Supporting InformationKusaba et al. 10.1073/pnas.1310653110SI Materials and MethodsCreation of GFPCreERt2 Knock-in to the SLC34a1 Locus. A targetingvector was constructed to insert the eGFPCreERT2 (GCE)transgene and a frt-flanked PGKneobpA selection cassette intothe initiation codon of the Slc34a1 gene. The GCE transgenecomprises an enhanced green fluorescent protein (eGFP) anda tamoxifen inducible Cre-recombinase fusion gene (CreERT2).A negative selectable marker thymidine kinase (MC1TK) cas-sette was also included in the targeting vector to select againstnonhomologous recombination. The genomic sequence of themouse Slc34a1 gene and surrounding sequence was downloadedfrom the University of California, Santa Cruz genome browser(http://genome.ucsc.edu). Repetitive sequences were masked.The lengths of the homology arms were dictated by the repetitiveDNA sequence surrounding the target site, resulting in a 2.6-kb5′ homology arm and 4.5-kb 3′ homology arm.A cloning strategy with suitable restriction enzymes and ap-

propriate primers was chosen based on the sequences of thehomology arms and all transgene cassettes. Homology arms wereamplified from the BAC clone RP24-99D5 using Accuprime Pfx.All DNA oligonucleotides were ordered from Integrated DNATechnologies. Both homology arms and the transgene cassetteswere cloned into pBluescript II. Linearized targeting constructwas electroporated into F1 hybrid (C57BL/6J × 129/Sv) embry-onic stem cells and transfectants were selected by culture inG418 and ganciclovir. Resistant clones were screened by long-range PCR. Positive clones were expanded and underwent blas-tocyst injection using standard procedures.

Animal Experiments.All experiments were performed according tothe animal experimental guidelines issued by the Animal Careand Use Committee at Harvard University. The unilateral is-chemia-reperfusion injury (IRI) surgery was performed exactlyas previously described (1) except that ischemia time was 26 minfor mild injury and 35 min for severe injury. Creation ofthe GFPCreERt2 knock-in to the SLC34a1 locus is detailedabove. For genetic labeling, tamoxifen (Sigma-Aldrich) wasdissolved in 3% (vol/vol) ethanol containing corn oil (Sigma-Aldrich) at a concentration of 10 mg/mL. For adult mice, ta-moxifen was injected intraperitoneally at the indicated doseeither once or every other day. To up-regulate SLC34a1GCEexpression, in some experiments mice were fed a low-phos-phorus (0.06%) diet (TestDiet). For labeling during nephro-genesis, 0.1 mg of tamoxifen was injected intraperitoneallyinto pregnant mice at 14.5 d postcoitum. Mouse renal tubularepithelial primary culture was performed exactly as describedpreviously (2).

Tissue Preparation. Mice were anesthetized and killed, immedi-ately perfused with PBS from the left ventricle, and kidneys wereremoved. For frozen sections, kidneys were fixed with 4% para-formaldehyde for 2 h on ice, incubated in 30% (vol/vol) sucrose at4 °C overnight, and embedded in optimum cutting temperaturecompound (Sakura FineTek) and 7-μm sections were cut. Forparaffin sections, kidneys were fixed with 10% (vol/vol) formalinand paraffin-embedded and 5-μm sections were cut. Immuno-fluorescence protocols and antibodies are detailed below.

Immunofluorescence Analysis and Antibodies. For BrdU staining,sections were rehydrated and permeablized with 0.2% TritonX-100 in PBS for 5min. Antigen retrieval was performed usingheated citrate (Antigen Unmasking Solution; VectorLabs). For

