THE JOURNAL OF BIOLOGICAL CHEMISTRY Q 1988 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 263, No. 18. Issue of June 26, pp. 8953-8957, 1988 Printed in U.S.A.

Studies on the Mutator Gene, mutT of Escherichia coli MOLECULAR CLONING OF THE GENE, PURIFICATION OF THE GENE PRODUCT, AND IDENTIFICATION OF A NOVEL NUCLEOSIDE TRIPHOSPHATASE*

(Received for publication, November 9, 1987)

Satish K. Bhatnagar and Maurice J. Bessman From the McCollum-Pratt Institute and the Department of Biology, The Johns Hopkins University, Baltimore, Maryland 21218

The mutator gene, mutT, has been cloned into an expression vector and overproduced in Escherichia coli. The gene product has been purified to over 90% homogeneity as judged by gel electrophoresis and amino acid analysis. The amino acid composition of the protein and the sequence of the 20 amino acids of the N-terminal region agree well with the nucleotide se- quence of the gene reported by Akiyama et al. (Aki- yama, M., Horiuchi, T., and Sekiguchi, M. (1987) Mol. Gen. Genet. 206, 9-16) and indicate that the first of the potential initiation codons (position 164) of the open reading frame in the PuuII fragment carrying the mutT gene is the site of initiation of translation of the 16,000-Da polypeptide. A novel nucleoside tri- phosphatase activity which has a preference for dGTP is associated with the purified protein, and preliminary experiments are consistent with the notion that the mutT gene product is the enzyme responsible for this activity.

As a continuation of our studies on the biochemical basis of spontaneous mutations, we are investigating the very un- usual mutator gene in Escherichia coli, mutT. Of the dozen or so genes in E. coli known to be directly involved in maintain- ing the fidelity of DNA synthesis (l), mutT has several unique characteristics. First described by Treffers (2) as a mutator gene causing very high spontaneous mutation rates, mutT has the unusual property of acting unidirectionally. That is, mu- tants produced spontaneously in a mutT background do not revert to wild type. This was explained by Yanofsky et al. (3), who demonstrated that mutT specifically induces unidirec- tional A:T + C:G transversions. The mutT allele is recessive and acts in trans (4). It is only expressed during DNA repli- cation and partially suppresses a dnaE mutation (5). These properties suggest that the mutT gene product is a highly specific component of the replication entourage, which may interact with the DNA polymerase I11 enzyme during DNA replication.

Our studies of mutT reported here are focused on the cloning of the gene from a X transducing phage, purification of the mutT gene product, and identification of a new nucle- oside triphosphatase associated with the purified protein. Akiyama et al. (6) have cloned mutT using a different strategy, sequenced the gene, and overproduced the gene product. Their results were very helpful in the latter stages of our work.

* This work was supported by Grant GM-18649 from the National Institutes of General Medical Sciences and is publication 1408 of the McCollum-Pratt Institute. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

EXPERIMENTAL PROCEDURES

Materials

Media and Chemicals-The composition of all bacterial growth media not specifically referenced in the text were as described by Miller (7) and Maniatis et al. (8). Antibiotic concentrations used for selection of bacteria were as follows: tetracycline, 15 pg/ml; ampicil- lin, 50 pg/ml on plates and 25 pg/ml in liquid cultures; and chlor- amphenicol, 20 pg/ml. Enzymes and reagents used for DNA manip- ulations were purchased from Bethesda Research Laboratories. IPTG’ was from Research Organics, La. , DEAE-cellulose from Whatman, and nucleotides and Sephadex G-100 from Pharmacia LKB Biotechnology Inc.

Microbial Strains-The E. coli strains specific to this work and their relevant genotypes are: TX48, guaC purM, from J. S. Gots; ES653, mutTl (9), and ES768, mutT49:Mu-1 (10) from Eli Siegel; SB3, guaCpurM mutTl, constructed in this laboratory by transducing recipient, TX48, with P1 phage grown on ES653; Q359, P2 lysogen, host for preparation of phage stocks. XD02, which has a high trans- ducing frequency for secA ( l l ) , was obtained from Donald Oliver. The common vector plasmids pBR322 and pUC18 were purchased from Bethesda Research Laboratories, and the low copy number mini plasmid pDPT487 derived from NR1 (12) was obtained from Dean Taylor via R. P. Cunningham, Department of Biological Sciences, State University of New York at Albany.

Methods

Preparation of plasmid DNA, X phage DNA, restriction enzyme digests, ligation, and agarose gel electrophoresis were done according to Maniatis et al. (8). Bacterial transformation was done according to Morrison (13) and DNA fragments from agarose gels were purified by the method of Tabak and Flavell(l4).

