Sulfabenzamide promotes autophagic cell death in T-47D ... · using the QuantiFast™ SYBR Green PCR Master Mix under the following program: 95˚C for 5 min followed by 40 cycles

Journal of Cell and Molecular Biology 10(1): 41-54, 2012 Research Article 41 Haliç University, Printed in Turkey.

http://jcmb.halic.edu.tr

Sulfabenzamide promotes autophagic cell death in T-47D breast cancer cells through p53/ DRAM pathway

Raziye MOHAMMADPOUR1, Shahrokh SAFARIAN*1, Soroor FARAHNAK1, Sana HASHEMINASL1, Nader SHEIBANI2 1School of Biology, College of Science, University of Tehran, Tehran, Iran 2Department of Ophthalmology and Visual Sciences, School of Medicine and Public Health, University of Wisconsin, Madison, USA (* author for correspondence; [email protected] )

Received: 26 March 2012; Accepted: 29 May 2012

�

Abstract

Sulfonamides exhibit their antitumor effects through multiple mechanisms including inhibition of membrane bound carbonic anhydrases, prevention of microtubule assembly, cell cycle arrest, and inhibition of angiogenesis. Here, sulfabenzamide’s mechanisms of action on T-47D breast cancer cells were determined. Cells incubated with sulfabenzamide exhibited negligible levels of apoptosis, necrosis and cell cycle arrest when compared to untreated cells. These results were confirmed by morphological examinations, DNA fragmentation assays, flow cytometric and real time RT-PCR analysis. Surprisingly, despite negligible detection of DNA fragmentation, a considerable increase in caspase-3 activity was observed in cells incubated with sulfabenzamide. The increased expression ratio of DFF-45/DFF-40 indicated that caspase-3-related DNA fragmentation was blocked and apoptosis symptoms could not be seen. However, the effects of caspase-3 for PARP1 and DNA-PK deactivation resulted in autophagy induction. The overexpression of critical genes involved in autophagy, including ATG5, p53 and DRAM, indicated that in T-47D cells sulfabenzamide-induced antiproliferative effect was mainly exerted through induction of autophagy. Furthermore, downregulation of AKT1 and AKT2 as well as over expression of PTEN resulted in attenuation of AKT/mTOR survival pathway showing that death autophagy should be occurred in sulfabenzamide treatment.

Keywords: Sulfabenzamide, breast cancer, autophagy, apoptosis, p53.

Sülfobenzamid, T-47D meme kanseri hücrelerinde p53/DRAM yolağı aracılığıyla otofajik hücre ölümünü teşvik eder

Sülfonamidler, membrana bağlı karbonik anhidraz inhibisyonunu, mikrotubül toplanmasının engellenmesini, hücre siklusunun durdurulmasını ve anjiyogenez inhibisyonunu içeren çoklu mekanizmalarla antitümör etkilerini göstermektedirler. Burada, T-47D meme kanser hücreleri üzerinde sülfobenzamid mekanizmasının etkisi belirlenmiştir. Sülfobenzamid ile inkübe edilen hücreler uygulama yapılmamış hücrelerle karşılaştırıldıklarında önemsenmeyecek seviyede apoptoz, nekroz ve hücre siklusunun durmasını ortaya koymuştur. Bu sonuçlar morfolojik incelemelerle, DNA fragmantasyon analizleriyle, flow sitometrik ve gerçek zamanlı RT-PCR analizleriyle doğrulanmıştır. Şaşırtıcı bir şekilde, DNA fragmantasyonunun ihmal edilebilecek tespitine rağmen, sülfobenzamidle inkübe edilmiş hücrelerde kaspaz 3 aktivitesinde dikkate değer bir artış gözlenmiştir. DFF-45/ DFF-40’ ın artmış ekspresyon oranı, kaspaz 3 ile ilişkili DNA fragmantasyonunun durdurulduğunu ve apoptoz belirtilerinin görülemeyeceğini işaret etmektedir. Bununla birlikte PARP1 ve DNA-PK deaktivasyonu için kaspaz 3’ün etkileri otofaji indüklenmesiyle sonuçlanmaktadır. ATG5, p53 ve DRAM gibi otofajide yer alan kritik genlerin aşırı ekspresyonu T-47D hücrelerinde sülfobenzamid-indüklenmiş antiproliferatif etkinin çoğunlukla otofaji indüksiyonu aracılığıyla uygulandığını belirtmektedir. Ayrıca, PTEN aşırı ekspresyonu gibi AKT1 ve AKT’’nin azalarak düzenlenmesi, otofaji ölümünün sülfobenzamid uygulamasıyla meydana geldiğini gösteren AKT1/mTOR sağ kalım yolağının etkisinin azalmasıyla sonuçlanmaktadır.

Anahtar kelimeler: sülfobenzamid, meme kanseri, otofaji, apoptoz, p53.

�

42 Raziye MOHAMMADPOUR et al.�

Introduction�

Sulfonamides are synthetic antibacterial agents with diverse pharmacological effects including antibacterial, antiviral, antidiabetic, antithyroid, and diuretic. Their antibacterial effects are contributed to the interfering with enzyme activities responsible for folic acid synthesis by competing for para aminobenzoic acid. These drugs are selectively toxic for prokaryotes (Owa et al., 1999; Fukuoka et al., 2001; Yokoi et al., 2002; Supuran 2003). Two novel sulfonamides, E7070 and E7010, are potently effective against cancer cells via inhibition of tubulin polymerization and proliferation. The matrix metalloprotease (MMP) inhibitory effects of sulfonamides have been evaluated for treatment of arthritis and cancer (Fukuoka et al., 2001; Ozawa et al., 2001; Supuran et al., 2003; Mohan et al., 2006). Sulfabenzamide, 4-Amino-N-benzoyl-benzene-sulfonamide, is a sulfonamide derivative used for treatment of specific vaginal infections in combination with sulfathiazole and sulfacetamide (Valley and Balmer, 1999).

