University of Arkansas, Fayetteville University of Arkansas, Fayetteville

ScholarWorks@UARK ScholarWorks@UARK

Graduate Theses and Dissertations

8-2013

Study of Thermotolerance Mechanism in Gossypium Hirsutum Study of Thermotolerance Mechanism in Gossypium Hirsutum

Through Identification of Heat Stress Genes Through Identification of Heat Stress Genes

Jin Zhang University of Arkansas, Fayetteville

Follow this and additional works at: https://scholarworks.uark.edu/etd

Part of the Agronomy and Crop Sciences Commons, Botany Commons, and the Plant Biology

Commons

Citation Citation Zhang, J. (2013). Study of Thermotolerance Mechanism in Gossypium Hirsutum Through Identification of Heat Stress Genes. Graduate Theses and Dissertations Retrieved from https://scholarworks.uark.edu/etd/882

This Thesis is brought to you for free and open access by ScholarWorks@UARK. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of ScholarWorks@UARK. For more information, please contact scholar@uark.edu.

Study of Thermotolerance Mechanism in Gossypium Hirsutum Through Identification of

Heat Stress Genes

STUDY OF THERMOTOLERANCE MECHANISM IN GOSSYPIUM HIRSUTUM

THROUGH IDENTIFICATION OF HEAT STRESS GENES

A thesis submitted in partial fulfillment

of the requirements for the degree of

Master of Science in Crop, Soil and Environmental Science

By

Jin Zhang

Shandong Agricultural University

Bachelor of Science in Bio-science, 2010

August 2013

University of Arkansas

This thesis is approved for recommendation to the Graduate Council

Dr. Vibha Srivastava Thesis Director

Dr. Craig S. Rothrock Dr. Kristofor Brye Committee Member Committee Member

Dr. Derrick M. Oosterhuis Committee Member

ABSTRACT

Heat stress causes major losses to cotton seed and lint yield. Introduction of heat stress

tolerance to Arkansas cotton varieties is highly desirable. However, very little is known about the

molecular basis of heat stress tolerance in cotton. The present study attempted to identify heat

stress tolerance genes in two heat-tolerant cotton cultivars, VH260 and MNH456, originating from

Pakistan. Towards this, the expression profile of the cotton orthologs of seven Arabidopsis heat

stress tolerance genes was studied in these two cultivars, and compared with the two

heat-susceptible cotton cultivars, ST213 and ST4288, originating from Mississippi Delta region.

In addition, physiological parameters such as membrane leakage and chlorophyll fluorescence in

the two set of varieties were studied to analyze the correlation between gene expression and

physiological data. The gene expression data indicated that both heat-tolerant cultivars highly

express heat-shock proteins and heat-shock transcription factors after heat treatment whereas

heat-susceptible cultivars show a lower expression. Similarly, Ascorbate Peroxidase I and

Annexin 8, the two general stress proteins are also highly induced in at least one of the heat

tolerant cultivars in response to heat treatment. No obvious differences were found in

photochemical efficiency of PSII in the four lines. However, heat susceptible cultivars show

greater membrane leakage after heat treatment as compared to the heat tolerant lines. This work

suggests that early induction of heat stress tolerance genes such as heat shock proteins and heat

shock factors play an important role in conferring heat stress on cotton varieties, VH260 and

MNH456.

ACKNOWLEDGEMENTS

I would like to express my gratitude and give credits to all the people that contribute to the

realization of this work. First and foremost, I would like to thank my previous advisor Dr. James

Mc. Stewart for giving me the opportunity doing research in the University of Arkansas and

providing assistantship needed to complete the project. I would also like to express my gratitude to

my advisor Dr. Vibha Srivastava for her guidance, support and active involvement of this research.

Her patience have been challenged but never outreached. I would like to thank Dr. Derrick M.

Oosterhuis for his guidance, research materials and growth chamber offered. Without his constant

support, I would not be able to complete the project. I would like to thank my advisory committee:

Dr. Kristofor Brye and Dr. Craig S. Rothrock for their advice, involvement in the project, and

critical review of my thesis. Also, big thanks to all the fellows in my lab: Aydin, Jamie, Gualab,

Soumen and Linh, and Dr. Oosterhuis’s lab: Toby, Tyson, Nguyen and Dimitra, many days were

spent with you working together and I learnt a lot from you guys.

My last thanks have to go to my parents for all their support through my college career.

Though they are not by my side, but they are always so understanding. Without their love I would

not have made it this far. Thanks for everything that everyone has done for me throughout the years

that helped me in my study and life, and thanks to all my friends (Cheng Li, Xiang Yan, Lei Huang,

Jack Xu and all my brothers and sisters in Fayetteville) to be with me at this great point in my life.

DEDICATION

This edition of the Study of Thermotolerance Mechanism in Gossypium Hirsutum Through

Identification of Heat Stress Genes is dedicated to all master and doctoral students at the

University of Arkansas.

TABLE OF CONTENTS

Study of Thermotolerance Mechanism in Gossypium hirsutum through Identification of

Heat Stress Genes

HYPOTHESIS AND OBJECTIVES ...................................................................................... 1

INTRODUCTION AND LITERATURE REVIEW

Cotton Taxonomy and Development ..................................................................................... 2

Heat Stress in Plants............................................................................................................... 3

Effects of Heat on Cotton Productivity .................................................................................. 4

Cotton in Arkansas ................................................................................................................. 6

Cotton Physiological Responses to High Temperature .......................................................... 7

Hormonal Changes under Heat Stress ................................................................................. 12

Oxidative Damage under High Temperature ....................................................................... 13

Mechanism of Heat Tolerance ............................................................................................. 14

Temperature Sensing and Signaling ..................................................................................... 18

Study of HSPs in Different Cotton Genotypes .................................................................... 20

Literature Cited .................................................................................................................... 22

CHAPTER 1

Comparison of the Physiological Responses to Heat Stress Between the Selected Heat

Tolerant and Heat Susceptible Genotypes of Cotton

Abstract ................................................................................................................................ 34

Introduction .......................................................................................................................... 35

Materials and Methods ......................................................................................................... 36

Statistical analysis ................................................................................................................ 38

Results and Discussion ........................................................................................................ 38

Acknowledgements .............................................................................................................. 41

References ............................................................................................................................ 42

Figure Legends..................................................................................................................... 44

CHAPTER 2

Identification of Cotton Orthologs of Arabidopsis Heat Tolerance Genes

Abstract ................................................................................................................................ 49

Introduction .......................................................................................................................... 50

Materials and Methods ......................................................................................................... 53

Result ................................................................................................................................... 54

References ............................................................................................................................ 59

CHAPTER 3

Study of the Gene Expression Pattern of Heat-Response Genes in the Cotton Cultivars

Exhibiting Heat Tolerance and Susceptibility

Abstract ................................................................................................................................ 63

Introduction .......................................................................................................................... 64

Materials and Methods:........................................................................................................ 66

Result and Discussion .......................................................................................................... 68

References ............................................................................................................................ 73

Figure Legends..................................................................................................................... 78

CONCLUSION ...................................................................................................................... 86

APPENDIX………………………………………………………………………………….87

1

HYPOTHESIS AND OBJECTIVES

Hypothesis

Arabidopsis has been used as a model plant in many molecular and genetic studies for

identifying genes associated with heat tolerance. Cotton orthologs of these Arabidopsis genes will

have the same function i.e. conferring heat tolerance in cotton.

Goal

To understand the thermotolerance mechanism and metabolic pathway involved in heat

stress tolerance in cotton by measuring the expression of cotton orthologs of heat-induced

Arabidopsis genes.

Towards this goal, following objectives were addressed:

1. To compare the physiological responses to heat stress between the selected heat tolerant

and heat susceptible genotypes of cotton.

2. To identify cotton orthologs of Arabidopsis heat tolerance genes

3. To study the gene expression pattern of heat-response genes in the cotton cultivars

exhibiting heat tolerance and susceptibility

2

INTRODUCTION AND LITERATURE REVIEW

Cotton Taxonomy and Development

Cotton is the world’s most important textile fiber and the second most important oil seed

crop. The genus Gossypium can be classified into 45 diploid and 5 allotetrapoid species (Fryxell,

1992). Among these species, four species of domesticated cotton are used for their seeds coats’

spinnable fibers (Lee, 1984). They are G. arboretum, G. herbaceum, G. barbadense, and G.

hirsutum (Brubaker et al., 1999). Though G. arboretum and G. herbaceum are still cultivated in

some parts of Africa and Asia, G. barbadense, and G. hirsutum are the dominant species in world

cotton production. Gossypium hirsutum, which is the indigenous species in Americas, is today the

most widely planted species of cotton in the world, constituting about 90% of production

worldwide (Brubaker et al., 1999).

Five stages of the growth and development of the cotton plant have been characterized:

germination and emergence, seedling establishment, leaf area and canopy development, flower

and boll development, and maturation. Seed germination usually takes 5-10 days for seedling to

emerge (Oosterhuis, 1990). Thirty five to forty days after emergence, the first observable floral

bud is recorded on the 6-9th

node (Beasley, 1975; Oosterhuis, 1990). It takes another 20-25 days

for the first square to anthesis (Beasley, 1975). During anthesis, white flowers open at dawn and

then within the following few hours, pollination occurs (Stewart, 1986; Oosterhuis, 1990).

However, it takes another 12 or more hours to finish fertilization since the pollen tube has to grow

3

down the style into the micropyle (Stewart, 1986). According to Walhood and McMeans (1964),

high successful fertilization rate positively influences the retention of the boll. Thus, cotton yield is

adversely affected when fertilization is adversely affected by environment or other factors

(Stewart, 1986).

Heat Stress in Plants

The global climate is changing fast over the decades. The world concentration of carbon

dioxide (CO2) has risen rapidly from around 350 mmol mol-1

in 1980 to 378 mmol mol-1

in 2007

(Singh et al., 2007). With the increasing human population and energy consumption from fossil

fuels, it is predicted that CO2 concentration will rise even faster in the future. This will directly

lead to the increase of the surface mean temperature. According to a report of the

Intergovernmental Panel on Climatic Change (IPCC), global mean temperature will rise 0.3℃

per decade (Jones et al., 1999) reaching approximately 1 and 3℃ above the present value by years

2025 and 2100. In addition, it is predicted that climate, in the future will have more frequent short

episodes of high temperature (Singh et al., 2007).

Heat shock or heat stress is defined as the increase in temperature that exceeds the level of

plant threshold temperature for a period of time, and causes irreversible damage to plant growth

and development (Wahid et al., 2007). Generally, heat shock or heat stress is caused at 10–15℃

higher than ambient temperature (Wahid et al., 2007). The definition of heat tolerance is the ability

4

of plant to grow and produce economically viable yield under higher temperatures (Peet and

Willits, 1998).

Heat stress due to high ambient temperatures is a worldwide problem that threatens crop

production (Hall, 2001). At extremely high temperatures, plant cells can be damaged or even killed

within minutes because of the catastrophic collapse of cellular organization (Schooffl et al., 1999).

At moderately high temperatures, long-term exposures can lead to the plant injuries or death. High

temperatures can cause direct injuries in the form of protein denaturation and aggregation, and

increased fluidity of membrane lipids. The denatured protein then loses enzyme activity in

chloroplasts and mitochondria, inhibits protein synthesis, induces protein degradation, and breaks

membrane integrity (Howarth, 2005). These injuries eventually lead to plant starvation, inhibition

of growth, reduced ion flux, production of toxic compounds and reactive oxygen species (ROS)

(Schooffl et al., 1999; Howarth, 2005). For example, sugarcane plants exhibit smaller internodes,

increased tillering, early senescence, and reduced total biomass under high temperatures (Ebrahim

et al., 1998).

Effects of Heat on Cotton Productivity

The production of cotton can be affected by many factors. Although yield is greatly affected

by genetics and management practices, the environment also plays an important role during plant

development, and affects plant potential yield. The current temperatures in most of the cotton

producing regions are already close to or above the optimum temperature for growth. All

5

vegetative and reproductive stages can be affected by high temperature. During the vegetative

stage, for example, high day temperature can damage leaf gas exchange properties. During

reproduction, a short period of heat stress can cause significant increases in the dropping of floral

buds and opened flowers (Wahid et al., 2007). Another study showed that high temperature can

not only influence planting seed by delaying germination or loss of vigor, which lead to the

reduction of emergence and seedling establishment (Weaich et al., 1996), but also influence

fertilization and boll retention during flowering and the boll growth period (Snider et al. 2010).

Since elevated temperatures are an important factor that causes impairment of pollen and anther

development (Peet et al., 1998; Sato et al., 2006), the increase in temperature or episodes of heat

stress during summer strongly decreased final yields (Wahid et al., 2007). For instance, a

simulation study with Gossypium hirsutum showed that enhanced CO2, high temperature, and

drought (predicted to occur concurrently) result in a projected 9% reduction in lint yield (Reddy et

al., 2002). Oosterhuis (2002) and Bibi et al. (2005) also found reduced yield when high

temperature occurred in Arkansas during reproductive development of cotton. A strong correlation

between temperature and cotton yield was found in which high temperature during flowering

resulted in lower yields (Oosterhuis, 2002).

Upland cotton is vulnerable to heat stress during the summer. Burke and Oliver (1993)

reported that for various species, the thermal kinetic window (TKW) for enzyme activity strongly

correlates with optimal temperatures for general metabolism and growth. Cotton’s TKW is

6

between 23.5℃ to 32℃ (Burke et al., 1988). Since typical daily high temperatures during summer

are often above this range, heat is a limitation to cotton development and productivity. For instance,

Upland cotton grown under 40/30℃ day/night temperature regime showed 50% decrease of total

shoot biomass compared to cotton grown under optimal 30/20℃ day/night temperature (Reddy et

al., 1991). High temperature can also affect the cotton production through reducing fruit retention

and boll size (Brown, 2001). For example, with higher temperatures above 30℃ daily maximum

temperature, the number of bolls retained per plant declined substantially (Reddy et al., 1991;

Reddy et al., 1992; Reddy et al., 1995; Zhao et al., 2005). Other two studies showed high

temperature negatively impacted boll size: Reddy et al. and Pettigrew (1999, 2008) also found a

significant decline in boll mass under elevated temperatures. According to Pettigrew (2008)

decreased seed number under heat stress caused the decline of boll size and lint yield. And the seed

number is mainly decided by ovule fertilization, which may be strongly affected by high

temperature. In order to overcome negative effects of heat stress, it is important to identify and/or

develop heat‐tolerant cultivars (Wahid et al., 2007). At present, the major constraint for identifying

heat‐tolerant cultivars is the lack of efficient screening tools, such as molecular markers. Better

understanding of the impact of high‐temperature stress on physiological, morphological, and yield

processes is necessary, which would not only mitigate the adverse effects of high‐temperature

stress but also help develop reliable field‐screening tools (Wahid et al., 2007).

Cotton in Arkansas

7

Over 658,362 acres of cotton was planted in 2011 in Arkansas. The production area is mainly

focused in the east part of Arkansas. The Arkansas Delta region, which stretches from Mississippi

County to Chicot County, leads in cotton production. In addition, there are smaller amounts of

cotton produced in southwest Arkansas (Carter, 2012). In 2011, among 75 Arkansas counties,

cotton was grown in 26 of them (FSA, 2012). In Arkansas, cotton planting usually takes place

between mid-April and mid-May. Barber et.al (2012) recommended that it is better to have the

cotton planted before May 9th for northern cotton producers to avoid slight decrease in yield

potential, and planting after May 16th may cause potential yield decreases in both northern and

southern part of Arkansas. Eighty nine percent of cotton was irrigated in Arkansas in 2011.

According to Carter (2012), cotton, which is similar to corn, performs best on deep, well-drained,

medium to coarse textured soils. Cotton is a very important crop to the Arkansas’s economy, and it

ranks as the third highest valued agricultural crop, with a value of approximately $577 million

dollars in 2011 in Arkansas. This accounts for approximately 14% of the total cash receipts for

Arkansas crops, and ranks third among all cotton producing states (NASS, 2012).

During summer in Arkansas, excesses in radiation, drought, and high temperatures are often

the main factors that limit plant growth and crop yield (Guilioni et al., 1997). Heat stress has been

reported as one of the most important causes of reduction in yield and dry matter production in

cotton (Oosterhuis, 2002; Bibi et al., 2005).

