Biological Journal of the Linnean Society 73 345ndash390

SENTERS A E and D E SOLTIS 2003 Phylogenetic relationshipsin Ribes (Grossulariaceae) inferred from ITS sequence dataTaxon 52 51ndash66

SINNOTT Q P 1985 A revision of Ribes L subg Grossularia (Mill)Pers Sect Grossularia (Mill) Nutt (Grossulariaceae) in NorthAmerica Rhodora 87 189ndash286

SOLTIS D E and P S SOLTIS 1997 Phylogenetic relationships inSaxifragaceae sensu lato a comparison of topologies basedon 18S rDNA and rbcL sequences American Journal of Botany84 504ndash522

SOLTIS D E M T CLEGG and M DURBIN 1990 rbcL sequencedivergence and phylogenetic relationships in Saxifragaceaesensu lato Proceedings of the National Academy of Sciences USA87 4640ndash4644

mdashmdashmdash E R MORGAN A GRABLE P S SOLTIS and R KUZOFF1993 Molecular systematics of Saxifragaceae sensu latoAmerican Journal of Botany 80 1056ndash1081

SPONBERG S A 1972 The genera of Saxifragaceae in the south-eastern United States Journal of the Arnold Arboretum 53 109ndash498

SUH Y L B THIEN H E REEVE and E A ZIMMER 1993 Molec-

ular evolution and phylogenetic implications of internal tran-scribed spacer regions of ribosomal DNA in WinteraceaeAmerican Journal of Botany 80 1042ndash1055

SULLIVAN J 1996 Combining data with different distributions ofamong-site rate variation Systematic Biology 45 375ndash380

SWOFFORD D 2001 PAUP Phylogenetic analysis using parsi-mony Version 4 Sunderland Sinauer Associates

TIFFNEY B H 1985a Perspectives on the origin of the oristicsimilarity between eastern Asia and eastern North AmericaJournal of the Arnold Arboretum 66 73ndash94

mdashmdashmdash 1985b The Eocene North Atlantic land bridge its impor-tance in tertiary and modern phytogeography of the northernhemisphere Journal of the Arnold Arboretum 66 243ndash273

mdashmdashmdashand S R MANCHESTER 2001 The use of geological andpaleontological evidence in evaluating plant phylogeographichypotheses in the northern hemisphere tertiary InternationalJournal of Plant Sciences 162 S3ndashS17

WEHR W C and D Q HOPKINS 1994 The Eocene orchards andgardens of Republic Washington Washington Geology 22 27ndash34

WEIGEND M and M BINDER 2001 Three new species of Ribes L(Grossulariaceae) from Central and South America System-atic Botany 26 727ndash732

WEINS J J and T W REEDER 1995 Combining data sets withdifferent numbers of taxa for phylogenetic analysis System-atic Biology 44 548ndash558

WEN J 1999 Evolution of the eastern Asian and eastern NorthAmerican disjunct distributions in owering plants AnnualReview of Ecology and Systematics 30 421ndash455

WENDEL J F A SCHNABEL and T SEELANAN 1995a An unusualribosomal DNA sequence from Gossypium gossypioides revealsancient cryptic intergenomic introgression Molecular Phylo-genetics and Evolution 4 298ndash313

mdashmdashmdash mdashmdashmdash and mdashmdashmdash 1995b Bidirectional interlocus con-certed evolution following allopolyploid speciation in cotton(Gossypium) Proceeding of the National Academy of Sciences USA92 280ndash284

WHITE T J T BRUNS S LEE and J TAYLOR 1990 Amplicationand direct sequencing of fungal ribosomal RNA genes forphylogenetics Pp 315ndash322 in PCR protocols a guide to methodsand applications eds M Innis D Gelfand J Sninsky and TWhite San Diego Academic Press

WOLFE J A 1964 Miocene oras from Fingerrock Wash SouthwesternNevada Geological Survey Professional paper 454-N

XIANG Q Y and D E SOLTIS 2001 Dispersal-vicariance analysesof intercontinental disjuncts historical biogeographical im-plications for angiosperms in the northern hemisphere Inter-national Journal of Plant Science 162 S29ndashS39

mdashmdashmdash and P S SOLTIS 1998 The eastern Asian and eastern andwestern North America oristic disjunction congruent phy-logenetic patterns in seven diverse genera Molecular Phylo-genetics and Evolution 10 178ndash190

mdashmdashmdash mdashmdashmdash mdashmdashmdash S R MANCHESTER and D J CRAWFORD2000 Timing the eastern Asian-eastern North American o-ristic disjunction molecular clock corroborates paleontologi-cal estimates Molecular Phylogenetics and Evolution 15 462ndash472