Knowledge regarding alterations in signaling pathways and the type of cell death induced by chemotherapeutic drugs is the first and most important step in design of effective treatments. Furthermore, manipulation of autophagy has the potential to improve anticancer therapeutics. Studies have shown that autophagy protects cancer cells against antitumor effects of some drugs by blocking the apoptotic pathway and maintaining ATP levels. In contrast, other cancer cells undergo autophagic cell death (ACD or type II programmed cell death, PCDII) after anticancer therapies (Kondo et al., 2005; Kondo and Kondo, 2006).

Various anticancer drugs that activate ACD in breast cancer cells have been reported including vitamin D analog, EB1089, Tamoxifen and other antiestrogen agents (Hoyer-Hansen et al., 2005). Tamoxifen induced autophagic pathway occurs through down regulation of AKT activity (Yokoyama et al., 2009). The 3'-methoxylated analogue isocannflavin B (IsoB) exhibits an inhibitory effect on T-47D cell proliferation, which is accompanied by the appearance of an intense intracytoplasmic vacuolization of autophagic origin (Brunelli et al., 2009).

Here, we choose sulfabenzamide for assessing its antitumor activity in T-47D breast cancer cell line. Our main objective was to determine whether this drug can be used as an antitumor drug in

medicine. From this point of view, we could ascertain that there is a correlation between the expression level of some critical genes and induction of death autophagy in T-47D cells.

Materials and methods

Reagents

Culture medium, RPMI 1640, and fetal bovine serum were from Gibco (England); penicillin streptomycin solution, DNA laddering kit, Annexin-V-FLOUS Staining Kit, Propidium Iodide (PI) kit, caspase-3 fluorometric immunosorbent enzyme assay kit, 4',6- Diamidino -2-phenylindole (DAPI) kit were all acquired from Roche (Germany); MTT was from Sigma (England); sulfabenzamide and doxorubicin were from Sina Darou (Iran) and Ebewe Pharma (Austria), respectively. QuantiFast™ SYBR Green PCR master mix and RNeasy plus Mini kit were provided from Qiagen (USA). RevertAidTM M-MuLV reverse transcriptase and random hexamer were purchased from Fermentas (Germany).

Cell culture

Epithelial tumor cell line, T-47D, stemmed from human ductal breast tissue, was provided from National Cell Bank of Pasteur Institute (Tehran, IRAN; ATCC number HTB-133). Cells were maintained in RPMI 1640 medium supplemented with heat-inactivated (35 min, 56°C) fetal bovine serum (10% v/v) and penicillin streptomycin solution (1% v/v) and incubated in humidified condition; 95% air and 5% CO2 at 37°C.

Drug preparation and treatments

Regarding the obtained results from MTT assays, LC50 for sodium sulfabenzamide and doxorubicin after 48 h were estimated at 10.8 and 0.337×10-3 mM, respectively. After reaching confluency (~ 80%), cells were incubated with freshly prepared drugs at the LC50 concentrations, harvested by trypsin-EDTA, washed three times by phosphate-buffered saline, and stored at -70°C.

Cytotoxicity/Viability assay

In brief, 104 cells/well were seeded in a 96 well culture plate and incubated with different concentrations of drugs for 24, 48 and 72 h. MTT was then added to the wells (4 mg/ml or 100 µg/well) and the produced formazan was systematically assessed using Elisa micro plate

Sulfabenzamide promotes autophagic cell death 43�

reader at the wavelength of 570 nm. The percent of cell viability related to each drug concentration was estimated in relation to the untreated sample. All assays were done at least three times unless stated otherwise.

Apoptosis quantification

After washing 106 cells with PBS, cell pellets were re-suspended in 100 µl of ready to use Annexin/PI buffer (20 µl of each Annexin and PI buffer in 1 ml incubation buffer) for 10-15 min at 25˚C. Samples were then diluted in 500 µl of incubation buffer and analyzed by flow cytometry (Partech Pass, USA) using FloMax software.

Cell cycle analysis

5×105 drug treated cells were incubated with DAPI solution (10 µg/ml and 6% Triton X-100 in PBS) for 30 min in the dark at 4ºC. Using a flow cytometer fluorescent emission of applied indicator was detected (excitation and emission wavelength of 359 nm and 461 nm, respectively) and the analysis was performed using FloMax software.

Morphological studies of the apoptotic cells

Cells were cultured on cover slips coated with Poly L-lysine and exposed to drugs for 48 h. Following staining with Annexin V-FITC (20 µg/ml) and PI (20 µg/ml) in the dark for 10-15 min, samples were examined using a fluorescent microscope (Carl Zeiss-Germany) using 450-500 nm excitation and 515-565 nm emission filters.

Measurement of caspase-3 activity

Following drug treatments, cells were harvested and incubated in lysis buffer on ice for 1 minute. After centrifugation, sample supernatants were used for caspase-3 activity measurements using AC-DEVED-AFC fluorescent substrate as recommended by the supplier. The concentration of enzyme-released AFC was estimated using fluorospectrophotometer (HITACHI model MPF4-Japan) at 400 nm excitation and 505 nm emission wavelengths.