Cotton Physiological Responses to High Temperature

8

As under drought stress, cotton plants under heat stress have a general tendency of showing

smaller cells, absence of stomata to reduce water loss, increased stomatal and trichomatous

densities, and greater xylem vessels of both root and shoot (Anon et al., 2004). At the

sub-cellular level, heat stress makes changes in chloroplasts, which strongly influences

photosynthesis. Research has shown that high temperatures curtailed photosynthesis by

modifying the thylakoid structure (Karim et al., 1997). Studies have also revealed that specific

effects of high temperatures on photosynthetic membranes result in the loss of grana stacking or

its swelling (Wahid et al., 2007). Since any constraint in photosynthesis can limit plant growth,

high temperatures negatively affect plant development. Researchers have suggested that the core

sites that can be injured by high temperatures are photochemical reactions in thylakoid lamellae

and carbon metabolism in the stroma (Wise et al., 2004). Furthermore, chlorophyll a and b

degradation was more obvious in developed leaves than developing leaves under high

temperatures (Karim et al., 1997, 1999). It is believed that the production of active oxygen species

is the factor that effects on chlorophyll or photosynthetic apparatus (Camejo et al., 2006; Guo et al.,

2006). High temperatures can also influence the photochemical efficiency of photosystem II

(PSII). PSII is highly sensitive to high temperature. Its activity is greatly decreased or even

partially stopped under heat stress (Bukhov et al., 1999; Camejo et al., 2005). This phenomenon

can be understood in the following two ways: First, because of the dissociation of oxygen

evolving complex (OEC) under heat stress, the imbalance occurs between the electron flows from

OEC toward the acceptor side of PSII (De Ronde et al., 2004). Second, heat stress causes

9

dissociation of manganese (Mn)-stabilizing 33-kDa protein and release of Mn atoms at PSII

reaction center complex (Yamane et al., 1998). Heat stress also impairs other parts of the reaction

center, like the D1 and/or the D2 proteins (De Las Rivas and Barber, 1997). This allows proline as

an alternative internal e- donor to donate electrons to PSII (Ronde et al. 2004).

High temperature influences plant photosynthetic capacity. It alters the energy distribution

and changes the activities of carbon metabolism enzymes, particularly the

ribulose-1,5-bisposphate carboxylase/oxygenase (rubisco) (Wahid et al., 2007). Arguments

existed whether high temperature inhibits photosynthesis through inactivation of rubisco or

ribulose-1,5-bisphosphate (RuBP) regeneration capacity. Feller et al. (1998) reported that rubisco

was inhibited at temperatures above 35℃ when upland cotton leaf tissue was exposed to

increasing temperature. However in field-grown Pima cotton, Wise et al. (2004) revealed that

under 39.4℃, leaf photosynthesis was functionally limited by the limitation of electron transport

and RuBP regeneration capacity. These researches suggested that electron transport and RuBP

regeneration were sensitive to short-term, moderately high temperature (Snider et al., 2010). Also,

high temperatures cause a decrease of biochemical reaction rate, and inactivation and denaturation

of enzymes, which result in severe reduction of photosynthesis (Nakamoto and Hiyama, 1999).

The imbalance between photosynthesis and respiration is another well-known outcome of

heat stress in plants. Generally, under high temperatures, with the decrease of photosynthesis rate,

dark- and photo-respiration rates increase considerably. For example, photorespiration in cotton at

10

moderately high temperature (35℃) has been shown to represent approximately 50% of

photosynthesis (Perry et al., 1983). Keys et al. (1977) also reported the increase in

photorespiration and decrease in photosynthesis in wheat under stress. The reason is attributed to

an increase in the oxygenase/carboxylase activity of rubisco under heat stress (Hall & Keys,

1983).

Dark respiration rates also highly increase under heat stress. For instance, research on bean

showed that respiration rate in beans exposed to high day/night temperature doubled than those

under the control temperature (Cowling and Sage, 1998). Also, according to Loka and Oosterhuis

(2012), high night temperatures caused a significant increase in respiration rates, which resulted

in a reduction of leaf energy levels and carbohydrate content. Since high respiration consumes

more carbohydrate, it will then decrease the carbon allocation to the sink organs. In cotton,

carbohydrate needs to be translocated from adjacent leaves to cotton bolls. The carbon

assimilation of the capsule wall also supports the development of cotton bolls (Wullschleger and

Oosterhuis, 1990; Wullschleger et al., 1991). Because high temperature increased respiratory

losses and decreased photosynthetic rates, it is expected to directly increase boll abscission rates.

According to Zhao et al. (2005) significantly higher abscission rates were observed in cotton

plants exposed to a higher day/night temperature regime (36/28℃) than those at optimal

temperature (30/22℃). Zhao et al. (2005) also claimed that significantly lower nonstructural

carbohydrate levels in the developing bolls is the main factor that contributes to boll abscission.

11

As a conclusion, carbohydrate limitation was the primary reason for fruit abscission. Under low

to moderate heat stress, a reduction in source and sink activities may occur leading to severe

reductions in growth, economic yield and harvest index (Wahid et al., 2007). Research showed that

even upland cotton exposed to a temperature of 40℃ for only 15 minutes had reduction of

translocation, which could be explained by the increased callose deposition on the sieve plates of

phloem cells (McNairn, 1972).

Cell membrane thermostability should also be taken into consideration under high

temperatures. Many processes including photosynthesis and respiration require a stable

environment and sustained function of cellular membranes (Blum, 1988). Heat stress accelerates

molecule movement across membranes, which result in loosening chemical bonds within

molecules (Wahid et al., 2007). Both denaturation of proteins and increase in unsaturated fatty

acids then result in more fluidity of the lipid bilayer of biological membranes (Savchenko et al.,

2002). Because the tertiary and quaternary structures of membrane proteins can be easily altered

under high temperature, the biological membranes are very vulnerable to heat stress. Such

alterations increase membrane permeability, leading to increased loss of electrolytes. Solute

leakage has been used as a measurement of heat-stress tolerance in diverse plant species, since it

could be an indication of decreased cell membrane thermostability (CMT) (Ashraf et al., 1994).

Research in Arabidopsis showed, total lipid content in membranes decreased 50% and the ratio of

unsaturated to saturated fatty acids decreased to 1/3 in those plants grown under high temperature

12

as compared to plants grown in normal temperature (Somerville and Browse, 1991).

Hormonal Changes under Heat Stress

Though the ability to tolerate specific stresses varies among species, it is well known that

plants can monitor and adapt to unfavorable environmental conditions. Hormones play an

important role in this process. Organisms have the ability to organize and identify different inputs

and respond appropriately through cross-talk in hormone signaling (Wahid et al., 2007). Heat

stress can alter hormones in many aspects including hormonal homeostasis, stability, content,

biosynthesis and compartmentalization (Maestri et al., 2002).

The stress hormone, abscisic acid (ABA), regulates many physiological properties. Like

other environmental stresses, heat stress can result in increased levels of ABA (Larkindale and

Huang, 2005). In the field, where heat stress is combined with drought stress, ABA induction

plays an important role in thermotolerance. It is suggested that ABA is involved in biochemical

pathways, which are indispensable for plants survival under heat and drought stress (Maestri et al.,

2002). One function of ABA is to modify gene expression. Analysis has been done on

ABA-responsive promoters, which includes several potential cis- and trans-acting regulatory

elements (Swamy and Smith, 1999). ABA can mediate up- or down-regulation of numerous genes

to help plant acclimate/adapt to dry environment (Xiong et al., 2002). Other researches also claim

that several heat shock proteins (HSPs) (e.g. HSP70) are also induced by ABA, which may be a

part of thermotolerance mechanism (Pareek et al., 1998). What’s more, heat shock transcription

13

factor 3 (HSF3) is ABA inducible as well (Rojas et al., 1999).

Salicylic acid (SA), another hormone, was also suggested to be responsive to heat-stress.

One function of SA is to clear the reactive oxygen species (ROS) and sugars at different plant

stages (Clarke et al., 2004; Frank et al., 2009; Larkindale and Huang, 2005). As a stress signaling

substrate, SA has been found to protect potato, mustard, tomato, bean, and Arabidopsis from heat

stress (Dat et al., 1998; Larkindale and Knight, 2002; Lopez- Delgado et al., 2009). SA can also

help heat shock transcription factors bind to the promoter of related genes (Wang and Li, 2006).SA

can also stabilize the trimers of heat shock transcription factors, which help them bind heat shock

elements to the promoter of related genes (Wang and Li, 2006).

Oxidative Damage under High Temperature

Heat stress can cause oxidative damage. Incomplete reduction of O2 from inefficient

photosynthetic or respiratory electron transport will result in reactive oxygen species (ROS)

accumulation (Iba, 2002; Agarwal et al., 2005). Generation of ROS due to high temperature leads

to cellular injury symptoms such as increasing of solute leakage and molecular damage (Liu and

Huang, 2000). ROS, which includes singlet oxygen (1O2), superoxide radical (O2−), hydrogen

peroxide (H2O2), and hydroxyl radical (OH−), can cause the autocatalytic peroxidation of

membrane lipids and pigments that results in the loss of membrane semi-permeability (Xu et al.,

2006).

14

Chloroplasts and mitochondria are the places where superoxide radicals are regularly

synthesized, as well as microbodies (Wahid et al., 2007). Superoxide dismutase (SOD), which

functions in eliminating O2−

produces H2O2 at the same time. H2O2 is then removed by ascorbate

peroxidase (APX) or catalase (CAT). While comparing with O2−

and, H2O2, OH− is more toxic.

OH− can cause damage to chlorophyll, proteins, DNA, lipids and other important macromolecules

that fatally affect plant metabolism, and finally lead to decrease in growth and yield (Sairam and

Tyagi, 2004).

Plants protect cells from oxidative damage through both enzymatic and non-enzymatic

detoxification mechanisms (Sairam and Tyagi, 2004). For instance, a number of physiological

changes occur upon overexpression of Superoxide dismutase (SOD) in plants. These changes

include removal of H2O2, oxidation of toxic reductants, biosynthesis and degradation of lignin in

cell walls, auxin catabolism, defensive responses to wounding, defense against pathogen or insect

attack, and some respiratory processes (Scandalios, 1993).

Mechanism of Heat Tolerance

In order to survive under high temperatures, plants have several different mechanisms

which include phenological and morphological adaptations, and avoidance or acclimation

mechanisms (Wahid et al., 2007). Changing leaf orientation, transpirational cooling, or alteration

of membrane lipid compositions, all belong to these mechanisms. Also, plants at different

developmental stages, and different tissues may have different thermotolerance mechanisms

15

(Queitsch et al., 2000). When stress occurs, stress signals, such as osmotic, ionic effects, changes in

temperature, and membrane fluidity, are created, which trigger downstream signaling processes.

The activation of stress-responsive mechanisms can help recover homeostasis and repair damaged

proteins and membranes (Wahid et al., 2007).

As a response to heat stress, plants undergo a series of molecular protective reactions. For

example, plants can change membrane composition to maintain functional integrity, and activate

oxidative defense systems, which are essential for cellular protection (Clarke et al., 2004;

Larkindale and Knight, 2002; Larkindale and Huang, 2005). Among these molecular protective

reactions, heat shock proteins (HSPs) play a crucial role. After plant is exposed to high

temperatures, changes occur at the molecular level. These changes include changing in expression

of genes and synthesis of stress-related proteins (Iba, 2002). HSPs, located in the cytoplasm and a

variety of cellular organelles, are evolutionarily conserved groups of molecules, and are

ubiquitous in all species (Iba, 2002; Vierling 1991). According to the difference of molecular

weights of HSPs, they are divided into five groups: HSP100s; HSP90s; HSP70s; HSP60s; and

small HSPs (sHSPs; 12–40 kDa) (Wang et al., 2004). It is widely accepted that HSPs function as

molecular chaperones to prevent aggregation and denaturing of cell proteins in response to high

temperature, and then to promote the appropriate refolding of denatured proteins (Frydman, 2001).

Specifically, HSPs help distorted proteins fold into normal shape and help shuttling old proteins to

“garbage disposals” (Wahid et al., 2007). For example, according to Sung et al. (2001) the

16

HSP70 group, one of the most conserved gene families, can promote the denatured protein

refolding under heat stress. Further, Su and Li (2008) confirmed the importance of plastid stromal

Hsp70s in basal thermotolerance of Arabidopsis. Involvement of HSPs as integral components of

acquired thermotolerance is well documented not only in plants but also in animals (Iba, 2002;

Vierling 1991). In addition, heat-shock transcription factors (HSFs), which bind heat-shock

promoter elements (HSEs) in the promoter regions, can regulate heat-inducible gene expression,

including that of HSP genes (Hsu et al., 2010).

Small HSPs can assemble heat shock granules (HSGs) and their disintegration. This will

benefit plant cells survival under continuous high temperature stress conditions (Miroshnichenko

et al., 2005). It was observed in a heat-tolerant line (ZPBL-304) of maize that under heat stress,

increased amount of chloroplast protein synthesis occurred as it is known that the presence of

HSPs can prevent protein denaturation caused by high temperature (Moriarty et al., 2002). The

conformational dynamism and aggregate state of small HSPs may be vitally important in

protecting plant cells from adverse effects of heat stress (Schooffl et al., 1999; Iba, 2002). For

example, Miroshnichenko et al. (2005) reported that: “small HSPs combined and formed into a

granular structure in the cytoplasm, which may function in protecting the protein biosynthesis

machinery in tomato plants under heat stress.” Several studies mentioned the involvement of

HSPs/chaperones in other stress-response mechanisms (Wang et al., 2004). The HSPs/chaperones

not only participate in regulating cellular redox state (Arrigo, 1998), but also in stress signal

17

transduction and gene activation (Nollen and Morimoto, 2002). HSPs can interact with the

stress-response mechanisms of osmolytes and antioxidant production as well (Wahid et al., 2007).

Besides HSPs, there are a number of other plant proteins that are involved in plant

thermotolerance mechanisms. Many researches have confirmed the expression of ubiquitin (Sun

and Callis, 1997), Pir proteins (Yun et al., 1997), late embryogenesis abundant (LEA) proteins

(Goyal et al., 2005) and dehydrins (Arora et al., 1998) under heat stress. It is also reported that

these proteins mainly function in protecting cellular and sub-cellular structures against oxidative

damage and dehydration forces.

Thermotolerance is the ability of an organism dealing with excessively high temperatures

(Wahid et al., 2007). It is well known that plants can acquire thermotolerance probably within

hours in order to survive under high temperatures (Vierling, 1991). It is an autonomous cellular

phenomenon, which can be acquired through exposure to a short but sublethal high temperature

as pretreatment. With the acquisition of high level of thermotolerance, a plant can protect its cells

from the subsequent lethal heat stress (Vierling, 1991). A number of processes are involved in the

acquisition of thermotolerance. Studies on Arabidopsis mutants have shown that not only heat

shock proteins (HSP32 and HSP101), but also ABA, ROS and SA pathways are involved in the

development and maintenance of the acquired thermotolerance (Larkindale and Huang, 2005;

Charng et al., 2006). According to Wahid et al. (2007), acquired thermotolerance is principally

related to the display of heat shock response, and accomplished by reprogramming of gene

18

expression, which allows plants to survive under heat stress. Since heat-stress responses in

plants are similar to other environmental stresses, such as cold and drought, the study of

acquired thermotolerance can provide useful information for general stress tolerance in

plants (Rizhsky et al., 2002).

Temperature Sensing and Signaling

The induction of the sensor of heat stress and transport of the generated thermal signal,

which can switch on adaptive response mechanisms, are important parts of stress tolerance.

Multiple stress perceptions and signaling pathways are involved in heat response mechanisms,

among these mechanisms, some are specific to heat response, while others are involved in

various steps in general stress responses (Chinnusamy et al., 2004). General response to stress

involves signaling of the stress via the redox system. Genomic re-programing was activated

by chemical signals such as ROS, Ca2+

and plant hormones via signaling cascades (Joyce et

al., 2003; Suzuki and Mittler, 2006).

Various signaling molecules, as well as ions are involved in temperature sensing and

signaling. When plants are under heat stress, cytosolic Ca2+ sharply rises (Larkindale and Knight,

2002). It seems that it is the increase of Ca2+ concentration in cytosol that transduces high

temperature induced signals to Mitogen Activated Protein Kinase (MAPK). MAPK cascades,

which have a crucial function in signal transduction pathways in plants, are considered to have a

prominent role in coping with many responses to external signals (Kaur and Gupta, 2005). Due

19

to the heat stress, significant changes appear in membrane fluidity, and cytoskeletal remodeling

triggers the activation of the heat-shock activated MAPK (HAMK) (Sangwan and Dhindsa, 2002).

On the other hand, the expression of HSPs also has close relation with Ca2+ influx and the action

of Ca-dependent protein kinases (CDPK) (Sangwan and Dhindsa, 2002). Even though some

former research claims that Ca2+ is not required for the production of HSPs in plants (Gong et al.,

1997), the later study proved that heat stress not only induces uptake of Ca2+

, but also induces

calmodulin (CaM) related genes. Since CaM can be active through binding Ca2+

, it can then

induce a cascade of regulatory events and regulation of many HSP genes (Liu et al., 2003). The

involvement of Ca2+ in the regulation of plant responses to various environmental stresses has also

been proven by several studies. Environmental injury could be alleviated during environmental

stresses through the increase of cytosolic Ca2+ content. However, according to Wang and Li (1999),

too much Ca2+ released or sustained high cytosolic Ca

2+ concentration might also be toxic to living

cells.

There are many potential signaling molecules including SA, ABA, CaCl2, H2O2, and ACC

that may have direct or indirect function in plant heat resistance. These molecules may alleviate

high temperature injury by reducing oxidative damage (Larkindale and Huang, 2004). A few

years ago, researchers showed more interest in the function of H2O2 and NO in plant cell

signaling under stressful situations (Dat et al., 2000). Another report suggested that MAPK

cascade is activated by H2O2. Also according to Liusia et al. Methyl-SA is involved in the

20

major signaling pathway in certain gene’s activation under heat stress (Llusia et al., 2005). As a

conclusion, Wahid et al. (2007) suggested that although numerous molecules including ROS,

hormones and ethylene have been identified for the perception of heat stress cues, Ca2+

seems to

play a special role in adaptive steps in coping with heat stress including sensing of high

temperature and induction of signaling cascades.