immunostaining of primary cultured tubular epithelial cells, cellsgrown on matrigel-coated coverslips were permeablized with0.2% Triton X-100 and fixed with 4% (vol/vol) paraformaldehydefor 5 min. Samples were blocked with 5% (vol/vol) normal goatserum in PBS and incubated with primary antibodies includingFITC-conjugated anti-Lotus tetragonolobus lectin (LTL) (FL-1321;Vector Labs; 1:1,000), FITC-conjugated anti-Dolichosbiflorus agglutinin (DBA) (FL-1031; Vector Labs; 1:1,000),rabbit anti-vimentin (ab92547; Abcam; 1:500), pig anti-nephrin(GP-N2; Progen Biotechnik; 1:100), goat anti–kidney injurymolecule-1 (KIM-1) (AF1817; R&D Systems; 1:500), rabbit anti-Ki67 (VP-RM04; Vector Laboratories; 1:500), rabbit anti-Pax2(ab92547; Abcam; 1:500), and mouse anti-dsRed (632496; Clon-tech; 1:50). Immunostaining for thymidine analogs was achievedusing two primary antibodies against BrdU, rat anti-BrdU (ab6326;Abcam; 1:250) and mouse anti-BrdU (347580; Becton Dickinson;1:200). Secondary antibodies were either FITC-, Cy3-, or Cy5-conjugated (Jackson ImmunoResearch) and incubated for 1 h.Nuclear counterstaining was performed using DAPI and followedby mounting in Prolong-Gold (Invitrogen). Images were obtainedby confocal (Nikon C1 Eclipse; Nikon) or standard (Nikon Eclipse90i; Nikon) microscopy.

Proximal Tubule Segment Definitions. S1/S2 vs. S3 segments weredistinguished both by anatomic location and by morphologicaldifferences among tubular epithelial cells from each segment. Thetransition from the S2 to S3 segment occurs in the upper half ofthe straight segment of the proximal tubule, and S3 segment brushborder microvilli are substantially longer than those in the S2segment, which aided in identification of S3. Epithelial cells in thedescending limb of the loop of Henle lack microvilli entirely,defining the end of the S3 segment.

RNA Extraction and Real-Time Quantitative PCR. Total RNA wasextracted from 1 × 106 cells using RNeasy kits (Qiagen) followedby cDNA synthesis using iScript cDNA synthesis kit (Bio-Rad).Real-time detection of PCR product was performed by SYBRGreen Master Mix (Bio-Rad), and all of the reactions were donein duplicate. The following primer sequences were used: CD133forward: GAAAAGTTGCTCTGCGAACC; CD133 reverse:TCTCAAGCTGAAAAGCAGCA CD24 forward: CTTCTGG-CACTGCTCCTACC; CD24 reverse: CACATTGGACTTGT-GGTTGC; KIM-1forward: AAACCAGAGATTCCCACACG;KIM-1 reverse: GTCGTGGGTCTTCCTGTAGC; vimentin for-ward: CGGAAAGTGGAATCCTTGCA; vimentin reverse: CAC-ATCGATCTGGACATGCTGT; SLC34a1 forward: CTCATTGT-GGGTGCCCAACATGATG; SLC34a1 reverse: ACCATGTGT-CTCCCACGGACTGGAAG; GAPDH forward: CATGTTCCA-GTATGACTCCACTC; and GAPDH reverse: GGCCTCACCCC-ATTTGATGT.

Quantification of Labeled Cells. For evaluation of recombinationefficiency, tdTomato-positive cells among LTL-positive epitheliawere quantitated in three areas of the kidney: outer cortex, innercortex, and the outer stripe of the medulla. S1 and S2 segmentswere identified as LTL-positive cortical convoluted that were notin straight segments. The S3 segment was identified as the LTL-positive straight tubule connecting to the loop of Henle in theinner stripe of the medulla. The S3 segment was separatelyidentified as either the straight tubule in the cortex and or in theouter stripe of the medulla. Thymidine analog- or Ki67-positive

Kusaba et al. www.pnas.org/cgi/content/short/1310653110 1 of 5

Supporting Information Corrected , March 20 2014

cells were quantitated as the percentage of the total number oftubular epithelial nuclei counted on the basis of DAPI staining.

Separation of tdTomato-Positive Proximal Tubular Epithelia UsingFACS. Tamoxifen (four doses of 3 mg) was injected intobigenic mice followed by 35-min IRI. Two days after IRI, thekidney cortex was minced and a single-cell suspension wasgenerated via liberase digestion for 30 min at 37 °C. Cells werewashed twice with PBS, filtered through 40- and 35-μm cellstrainers, resuspended in PBS and 2% FBS with 1:1,000 DAPI(1 mg/mL), and subjected to FACS using FACSAria II (BDBioscience). Dead cells (DAPI+) were excluded during theFACS. TdTomato+ DAPI− cells were collected in DMEM

and 10% FBS, washed with PBS, and RNA-extracted. Datawere analyzed by FlowJo software (Version 7.5; Tree Star Inc.).For a positive control for the quantitative PCR analysis, bonemarrow cells were harvested from mouse femur using a 27-gaugesyringe. RNA extraction, quantitative PCR and primer sequencesare detailed above.