DNA laddering assay

2×106 drug treated cells were lysed with an equal volume of binding/lysis buffer for 10 minutes at 15-25ºC. The obtained extract was processed as recommended by the supplier. Electrophoresis of the samples in 1% agarose gel at 75 volt for 90 minutes revealed DNA cleavage pattern of cells

relative to positive control (DNA extracted prepared from U937 cells incubated 3h with 4 µM camptothecin).

Preparation of total RNA, cDNA synthesis and real time RT-PCR

Total RNA was purified using the RNeasy Qiagen kit according to the manufacturer’s recommendation. First strand cDNA was generated using RevertAidTM M-MuLV reverse transcriptase and 5µg of RNA with random hexamer primers. Real time quantitative RT-PCR was performed using the QuantiFast™ SYBR Green PCR Master Mix under the following program: 95˚C for 5 min followed by 40 cycles (95˚C for 10 sec, annealing for 25 sec and extension at 72˚C for 30 sec). Analysis was done using Corbett rotor-gene 6000 software based on the comparative Ct method (or ΔΔCt method). The relative amount of target materials was quantified compared to the reference gene (GAPDH). Primers were prepared by TAG (Copenhagen, Denmark) and were used to amplify specific regions of cDNA as listed in Table1.

Statistical analysis

For all methods statistical analysis were performed by the SPSS version 16 and Excel 2007 softwares. Statistical analysis for MTT assay, flow cytometry, caspase-3 activity were performed by one way ANOVA and real time RT-PCR methods were carried out by t-test. All results are presented as mean ± standard deviation (p< 0.05 was considered statistically significant).

Results

Sulfabenzamide inhibits the proliferation of T-47D cells

The MTT assay was used to evaluate the viability of T-47D cells incubated with different concentrations of sulfabenzamide (0.0-20 mM) or doxorubicin (0.0-0.6 µM) after 24, 48 and 72 h (chemical structures are shown in Figure 1A). We checked toxic effects of doxorubicin on T-47D since it had been reported that its anticancer effects on different cell types exerts through distinct cellular processes (apoptosis or cell cycle arrest). Thus, it could be utilized as a control in our experiments. The 50% growth inhibition (LC50) concentration for sulfabenzamide and doxorubicin after 48 h, were calculated as 10.8 mM and 0.33 µM, respectively, and utilized in the following experiments (Figure 1B).


Table 1. List of primers. Forward and reverse primer pairs for PTEN gene were designed to amplify a region which could not anneal to PTEN pseudogene. Primer for p53 was designed for the mutant form present in T-47D cells.

Gene Accession number primers PCR product(bp)

GAPDH NC_000012.11

F: CCAGGTGGTCTCCTCTGACTTCAACAG

R: AGGGTCTCTCTCTTCTTCCTCTTGTGCTCT

218

ATG5 NC_000006.11

F: GTGAGATATGGTTTGAATATGAAGGC

R: CTCTTAAAATGTACTGTGATGTTCCAA

122

beclin1 NC_000017.10

F: GGAGAGGAGCCATTTATTGAAACT

R: AGAGTGAAGCTGTTGGCACTTTCTG

104

DRAM NC_000012.11

F: CTTGGATTGGTGGGATGTTTC

R: GATGATGGACTGTAGGAGCGTGT

135

AKT1 NC_000014.8

F: CCAGATGGAAAGACGTTTTTGTG

R: GAGAACAAACTGGATGAAATAAA

106

AKT2 NC_000019.9

F: CTGCGGAAGGAAGTCATCATTGC

R: CGGTCGTGGGTCTGGAAGGCATAC

125

caspase-3 NC_000004.11

F: CAAACTTTTTCAGAGGGGATCG

R: GCATACTGTTTCAGCATGGCAC

261

bax NC_000019.9

F: AAGAAGCTGAGCGAGTGTC

R: GGCCCCAGTTGAAGTTGC

157

cyclinB1 NC_000005.9

F: ATGGAACTAACTATGTTGGACTATG

R: AGTATATGACAGGTAATGTTGTAGAGT

138

bcl-2 NC_000018.9

F: AGGGGGAAACACCAGAATCAAGTG

R: CCCAGAGAAAGAAGAGGAGTTATAA

113

AIF NC_000023.10

F: GGTCTTGTGGACAGTAGTTTGCC

R: TCTCACTCTCTGATCGGATACCA

115

p53 NC_000017.10

F:CCTGTGCAGCTGTGGGTTGATTT

R: AGGAGGGGCCAGACCATCGCTAT

150

DFF40 NC_000001.10

F: TTGGAGTCCCGATTTCAGAG

R: CTGTCGAAGTAGCTGCCATTG

194

DFF45 NC_000001.10

F:TTCTGTGTCTACCTTCCAATACTA

R:CTGTCTGTTTCATCTACATCAAAG

127

PARP1 NC_000001.10

F: TAACATTAGTCTGGATGGTGTAGA

R: TTACCTGAGCAATATCATAGACAAT

113

DNA-PK NC_000008.10

F: TGGCATTACAGACATCTTTAGTTT

R: ACTTTAGGATTTCTTCTCTACATTCA

111

PTEN NC_000010.10

F: TGGCTAAGTGAAGATGACAATCATG

R: GCACATATCATTACACCAGTTCGT

81


Figure 1. A) Chemical structure of sulfabenzamide and doxorubicin. B) Viability curve of sodium sulfabenzamide and doxorubicin treated T-47D cells. Percent viability of cells incubated with sodium sulfabenzamide and doxorubicin was calculated relative to the related untreated controls after 24, 48 and 72 h. Each point relates to the mean value of at least three independent experiments. The related correlation coefficient (r2) was adjusted until the best fit for the selected mathematical function was used to interpolate the experimental points.