Accumulation of compatible osmolytes, which include salinity, water deficit and extreme

temperatures, is another necessary adaptive mechanism in many plants grown under abiotic

stresses. The accumulation of certain organic compounds of low molecular mass, is generally

referred to as compatible osmolytes (Hare et al., 1998; Sakamoto and Murata, 2002). When

environmental stress occurs, different plant species may accumulate different types of osmolytes

such as sugars and sugar alcohols (polyols), proline, tertiary and quaternary ammonium

compounds, and tertiary sulphonium compounds (Sairam and Tyagi, 2004). Accumulation of such

solutes may allow plants to cope with dehydration.

Study of HSPs in Different Cotton Genotypes

Heat shock proteins (HSPs) play a crucial role in thermotolerance mechanisms under high

temperature. Because of the existence of HSPs, plants can tolerate and survive under heat stress.

HSPs directly and indirectly improve many physiological phenomena including photosynthesis,

carbon assimilation and partitioning, water and nutrient use efficiency, and membrane stability

(Camejo et al., 2005; Ahn and Zimmerman, 2006; Momcilovic and Ristic, 2007). These

21

improvements allow and make it possible for plants to grow and develop under heat stress.

However, due to the difference between species, the heat tolerance ability varies. The tolerance

also varies between genotypes within a species. There exists tremendous variation within and

between species, making it possible for breeders to improve crop’s heat-stress tolerance through

genetic means. Some conventional plant breeding protocols have been successfully developed,

which aim at improving heat-tolerance of cotton (Ehlers and Hall, 1998; Camejo et al., 2005).

Molecular breeding and genetic engineering have become novel additional tools, which could be

applied in plant breeding to develop heat tolerant genotypes.

Up to now, only a few studies have been done on thermotolerance mechanisms in cotton.

Research at molecular level needs to be done to reveal the thermotolerance mechanisms in cotton.

Only a few genes have been identified that enhance drought and heat tolerance in upland cotton.

According to Maqbool et al. (2009), GHSP26 is a Gossypium arboreum alpha-crystalline heat

shock protein gene that enhances drought tolerance. In their research, real-time quantitative PCR

(qPCR) analysis was used to detect the expression level of GHSP26 in transgenic cottons under

stressed conditions. Results showed that GHSP26 overexpressed in transgenic upland cotton

plants under drought stress. Another research suggested that the ectopic expression of the SAP5

(AT3G12630) gene improved drought and heat tolerance in transgenic cotton

(Gossypium hirsutum) (Hozain et al., 2012). SAP5 gene is a member of the stress-associated

family of genes that encode proteins containing A20/AN1 zinc finger domains. Their research

22

suggested that through up-regulating the expression of endogenous stress-responsive genes, the

expression of SAP5 protected photosystem (PSII) complexes from photodamage after drought

stress. In addition, transgenic plants which contain SAP5 were significantly more heat tolerant

than wild-type plants (Hozain et al., 2012). There are still many genes related to heat tolerance yet

to be identified in cotton.

Literature Cited

Agarwal, S., Sairam, R.K., Srivastava, G.C., Tyagi, A., and Meena, R.C., 2005. Role of ABA,

salicylic acid, calcium and hydrogen peroxide on antioxidant enzymes induction in wheat

seedlings. Plant Sci. 169: 559-570.

Ahn, Y.-J., and Zimmerman, J.L., 2006. Introduction of the carrot HSP17.7 into potato (Solanum

tuberosum L.) enhances cellular membrane stability and tuberization in vitro. Plant Cell

Environ. 29: 95–104.

Anon, S., Fernandez, J.A., Franco, J.A., Torrecillas, A., Alarcon, J.J., and Sanchez-Blanco, M.J.,

2004. Effects of water stress and night temperature preconditioning on water relations and

morphological and anatomical changes of Lotus creticus plants. Sci. Hortic. 101: 333–342.

Arora, R., Pitchay, D.S., and Bearce, B.C., 1998. Water stress induced jheat tolerance in

geranium leaf tissues a possible link through stress proteins. Physiol. Plant. 103: 24–34.

Arrigo, A.P., 1998. Small stress proteins: chaperones that act as regulators of intracellular redox

state and programmed cell death. Biol. Chem. 379: 19–26.

Ashraf, M., Saeed, M.M., and Qureshi, M.J., 1994. Tolerance to high temperature in cotton

(Gossypium hirsutum L.) at initial growth stages. Environ. Exp. Bot. 34: 275–283.

Barber, T., and McClelland, B., 2012. 2012 Arkansas Cotton Quick Facts. University of Arkansas

Division of Agriculture, Research and Extension. pp:1-5.

Beasley, C.A., 1975. Developmental morphology of cotton flowers and seed as seen with the

scanningelectron microscope. Am J Bot. 62: 584-592.

23

Bibi, A.C., Oosterhuis, D.M., Gonias, E.D., Bourland, F.M., 2005. Screening a diverse set of cotton cultivars for

high temperature tolerance. In D.M. Oosterhuis (ed.) Proceedings of the 2004 Cotton Research Meeting and

Summaries of Research in Progress. Arkansas Agricultural Experiment Station. pp: 39-43.

Blum, A., 1988. Plant Breeding for Stress Environments. CRC Press Inc., Boca Raton, Florida.

pp: 223.

Blum, A., Klueva, N., and Nguyen, H.T., 2001. Wheat cellular thermotolerance is related to yield

under heat stress. Euphytica. 117: 117–123.

Brown, P.W., 2001. Heat stress and cotton yields in Arizona. In: Cotton: A College of Agriculture

Report. AZ1224. College of Agriculture, Univ. of Arizona, Tucson, AZ. 7p.

Brubaker, C.L., Buorland, F.M., and Wendel, J.F., 1999. Chapter 1.1. The origin and

domestication of cotton. In Smith, C.W., and Cothren, J. T., (eds.) 1999. Cotton: Origin,

History, Technology, and Production. John Willie & Sons, Inc., Danvers, MA. pp: 3-31.

Bukhov, N.G., Wiese, C., Neimanis, S., and Heber, U., 1999. Heat sensitivity of chloroplasts and

leaves: leakage of protons from thylakoids and reversible activation of cyclic electron

transport. Photosyn. Res. 59: 81–93.

Burke, J.J., and Oliver, M.J., 1993. Optimal thermal environments for plant metabolic processes

(Cucumis sativus L.): Light-harvesting chlorophyll a/b pigment-protein complex of

photosystem II and seedling establishment in cucumber. Plant Physiol. 102: 295-302.

Burke, J.J., Mahan, J.R., and Hatfield, J.L., 1988. Crop-sepcific thermal inetic windows in

relation to wheat and cotton biomass production. Agron, J. 80: 553-556.

Camejo, D., Jime nez, A., Alarco n, J.J., Torres, W., Go mez, J.M., and Sevilla, F., 2006.

Changes in photosynthetic parameters and antioxidant activities following heat-shock

treatment in tomato plants. Funct. Plant Biol. 33: 177–187.

Camejo, D., Rodr´ıguez, P., Morales, M.A., Dell’amico, J.M., Torrecillas, A., and Alarco´ n, J.J.,

2005. High temperature effects on photosynthetic activity of two tomato cultivars with

different heat susceptibility. J. Plant Physiol. 162: 281–289.

Carter, D.K., 2012. 2011 Geographical Distribution of Arkansas Cotton Area.

Charng, Y., Liu, H., Liu, N., Hsu, F., and Ko, S., 2006. Arabidopsis Hsa32, a novel heat shock

24

protein, is essential for acquired thermotolerance during long term recovery after acclimation.

Plant Physiol. 140: 1297–1305.

Chinnusamy, V., Schumaker, K., and Zhu, J.K., 2004. Molecular genetic perspectives on

cross-talk and specificity in abiotic stress signaling in plants. J. Exp. Bot. 55: 225–236.

Clarke, S.M., Mur, L.A., Wood, J.E, and Scott, I.M., 2004. Salicylic acid dependent signaling

promotes basal thermotolerance but is not essential for acquired thermotolerance in

Arabidopsis thaliana. Plant J. 38: 432–47.

Cowling, S.A., and Sage, R.F., 1998. Interactive effects of low atmospheric CO2 and elevated

temperature on growth, photosynthesis and respiration in Phaseolus vulgaris. Plant Cell

Environ. 21: 427-435.

Dat, J., Vandenbeele, S., Vranova, E., Van Montagu, M., Inze , D., and Van Breusegem, F., 2000.

Dual action of the active oxygen species during plant stress responses. Cell. Mol. Life Sci. 57:

779–795.

Dat, J.F., Foyer, C.H., and Scott, I.M., 1998. Changes in salicylic acid and antiox- idants during

induction of thermo tolerance in mustard seedlings. Plant Physiol. 118: 1455–1461.

De Las Rivas, J., and Barber, J., 1997. Structure and thermal stability of photosys- tem II

reaction centers studied by infrared spectroscopy. Biochemistry. 36: 8897–8903.

De Ronde, J.A.D., Cress, W.A., Kruger, G.H.J., Strasser, R.J., and Staden, J.V., 2004.

Photosynthetic response of transgenic soybean plants containing an Arabidopsis P5CR gene,

during heat and drought stress. J. Plant Physiol. 61: 1211–1244.

Ebrahim, M.K., Zingsheim, O., El-Shourbagy, M.N., Moore, P.H., and Komor, E., 1998. Growth

and sugar storage in sugarcane grown at temperature below and above optimum. J. Plant

Physiol. 153: 593–602.

Ehlers, J.D., and Hall, A.E., 1998. Heat tolerance of contrasting cowpea lines in short and long

days. Field Crops Res. 55: 11–21.

Feller, U., Crafts-Brandner, S.J., and Salvucci, M.E., 1998. Moderately high temperatures inhibit

ribuose-1,5-biophosphate carboxylase/oxygenase (Rubisco) activase- mediated activation of

Rubisco. Plant Physiol. 116: 539-546.

25

Frank, G., Pressman, E., Ophir, R., Althan, L., Shaked, R., Freedman, M., Shen, S., and Firon, N.,

2009. Transcriptional profiling of maturing tomato (Solanum lycopersicum L.) microspores

reveals the involvement of heat shock proteins, ROS scavengers, hormones, and sugars in the

heat stress response. J. Exp. Bot. 60: 3891–908.

Frydman, J., 2001. Folding of newly translated proteins in vivo: the role of molecular chaperones.

Annu Rev Biochem. 70: 603–47.

Fryxell, P.A., 1992. A revised taxonomic interpretation of Gossypium L. (Malvaceae). Rheedea 2:

108-165.

Gong, M., Chen, S.N., Song, Y.Q., and Li, Z.G., 1997. Effect of calcium and calmod- ulin on

intrinsic heat tolerance in relation to antioxidant systems in maize seedlings. Aust. J. Plant

Physiol. 24: 371–379.

Goyal, K., Walton, L.J., and Tunnacliffe, A., 2005. LEA proteins prevent protein aggregation due

to water stress. Biochem. J. 388: 151–157.

Guilioni, L., Wery, J., Tardieu, F., 1997. Heat stress-induced abortion of buds and flowers in pea:

is sensitivity linked to organ age or to relations between reproductive organs? Ann. Bot. 80:

159–168.

Guo, Y.-P., Zhou, H.-F., and Zhang, L.-C., 2006. Photosynthetic characteristics and protective

mechanisms against photooxidation during high temperature stress in two citrus species. Sci.

Hort. 108: 260–267.

Hall, A.E., 2001. Crop Responses to Environment. CRC Press LLC, Boca Raton, Florida.

Hall, N.P., and Keys, A.J., 1983. Temperature dependence of the enzymic carboxylation and

oxygenation of ribulose 1, 5-bisphosphate in relation to effects of temperature on

photosynthesis. Plant Physiol. 72: 945-948.

Hare, P.D., Cress, W.A., and Staden, J.V., 1998. Dissecting the roles of osmolyte accumulation

during stress. Plant Cell Environ. 21: 535–553.

Howarth, C.J., 2005. Genetic improvements of tolerance to high temperature. In: Ashraf, M., and

Harris, P.J.C. (Eds.), Abiotic Stresses: Plant Resistance Through Breeding and Molecular

Approaches. Howarth Press Inc., New York.

26

Hozain, M., Abdelmageed, H., Lee, J., Kang, M., Fokar, M., Allen, R.D., and Holaday, A.S.,

2012. Expression of AtSAP5 in cotton up-regulates putative stress-responsive genes and

improves the tolerance to rapidly developing water deficit and moderate heat stress. J Plant

Physiol. 169(13): 1261-70.

Hsu, S.F., Lai, H.C., and Jinn, T.L., 2010. Cytosol-localized heat shock factor-binding protein,

AtHSBP, functions as a negative regulator of heat shock response by translocation to the

nucleus and is required for seed development in Arabidopsis. Plant Physiol. 153: 773–84.

Iba, K., 2002. Acclimative response to temperature stress in higher plants: approaches of gene

engineering for temperature tolerance. Annu Rev Plant Biol. 53: 225-245.

Jones, P.D., New, M., Parker, D.E., Mortin, S.,and Rigor, I.G., 1999. Surface area temperature

and its change over the past 150 years. Rev. Geophys. 37: 173–199.

Joyce, S.M., Cassells, A.C., and Mohan, J.S., 2003. Stress and aberrant phenotypes in vitro

culture. Plant Cell Tissue Organ Cult. 74: 103–121.

Karim, M.A., Fracheboud, Y., and Stamp, P., 1997. Heat tolerance of maize with reference of

some physiological characteristics. Ann. Bangladesh Agri. 7: 27–33.

Karim, M.A., Fracheboud, Y., and Stamp, P., 1999. Photosynthetic activity of devel- oping leavea

mays is less affected by heat stress than that of developed leaves. Physiol. Plant. 105: 685–

693.

Kaur, N., and Gupta, A.K., 2005. Signal transduction pathways under abiotic stresses in plants.

Curr. Sci. 88: 1771–1780.

Keys, A.J., Sampiao, EVSB., Cornelius, M.J., and Bird, I.F., 1977. Effect of temperature on

photosynthesis and photorespiration of wheat leaves. J Exp Bot. 28: 525-533.

Larkindale, J., and Huang, B., 2004. Thermotolerance and antioxidant systems in Agrostis

stolonifera: involvement of salicylic acid, abscisic acid, calcium, hydrogen peroxide, and

ethylene. J. Plant Physiol. 161: 405–413.

Larkindale, J., and Huang, B., 2005. Effects of abscisic acid, salicylic acid, ethy- lene and

hydrogen peroxide in thermotolerance and recovery for creeping bentgrass. Plant Growth

Regul. 47: 17–28.

27

Larkindale, J., and Knight, M.R., 2002. Protection against heat stress-induced oxidative damage

in Arabidopsis involves calcium, abscisic acid, ethylene and salicylic acid. Plant Physiol. 128:

682–695.

Lee, J.A., 1984. Chapter 1. Cotton as a world crop. pp. 1-25. In R. J. Kohel and C.F. Lewis (eds.)

1984. Cotton. American Society of Agronomy, Inc., Crop Science Society of America, Inc.,

Soil Science Society of America, Inc. Madison WI.

Liu, H.-T., Li, B., Shang, Z.-L., Li, X.-Z., Mu, R.-L., Sun, D.-Y., and Zhou, R.-G., 2003.

Calmodulin is involved in heat shock signal transduction in wheat. Plant Physiol. 132: 1186–

1195.

Liu, X., and Huang, B., 2000. Heat stress injury in relation to membrane lipid peroxidation in

creeping bent grass. Crop Sci. 40: 503–510.

Llusia, J., Penuelas, J., and Munne-Bosch, S., 2005. Sustained accumulation of methyl salicylate

alters antioxidant protection and reduces tolerance of holm oak to heat stress. Physiol. Plant.

124: 353–361.

Loka, D.A., and Oosterhuis, D.M., 2012. Effect of High Night Temperatures on Cotton

Respiration, ATP Content, and Carbohydrates.

Lopez-Delgado, H., Dat, J.F., Foyer, C.H., and Scott, I.M., 2009. Induction of thermotolerance in

potato microplants by acetylsalicylic acid and H2O2. J. Exp. Bot. 49: 713–20.

Maestri, E., Klueva, N., Perrotta, C., Gulli, M., Nguyen, H.T., and Marmiroli, N., 2002.

Molecular genetics of heat tolerance and heat shock proteins in cereals. Plant. Mol. Biol. 48:

667–681.

Maqbool, A., Abbas, W., Rao, A.Q., Irfan, M., Zahur, M., Bakhsh, A., Riazuddin, S., and

Husnain, T., 2009. Gossypium arboreum GHSP26 enhances drought tolerance in Gossypium

hirsutum. Biotechnol Prog. Jan. 26(1): 21-5.

McNairn, R.B., 1972. Phloem translocation and heat-induced callose formation in the Andean

giant rosette plant Espeletia timotensis. Ecology. 66: 512-520.

Miroshnichenko, S., Tripp, J., Nieden, U., Neumann, D., Conrad, U., and Manteuf- fel, R., 2005.