Statistical Analysis. Results are expressed as mean ± SE. Eachexperiment was performed using at least three mice per group andrepeated in entirety at least once with similar results. The quan-tification was performed from at least 10 high-power field picturesfor each kidney. Statistical analysis was performed using the un-paired t test. P values of < 0.05 were considered to be significant.

1. Fabian SL, et al. (2012) Hedgehog-Gli pathway activation during kidney fibrosis. Am JPathol 180(4):1441–1453.

2. Ichimura T, et al. (2008) Kidney injury molecule-1 is a phosphatidylserine receptor thatconfers a phagocytic phenotype on epithelial cells. J Clin Invest 118(5):1657–1668.

Fig. S1. Schematic illustration of targeting strategy for SLC34a1GFP-Cre ERT2 knock-in allele. A targeting vector was constructed to insert the eGFPCreERT2

(GCE) transgene and a frt-flanked PGKneobpA selection cassette into the initiation codon of the Slc34a1 gene.

Kusaba et al. www.pnas.org/cgi/content/short/1310653110 2 of 5

Fig. S2. A low-phosphorus diet increased recombination efficiency. (A and B) Because a low-phosphorous diet increases SLC34a1 expression, we testedwhether a low-phosphorous diet would increase recombination efficiency. SLC34a1GCE; R26tdTomato mice were fed a low-phosphorous (0.06%) diet for 5 dthen administered 0.05 mg of tamoxifen. An increase in labeling was observed in both S1/2 and cortical S3 segments. Average ± SE. LPD, low-phosphorus diet;ND, normal diet. (Scale bars, 30 μm.)

Fig. S3. Confirmation that mild vs. severe injury induced differential proliferative responses. (A–F). With mild injury, Ki67 expression was observed in the innercortex only, 2 d after IRI. With severe injury, Ki67 expression in the tubular compartment was observed in both the inner and the outer cortex. (G) Quanti-fication of Ki67-positive epithelia after mild vs. severe IRI. Average ± SE. (Scale bars, 30 μm.)

Fig. S4. BrdU uptake reflects cell division in the postischemic kidney. To distinguish between cell division and DNA damage and repair in BrdU-positive cells,kidney was harvested 2 d after IRI and BrdU and Ki67 costaining performed. (A) There were fewer BrdU-positive cells (arrows in A) compared with Ki67-positivecells (B). All BrdU-positive cells also costained for Ki67 (C), indicating that BrdU positivity reflects cell division and not simply DNA damage. Note Ki67-positiveand BrdU-negative cells (arrowheads), which reflect cells that have reentered the cell cycle but did not progress through S-phase during the 3-h BrdU pulse.(Scale bars, 15μm.)

Kusaba et al. www.pnas.org/cgi/content/short/1310653110 3 of 5

Fig. S5. In vitro culture induces tubular dedifferentiation and proliferation. (A–F) TdTomato-positive clone size expanded during culture (arrowhead indicatesthe same particle in the dish, confirming location of the colony across time). (G–I) TdTomato-positive cells costain with Ki67, indicating that these cells arecycling. TdTomato-positive cells are also uniformly positive for vimentin (J–L) and Pax2 (M–O), indicating that these cells underwent dedifferentiation.

Kusaba et al. www.pnas.org/cgi/content/short/1310653110 4 of 5

Fig. S6. Fully differentiated proximal tubular epithelial cells dedifferentiate after injury. Representative immunofluorescence pictures in the inner cortex of35-min IRI kidney showed that some, but not all, tdTomato+ tubular epithelia expresse KIM-1 (A) and vimentin (B, arrowheads). The fraction of KIM-1+ cellsamong tdTomato+ cells was higher in 35-min than in 26-min IRI kidney in both inner and outer cortex (C). The fraction of vimentin+ cells among tdTomato+cells was also higher in 35-min than 26-min IRI kidney in the inner cortex (D). Values are expressed as means ± SE. (Scale bars, 30 μm in A and 15 μm in B.)

Kusaba et al. www.pnas.org/cgi/content/short/1310653110 5 of 5