T-47D cells do not exhibit DNA fragmentation and apoptotic morphology in the presence of sulfabenzamide or doxorubicin

Unlike DNA fragmentation patterns observed in DNA extracted from U937 cells incubated with camptothecin (as a positive control of DNA laddering kit), the gel electrophoresis of DNA prepared from cells incubated with sulfabenzamide (10.8 mM) or doxorubicin (0.33 µM) showed no DNA ladder or smear pattern confirming lack of apoptosis or necrosis in these cells (Figure 2A). Morphological analysis of sulfabenzamide and doxorubicin treated cells, double stained with Annexin-FITC and PI, evaluated by fluorescent microscopy and confirmed the results of DNA laddering analysis. There were few cells having morphological characteristics of apoptotic and

necrotic cells (Figures 2B, 2C). Early (young) apoptotic cells have rounded shape and shiny green membrane because PI cannot penetrate into the cells and Annexin-FITC binds to the externally membrane-exposed phosphatidylserines (Figures 2B, 2C). Late apoptotic and necrotic cells have membrane permeability for PI so their nuclei are stained red (Figure 2C). The main difference between necrotic and late apoptotic cells is the potency of late apoptotic cells for simultaneous staining of nuclei and membrane-exposed phosphatidylserines with PI and Annexin-FITC, respectively. Membrane blebbing, which is a common feature of apoptotic cells was seen in Figure 2B. Evidently, healthy cells cannot be seen under fluorescent microscope since they were not stained with either of the fluorescent dyes (Figure 2E).


Figure 2. A) DNA laddering analysis. 1-3 µg DNA prepared from 2×106 cells was resolved by electrophoresis in a 1% agarose gel. DNA fragmentation was observed only in positive control (camptothecin treated) cells, but it was not detected in control or cells incubated with doxorubicin or sodium sulfabenzamide. B) Observation of the morphology of early apoptotic cells using fluorescent microscopy following double staining with Annexin V-FITC and PI. Morphological characteristics of early apoptotic cells (rounded green shiny cells showing membrane blebbing) in sulfabenzamide treated cells. C) Observation of the morphology of late apoptotic and necrotic cells using fluorescent microscopy following double staining with Annexin V-FITC and PI. Morphological characteristics of late apoptotic (flattened green shiny cells showing red dense nuclei) and necrotic cells (red dense spheres lacking green shiny membrane) in sulfabenzamide treated cells. Similar results were observed for doxorubicin (not shown). Living cells due to lack of staining with dyes are not detectable in fluorescent visual field (E) but are visible using phase contrast microscopy (D).


Figure 3. Caspase-3 activity was increased in cells incubated with sulfabenzamide or doxorubicin. Enzyme activity in the control, sodium sulfabenzamide, or doxorubicin treated cells were 1.308±0.115, 2.07±0.08, and 2.496±0.11 nM.h-1, respectively. Standard curve based on emission (Y axis) of different concentration of free AFC (nM) is plotted (inset). Diagram of free AFC is plotted in 400 nm excitation and 505 nm emission wavelengths.

Table 2. Numerical results of flow cytometry analysis. Results are the mean value ± SD for at least three replicated experiments. Each column named with Qi which includes data related to the quadrant that are Q1

(PI+ and Annexin V-FITC-) or Q1+Q2 (Q2 is the region for PI+ and Annexin V-FITC+) indicated percent value of necrotic cells, and columns Q4 (PI- and Annexin V-FITC+) or Q2+Q4 show percent values of apoptotic cells (see text). Column Q3 (PI- and Annexin V-FITC-) indicates percent value of normal cells. Column of G1, S and G2/M represent the percent value of the cells placed in each related phase of cell cycle. NC, Dox and SU are abbreviations for Negative Control, Doxorubicin and Sulfabenzamide, respectively.

Treated cells

Q3 Q1 Q2 Q4 Q1+Q2 Q2+Q4 G1 S G2

NC 98.94±0.72 0.90±0.46 0.05±0.04 0.35±0.09 0.96±0.50 0.40±0.11 67.06±5.79 16.39±4.27 16.54±3.20

DOX 97.60±1.12 1.33±0.68 0.015±0.02 1.05±0.90 1.34±0.67 1.06±0.90 30.58±1.14 40.55±4.65 28.86±3.51

SU 98.58±0.56 0.27±0.19 0.09±0.08 0.86±0.57 0.37±0.1 0.96±0.54 48.80±4.28 27.47±4.39 22.70±3.79


Caspase-3 activity was increased in the sulfabenzamide and doxorubicin treated cells

Using caspase-3 specific substrate, subsequent releasing of the fluorescent product (AFC) was measured and average enzymatic velocity was calculated (three independent experiments) as 16.6±1.42, 26.2±1.3 and 38.3±0.85 (∆F.h-1, ∆F means fluorescent intensity alteration) for untreated cell, sulfabenzamide or doxorubicin treated cells, respectively. Using the standard curve of free AFC, enzymatic activity was calculated as 1.308±0.115, 2.07± 0.08 and 2.496± 0.11nM.h-1, respectively (Figure 3).

Comparing with untreated cells, caspase-3 activity was increased in drug treated samples. Elevated activity of caspase-3, which is a sign of apoptosis induction, is in contrast with the DNA laddering results and is further discussed below.