Immunomodulation of function of small heat shock proteins prevents their assembly into heat

stress granules and results in cell death at sublethal temperatures. Plant J. 41: 269–281.

28

Momcilovic, I., and Ristic, Z., 2007. Expression of chloroplast protein synthesis elongation

factor, EF-Tu, in two lines of maize with contrasting tolerance to heat stress during early

stages of plant development. J. Plant Physiol. 164: 90–99.

Moriarty, T., West, R., Small, G., Rao, D., and Ristic, Z., 2002. Heterologous expression of

maize chloroplast protein synthesis elongation factor(EF- TU) enhances Escherichia coli

viability under heat stress. Plant Sci. 163: 1075–1082.

Nakamoto, H., and Hiyama, T., 1999. Heat-shock proteins and temperature stress. In, Pessarakli,

M. (Ed.), Handbook of Plant and Crop Stress. Marcel Dekker, New York. pp: 399–416.

Nollen, E.A.A., and Morimoto, R.I., 2002. Chaperoning signaling pathways: molec- ular

chaperones as stress-sensing ‘heat shock’ proteins. J. Cell Sci. 115: 2809–2816.

Oosterhuis, D.M., 1990. Growth and development of the cotton plant. Nitrogen nutrition in

cotton: Practical Issues. Miley, W.N., and Oosterhuis, D.M., (eds.). Amercian Society of

Agronomy, Madison, WI. pp:1-24.

Oosterhuis, D.M., 2002. Day or night high temperatures: A major cause of yield variability.

Cotton Grower. 46: 8-9.

Pareek, A., Singla, S.L., and Grover, A., 1998. Proteins alterations associated with salinity,

desiccation, high and low temperature stresses and abscisic acid application in seedlings of

Pusa 169, a high-yielding rice (Oryza sativa L.) cultivar. Curr. Sci. 75: 1023–1035.

Peet, M.M., and Willits, D.H., 1998. The effect of night temperature on greenhouse grown

tomato yields in warm climate. Agric. Forest Meteorol. 92: 191–202.

Perry, S.W., Krieg, D.R., and Hutmacher, R.B., 1983. Photosynthetic rate control in cotton. Plant

Physiol. 73: 662-665.

Pettigrew, W.T., 2008. The effect of higher temperatures on cotton lint yield production and fiber

auality. Crop Sci. 48: 278-285

Queitsch, C., Hong, S.W., Vierling, E., and Lindquest, S., 2000. Heat shock protein 101 plays a

crucial role in thermotolerance in Arabidopsis. Plant Cell. 12: 479–492.

Reddy, K.R., Davidonis, G.H., Johnson, A.S., and Vinyard, B.T., 1999. Temperature regime and

carbon dioxide enrichment alter cotton boll development and fiber properties. Agron. J. 91:

29

851-858.

Reedy, K.R., Doma P.R., Mearns L.O., Boone, M.Y.L., Hodges, H.F., Richardson, A.G., and

Kakani, V.G., 2002. Simulating the impacts of climate change on cotton production in the

Mississippi delta. Climate Res. 22: 271-281.

Reddy, K.R., Hodges, H.F., and McKinion, J.M., 1995. Carbon dioxide and temperature effects

on pima cotton growth. Agric. Ecosyst. Environ. 54: 17-29.

Reddy, K.R., Hodges, H.F., McKinion, J.M., and Wall, G.W., 1992. Temperature effects on pima

cotton growth and development. Agron. J. 84: 237-243.

Reddy, V.R., Reedy, K.R., and Baker, D.N., 1991. Temperature effects on growth and

development of cotton during the fruiting period. Agron. J. 83: 211-217.

Rizhsky, L., Hongjian, L., and Mittler, R., 2002. The combined effect of drought stress and heat

shock on gene expression in tobacco. Plant Physiol. 130: 1143–1151.

Rojas, A., Almoguera, C., and Jordano, J., 1999. Transcriptional activation of a heat shock gene

promoters in sunflower embryos: synergism between ABI3 and heat shock factors. Plant J. 20:

601–610.

Sairam, R.K., and Tyagi, A., 2004. Physiology and molecular biology of salinity stress tolerance

in plants. Curr. Sci. 86: 407–421.

Sakamoto, A., and Murata, N., 2002. The role of glycine betaine in the protection of plants from

stress: clues from transgenic plants. Plant Cell Environ. 25: 163–171.

Sangwan, V., and Dhindsa, R.S., 2002. In vivo and in vitro activation of temperature- responsive

plant map kinases. FEBS Lett. 531: 561–564.

Sato, S., Kamiyama, M., Iwata, T., Makita, N., Furukawa, H., and Ikeda, H., 2006. Moderate

increase of mean daily temperature adversely affects fruit set of Lycopersicon esculentum by

disrupting specific physiological processes in male reproductive development. Ann. Bot. 97:

731–738.

Savchenko, G.E., Klyuchareva, E.A., Abrabchik, L.M., and Serdyuchenko, E.V., 2002. Effect of

periodic heat shock on the membrane system of etioplasts. Russ. J. Plant Physiol. 49: 349–

359.

30

Scandalios, J.G., 1993. Oxygen stress and superoxide dismutases. Plant Physiol. 101: 7–12.

Schooffl, F., Prandl, R., and Reindl, A., 1999. Molecular responses to heat stress. In: Shinozaki,

K., Yamaguchi-Shinozaki, K. (Eds.), Molecular Responses to Cold, Drought, Heat and Salt

Stress in Higher Plants. R.G. Landes Co., Austin, Texas. Pp: 81–98.

Singh, R.P., Vara Prasad, P.V., Sunita, K., Giri, S. N., and Reddy, K.R., 2007. Influence of high

temperature and breeding for heat tolerance in cotton: a review. Advances in Agronomy. 93:

313-314.

Snider, J.L., Oosterhuis, D.M., and. Kawakami, E.M., 2010. Genotypic differences in

thermotolerance are dependent upon pre-stress capacity for antioxidant protection of the

photosynthetic apparatus in Gossypium hirsutum. Physiol. Plant. 138: 268-277.

Somerville, C., and Browse, J., 1991. Plant lipids, metabolism and membranes. Science. 252:

80–87.

Stewart, J.M., 1986. Integrated events in the flower and fruit. In J.R. Mauney and JM Stewart

(eds.) Cotton Physiology. The Cotton Foundation, Memphis, TN. Pp: 261-300.

Su, P.H., and Li, H.M., 2008. Arabidopsis stromal 70-kD heat shock proteins are essential for

plant development and important for thermotolerance of germinating seeds. Plant Physiol. 146:

1231–41.

Sun, C.W., and Callis, J., 1997. Independent modulation of Arabidopsis thaliana polyubiquitin

mRNAs in different organs of and in response to environmental changes. Plant J. 11: 1017–

1027.

Sung, D.Y., Vierling, E., and Guy, C.L., 2001. Comprehensive expression profile analysis of the

Arabidopsis Hsp70 gene family. Plant Physiol. 126: 789–800.

Suzuki, N., and Mittler, R., 2006. Reactive oxygen species and temperature stresses: a delicate

balance between signaling and destruction. Physiol. Plant. 126: 45–51.

Swamy, P.M., and Smith, B.N., 1999. Role of abscisic acid in plant stress tolerance. Curr. Sci. 76:

1220–1227.

U.S. Department of Agriculture, Farm Service Agency (USDA, FSA). “Crop Acreage Data.” Accessed March

2012 from website:

31

http://www.fsa.usda.gov/FSA/webapp?area=newsroom&subject=landing&topic=foi-er-fri-cad

U.S. Department of Agriculture, National Agricultural Statistics Service (USDA, NASS). “Crop Values, 2011

Summary.” Accessed March 2012 from:

http://usda01.library.cornell.edu/usda/current/CropValuSu/CropValuSu-02-16-2012.pdf

Vierling, E., 1991. The roles of heat shock proteins in plants. Annu Rev Plant Physiol Plant Mol

Biol. 42: 579-620.

Wahid, A., Gelani, S., Ashraf, M., and Foolad, M.R., 2007. Heat tolerance in plants: An overview.

Environmental and Experimental Botany. 61: 199–223.

Walhood, V.T., and McMeans, J.L., 1964. Seed number as a facter in fruit retention in cotton.

Proceedings of the 18th Annual Beltwide Cotton Defoliation Physiology Conference.

Pp:30-33.

Wang, J.B., and Li, R.Q., 1999. Changes of Ca2+ distribution in mesophyll cells of pepper under

heat stress. Acta Hortic. Sin. 26: 57–58.

Wang, L.-J., and Li, S.-L., 2006. Salicylic acid-induced heat or cold tolerance in relation to Ca2+

homeostasis and antioxidant systems in young grape plants. Plant Sci. 170: 685–694.

Wang, W., Vinocur, B., Shoseyov, O., and Altman, A., 2004. Role of plant heat-shock proteins

and molecular chaperones in the abiotic stress response. Trends Plant Sci. 9: 244–252.

Weaich, K., Briston, K.L., and Cass, A., 1996. Modeling preemergent maize shoot growth. II.

High temperature stress conditions. Agric. J. 88: 398–403.

Wise, R.R., Olson, A.J., Schrader, S.M., and Sharkey, T.D., 2004. Electron transport is the

functional limitation of photosynthesis in field-grown Pima cotton plants at high temperature.

Plant Cell Environ. 27: 717–724.

Wullschleger, S.D., and Oosterhuis, D.M., 1990. Photosynthetic carbon production and use by

developing cotton leaves and bolls. Crop Sci. 30: 1259-1264.

Wullschleger, S.D., Oosterhuis, D.M., Hurren, R.G., and Hanson, P., 1991. Evidence for light

dependent recycling of respired carbon dioxide by the cotton fruit. Plant Physiol. 97: 574-579.

Xiong, L., Lee, H., Ishitani, M., and Zhu, J.-K., 2002. Regulation of osmotic stress responsive

32

gene expression by LOS6/ABA1 locus in Arabidopsis. J. Biol. Chem. 277: 8588–8596.

Xu, S., Li, J., Zhang, X., Wei, H., and Cui, L., 2006. Effects of heat acclima- tion pretreatment on

changes of membrane lipid peroxidation, antioxidant metabolites, and ultrastructure of

chloroplasts in two cool-season turfgrass species under heat stress. Environ. Exp. Bot. 56:

274–285.

Yamane, Y., Kashino, Y., Koike, H., and Satoh, K., 1998. Effects of high tempera- tures on the

photosynthetic systems in spinach: oxygen-evolving activities, fluorescence characteristics

and the denaturation process. Photosynth. Res. 57: 51–59.

Yun, D.-J., Zhao, Y., Pardo, J.M., Narasimhan, M.L., Damsz, B., Lee, H., Abad, L.R., D’urzo,

M.P., Hasegawa, P.M., and Bressan, R.A., 1997. Stress proteins on the yeast cell surface

determine resistance to osmotin, a plant antifungal protein. Proc. Natl. Acad. Sci. USA. 94:

7082–7087.

Zhao, D., Reddy, K.R., Kakani, V.G., Koti, S., and Gao, W., 2005. Physiological casuses of

cotton fruit abscission under conditions of high temperature and enhanced ultraviolet-B

radition. Physiol Plant. 124: 189-199.

33

CHAPTER 1

Comparison of The Physiological Responses to Heat Stress Between the Selected Heat

Tolerant and Heat Susceptible Genotypes of Cotton

Jin Zhang

Department of Crop, Soil, and Environmental Sciences, University of Arkansas, 115 Plant Science

building, University of Arkansas, Fayetteville, AR, 72701, USA

34

Abstract

Heat stress causes major losses to cotton seed and lint yield. Introduction of heat stress

tolerance to Arkansas cotton varieties is highly desirable. Heat stress can negatively influence

plant photosynthesis. Chlorophyll fluorescence is a physiological parameter that has been shown

to correlate with photochemical efficiency. The increased solute leakage has also been used as an

indirect measurement of heat-stress in cotton. Heat stress would decrease photochemical

efficiency and membranes integrety of cotton leaves with genotypic variation. Four Gossypium

hirsutum cultivars (VH260, MNH456, ST213, and ST4288) were grown in a growth chamber

and exposed to optimal (32/24℃) and high day/night temperature (38/24℃) conditions during

both seedling development and flowering were analyzed for chlorophyll fluorescence and solute

leakage in the leaves. No significant differences of chlorophyll fluorescence were observed in

both seedling leaves and fully expanded leaves between heat-treated plants and control plants in

the four cultivars. An increase of solute leakage was observed in heat sensitive cultivars, but only

a slight increase occurred in heat tolerant cultivars after one week of heat treatment in both

seedling and flowering plants. This work suggests that cotton cultivars, VH260 and MNH456 are

more tolerant to heat stress than ST213 and ST4288.

35

Introduction

Research has shown that high temperature curtails photosynthesis by modifying the

thylakoids structure (Karim et al., 1997). Studies have also revealed that specific effects of high

temperatures on photosynthetic membranes result in the loss of grana stacking or its swelling

(Wahid et al., 2007). Since constraints in photosynthesis can limit plant growth, high temperatures

negatively affect plant development. Researchers have suggested that the core sites that can be

injured by high temperatures are photochemical reactions in thylakoid lamellae and carbon

metabolism in the stroma (Wise et al., 2004). Alterations in various photosynthetic attributes are

good indicators of heat stress as they correlate with plant growth. Chlorophyll fluorescence, the

ratio of variable fluorescence to maximum fluorescence (Fv /Fm), and the base fluorescence (F0)

are physiological parameters has been used to correlate with photochemical efficiency and heat

stress (Yamada et al., 1996).

Cellular membranes are also sensitive to high temperature. Heat stress can alter the tertiary

and quaternary structures of membrane proteins, which enhance the permeability of membranes.

This was shown by the increased loss of electrolytes which has been used as an indirect measure

of heat-stress tolerance in cotton for a long time (Ashraf et al., 1994). Many factors can influence

electrolyte leakage including tissue age, organ, developmental stage, growing season, and degree

of hardening. Reports for maize suggest that heat stress can cause much less severe injuries to

plasmalemma in developing maize leaves than in mature leaves (Karim et al., 1997, 1999).

36

The objective of this study is to measure the effect of long-term (1 week) heat stress on

photosynthesis and membrane leakage of both seedling leaves and fully expanded leaves on the

day of anthesis to confirm the genotypic differences. We hypothesized that G. hirsutum cultivars

VH260 & MNH456 reported to have greater reproductive thermotolerance than conventional

cultivars would also have higher photosynthetic rates and lower biological membranes damage in

fully expanded leaves and seedling leaves.

Materials and Methods

Plant materials and temperature treatment

Two experiments were conducted to evaluate the effect of heat stress on both seedling and

flowering stages in Gossypium hirsutum. Experiments were started in July 2012. A total of four

genotypes were used in this research. Two heat tolerant cultivars VH260 and MNH456 and two

heat susceptible lines, ST213 and ST4288. Seeds were planted in two-liter pots containing

Sunshine Mix and placed in two growth chambers (E15 in Rosen Center, University of Arkansas,

and M3 chamber in Arkansas Agricultural Research and Extension Center, Fayetteville AR).

Day/night of 32/24℃ temperatures regimes and 14/10hr day/night photoperiod at a 500 μmol

m-2

s-1

photosynthetically active radiation (PAR) regimes were applied. Plants were irrigated with

deionized (DI) water until four days after germination, after that, quarter-strength Hoagland’s

solution was applied daily.

37

Two weeks after planting, half of the seedlings in the M3 chamber were randomly

transferred to another growth chamber with day/night temperature regime of 38/24℃ for one week

of heat treatment. For the flowering group plants, at approximately flowering time (six weeks after

germination), half of the plants in the E15 chamber were randomly transferred to another growth

chamber with day/night temperature regime of 38/24℃ for one week of heat treatment.

Chlorophyll fluorescence

Photochemical efficiency of photosynthesis II was estimated by obtaining fluorescence

transients from fully-expanded leaves in flowering cotton and from the first two true leaves in

seedling cotton in all four cultivars grown under optimal (32/24℃) or high (38/24℃)

temperatures with a portable fluorometer (Model OS1-FL, Opti-Sciences, Hudson, NH).

Measurements were taken between 12:00 to 1:00 pm in the growth chamber to keep the

temperature and light constant. The same position leaf was evaluated on each plant. For seedling

cotton, the second true leaves were selected, and for flowering cotton, the upper-most

fully-expanded main-stem leaves were measured. Three points (avoiding leaf veins) were

measured on each leaf. ETR (electron transport rate) and Actual Quantum Yield data were

recorded and converted to Micro-soft excel file.

Membrane leakage

The same leaves used for chlorophyll fluorescence were measured for membrane leakage.

38

Three leaf discs, avoiding leaf veins, were cut out with a cork borer and placed into a petri dish

filled with deionized water. Equal amounts (10ml) deionized H2O was added into each vial. Plastic

wrap was used to keep contaminants from getting into them. Samples were kept in the dark for 48h

and then measurements were taken with a single probe conductivity meter. The conductivity meter

was calibrated according to the manufacturer’s instructions and measurements were taken. After

measuring conductivity, samples were boiled in hot water (95℃) for 10 minutes and the

conductivity were measured again to calculate the relative injury.

Statistical analysis

The physiological parameters of these four cultivars grown under high and normal day/night

temperature regimes were compared (from different plants) using Student’s t -test (α = 0.05).

Statistical analysis was performed using JMP IN 7.0 software (SAS Institute, Cary, NC). Pictures

were performed using SIGMA PLOT 12.

Results and Discussion

Four G. hirsutum cultivars were used in this study. Among these, two cultivars, MNH456 and

VH260 maintain higher boll retention at 45℃ (personal communication, Dr. Saghir Ahmad, Vehari

Cotton Research Station in Vehari, Pakistan). It is reported that cultivar VH260 exhibited greater

photosynthetic thermotolerance than a conventional cultivar (G. hirsutum cv. ST4554 B2RF) due

to elevated pre-stress antioxidant enzyme activity of the subtending leaf (Snider et al., 2010), and

significantly higher fertilization efficiencies at 38℃ following long-term exposure to high-ambient

39

temperature conditions (Kurek et al., 2007, Snider et al., 2009). The two heat susceptible cultivars

used were ST213 and ST4288. ST213 is an obsolete cultivar that originated in Mississippi River

Delta (seed obtained from Dr. James Frelichowski), and ST4288 is a modern cultivar commonly

used in Mississippi River Delta (seed obtained from Dr. Oosterhuis).

Previous studies have shown that increased leaf temperatures correlated with decline in

maximum quantum yield (Fv/Fm). The cause of fluorescence decline during heat stress has been

related to malfunctioning of primary photochemical reactions, primarily involving inhibition of

PSII, located in the thylakoid membrane system (Berry and Bjorkman, 1980). In the present

study, actual quantum yield was measured in the leaves of both seedlings and flowering plants

after exposing to 38℃ day temperature for one week. No significant two-way interaction

between cultivars and growth temperature for actual quantum yield was observed in seedling

leaves (Fig. 1), and in the upper-most fully-expanded leaves for flowering plants (Fig. 2). The

average actual quantum yields in each line are all between 0.65-0.72 in seedlings (Fig. 1), and

between 0.7-0.79 in flowering plants (Fig. 2). According to Snider et al. (2009), quantum yield

was unaffected by high temperature in VH260. Combined with other parameters, they suggested

that VH260 has higher photosynthetic rates and photochemical efficiencies compared with a less

thermotolerant cultivar ST4554. Their results as similar to the result in this study that quantum

yield was unaffected by high temperature in both heat tolerant cultivars VH260 and MNH456.

However, the quantum yields in both heat susceptible cultivars ST213 and ST4288 were also

40

unaffected by high temperature, which contradicts the result of Snider et al (2009). In their

research, a slight decline (4.5% decline) of maximum quantum yield was observed in ST4554

under heat stress. Many studies have reported that PSII is relatively insensitive to leaf temperature

below 40℃ (Haldimann and Feller, 2004, 2005). This may be an explanation of why quantum

yield was unaffected in the four cultivars upon one week of heat treatment at 38℃ day

temperature. Also, with the limited growth chamber space, only five biological replicates in each

cultivar could be measured. This led to a small sample size and large SD values, which limited the

accuracy of the result.

The integrity of plasma membrane was analyzed by measuring electrolyte leakage, which

is a direct indicator of membrane injury. Relative injury to plasma membrane was calculated

for the four genotypes after exposure to heat stress. The electrolyte leakage was measured in the

leaves of both seedlings and flowering plants after exposing to 38℃ day temperature for one

week. There were genotypic differences in relative injury to the plasma membranes as indicated

by electrolyte leakage. High day temperature resulted in a significant increase in the relative

injury in all cultivars except VH260 (Fig. 3). The relative injury of membrane in seedling leaves

of VH260 was not significantly affected by high day temperature treatments (Fig. 3). The

electrolyte leakage of upper-most fully-expanded leaves in VH260 and MNH456 was not

affected by elevated temperature, whereas the average relative injury of membranes were

significantly higher in ST213 and ST4288 in both heat treated and untreated samples (Fig.4).

41

Further, significant increase of electrolyte leakage was observed in both ST213 and ST4288 after

one week of heat treatment under 38/24℃ day/night temperature regime (Fig. 4).

The results presented in Fig. 3 and 4 confirm that the heat tolerance cultivars VH260 and

MNH456 do not have changes in the membrane leakage between high and normal temperature.

According to Snider et al. (2010), VH260 expressed a greater photosynthetic thermotolerance

than a conventional cultivar ST4554. Cultivars MNH456 & VH260 were also confirmed by Dr.

Saghir Ahmad to maintain higher boll retention at 45℃ in Vehari, Pakistan (Personal

communication). The slight increase of electrolyte leakage in seedling leaves of MNH456 and

unaffected solute leakage in fully-expanded leaves during flowering of VH260 and MNH456

under heat stress is consistent with the two previous studies, which confirmed these two cultivars

as heat tolerant during high temperature. As commercial cultivars in the U.S.A, ST4288 are more

sensitive to heat stress. Previous study showed that ST213, an obsolete cultivar, expressed a lower

solute leakage and higher photochemical efficiency compared to modern cultivars under 38℃ for

one week (Brown and Oosterhuis, 2005). The significant increase of solute leakage in both

seedling leaves and fully-expanded leaves during flowering of ST213 and ST4288 under heat

stress is also consistent with the previous study, which confirmed these two cultivars as sensitive

to heat stress.

Acknowledgements

The author thanks University of Arkansas, Crop, Soil, & Environmental Science department

42

for assistantship funding of this research. Additionally, thanks M. Toby and D. Loka for their

assistance in the laboratory and D.M. Oosterhuis and S. Ahmad for providing kindly advice and the

G. hirsutum seeds used in this study.

References

Ashraf, M., Saeed, M.M., and Qureshi, M.J., 1994. Tolerance to high temperature in cotton

(Gossypium hirsutum L.) at initial growth stages. Environ. Exp. Bot. 34: 275–283.

Berry, J., Bjorkman. O., 1980. Photosynthetic response and adaptation to temperature in higher

plants. Annu Rev Plant Physiol. 31: 491–543

Brown, R.S., and Oosterhuis, D.M., 2005. High daytime temperature stress effects on the

physiology of modern versus obsolete cotton cultivars. AAES Research Series 533: 64

Haldimann, P., and Feller, U., 2004. Inhibition of photosynthesis by high temperature in oak

(Quercus pubescens L.) leaves grown undder natural conditions closely correlates with a

reversible heat-dependent reduction of the activation state of ribulose-1,5-bisphosphate

carboxylase/oxygenase. Plant Cell Environ. 27: 1169-1183

Haldimann, P., and Feller, U., 2005. Growth at moderately elevated temperature alters the

physiological response of the photosynthetic apparatus to heat stress in pea (Pisum sativum L.)

Plant Cell Environ. 27: 1169-1183

Karim, M.A., Fracheboud, Y., and Stamp, P., 1997. Heat tolerance of maize with reference of

some physiological characteristics. Ann. Bangladesh Agri. 7: 27–33.

Karim, M.A., Fracheboud, Y., and Stamp, P., 1999. Photosynthetic activity of devel- oping leavea

mays is less affected by heat stress than that of developed leaves. Physiol. Plant. 105: 685–

693.

Kurek, I., Chang, T.K., Bertain, S.M., Madrigal, A., Liu, L., Lassner, M.W., and Zhu, G., 2007.

Enhanced thermostability of Arabidopsis rubisco activase improves photosynthesis and

growth rates under moderate heat stress. Plant Cell. 19: 3230-3241.

43

Snider, J.L., Oosterhuis, D.M., and Kawakami, E.M., 2010. Genotypic differences in

thermotolerance are dependent upon pre-stress capacity for antioxidant protection of the

photosynthetic apparatus in Gossypium hirsutum. Physiol. Plant. 138: 268-277.

Snider, J.L., Oosterhuis, D.M., Skulman, B.W., and Kawakami, E.M., 2009. Heat stress-induced

limitations to reproductive success in Gossypium hirsutum. Physiol. Plant. 137: 125-138.

Wahid, A., Gelani, S., Ashraf, M., and Foolad, M.R., 2007. Heat tolerance in plants: An overview.

Environmental and Experimental Botany. 61: 199–223.

Wise, R.R., Olson, A.J., Schrader, S.M., and Sharkey, T.D., 2004. Electron transport is the

functional limitation of photosynthesis in field-grown Pima cotton plants at high temperature.

Plant Cell Environ. 27: 717–724.

Yamada, M., Hidaka, T., and Fukamachi, H., 1996. Heat tolerance in leaves of trop- ical fruit

crops as measured by chlorophyll fluorescence. Sci. Hortic. 67: 39–48.

44

Figure Legends

Fig. 1. Actual Quantum Yield of thermotolerant (VH260 & MNH456) and thermosensitive

(ST213 & ST43288) G. hirsutum of seedling first two true leaves exposed to optimal (32/24℃;

black vertical bar) and high (38/24℃; gray vertical bar) day temperatures. All values are means

± standard error (n=5). Error bars represent the SD for all experiments. Values not sharing a

common letter are significantly different (LSD; P < 0.1)

Fig. 2. Actual Quantum Yield of thermotolerant (VH260 & MNH456) and thermosensitive

(ST213 & ST43288) G. hirsutum of flowering fully expanded leaves exposed to optimal

(32/24℃; gray vertical bar) and high (38/24℃; black vertical bar) day temperatures. All values

are means ± standard error (n=5). Error bars represent the SD for all experiments. Values not

sharing a common letter are significantly different (LSD; P < 0.1)

Fig. 3. Relative membrane injury of thermotolerant (VH260 & MNH456) and

thermosensitive (ST213 & ST43288) G. hirsutum of seedling first two true leaves exposed to

optimal (32/24℃; black vertical bar) and high (38/24℃; gray vertical bar) day temperatures. All

values are means ± standard error (n=5). Error bars represent the SD for all experiments. Values

not sharing a common letter are significantly different (LSD; P < 0.1)

Fig. 4. Relative membrane injury of thermotolerant (VH260 & MNH456) and

thermosensitive (ST213 & ST43288) G. hirsutum of flowering fully expanded leaves exposed to

optimal (32/24℃; black vertical bar) and high (38/24℃; gray vertical bar) day temperatures. All

values are means ± standard error (n=5). Error bars represent the SD for all experiments. Values

45

not sharing a common letter are significantly different (LSD; P < 0.1)

46

Figure. 1 Actual quantum yield of seedling cotton samples

Figure. 2 Actual quantum yield of flowering cotton samples

47

Figure. 3 Relative membrane injury of seedling cotton samples

Figure. 4 Relative membrane injury of flowering cotton samples

48

CHAPTER 2

Identification of Cotton Orthologs of Arabidopsis Heat Tolerance Genes

Jin Zhang

Department of Crop, Soil, and Environmental Sciences, University of Arkansas, 115 Plant Science

building, University of Arkansas, Fayetteville, AR, 72701, USA

49

Abstract

The molecular basis of heat stress tolerance in cotton is not well studied, while many genes

associated with heat stress have been identified in Arabidopsis. The cotton orthologs of these

Arabidopsis genes are expected to have the same function i.e. to confer heat tolerance in cotton. In

this study, first the literature was searched to find heat tolerance genes mainly in Arabidopsis,

then homology between Arabidopsis genes and cotton ESTs (Expressed sequence Tags) were

analyzed to identify putative orthologs. As a result, six Arabidopsis genes and one G. barbadense

gene, were selected. These genes include heat shock protein genes, heat shock transcription factors,

drought tolerance gene, and two general stress protein genes. With the hypothesis that cotton

orthologs of these genes are involved in heat tolerance in cotton, primers were designed to carry

out for Real-time quantitative PCR (qRT-PCR) analysis.

50

Introduction

It is widely accepted that HSPs function as molecular chaperones to prevent aggregation

and denaturing of cell proteins in response to high temperature, and then to promote the

appropriate refolding of denatured proteins (Frydman, 2001). Previous studies have identified

some HSPs in different plant species. For instance, HSP101, which was identified in maize, is a

nucleus-localized protein. As a member of campylobacter invasion antigen B (CiaB) protein

sub-family, HSP101, which can promote the recovery of aggregated protein, is essential for the

induction of thermotolerance. When maize was expose to high temperature, levels of HSP101

increased, correspondingly. However the expression pattern of HSP101 varies in different organs

(Young et al., 2001).

HSP70 is another well studied heat tolerance gene. It is proposed to have a variety of

functions such as protein translation and translocation, proteolysis, protein folding or chaperoning,

suppressing aggregation, and reactivating denatured proteins (Zhang et al., 2005). Research

showed that those mutants which were unable to synthesize HSPs or the cells in which HSP70

synthesis is blocked or inactivated are more sensitive to heat stress (Burke, 2001).

Low Molecular Weight (LMW) HSPs may also play structural roles in maintaining cell

membrane integrity. For example, HSP22, which belongs to the plant small HSP super-family, is

highly expressed under continuous heat stress (Lund et al., 1998). Their function as protecting PSII,

especially in photosynthetic electron transport, from adverse effects of heat stress was also

51

confirmed by localization of LMW-HSPs in chloroplast membranes (Barua et al., 2003).

ABA also has function in modification of gene expression in response to environmental

stress. Analysis has been done on ABA-responsive promoters, which include several potential

cis- and trans-acting regulatory elements (Swamy and Smith, 1999). ABA can mediate up- or

down-regulation of numerous genes to help plants acclimate/adapt to dry environment (Xiong et

al., 2002). Other researchers claim that several HSPs (e.g. HSP70) are also induced by ABA,

which may be a part of thermotolerance mechanism (Pareek et al., 1998). What’s more, heat

shock transcription factor 3 (HSF3), functions synergistically with chimeric genes with a small

HSP promoter, is ABA inducible (Rojas et al., 1999).

The involvement of Ca2+ in the regulation of plant responses to various environmental

stresses has also been proven by several studies. Environmental injury could be alleviated during

environmental stresses through the increase of cytosolic Ca2+ content. However, according to

Wang and Li (1999), too much Ca2+ (released or sustained high cytosolic Ca

2+) concentration

might also be toxic to living cells. Annexin gene family, which generates calcium-binding

proteins, plays an important role in transporting calcium signals into adaptive responses.

ANNAT8, a member of annexin gene family, showed a positive response for salt stress in

Arabidopsis, which suggests the importance of annexin genes during salt stress (Cantero et al.,

2006).

52

Up to now, many investigations have been done on cotton to overcome heat stress problems.

Several cultivars of cotton that are heat tolerant or susceptible to heat have been identified.

However, only a few studies have been done on thermotolerance mechanisms in cotton. Research

at molecular level needs to be done to reveal the thermotolerance mechanisms in cotton. Only a

few genes have been identified that enhance drought and heat tolerance in upland cotton.

According to Maqbool et al. (2009), GHSP26 is a Gossypium arboreum alpha-crystalline heat

shock protein gene that enhances drought and heat tolerance. In their research, real-time

quantitative PCR (qPCR) analysis was used to detect the expression level of GHSP26 in

transgenic cottons under stressed conditions. Results showed that GHSP26 was overexpressed in

transgenic upland cotton plants under drought stress. Research also suggested that the ectopic

expression of the SAP5 (AT3G12630) gene improved drought and heat tolerance in transgenic

cotton (Gossypium hirsutum) (Hozain et al., 2012). SAP5 gene is a member of the

stress-associated family of genes that encode proteins containing A20/AN1 zinc finger domains.

Their research suggested that through up-regulating the expression of endogenous

stress-responsive genes, the expression of SAP5 protected photosystem (PS) II complexes from

photodamage after drought stress. In addition, transgenic plants, which contain SAP5, were

significantly more heat tolerance than wild-type plants (Hozain et.al., 2012). There are still many

genes related to heat tolerance yet to be identified in cotton.

Since Arabidopsis has been used as a model plant in many molecular and genetic studies for

identifying genes associated with heat tolerance, we hypothesized that cotton orthologs of

53

Arabidopsis genes will have the same function i.e. conferring heat tolerance in cotton. This study

is designed to understand the thermotolerance mechanism and metabolic pathway involved in heat

stress in cotton through measuring the expression level of Genes which are orthologue to

Arabidopsis heat tolerant genes. The objective of this chapter is to identify cotton orthologs of

Arabidopsis heat tolerance genes.

Materials and Methods

Searching and Selection of Heat Tolerant Genes

Literature related to plant heat tolerance genes were searched and reviewed. National

Center for Biotechnology Information (NCBI) database and The Arabidopsis Information

Resource (TAIR) were mainly used as the literature sources. Genes, mainly Arabidopsis and

cotton genes, that have been confirmed to enhance heat and drought tolerance were selected and

listed for further identification. The selected genes were first checked through Arabidopsis e-FP

Browser (e-FP), to see the gene expression pattern, including expression time, expression organ,

and gene expression quantity. Those highly expressed genes in seedling and open flowers were

sought out for further examination.

Identification of Cotton Orthologs

All the heat tolerant genes that were highly expressed in seedlings and open flowers were

then selected to look for similarities with cotton gene sequence by using NCBI and Cotton

54

Genome Database (Cotton DB) using Basic Local Alignment Search Tool (BLAST). The

corresponding protein sequences of heat tolerance genes were used to align with cotton Express

Sequence Tag (EST), since cotton genome sequencing is still not finished. E-value and identity

were main parameters that were considered when screening the selected heat tolerance genes.