Sulfabenzamide did not induce apoptosis but induced a minimal shift from G1 to S and G2/M phases of the cell cycle

Using flow cytometric analysis and Annexin-FITC and PI staining, the incidence of apoptosis and necrosis in untreated, sulfabenzamide, or doxorubicin treated cells were quantified (Figure 4A and Table 2).

Congruent with graph interpretation methods applied in most publications, the sum of cell populations in regions Q2 (PI+ and Annexin V-FITC+) and Q4 (PI- and Annexin V-FITC+) were considered as early and late apoptotic cells (Hsu et al., 2006; Tyagi et al., 2006; Dowejko et al., 2009; LaPensee et al., 2009). In addition, regions Q1 (PI+ and Annexin V-FITC-) and Q3 (PI- and Annexin V-FITC-) indicated necrotic and unscathed populations, respectively. In some publications, cell percentages located in Q1 and Q2 (Q2 is the region for PI+ and Annexin V-FITC+) quarters are considered as necrotic cells (Davis et al., 2000). In these studies, Q4 quarter (PI- and Annexin V-FITC+) represented the percentage of apoptotic cells. Therefore, in Table 2 determination of necrotic cells was performed separately via Q1, as well as Q1+Q2, and the estimation for apoptotic cells was carried out as Q2+Q4 as well as Q4, in order to indicate that the low percentages of apoptotic and necrotic cells observed was not influenced by the applied analytical methods.

Flow cytometry is useful for calculating the percentages of cells existing in various stages of the

cell cycle including G1, S and G2/M. To make a practical use of this technique, cells were stained with DAPI, which enters the nucleus and binds to DNA and emanates fluorescent emission. Although, no significant change in the normal pattern of cell distribution throughout the cell cycle was observed for sulfabenzamide treated cells (18% shift from G1 to S and G2/M) a considerable transition (37%) was detected from G1 to S (main transition) and G2/M in cells incubated with doxorubicin as positive control (Figure 4B and Table 2).

Alterations in expression of proapoptotic, prosurvival and autophagic genes in sulfabenzamide and doxorubicin treated cells

The changes in expression level of apoptotic, cell survival and autophagic genes were evaluated using real time RT-PCR. With respect to the results shown in Figure 5 as well as its insets it can be seen that in sulfabenzamide treatments some apoptotic genes (DFF-45 and DNA-PK ) were over expressed while some others were down regulated (PARP1, Bax, Bcl-2 and AIF) or retained their expression level in a constant condition (DFF-40 and caspase-3). Moreover, some critical genes which are important in cell survival pathway were also down- regulated (AKT1 and AKT2) or over expressed (PTEN). Alterations in gene expression were evaluated for some autophagic genes such as ATG5, p53 and DRAM indicating higher amounts of the related transcripts in drug treated cells relative to the untreated ones. In doxorubicin treated cells some apoptotic genes were focused and their alterations including over expression of caspase-3, DNA-PK, DFF-45 and Bax; down regulation of DFF-40 and constant expression of AIF and PARP1 were evaluated (Figure 5).


Figure 4. A) Two dimensional plots of Annexin V-FITC against PI related to the flow cytometric experiments. Two dimensional diagrams from flow cytometric studies showed that the percentage of apoptotic cells (cells located in the Q4 area or total cells in Q2 + Q4) and necrosis (cell located in Q1 or in Q1+Q2) do not show dramatic differences compared with control cells. B) Effects of sodium sulfabenzamide and doxorubicin on the cell cycle distribution. FL4-A indicates the area under the registered electrical signal of each stained cell. The curves from left to right relate to G1, S, G2/M phases of the cell cycle in control, doxorubicin or sodium sulfabenzamide treated samples.


Figure 5. Quantitative real time RT-PCR analysis histograms. Real time RT-PCR for the selected genes for sulfabenzamide (A) and Doxorubicin (B) treated T-47D cells were determined as described in Methods. The relative amount of target material was quantified compared to the reference gene using the comparative Ct (ΔΔCt) method. The statistical significant differences are indicated with * and ** for 0.01<p<0.05 and p<0.01, respectively. Numerical results are the mean value ± SD for at least three replicated experiments (inset).

Discussion

We determined the inhibitory concentrations of sodium sulfabenzamide and doxorubicin, which decreased T-47D cell viability by 50 percent (LC50) after 48 h, to be 10.8 and 0.337×10-3 mM, respectively (Figure 1B). We postulated that apoptosis is responsible for the 50% decrease in viability of T-47D cells incubated with these drugs. The laddering pattern of cleaved genomic DNA is one of the important hallmarks of apoptosis (Alberts et al., 2008). Figure 2A shows that no laddering was observed in DNA samples prepared from T-47D cells incubated with sulfabenzamide and doxorubicin. Fluorescent microscopic and flow cytometric analysis further confirmed lack of significant apoptosis in T-47D cells incubated with these drugs (Figures 2, 4A and Table 2). This

notion was also confirmed by decreased expression of AIF and PARP1 in sulfabenzamide treatment (Figure 5). Several studies have broadened the role of poly-ADP-ribosylation in cell killing showing that PARP1 activation occurs during AIF induced apoptosis (Yu et al., 2002). In doxorubicin treatment, the constant expression of AIF and PARP1 could also support the lacking of apoptosis since deactivation of PARP1 by caspase-3 could finally negate the possible effects of AIF for apoptosis induction (Figure 5).

An increase in caspase-3 activity was observed in cells incubated with sulfabenzamide or doxorubicin (Figure 3). The increase in caspase-3 activity in T-47D cells incubated with doxorubicin was in parallel with its increased mRNA level (Figures 3 and 5). In contrast, in sulfabenzamide incubated T-47D cells, the cited increase occurred


independent of changes in the related mRNA level (Figures 3 and 5). The increased activity of caspase-3 was negated via overexpression of DFF-45. DFF-45 is the natural inhibitor of DFF-40 (CAD) (Liu et al., 1997). In addition, the increased expression of DFF-45, along with a modest increase (for sulfabenzamide) and a significant decrease (for doxorubicin) in DFF-40 expression (Figure 5), indicated that the increased activity of caspase-3 could be blocked by the increased expression ratio of DFF-45/DFF-40. This reduces the level of active DFF-40 to trigger DNA fragmentation and appearance of apoptotic symptoms. Furthermore, it has been reported that caspases are activated during autophagy in dying cells and are suppressed for apoptosis induction (Martin et al., 2004; Yu et al., 2004). Therefore, it can be deduced that during autophagy, the effects of activated caspase-3 on their downstream substrates (like DFF-40) should be suppressed by special factors (e.g. DFF-45 in T-47D cells) only in those cellular routes which are involved in the appearance of apoptosis symptoms (e.g. DNA fragmentation).

Cell cycle arrest, an important cellular target affected by sulfabenzamide and doxorubicin, was analyzed using flow cytometry. Incubation of T-47D cells with 0.33 µM doxorubicin resulted in a significant accumulation of cells in S phase, and to a lesser extent in G2/M phase of the cell cycle (Figure 4B and Table 2). Thus, doxorubicin exerts its antiproliferative action mainly through cell cycle arrest. Induced mitotic catastrophe following increased activation of cyclinB1/Cdc2 may occur while cells are delayed, particularly in G2 phase of the cell cycle (Lindqvist et al., 2007). The induced G2/M arrest along with down regulation of cyclinB1 expression confirmed that anticancer activity of doxorubicin is not via mitotic catastrophe (Figure 5 and Table 2). In contrast to doxorubicin, minimal cell cycle arrest in S and G2/M phases (totally 18%) was observed in T-47D cells incubated with 10.8 mM sulfabenzamide (Figure 4B and Table2). Thus, cell cycle arrest could not be mainly responsible for a 50% reduction in cell viability in the presence of sulfabenzamide.

As we know, when apoptosis is blocked or delayed autophagy triggered and vice versa. These possibilities are consistent with our findings regarding lack of apoptosis in drug treated cells and induction of autophagy. The induced overexpression of ATG5 supported that autophagy

triggered in the presence of sulfabenzamide (Figure 5). This could be probably occurred through the increase in Bax activity working on mitochondrial membrane to result in activation of caspase-3 for PARP1 and DNA-PK deactivation and autophagy induction. It has been reported that induction of autophagy by PUMA (the p53-inducible BH3-only protein) depends on Bax/Bak and can be reproduced by overexpression of Bax (Yee et al., 2009). Here, in doxorubicin treatment, increase in Bax activity could be occurred in parallel with the increment of Bax transcripts affecting on the cells for caspase-3 activation and changing the cell's destiny toward autophagy (Figure 5). This notion could be also supplied in sulfabenzamide treatment aside from the mild decrease in Bax expression because activation of the existed Bax molecules in the cells could be happened for caspase-3 activation and autophagy induction (Figure 5). It has been also reported that proteolytic cleavage of PARP1, performed by caspase-3, produces specific proteolytic cleavage fragments which are involved in the cell’s decision to change its fate from apoptosis toward autophagy (Munoz-Gamez et al., 2009; Chaitanya et al., 2010). Induction of autophagic cell death is dependent on DNA-PK inhibition (Daido et al., 2005). Thus, the increased activity of caspase-3 could finally deactivate PARP1 (has a decreased and constant expression level in sulfabenzamide and doxorubicin treatments, respectively) and DNA-PK (has an increased and invariable expression level in sulfabenzamide and doxorubicin treatments, respectively) until apoptosis was blocked and autophagy induced (Figures 3 and 5).

Despite the existence of some controversies regarding the possible role of autophagy in tumor progression by promoting cell survival, autophagy can exist as a backup mechanism promoting cellular death when other mortality mechanisms are not functional. Hyperactivation of autophagy above the threshold point leads to unlimited self-eating of the cells causing autophagy or type II programmed cell death (Hoyer-Hansen et al., 2005; Maiuri et al., 2010). Based on our data, downregulation of AKT1 and AKT2 as well as upregulation of PTEN in sulfabenzamide treated cells indicated that cell survival pathways were slowed down (Figure 5). In addition, down regulation of bcl-2 was happened along with the induction of autophagy (Figure 5). It has been reported that targeted silencing of bcl-2 expression (an anti-autophagic gene) in human breast cancer cells with RNA-interference has


promoted autophagic cell death and thus presents a therapeutic potential (Akar et al., 2008).

p53 is involved in decreasing cell survival potency through inactivation of AKT/mTOR pathways, and stimulation of autophagy via transactivation of DRAM (Maiuri et al., 2007). Thus, the observed increased expression level of DRAM and p53 genes support our conclusion that the repression of AKT/mTOR survival pathway (via p53 overexpression) and autophagy induction (via increased DRAM transcripts) are responsible for reduced viability of T-47D cells and induction of death inducing autophagy in the presence of sulfabenzamide (Figure 5). T -47D cells contain only a single copy of the p53 missense mutation (Schafer et al., 2000). It has been reported by various studies that mutant p53 may lose its natural antitumor activity (Lim et al., 2009). Interestingly, in the presence of sulfabenzamide the antitumor activities of mutant form of p53 should return to the normal activities of the wild type form to induce autophagic cell death. This is very similar to the mechanism of action for some antitumor drugs reactivating mutant p53 to kill cancerous cells (Lambert et al., 2009).