Usually the genes, which have E-values lower than E-70 and Identity higher than 60%, were

considered to be good candidates. The cotton sequence coverage of selected genes was also

considered as a supplement parameter. After alignment, the related cotton ESTs sequence were

used to make alignment with corresponding genes nucleotide sequences to find the highly

conserved region. Short gene sequence (<500 bp) was not considered since it may be hard to

design primers.

Design of primers

Highly conserved sequence regions of each gene were selected for designing primer. The

primers used in qPCR for each gene were designed by using Primer 3

(http://frodo.wi.mit.edu/primer3/), and processed in Net Primer

(http://www.premierbiosoft.com/netprimer/index.html) in order to evaluate either self- and

cross-dimerization.

Result

In total, 7 heat tolerance genes in Arabidopsis and cotton were selected as listed below.

55

Form. 1

Category Genes Function Identity Reference

Heat stress

transcription

factors

HSFA2 Heat/drought tolerance 57% Nishizawa et al. (2006)

HSFA1b Heat response 81% Yoshida et al. (2011)

Heat shock

proteins

GHSP26 Heat/drought tolerance 82% Maqbool et al. (2009)

HSP101 Thermotolerance

90%

Hong and Vierling (2000,

2001)

HSC70-1 Heat stress response 93% Li et al. (2011)

Antioxidant

enzyme gene APX1 Ascorbate peroxidase 76% Shi et al. (2001)

Calcium

signaling ANNAT8

Induction of abiotic stress

tolerance pathway 61% Cantero et al. (2006)

Reference

gene GhPP2A1 Housekeeping 100% Artico et al. (2010)

Primers are listed below:

From. 2

Gene Primer Tm GC

content

Primer

Length

Sequence

length

HSFA2

FP: GAAGGAAGGGCTTAACGAGG

RP: GCTGACGAATGAAACTGGAGA

60.5C

60.1C

55%

45%

20bp

22bp

202bp

HSP101

FP: GGAAGTGGAATCTGCGATAGC

RP: GATTTTGTCCCACCACTCTTTG

61.2C

60.1C

52%

45%

21bp

22bp

200bp

GHSP26

FP: TCCTTTTGGTTTGTTGGACCC

RP: ACCTTCACATCCTCTTTCGTCA

59.5C

60.1C

48%

45%

21bp

22bp

213bp

HSP3 FP: AGAAAAGTTGACCCTGACCGC

RP:AACCTCCTCTTCGAGACCAAAC

61.2C

62.1C

52%

50%

21bp

22bp

186bp

APX1 FP: GGCACTCAGCTGGAACTTTTG

RP: AGCGTAGGTGAGGTTAGGGAA

61.2C 52% 21bp 163bp

56

HSC70-1 FP:TTGTTACCGTCCCTGCATACTT

RP: GACATCAAAAGTACCGCCACC

60.1C

61.2C

45%

52%

22bp

21bp

200bp

ANNAT8 FP:CAGGATCTTGAGTACAAGGAGCA

RP: GTAAGTGCATCCTCATCGGTTC

60.8C

60.9C

48%

50%

23bp

22bp

225bp

GhPP2A1

FP: GATCCTTGTGGAGGAGTGGA

RP: GCGAAACAGTTCGACGAGAT

60.5C

58.4C

55%

50%

20bp

20bp

100bp

Heat stress transcription factor HSFA2, which was reported by Nishizawa et al. (2006),

enhances heat and drought tolerance in Arabidopsis. This research suggests that the expression of

HsfA2 in Arabidopsis is strictly heat stress-dependent and this transcription factor represents a

regulator of a subset of stress response genes in Arabidopsis. They also found that HsfA2

expression is strongly heat stress-induced and it is a relatively stable protein that accumulates

like HSPs (Nishizawa et al., 2006). E-FP result showed that HSFA2 is highly expressed in

Arabidopsis flower organ after 1 hour heat treatment at 37℃. The protein BLAST result showed

that HSFA2 protein heat stress transcription factor A-2 (NP_180184.1) has 57% identity and

E-value of 4e-100 aligned with Gossypium hirsutum cDNA DT545429.

Another heat stress transcription factor HSFA1b, which is also called HSF3, was

confirmed by Yoshida et al. (2011) that functions as the main positive regulators in heat

shock-responsive gene expression. E-FP results showed this gene is expressed in Arabidopsis dry

seed and seedlings after 1 hour heat treatment at 37℃. The protein BLAST result showed that

HSFA1b corresponding protein heat shock factor 3 (NP_850832.1) has 81% identity and E-value

of 3e-91 with Gossypium hirsutum cDNA DT559215.1.

GHSP26 is a Gossypium arboreum alpha-crystalline heat shock protein gene that enhances

57

drought tolerance (Maqbool et al., 2009). In their research, Real-time quantitative PCR analysis

was used to detect the expression level of GHSP26 in transgenic plants under stress conditions.

Results showed that compared to non-transgenic cotton, a significant overexpression (over

60-fold increase) of GHSP26 in transgenic cotton plants was observed under drought stress.

Searching from NCBI database we know that GHSP26 is expressed in cotton seedlings. The

nucleotide BLAST result showed that GHSP26 has 82% identity and E-value of 2e-72 with

Gossypium hirsutum DNA DN779846.1.

HSP101 has been proven to enhance heat tolerance by Hong and Vierling, (2000, 2001)

Loss-of-function mutants of Hsp101 in A. thaliana is unable to acquire thermotolerance. E-FP

result showed this gene is highly expressed in Arabidopsis dry seed and flower organ after 1 hour

heat treatment at 37℃. The protein BLAST result showed that HSP101 corresponding protein

heat shock protein 101 (NP_565083.1) has 90% identity and E-value of 5e-170 with Gossypium

hirsutum cDNA DT564565.1.

HSC70-1 responses to heat stress in transgenic tomato (Li et al., 2011). In this research

compared to non-transgenic seeds, transgenic tomato seeds which express Arabidopsis HSC70-1,

have higher germination rate, seedling height, and seedling fresh weight under heat stress. Also,

in Arabidopsis, plastid stromal cpHSC70-1 is confirmed to play an important role in the

thermotolerance of germinating seeds (Su and Li 2008). E-FP results showed HSC70-1 is a

common gene in Arabidopsis that is expressed all the time in every organ examined. During heat

58

treatment at 37℃, the gene expression level increases. The protein BLAST result showed that

HSC70-1 corresponding protein heat shock 70kDa protein 1/8 (NP_195870.1) has 93% identity

and E-value of zero with Gossypium hirsutum cDNA FJ415195.1.

APX1 and ANNAT8 are general stress genes that respond to many abiotic stresses. The

Barley HvAPX1 gene was introduced into A. thaliana, and the transgenic plants were

significantly more tolerant to heat stress as compared to the wild-type (Shi et al., 2001). E-FP

results showed this is a common gene in Arabidopsis that is expressed all the time in each organ

examined. During heat treatment at 37℃, the gene expression level increases. The protein

BLAST result showed that APX1 corresponding protein glyoxysomal ascorbate peroxidase

(EU244478.1) has 76% identity and E-value of 1e-128 aligned with Gossypium hirsutum cDNA

EF432582.1. Annexin 8 (ANNAT8), which functions in calcium-dependent phospholipid binding

and calcium ion binding, is responsive to many environmental stresses including water

deprivation, salt stress, cold, and heat stress (Cantero et al., 2006). E-FP result showed that

ANNAT8 is a common gene in Arabidopsis that is expressed all the time at every organ

examined. During heat treatment at 37℃, the gene expression level increases. The protein

BLAST result showed that ANNAT8 corresponding protein Annexin 8 (NM_121276.2) has 61%

identity and E-value of 4e-141 with Gossypium hirsutum cDNA ES813534.1.

Reference gene Ghpp2a1 DT545658 (Catalytic subunit of protein phosphatase 2A), which

is a cotton housekeeping gene and maintains stable and high expression level during all the

59

development stages in cotton all organs (Artico et al., 2010), was used for RNA expression

analysis.

References

Artico, S., Nardeli, S.M., Brilhante, O., Grossi-de-Sa, M.F., and Ferreira, M.A., 2010.

Identification and evaluation of new reference genes in Gossypium hirsutum for accurate

normalization of real-time quantitative RT-PCR data. BMC Plant Biology. 10: 49.

Barua, D., Downs, C.A., and Heckathorn, S.A., 2003. Variation in chloroplast small heat-shock

protein function is a major determinant of variation in thermotol- erance of photosynthetic

electron transport among ecotypes of Chenopodium album. Funct. Plant Biol. 30: 1071–1079.

Burke, J.J., 2001. Identification of genetic diversity and mutations in higher plant acquired

thermotolerance. Physiol. Plant. 112: 167–170.

Cantero, A., Barthakur, S., Bushart, T.J., Chou, S., Morgan, R.O., Fernandez, M.P., Clark, G.B.,

and Roux, S.J., 2006. Expression profiling of the Arabidopsis annexin gene family during

germination, de-etiolation and abiotic stress. Plant Physiology and Biochemistry. 44: 13–24.

Frydman, J., 2001. Folding of newly translated proteins in vivo: the role of molecular chaperones.

Annu Rev Biochem. 70: 603–47.

Hong, S.W. and Vierling, E. (2000) Mutants of Arabidopsis thaliana defective in the acquisition

of tolerance to high temperature stress. Proc. Natl Acad. Sci. USA, 97: 4392–4397.

Hong, S.W., and Vierling, E., 2001. Hsp101 is necessary for heat tolerance but dispensable for

development and germination in the absence of stress. Plant J. 27: 25–35.

Hozain, M., Abdelmageed, H., Lee, J., Kang, M., Fokar, M., Allen, R.D., and Holaday, A.S.,

2012. Expression of AtSAP5 in cotton up-regulates putative stress-responsive genes and

improves the tolerance to rapidly developing water deficit and moderate heat stress. J Plant

Physiol. Sep 1. 169(13): 1261-70.

Lund, A.A., Blum, P.H., Bhattramakki, D., and Elthon, T.E., 1998. Heat-stress response of maize

mitochondria. Int. J. Plant Sci. 159: 39–45.

60

Maqbool, A., Abbas, W., Rao, A.Q., Irfan, M., Zahur, M., Bakhsh, A., Riazuddin, S., and

Husnain, T., 2009. Gossypium arboreum GHSP26 enhances drought tolerance in Gossypium

hirsutum. Biotechnol Prog. Jan. 26(1): 21-5.

Nishizawa, A., Yabuta, Y., Yoshida, E., Maruta, T., Yoshimura, K., and Shigeoka, S., 2006.

Arabidopsis heat shock transcription factor A2 as a key regulator in response to several types

of environmental stress. Plant J. 48: 535–547.

Pareek, A., Singla, S.L., and Grover, A., 1998. Proteins alterations associated with salinity,

desiccation, high and low temperature stresses and abscisic acid application in seedlings of

Pusa 169, a high-yielding rice (Oryza sativa L.) cultivar. Curr. Sci. 75: 1023–1035.

Rojas, A., Almoguera, C., and Jordano, J., 1999. Transcriptional activation of a heat shock gene

promoters in sunflower embryos: synergism between ABI3 and heat shock factors. Plant J. 20:

601–610.

Shi, W. M., Muramoto, Y., Ueda, A., and Takabe, T., 2001. Cloning of peroxisomal ascorbate

peroxidase gene from barley and enhanced thermotolerance by overexpressing in Arabidopsis

thaliana. Gene. 273: 23–27.

Su, P., and Li, H., 2008. Arabidopsis stromal 70-kD heat shock proteins are essential for plant

development and important for thermotolerance of germinating seeds. Plant Physiol. 146:

1231–1241.

Swamy, P.M., and Smith, B.N., 1999. Role of abscisic acid in plant stress tolerance. Curr. Sci. 76:

1220–1227.

Wang, J.B., and Li, R.Q., 1999. Changes of Ca2+ distribution in mesophyll cells of pepper under

heat stress. Acta Hortic. Sin. 26: 57–58.

Wang, W., Vinocur, B., Shoseyov, O., and Altman, A., 2004. Role of plant heat-shock proteins

and molecular chaperones in the abiotic stress response. Trends Plant Sci. 9: 244–252.

Xiong, L., Lee, H., Ishitani, M., Zhu, and J.-K., 2002. Regulation of osmotic stress responsive

gene expression by LOS6/ABA1 locus in Arabidopsis. J. Biol. Chem. 277: 8588–8596.

Yoshida, T., Ohama, N., Nakajima, J., Kidokoro, S., Mizoi, J., Nakashima, K., Maruyama, K.,

Kim, J.M., Seki, M., Todaka, D., Osakabe, Y., Sakuma, Y., SchöZ, F., Shinozaki, K., and

Kazuko, Y.S., 2011. Arabidopsis HsfA1 transcription factors function as the main positive

61

regulators in heat shock-responsive gene expression. Mol. Genet. Genomics. 286: 321–332.

Young, T.E., Ling, J., Geisler-Lee, C.J., Tanguay, R.L., Caldwell, C., and Gallie, D.R., 2001.

Developmental and thermal regulation of maize heat shock protein, HSP101. Plant Physiol.

127: 777–791.

Zhang, J.-H., Huang, W.-D., Liu, Y.-P., Pan, and Q.-H., 2005. Effects of temperature acclimation

pretreatment on the ultrastructure of mesophyll cells in young grape plants (Vitis vinifera L. cv.

Jingxiu) under cross-temperature stresses. J. Integr. Plant Biol. 47: 959–970.

62

CHAPTER 3

Study of the Gene Expression Pattern of Heat-response Genes in the Cotton Cultivars

Exhibiting Heat Tolerance and Susceptibility

Jin Zhang

Department of Crop, Soil, and Environmental Sciences, University of Arkansas, 115 Plant Science

building, University of Arkansas, Fayetteville, AR, 72701, USA

63

Abstract

The present study attempted to identify heat stress tolerance genes in two heat-tolerant

cotton cultivars, VH260 and MNH456, originating from Pakistan. Towards this, the expression

profile of the cotton orthologs of seven Arabidopsis and cotton heat stress tolerance genes were

studied in these two cultivars, and compared with the two heat-susceptible cotton cultivars, ST213

and ST4288, originating from Mississippi River Delta region. The gene expression data indicated

that both heat-tolerant cultivars highly express heat-shock proteins and heat-shock transcription

factors after heat treatment, whereas heat-susceptible cultivars show lower expression. Similarly,

Ascorbate Peroxidase I and Annexin 8, the two general stress proteins are also highly induced in at

least one of the heat tolerant cultivars in response to heat treatment. This work suggests that early

induction of heat shock protein genes and heat shock factor genes plays an important role in

conferring heat stress tolerance on cotton cultivars, VH260 and MNH456.

64

Introduction

Changes in gene expression play a crucial role in thermotolerance. Heat stress can alter gene

expression patterns (Yang et al., 2006), which induces expression of the HSP, while inhibiting

expression of many other genes (Yost and Lindquist, 1986). It is well known that heat shock

proteins (HSPs) play a crucial role in thermotolerance mechanisms under high temperature. HSPs

directly and indirectly improve many physiological phenomena including photosynthesis, carbon

assimilate partitioning, water and nutrient use efficiency, and membrane stability (Camejo et al.,

2005; Ahn and Zimmerman, 2006; Momcilovic and Ristic, 2007). These improvements allow and

make it possible for plants to grow and develop under heat stress. However, heat tolerance varies

between species and genotypes within a species. This variation is important for breeders to improve

crop’s heat-stress tolerance through genetic means. Some conventional plant breeding protocols

have been successfully developed, which aim at improving heat-tolerance of cotton (Ehlers and

Hall, 1998; Camejo et al., 2005). Nowadays, molecular breeding and genetic engineering have

become additional tools, which could be applied in plant breeding to develop heat tolerant

genotypes.

Up to now, many investigations have been done on cotton to overcome heat stress problems.

Several cultivars of cotton that are heat tolerant or susceptible to heat have been identified.

However, only a few studies have been done on thermotolerance mechanisms in cotton. Especially,

research at the molecular level needs to be done to reveal the thermotolerance mechanisms in

65

cotton. Only a few genes have been identified that enhance drought and heat tolerance in upland

cotton. According to Maqbool et al. (2009), overexpression of GHSP26, a small HSP gene in

Gossypium arboretum in response to dehydration, was observed in transgenic upland cotton

plants under drought stress. Research also suggested that through up-regulating the expression of

endogenous stress-responsive genes, the ectopic expression of the AtSAP5 (AT3G12630) gene

improved drought and heat tolerance in transgenic cotton (Gossypium hirsutum) (Hozain et al.,

2012). There are still many genes related to heat tolerance yet to be identified in cotton.

Gene expression analysis is becoming more and more important in biological research.