Evidently, checking of the protein expression levels using other supplementary methods such as western blotting could provide us better documents to support the presented real time RT-PCR data. But, in our work, we found that the registered alterations for the level of RNA transcripts were in a good consistence with the expected cellular behaviors when the proteins' expression levels or their activities were theoretically going to become changed in parallel with the RNA levels in the cells. Therefore, regardless of some exceptions, evaluating RNA transcripts could provide us an adequate image illustrating the changes in the proteins’ expression levels in the cells.

Conclusions

In summary, we showed that cell cycle arrest (and possibly autophagy) may play a role in action of doxorubicin on T-47D cells. However, the contribution of apoptosis and cell cycle arrest antiproliferative effect of sulfabenzamide on T-47D cells is minimal. These observations are in contrast to many reports in which the mechanism of action of sulfonamide derivatives on cancer cells attributed to the conventional processes of apoptosis and cell cycle arrest. We believe that induction of autophagic cell death in T-47D cells is triggered through p53/DRAM pathway (occurred

along with decreasing of Akt/mTOR pathway) and this is a reasonable cellular axis to justify our results.

Abbreviations

AKT: v-akt murine thymoma viral oncogene homolog, mTOR: Mechanistic Target Of Rapamycin, PTEN: Phosphatase and Tensin homolog, DRAM: Damage Regulated Autophagy Modulator, ATG5:Autophagy related gene 5, Beclin1: Bcl2 Interacting protein 1, PARP1: Poly ADP-Ribose Polymerase 1, DFF-40/CAD: DNA Fragmentation Factor 40/ Caspase-Activated DNase, Bax: Bcl2-Associated X protein, Bcl-2: B-Cell Lymphoma 2, AIF: Apoptosis Inducing Factor, DFF-45/iCAD: DNA Fragmentation Factor 45/inhibitor of Caspase-Activated DNase, Cdc2: Cell Division Cycle protein 2, ARF: ADP Ribosylation Factor, GAPDH: Glyceraldehyde-3-Phosphate Dehydrogenase, ACD: Autophagic Cell Death, PCDII: type II Programmed Cell Death, RPMI: Roswell Park Memorial Institute.

Conflict of interest

The authors declare that they have no competing interest.

Authors' contributions

SS designed the study and experiments, analyzed and interpreted data and also prepared the manuscript. RM carried out the experiments and participated in data analysis as well as writing the initial draft of the manuscript. SH and SF participated in performing the experiments. NS contributed on giving scientific comments and also carried out final editing of the manuscript.

Acknowledgements

Iran National Science Foundation (INSF) and Research Council of University of Tehran have been gratefully appreciated by the authors because of their foundational supports for this work.

References

Akar U, Chaves-Reyez A, Barria M, Tari A, Sanguino A, Kondo Y, et al. Silencing of Bcl-2 expression by small interfering RNA induces autophagic cell death in MCF-7 breast cancer cells. Autophagy. 4: 669–679, 2008.

Alberts B, Johnson A, Lewis J, Raff M, Roberts K, Walter P. Molecular Biology of the Cell.


Garland science Taylor & Francis Group, LLC, UK, 1115-1130, 2008.

Brunelli E, Pinton G, Bellini P, Minassi A, Appendino G, Moro L. Flavonoid-induced autophagy in hormone sensitive breast cancer cells. Fitoterapia. 80: 327-332, 2009.

Chaitanya GV, Steven AJ, Babu PP. PARP-1 cleavage fragments: signatures of cell-death proteases in neurodegeneration. Cell Commun Signal. 8:31-41, 2010.

Daido S, Yamamoto A, Fujiwara K, Sawaya R, Kondo S, Kondo Y. Inhibition of the DNA-dependent protein kinase catalytic subunit radiosensitizes malignant glioma cells by inducing autophagy. Cancer Res. 65: 4368-4375, 2005.

Davis JW, Melendez K, Salas VM, Lauer FT, Burchiel SW. 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) inhibits growth factor withdrawal-induced apoptosis in the human mammary epithelial cell line, MCF-10A. Carcinogenesis. 21: 881-886, 2000.

Dowejko A, Bauer RJ, Muller-Richter UDA, Reichert TE. The human homolog of the Drosophila headcase protein slows down cell division of head and neck cancer cells. Carcinogenesis. 30: 1678-1685, 2009.

Fukuoka K, Usuda J, Iwamoto Y, Fukumoto H, Nakamura T, Yoneda T, et al. Mechanisms of action of the novel sulfonamide anticancer agents E7070 on cell cycle progression in human non-small cell lung cancer cells. Inves New Drugs. 19: 219-227, 2001.

Hoyer-Hansen M, Bastholm L, Mathiasen IS, Elling F, Jaattela M. Vitamin D analog EB1089 triggers dramatic lysosomal changes and Beclin 1-mediated autophagic cell death. Cell Death Differ. 12: 1297–1309, 2005.

Hsu CL, Yen GC. Induction of cell apoptosis in 3T3-L1 pre-adipocytes by flavonoids is associated with their antioxidant activity. Mol Nutr Food Res. 50: 1072-1079, 2006.