Understanding patterns of expressed genes is crucial to provide insights into complex regulatory

networks that may lead to the identification of genes relevant to new biological processes

(Vandesompele et al., 2002). Reverse transcription real-time quantitative polymerase chain

reaction (qPCR) is a convenient method to study gene expression changes (Gachon and Charrier,

2004). There are also other experimental techniques used to evaluate gene expression levels,

such as Northern blot hybridization and reverse transcription-polymerase chain reaction

(RT-PCR). Compared to these techniques, qPCR has higher sensitivity, specificity, and broad

quantification range of up to seven orders of magnitude (Hong et al., 2008). Therefore, qPCR

analysis has become the most commonly used method for validating the whole-genome

microarray data or a smaller set of genes and molecular diagnostics (Jain et al., 2006).

Same plant materials mentioned in chapter 1 were used in this study. The study is designed to

66

understand the thermotolerance mechanism and metabolic pathway involved in heat stress in

cotton through measuring the expression level of genes which are orthologues of Arabidopsis heat

tolerance genes. The objective of this study is to prove the selected gene’s relation to heat stress

through measuring the gene expression level in different cultivars.

Materials and Methods:

Plant Materials and Temperature Treatment

Two experiments were conducted to evaluate the effect of heat stress on both seedling and

flowering stages in Gossypium hirsutum. Experiments were started in July 2011. A total of four

genotypes were used in this research which are two heat tolerance cultivars VH260 and MNH456,

and two heat susceptible cultivars ST213 and ST4288 which were mentioned in Chapter 1. The

growth environment mentioned in Chapter 1 was also continue used in this study.

After two weeks, the temperature of the M3 chamber was changed to 38℃ at midday for

three hours. The first two true leaves of cotton seedlings were collected at the following time point

0 hour, 1 hour, 2 hour, and 3 hours and stored at -80℃ for RNA isolation. At approximately

flowering time (six weeks after germination), 38/24℃ day/night temperature regime was applied

in the E15 chamber. The first day flowers were collected at 2 pm after 0, 1, 2, 3 days heat

treatment. Materials were stored at -80℃ for RNA isolation.

RNA Isolation

67

For Cotton seedling samples, total RNA was isolated and purified with the ‘Plant RNeasy

Mini Kit’ (Qiagen) from all the collected tissue according to the manufacturer’s protocol. For

cotton flower samples, the hot borate method (Pang et al., 2011) was used for RNA isolation. RNA

quality and concentration were tested using Nanodrop-1000. Samples that have OD 260/280 ratio

of 1.8 to 2 and OD 260/230 of 1.8 or greater, which means good quality RNA devoid of protein,

salt and solvents, were selected. Then RNA samples were diluted to 25ng/ul and stored at -20℃.

Quantitative RT-PCR

The expression profile of each selected cotton gene was obtained through qRT-PCR

reactions by using the SuperScript Ш Platinum SYBR Green One-Step qRT-PCR kit according to

the improved manufacturer protocols (Hendrix, 2006). The reaction mixtures contained 1.5μL of

diluted cDNA (25ng/ul), 0.2μL of each primer (10ng/ul), 0.2μL of Platinum Taq DNA

polymerase (Invitrogen), and 5.5μL of SYBR®Green Mix Buffer. 4.4μL of Rnase free water was

added to adjuste the final volume of 12μL. Polymerase chain reactions were carried out in an

optical 96-well plate with BIO-RAD CFX96 Touch™ Real-Time PCR Detection System.

Reaction mixtures were incubated for five minutes at 94°C, followed by 39 amplification cycles

of 15s at 94°C, 10s at 60°C and 15s at 72°C. Melting curve of amplification products was

conducted to examine the specificity of the reactions (Hendrix, 2006). The amplification products

which have melting curve peaks between 78-82°C were considered to be the right products. The

data was analyzed according to the methods by Peirson et al. (2003).

68

Data Analysis

The expression levels of genes were calculated according to the methods by Livak and

Schmittgen (2001). CT values were exported from BIO-RAD CFX96 Touch™ Real-Time PCR

Detection System for expression calculations with Microsoft Excel. Relative fold expression

changes were calculated using the comparative CT method, where fold change is calculated as 2–

ΔΔCT, in which ΔCT = CT of target gene – CT of reference gene, and ΔΔCT = ΔCT of heat treated

(38℃) sample – ΔCT of control (32℃) sample.

The physiological parameters of these four cultivars grown under high and normal day/night

temperature regimes were compared (from different plants) using a two-way ANOVA and LSD

post hoc analysis (α = 0.05). Statistical analysis was performed using JMP IN 7.0 software (SAS

Institute, Cary, NC). Pictures were performed using SIGMA PLOT 12.

Result and Discussion

In seedling samples, the gene expression of HSFA1b, GHSP26, HSP101, HSC70-1 and

APX1 under different heat treatment time periods were measured using RNA isolated from the

first two true leaves. HSFA1b was rapidly over expressed in VH260 and MNH456, which

increased thousands to over hundred thousand times after heat treatment in cotton seedlings.

However, in heat susceptible lines, only less than ten folds increase was observed in ST4288 and

expression even decreased in ST213 (Fig. 1). These results coincide with the result of Yoshida et

al. (2011), who observed that the HsfA1a, HsfA1b, and HsfA1d acted as the main positive

69

regulators of heat stress response, and function at the initiation of transcriptional cascade for heat

stress responsive genes. According to previous study by Yamaguchi-Shinozaki and Shinozaki

(2006) and Sakuma et al. (2006), in Arabidopsis, DREB2A is one of the transcription factors that

activates the expression of heat and drought stress responsive genes, and its expression is

induced by both drought and heat stresses. Yoshida et al. (2011) found that HsfA1a, HsfA1b, and

HsfA1d regulate the expression of DREB2A in response to heat stress. Their research also

suggests that most heat stress inducible genes are regulated by HsfA1a, HsfA1b, and HsfA1d.

More than hundreds of relative fold increases of GHSP26 were observed in VH260,

MNH456, and ST213, and less than 10 fold increase in ST4288 (Fig. 2). Maqbool et al. (2009)

observed that transgenic cotton plants over-expressing GHSP26 has higher ability to cope with

drought stress as compared to non-transgenic plants. According to Maqbool et al. (2007), GHSP26

protein sequence shares significantly high identity with Arabidopsis thaliana (CAA38036), Oryza

sativa (BAA78385), and Nicotiana tabacum (BAA29064). All these proteins comprise

alpha-crystalline-type HSPs, a family of small stress induced proteins ranging from 12 to 43 kDa,

which are ATP-independent chaperones that prevent proteins aggregation and are necessary in

refolding in combination with other HSPs (Jakob et al., 1993).

HSP101 was highly expressed in VH260 and MNH456, which increased ten to over

hundred times after heat treatment in cotton young leaves. However, in heat susceptible cultivars

ST213 and ST4288, significant decrease was observed in seedling leaves after two hours heat

70

stress (Fig. 3). The HSC-70 gene showed a 2 – 9 times increase in expression in VH260 and

MNH456, and no increase or even decrease in heat susceptible cultivars (Fig. 4). According to

previous studies, both HSP101 and HSP70 are very important heat shock proteins that function

as molecular chaperones to prevent aggregation and denaturation of cellular proteins in response

to high temperature (Frydman, 2001). When maize was exposed to high temperature, levels of

HSP101 increased correspondingly (Young et al., 2001). Burke (2001) had reported that those

mutants in Arabidopsis, which were unable to synthesize HSPs or in which HSP70 synthesis was

blocked or inactivated, were more sensitive to heat stress. Another result showed that plastid

stromal cpHSC70-1 is important for the thermotolerance of germinating seeds in Arabidopsis (Su

and Li 2008).

Only VH260 showed an obvious fold increase of APX1 with 3 – 9 fold increase in seedling

samples during hours of heat stress, while similar expression patterns were found in other three

cultivars i.e. the expression level decreased in seedling samples (Fig. 5). Previous study by

Davletova et al. (2005) had shown that APX1 is a central component of the reactive oxygen

network in Arabidopsis, and plays a key role in protection of adjacent compartments. This was

proved by oxidized proteins in chloroplastic, mitochondrial, and membrane in mutant plants.

Their research also suggested that HSFs are involved in the signal transduction pathway

controlling APX1 expression under environmental stress tests due to the result that HSF21 in

transgenic Arabidopsis plants prevented the accumulation of transcripts encoding of APX1

during light stress.

71

In flowering samples, the gene expression of HSFA2, ANNAT8, HSP101, HSC70-1 and

APX1 under different heat treatment time periods were measured using RNA isolated from ovary

tissue.

The study showed an increasing expression level of HSFA2 in all four cultivars after one to

three days of heat treatment. In heat tolerant cultivars (VH260 and MNH456) the expression

level increased ten to hundred times, whereas in heat susceptible cultivars (ST213 and ST4288)

only less than ten times increase was observed (Fig. 6). This result suggests that HSFA2 is highly

induced during heat stress in both types of cultivars, and its level of induction is much more in

heat tolerant lines. This result correlates with previous studies: according to Schramm et al.

(2006), expression of HsfA2 is strongly heat induced in Arabidopsis; and it is a relatively stable

protein, which accumulates like HSPs. Using microarray analysis, Busch et al. (2005) also found

that HsfA2 is strongly heat induced at transcriptional level. In the study of Schramm et al. (2006),

through Pearson correlation analysis, a core cluster of HSPs including Hsp26.5-P(r), Hsp25.3-P,

Hsp22.0-ER, Hsp18.1-CI, Hsp70b, and Hsp101-3 was identified to be affected by HSFA2.

EMSA (Electrophoretic Mobility Shift Assay) and transient reporter assays using promoter-GUS

fusions further confirmed the direct binding of HsfA2 to the promoters of these genes. With these

results, they concluded that expression of this subset of HSPs is regulated by HsfA2.

ANNAT8 increased 4 – 10 times in the heat tolerant lines, VH260 and MNH456, whereas

no obvious differences were observed in heat susceptible cultivars after heat treatment (Fig. 7).

72

These results match with the result of Cantero et al. (2006), who found that ANNAT8 is positively

affected by high temperature, dehydration and high NaCl. According to previous study, when

plants are under heat stress, cytosolic Ca2+ sharply rises (Larkindale and Knight, 2002). It seems

that it is the increase of Ca2+ concentration in cytosol transduces high temperature signal to

Mitogen Activated Protein Kinase (MAPK), which was considered to have a prominent role in

coping with many responses to external signals (Kaur and Gupta, 2005). ANNAT8 as a calcium

ion binding protein may function in transporting calcium signals into adaptive responses (Cantero

et al., 2006).

HSP101, a heat shock protein gene, was induced in VH260 and MNH456 to 4 – 9 times

upon heat treatment in cotton flowering plants. However, in heat susceptible lines, ST213 and

ST4288, less than two times increase were observed in ovary samples (Fig. 8). Another heat

shock protein gene, HSC-70, showed 2 – 10 times increase in expression in VH260 and

MNH456, and no increase or even decrease in expression in the heat susceptible cultivars (Fig.

9). Expression pattern of both HSP101 and HSC70 in flowering cottons is similar to that in

seedlings of the four lines.

Only VH260 showed a clear induction in APX1 gene expression in ovary upon heat

treatment with six fold increase after two days of heat stress. Other three cultivars showed only

a slight increase in APX1 expression level in the ovary (Fig. 10).

Also, the ΔΔCT values between the four genotypes in 32℃ of all 7 genes were compared to

73

see the expression differences.

Form. 3 Comparison of ΔΔCT values between the four genotypes in 32℃ of all 7 genes

Genes VH260 MNH456 ST213 ST4288

HSP101 (Seedling) 1 1.494849 781.4447 317.3652

HSP101 (Ovary) 1 2.084932 24.76104 9.849155

HSFA2 1 0.80107 17.14838 1.79005

HSFA1b 1 13.6421 1100708 1758.342

HSC70 (Seedling) 1 10.70342 7.674113 14.42001

HSC70 (Ovary) 1 4.594793 4.594793 14.6213

GHSP26 1 75.58353 2.675855 20.25211

APX1 (seedling) 1 9.986644 4.890561 14.12325

APX1 (Ovary) 1 1.505247 1.827663 2.329467

ANNAT8 1 0.517632 3.458149 3.138336

In our study, the expression pattern of the selected heat tolerance genes in four cultivars

can be explained as follows. Due to the genotypic difference, heat shock factors (HSF) and heat

shock proteins (HSP) are already highly expressed at 32℃ in heat susceptible lines, which have a

relative lower heat-threshold. Whereas, in heat tolerant lines, these genes are either silent or

expressed at very low levels. When the temperature rises to 38℃, HSFs and HSPs start to highly

express in heat tolerant lines, which represents a thousand-fold increase. However, in heat

susceptible lines, HSPs and HSFs are not sufficiently induced, thereby cellular proteins are not

protected from heat denaturation.

References

74

Ahn, Y.-J., and Zimmerman, J.L., 2006. Introduction of the carrot HSP17.7 into potato (Solanum

tuberosum L.) enhances cellular membrane stability and tuberization in vitro. Plant Cell

Environ. 29: 95–104.

Artico, S., Nardeli, S., Brilhante, O., Grossi-de-Sa, M., and Alves-Ferreira, M., 2010.

Identification and evaluation of new reference genes in Gossypium hirsutum for accurate

normalization of real-time quantitative RT-PCR data. BMC Plant Biology. 10(1): 49.

Burke, J.J., 2001. Identification of genetic diversity and mutations in higher plant acquired

thermotolerance. Physiol. Plant. 112, 167–170.

Busch, W., Wunderlich, M. and Scho ffl, F., 2005. Identification of novel heat shock

factor-dependent genes and biochemical pathways in Arabidopsis thaliana. Plant J. 41: 1–14.

Camejo, D., Rodr´ıguez, P., Morales, M.A., Dell’amico, J.M., Torrecillas, A., and Alarco´ n, J.J.,

2005. High temperature effects on photosynthetic activity of two tomato cultivars with

different heat susceptibility. J. Plant Physiol. 162: 281–289.

Cantero, A., Barthakur, S., Bushart, T.J., Chou, S., Morgan, R.O., Fernandez, M.P., Clark, G.B.,

and Roux, S.J., 2006. Expression profiling of the Arabidopsis annexin gene family during

germination, de-etiolation and abiotic stress. Plant Physiology and Biochemistry. 44: 13–24.

Davletova, S., Rizhsky, L., Liang, H.J., Zhong, S.Q., Oliver, D. J., C, J., Shulaev, V., Schlauch,

K., and Mittlera, R., 2005. Cytosolic Ascorbate Peroxidase 1 Is a Central Component of the

Reactive Oxygen Gene Network of Arabidopsis. The Plant Cell. Vol. 17: 268–281.

Ehlers, J.D., and Hall, A.E., 1998. Heat tolerance of contrasting cowpea lines in short and long

days. Field Crops Res. 55: 11–21.

Frydman, J., 2001. Folding of newly translated proteins in vivo: the role of molecular

chaperones. Annu Rev Biochem. 70: 603–47.

Gachon, C.MA., and Charrier, B., 2004. Real-time PCR: what relevance to plant studies? J Exp

Bot. 55: 1445-1454.

Hendrix, B.L., 2006. Molecular characterization of cotton: Genome size evolution and the

genomics and metabolomics of osmotic stress in roots. Dissertation, University of Arkansas.

Hong, SYSS., Yang, M.S., Xiang, F., and Park, C.M., 2008. Exploring valid reference genes for

75

gene expression studies in Brachypodium distachyon by real-time PCR. Bmc Plant Biology. 8:

112.

Hozain, M., Abdelmageed, H., Lee, J., Kang, M., Fokar, M., Allen, R.D., and Holaday, A.S.,

2012. Expression of AtSAP5 in cotton up-regulates putative stress-responsive genes and

improves the tolerance to rapidly developing water deficit and moderate heat stress. J. Plant

Physiol. 169: 1261-70.

Jain, MNA., Tyagi, A.K., and Khurana, J.P., 2006. Validation of housekeeping genes as internal

control for studying gene expression in rice by quantitative real-time PCR. Biochem. Biophys.

Res. Commun. 345: 651.

Jakob, U.M., Gaestel, K. E., and Buchner, J., 1993. Small heat shock proteins are molecular

chaperones. J. Biol. Chem. 268: 1517–1520.

Jones, P.D., New, M., Parker, D.E., Mortin, S., and Rigor, I.G., 1999. Surface area temperature

and its change over the past 150 years. Rev. Geophys. 37: 173–199.

Kaur, N., and Gupta, A.K., 2005. Signal transduction pathways under abiotic stresses in plants.

Curr. Sci. 88: 1771–1780.

Kurek, I., Chang, T.K., Bertain, S.M., Madrigal, A., Liu, L., Lassner, M.W., and Zhu, G., 2007.

Enhanced thermostability of Arabidopsis rubisco activase improves photosynthesis and

growth rates under moderate heat stress. Plant Cell. 19: 3230-3241.

Larkindale, J., and Knight, M.R., 2002. Protection against heat stress-induced oxida- tive damage

in Arabidopsis involves calcium, abscisic acid, ethylene and salicylic acid. Plant Physiol. 128:

682–695.

Livak, K., and Schmittgen, T., 2001. Analysis of relative gene expression data using real-time

quantitative PCR and the 2-delta delta CT method. Methods 25: 402-408.

Maqbool, A., Abbas, W., Rao, A.Q., Irfan, M., Zahur, M., Bakhsh, A., Riazuddin, S., and

Husnain, T., 2009. Gossypium arboreum GHSP26 enhances drought tolerance in Gossypium

hirsutum. Biotechnol Prog. Jan. 26(1): 21-5.

Maqbool, A., Zahur, M., Irfan, M., Qaiser, U., Rashid, B., Husnain, T., and Riazuddin, S., 2007.

Identifi cation, Characterization and Expression of Drought Related alpha-Crystalline Heat

Shock Protein Gene (GHSP26) from Desi Cotton. Crop. Sci. Vol. 47.

76

Momcilovic, I., and Ristic, Z., 2007. Expression of chloroplast protein synthesis elongation

factor, EF-Tu, in two lines of maize with contrasting tolerance to heat stress during early

stages of plant development. J. Plant Physiol. 164: 90–99.

Nishizawa, A., Yabuta, Y., Yoshida, E., Maruta, T., Yoshimura, K., and Shigeoka, S., 2006.

Arabidopsis heat shock transcription factor A2 as a key regulator in response to several types

of environmental stress. Plant. J. 48: 535–547

Pang, M., Stewart, M. J., and Zhang, J., 2011. A mini-scale hot borate method for the isolation of

total RNA from a large number of cotton tissue samples. African J. Biotech. 10:15430–15437.

Peirson, S.N., Butler, J.N., and Foster, R.G., 2003. Experimental validation of novel and

conventional approaches to quantitative real-time PCR data analysis. Nucleic Acids Research.

Jul 15. 31(14): e73.

Sakuma, Y., Maruyama, K., Osakabe, Y., Qin, F., Seki, M., Shinozaki, K., and

Yamaguchi-Shinozaki, K., 2006. Functional analysis of an Arabidopsis transcription factor,

DREB2A, involved in droughtresponsive gene expression. Plant Cell. 18: 1292–1309

Schramm, F., Ganguli, A., Kiehlmann, E., Englich, G., Walch, D., and Doring, P.K., 2006. The

heat stress transcription factor HsfA2 serves as a regulatory amplifier of a subset of genes in

the heat stress response in Arabidopsis. Plant. Mol. Bio. 60: 759–772.

Snider, J.L., Oosterhuis, D.M., and Kawakami, E.M., 2010. Genotypic differences in

thermotolerance are dependent upon pre-stress capacity for antioxidant protection of the

photosynthetic apparatus in Gossypium hirsutum. Physiol. Plant. 138: 268-277.

Snider, J.L., Oosterhuis, D.M., Skulman, B.W., and Kawakami, E.M., 2009. Heat stress-induced

limitations to reproductive success in Gossypium hirsutum. Physiol. Plant. 137: 125-138.

Su, P.H., and Li, H.M., 2008. Arabidopsis stromal 70-kD heat shock proteins are essential for

plant development and important for thermotolerance of germinating seeds. Plant Physiol. 146:

1231–41.

Vandesompele, JDPK., Pattyn, F., Poppe B., Van Roy, N., De Paepe, A., and Speleman, F., 2002.

Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of

multiple internal control genes. Genome Biol. 3:7.

Yamaguchi-Shinozaki, K., and Shinozaki, K., 2006. Transcriptional regulatory networks in

77

cellular responses and tolerance to dehydration and cold stresses. Annu Rev Plant Biol. 57:

781–803.

Yang, K.A., Lim, C.J., Hong, J.K., Park, C.Y., Cheong, Y.H., Chung, W.S., Lee, K.O., Lee, S.Y.,

Cho, M.J., and Lim, C.O., 2006. Identification of cell wall genes modified by a permissive

high temperature in Chinese cabbage. Plant Sci. 171: 175–182.

Yoshida, T., Ohama, N., Nakajima, J., Kidokoro, S., Mizoi, J., Nakashima, K., Maruyama, K.,

Kim, J.M., Seki, M., Todaka, D., Osakabe, Y., Sakuma, Y., SchöZ, F., Shinozaki, K., and

Kazuko, Y.S., 2011. Arabidopsis HsfA1 transcription factors function as the main positive

regulators in heat shock-responsive gene expression. Mol. Genet. Genomics. 286: 321–332.

Yost, H.J., and Lindquist, S., 1986. RNA splicing is interrupted by heat shock and is rescued by

heat shock protein synthesis. Cell. 45: 185–193.

Young, T.E., Ling, J., Geisler-Lee, C.J., Tanguay, R.L., Caldwell, C., and Gallie, D.R., 2001.

Developmental and thermal regulation of maize heat shock protein, HSP101. Plant Physiol.

127: 777–791.

78

Figure Legends

Fig. 1. Relative fold difference of HSFA1b expression level in thermotolerant (VH260 &

MNH456) and thermosensitive (ST213 & ST43288) G. hirsutum seedling first two true leaves

exposed to optimal temperature (32/24℃; black vertical bar) and high temperature (38/24℃; gray

vertical bars) for 1, 2, and 3 hours. All values are means ± standard error (n=3).

Fig. 2. Relative fold difference of GHSP26 expression level in thermotolerant (VH260 &

MNH456) and thermosensitive (ST213 & ST43288) G. hirsutum seedling first two true leaves

exposed to optimal temperature (32/24℃; black vertical bar) and high temperature (38/24℃; gray

vertical bars) for 1, 2, and 3 hours. All values are means ± standard error (n=3).

Fig. 3. Relative fold difference of HSP101 expression level in thermotolerant (VH260 &

MNH456) and thermosensitive (ST213 & ST43288) G. hirsutum seedling first two true leaves

exposed to optimal temperature (32/24℃; black vertical bar) and high temperature (38/24℃; gray

vertical bars) for 1, 2, and 3 hours. All values are means ± standard error (n=3).

Fig. 4. Relative fold difference of HSC70 expression level in thermotolerant (VH260 &

MNH456) and thermosensitive (ST213 & ST43288) G. hirsutum seedling first two true leaves

exposed to optimal temperature (32/24℃; black vertical bar) and high temperature (38/24℃; gray

vertical bars) for 1, 2, and 3 hours. All values are means ± standard error (n=3).

Fig. 5. Relative fold difference of APX1 expression level in thermotolerant (VH260 &

MNH456) and thermosensitive (ST213 & ST43288) G. hirsutum seedling first two true leaves

exposed to optimal temperature (32/24℃; black vertical bar) and high temperature (38/24℃; gray

79

vertical bars) for 1, 2, and 3 hours. All values are means ± standard error (n=3).

Fig. 6. Relative fold difference of HSFA2 expression level in thermotolerant (VH260 &

MNH456) and thermosensitive (ST213 & ST43288) G. hirsutum first day opening flowers

exposed to optimal temperature (32/24℃; black vertical bar) and high temperature (38/24℃; gray

vertical bars) for 1, 2, and 3 days. All values are means ± standard error (n=3).

Fig. 7. Relative fold difference of ANNAT8 expression level in thermotolerant (VH260 &

MNH456) and thermosensitive (ST213 & ST43288) G. hirsutum first day opening flowers

exposed to optimal temperature (32/24℃; black vertical bar) and high temperature (38/24℃; gray

vertical bars) for 1, 2, and 3 days. All values are means ± standard error (n=3).

Fig. 8. Relative fold difference of HSP101 expression level in thermotolerant (VH260 &

MNH456) and thermosensitive (ST213 & ST43288) G. hirsutum first day opening flowers

exposed to optimal temperature (32/24℃; black vertical bar) and high temperature (38/24℃; gray

vertical bars) for 1, 2, and 3 days. All values are means ± standard error (n=3).

Fig. 9. Relative fold difference of HSC70 expression level in thermotolerant (VH260 &

MNH456) and thermosensitive (ST213 & ST43288) G. hirsutum first day opening flowers

exposed to optimal temperature (32/24℃; black vertical bar) and high temperature (38/24℃; gray

vertical bars) for 1, 2, and 3 days. All values are means ± standard error (n=3).

Fig. 10. Relative fold difference of APX1 expression level in thermotolerant (VH260 &

MNH456) and thermosensitive (ST213 & ST43288) G. hirsutum first day opening flowers

exposed to optimal temperature (32/24℃; black vertical bar) and high temperature (38/24℃; gray

80

vertical bars) for 1, 2, and 3 days. All values are means ± standard error (n=3).

81

Figure 1

Figure 2

82

Figure 3

Figure 4

83

Figure 5

Figure 6

84

Figure 7

Figure 8

85

Figure 9

Figure 10

86

CONCLUSION

No obvious differences were found in photochemical efficiency of PSII in both heat tolerant

and heat susceptible lines. Two heat susceptible cultivars show a significant increase in membrane

leakage after heat treatment as compared to the heat tolerant lines. These results suggest that

genotypic differences exist between heat tolerant cultivars VH260, MNH456 and heat

susceptible cultivars ST213 and ST4288.

Both heat-tolerant cultivars highly express heat-shock proteins and heat-shock factors after

heat treatment, whereas heat-susceptible cultivars show a lower expression. Ascorbate Peroxidase

I and Annexin 8, the two general stress proteins are also highly induced in at least one of the heat

tolerant cultivars upon heat treatment. These results suggest that early induction of heat-stress

response genes such as heat shock proteins and heat shock factors, and general stress gene such as

Annexin 8 play an important role in conferring heat stress tolerance in cotton varieties VH260 and

MNH456. Thus, the heat tolerance mechanism in cotton is similar to that of Arabidopsis.

87

APPENDIX

Table 1: Actual Quantum Yield of seedling first two true leaves of four cultivars exposed to

optimal and high day temperatures.

Sample

number

VH260 MNH456 ST213 ST4288

32℃ 38℃ 32℃ 38℃ 32℃ 38℃ 32℃ 38℃

1 0.705 0.728 0.597 0.635 0.698 0.628 0.678 0.648

2 0.701 0.766 0.643 0.665 0.683 0.634 0.704 0.607

3 0.692 0.682 0.589 0.699 0.688 0.701 0.677 0.66

4 0.586 0.651 0.681 0.648 0.623 0.713 0.769 0.59

5 0.704 0.723 0.627 0.638 0.636 0.685 0.72 0.731

6 0.591 0.631 0.673 0.659 0.68 0.682 0.717 0.645

7 0.679 0.678 0.719 0.651 0.673 0.691 0.728 0.678

8 0.67 0.707 0.665 0.706 0.666 0.714 0.683 0.673

9 0.612 0.638 0.675 0.611 0.621 0.652 0.763 0.739

10 0.613 0.640 0.685 0.652 0.649 0.663 0.726 0.741

11 -- -- 0.725 0.702 -- -- 0.694 0.678

12 -- -- 0.66 0.665 -- -- -- --

Table 2: Actual Quantum Yield of flowering upper most fully expanded leaves of four cultivars

exposed to optimal and high day temperatures.

Sample

number

VH260 MNH456 ST213 ST4288

32℃ 38℃ 32℃ 38℃ 32℃ 38℃ 32℃ 38℃

1 0.797 0.799 0.782 0.746 0.774 0.749 0.78 0.76

2 0.805 0.775 0.773 0.775 0.786 0.778 0.736 0.775

3 0.8 0.798 0.757 0.754 0.768 0.765 0.746 0.747

4 0.78 0.745 0.755 0.756 0.772 0.753 0.791 0.726

5 0.796 0.792 0.757 0.758 0.776 0.754 0.796 0.734

6 -- -- -- -- 0.780 0.739 0.769 0.787

88

Table 3: Relative membrane injury of seedling first two true leaves of four cultivars exposed to

optimal and high day temperatures.

Sample

number

VH260 MNH456 ST213 ST4288

32℃ 38℃ 32℃ 38℃ 32℃ 38℃ 32℃ 38℃

1 0.395 0.385 0.453 0.488 0.355 0.545 0.358 0.431

2 0.415 0.489 0.489 0.568 0.368 0.502 0.371 0.436

3 0.442 0.427 0.473 0.559 0.397 0.460 0.397 0.618

4 0.401 0.521 0.434 0.530 0.368 0.424 0.309 0.495

5 0.444 0.514 0.429 0.504 0.372 0.464 0.341 0.614

Table 4: Relative membrane injury of flowering upper most fully expanded leaves of four

cultivars exposed to optimal and high day temperatures.

Sample

number

VH260 MNH456 ST213 ST4288

32℃ 38℃ 32℃ 38℃ 32℃ 38℃ 32℃ 38℃

1 0.312 0.314 0.289 0.303 0.316 0.502 0.370 0.447

2 0.335 0.324 0.281 0.314 0.325 0.443 0.399 0.504

3 0.312 0.311 0.307 0.305 0.353 0.417 0.376 0.560

4 0.303 0.297 0.316 0.304 0.354 0.409 0.373 0.563

5 0.315 0.312 0.283 0.309 0.337 0.443 0.379 0.519

89

Table 5: Ct value of related gene expression level in seedling first two true leaves of four

cultivars exposed to optimal and high day temperatures.

Cultivar Sample:

hour-replicate

HSPP2A1

(Ct)

HSFA1b

(Ct)

GHSP26

(Ct)

HSP101

(Ct)

HSC70

(Ct)

APX1

(Ct)

VH260 0-2 20.57 38.95 27.72 25.07 18.9 20.05

1-1 20.7 22.86 18.43 17.55 17.35 18.06

1-3 20.78 21.59 17.5 17.01 16.49 16.78

2-1 20.59 28.33 13.97 19.62 17.71 18.01

2-2 22.02 27.55 15.71 22.42 19.44 20.56

3-1 21.23 36.57 17.13 22.39 18.51 19.3

3-3 20.73 34.03 16.22 20.41 18.59 19.56

MNH456 0-2 23.14 37.75 24.05 27.06 18.05 19.3

1-1 22.62 28.55 13.17 18.3 15.83 17.84

1-2 21.15 24.47 12.17 17.8 14.61 17.21

2-1 19.77 23.56 14.88 24.11 18.7 17.46

2-2 21.5 23.06 15.23 24.66 18.19 19.06

3-2 19.1 37.01 15.05 22.35 16.32 17.22

3-3 21.65 37.07 16.43 25.36 17.98 18.44

ST213 0-1 20.53 18.84 26.26 15.42 15.62 17.72

1-1 20.66 22.07 19.16 17.34 17.29 18.06

1-3 20.74 24.77 18.08 19.01 17.3 18.42

2-2 21.59 22.74 17.97 25.09 18.15 19.9

2-3 21.11 22.5 17.14 27.1 18.4 19.11

3-1 20.65 23.29 17.09 21.98 18.55 19.38

3-2 20.88 24.04 17.16 26.61 18.62 19.13

ST4288 0-1 21.18 28.78 23.99 17.37 15.66 16.84

1-2 22.01 29.43 23.06 17.8 17.11 18.38

1-3 22.87 29.05 22.86 21.63 17.81 19.2

2-1 22.52 27.62 23.99 24.56 19.67 19.99

2-2 22.05 27.17 22.52 27.62 19.52 18.45

3-1 20.89 26.23 21.38 26.81 20.23 20.09

3-2 20.69 26.52 21.84 26.7 19.15 20.14

90

Table 6: Ct value of related gene expression level in first day opening flowers of four cultivars

exposed to optimal and high day temperatures.

Cultivar Sample:

hour-replicate

HSPP2A1

(Ct)

HSFA2

(Ct)

ANNAT8

(Ct)

HSP101

(Ct)

HSC70

(Ct)

APX1

(Ct)

VH260 0-3 21.33 30.7 30.35 31.16 23.14 21.14

1-1 21.03 27.11 30.19 28.96 21.76 21.04

1-2 23.73 27.9 31.89 30.78 22.95 22.67

2-1 20.07 21.8 25.75 26.79 18.63 17.02

2-3 21.45 24.36 27.7 28.13 19.46 19.06

3-1 21.24 27.15 30.9 29.02 20.59 20.57

3-3 19.28 26.38 28.91 27.72 19.31 20.05

MNH456 0-3 20.67 30.36 30.64 29.44 20.28 19.89

1-1 19.37 22.48 27.53 25.56 17.64 17.17

1-3 19.48 22.69 26.08 25.6 18.47 18.16

2-1 22.16 25.04 30.34 28.8 21.83 20.33

2-3 21.2 24.83 29.18 28.49 20.61 19.57

3-2 21.21 25.53 28.66 28.84 20.07 20.44

3-3 18.08 21.58 24.11 25.04 17.88 16.43

ST213 0-3 21.08 26.35 28.31 26.28 20.69 20.02

1-1 22.14 25.58 28.8 28.91 21.03 20.64

1-3 22.13 25.29 29.41 28.82 21.05 21.14

2-2 22.28 27.41 29.87 28.84 21.08 20.35

2-3 23.35 28.36 31.38 30.34 22.31 21.92

3-1 22.3 25.46 29.26 26.03 21.3 20.87

3-2 19 21.97 26.18 24 18.3 17.09

ST4288 0-2 23.1 31.63 30.47 29.63 21.04 21.69

1-1 21.59 27.58 27.95 27.2 19.52 19.62

1-2 21.1 28.26 28.17 29.04 19.75 19.35

2-1 21.02 26 28.38 28.79 20.05 18.88

2-2 23.44 29.65 29.82 30.79 22.86 22.61

3-1 21.07 26.48 28.64 28.08 21.5 19.37

3-3 23.63 29.5 30.55 29.82 24.93 23.42