Kondo Y, Kanzawa T, Sawaya R, Kondo S. The role of autophagy in cancer development and response to therapy. Nat Rev Mol Cell Biol. 5: 726-734, 2005.

Kondo Y, Kondo S. Autophagy and cancer therapy. Autophagy. 2: 85-90, 2006.

Lambert JMR, Gorzov P, Veprintsev DB, Söderqvist M, Segerbäck, D, Bergman J et al. PRIMA-1 reactivates mutant p53 by covalent binding to the core domain. Cancer Cell. 15: 376-388, 2009.

LaPensee EW, Schwemberger SJ, LaPensee CR, Bahassi E, Afton SE, Ben-Jonathan N. Prolactin confers resistance against cisplatin in breast cancer cells by activating glutathione-S-transferase. Carcinogenesis. 30: 1298-1304, 2009.

Lim LY, Vidnovic N, Ellisen LW, Leong C-O. Mutant P53 mediates survival of breast cancer cells. Brit J Cancer. 101: 1606 – 1612, 2009.

Lindqvist A, Van Zon W, Karlsson Rosenthal C, Wolthuis RMF. Cyclin B1–Cdk1 activation continues after centrosome separation to control mitotic progression. PLoS Biol. 5: 1127-1137, 2007.

Liu X, Zou H, Slaughter C, Wang X. DFF, a heterodimeric protein that functions downstream of caspase-3 to trigger DNA fragmentation during apoptosis. Cell. 8: 175-184, 1997.

Maiuri MC, Galluzzi L, Morselli E, Kepp O, Malik SA, Kroemer G. Autophagy regulation by p53. Curr Opin Cell Biol. 22: 181–185, 2010.

Maiuri MC, Zalckvar E, Kimchi A, Kroemer G. Self-eating and self-killing: crosstalk between autophagy and apoptosis. Nat Rev Mol Cell Biol. 8: 741-752, 2007.

Martin DN, Baehrecke E. Caspases function in autophagic programmed cell death in Drosophila. Development. 131: 275- 284, 2004.

Mohan R, Banerjee M, Ray A, Manna T, Wilson L, Owa T et al. Antimitotic sulfonamides inhibit microtubule assembly dynamics and cancer cell proliferation. Biochemistry. 45: 5440-5449, 2006.

Munoz-Gamez A, Rodriguez-Vargas JM, Quiles-Perez R, Aguilar-Quesada R, Martin-Oliva D, de Murcia G et al. PARP-1 is involved in autophagy induced by DNA damage. Autophagy. 5: 61-74, 2009.

Owa T, Yoshino H, Okauchi T, Yoshimatsu K, Ozawa Y, Sugi NH, et al. Discovery of novel antitumor sulfonamides targeting G1 phase of


the cell cycle. J Med Chem. 42:3789-3799, 1999.

Ozawa Y, Sugi NH, Nagasu T, Owa T, Watanabe T, Koyanagi N et al. E7070, a novel sulphonamide agent with potent antitumour activity in vitro and in vivo. Eur J Cancer. 37: 2275-2282, 2001.

Schafer JM, Lee ES, O'Regan RM, Yao K, Jordan VC. Rapid development of tamoxifen-stimulated mutant p53 Breast Tumors (T47D) in athymic mice. Clin Cancer Res. 6: 4373-4380, 2000.

Supuran CT, Casini A, Scozzafava A. Protease inhibitors of the sulfonamide type: Anticancer, antiinfammatory, and antiviral agents. Med Res Rev. 23: 535-558, 2003.

Supuran CT. Indisulam: an anticancer sulfonamide in clinical development. Expert Opin Investig Drugs. 12: 283-287, 2003.

Tyagi A, Singh RP, Agarwal C, Agarwal R. Silibinin activates p53-caspase2 pathway and causes caspase-mediated cleavage of Cip1/p21 in apoptosis induction in bladder transitional-cell papilloma RT4 cells: evidence for a regulatory loop between p53 and caspase 2. Carcinogenesis. 27: 2269-2280, 2006.

Valley AW, Balmer CM. Pharmacotherapy: A Pathophysiologic Approach. Appleton & Lange, CT. 1957-2012, 1999.

Yee KS, Wilkinson S, James J, Ryan KM, Vousden KH. PUMA and Bax-induced autophagy contributes to apoptosis. Cell Death Differ. 16: 1135–1145, 2009.

Yokoi A, Kuromitsu J, Kawai T, Nagas T, Sugi NH, Yoshimatsu K, et al. Profiling novel sulfonamide antitumor agents with cell-based phenotypic screens and array-based gene expression analysis. Mol Cancer Ther. 1: 275-286, 2002.

Yokoyama T, Kondo Y, Bogler O, Kondo S. Drug Resistance in Cancer Cells (Mehta, K. and Siddik, Z.H., eds). Springer Science+Business Media, LLC: PA. 53-71, 2009.

Yu L, Lenardo MJ, Baehrecke EH� Autophagy and caspases: a new cell death program. Cell Cycle. 3:1124-1126, 2004.

Yu SW, Wang H, Poitras MF, Coombs C, Bowers WJ, Federoff HJ et al. Mediation of poly (ADP-ribose) polymerase-1-dependent cell death by apoptosis-inducing factor. Science. 297: 259-63, 2002.

Documents

Sulfabenzamide promotes autophagic cell death in T-47D ... · using the QuantiFast™ SYBR Green PCR Master Mix under the following program: 95˚C for 5 min followed by 40 cycles