For routine screening of cultures for the mutT phenotype, the following qualitative test was developed. The cultures were grown in LB medium to saturation at 37 “C, and 25 pl aliquots were spotted onto plates containing LB agar + nalidixic acid (20 pg/ml) and/or streptomycin (150 pg/ml). The plates were incubated at 37 ‘C for 16- 24 h. Mutator strains produced up to 50 colonies/25-pl spot, whereas cells carrying the wild type mutT gene produced less than three colonies. In this way, up to 20 cultures could be screened per plate. For a quantitative assay of mutator activity, the cultures were grown to saturation as above, and suitable dilutions of mutator and wild type cultures were plated on nalidixic acid and/or streptomycin plates. The plates were incubated at 37 “C for 24-36 h and compared to the number of viable cells grown on LB plates.

Purification of the mutT gene product was followed by polyacryl- amide gel electrophoresis in the presence of sodium dodecyl sulfate according to Laemmli (15) on a mini gel electrophoresis apparatus. The 4% stacking and 20% resolving gels were run at 100 and 200 volts, respectively. Protein concentration was assayed according to Bradford (16).

Amino acid composition of the mutT protein was determined by chromatography after standard acid hydrolysis and phenyl isothio- cyanate labeling procedures. The N-terminal amino acid sequence was analyzed in an Applied Biosystems gas phase protein sequencer, model 470A, coupled to an on-line PTH analyzer, model 120A.

’ The abbreviations used are: IPTG, isopropyl B-D-thiogalactopyr- anoside; kb, kilobase.

8953

8954 mutT Mutator Gene of E. coli

Assay of Nucleoside Triphosphutose-The reaction mixture con- tains, in 0.3 ml: 67 mM Tris-HCI, pH 9.0, 6.7 mM MgC12, 3.4 mM substrate, and 2-10 milliunits of enzyme. After 20 min at 37 “C, the reaction is stopped by the addition of 50 pl of cold 1 N perchloric acid and 50 pl of an aqueous suspension of Norit A (20% packed volume). The suspension is mixed intermittently for 5 min, centrifuged, and an aliquot of the supernatant is used for the determination of inor- ganic orthophosphate by the method of Ames and Dubin (17). A unit of enzyme forms 1 pmol of inorganic orthophosphate from dGTP per min under these conditions.

RESULTS AND DISCUSSION

Cloning of the mutT Gene There are no readily observable characteristics which can

be used for selecting or mass screening of strains carrying mutT. Accordingly, we made use of two genetic markers approximately 90% cotransducible with and flanking mutT and which can be conveniently selected. These two genes, secA and guuC, are located at 2.4 and 2.6 min, respectively, on the E. coli genome, and mutT is about half way between them (18). Out of several available X transducing phages carrying secA, AD02 which contains additional DNA in a clockwise direction was selected for study. In order to check whether the mutT gene was also present in this phage, a strain of E. coli, SB3, was constructed by transducing mutT- into a guaC- recipient. From an infection of SB3 by XD02, 20 lysogens were selected for guaC+ and all 20 were shown to have wild type spontaneous mutation rates by the spot test described under “Methods.” This strongly suggested that AD02 carried the wild type mutT gene and incidently supports the positioning of mutT between secA and guuC. On the basis of this analysis, AD02 was selected as the source of the mutT gene, and the strategy for subcloning it is shown in Fig. 1. A BamHI restriction digest of XD02 was mixed with a prepa- ration of X arms purified from a BamHI digest of X47.1. After ligation and packaging, a phage lysate was prepared on Q359. Individual phages were selected for their ability to comple- ment guuC in SB3, and 10 positive lysogens were then tested for mutator activity. All 10 showed wild type mutation rates and one of these, designated XSKO21, was chosen for further study. A BamHI digest of ASK021 revealed that it contained a 12.5-kb fragment from XD02.

Cox and Yanofsky (4) reported that the mutT allele acts in trans on an F’ episome. This encouraged us to transfer the 12.5-kb fragment into a plasmid for further subcloning. In order to reduce the risk of possible interference by several genes near mutT which code for cell surface components, a low copy number mini plasmid, pDPT487, which is present at one to two copies/cell was used as the vector for cloning the 12.5-kb BamHI fragment. Transformation of SB3 by the recombinant plasmid cured guuC and mutT (Table I). One such plasmid, pSK5, was used to subclone the gene. A restric- tion map of the secA gene (11) indicates a single recognition site for SalI. When the 12.5-kb fragment was treated with SalI, two fragments, 7.0 and 5.5 kb, were produced. From the relative positions on the genetic map it could be reasoned that the single SalI cut of the 12.5-kb fragment would effectively separate mutT from the cell surface genes and allow it to be subcloned into a multicopy plasmid. Accordingly, after treat- ment of pSK5 with SalI and insertion into pBR322, a hybrid plasmid, pSK6, containing the 7.0-kb insert complemented both mutT and gwC when introduced into SB3 (Table I). After searching several restriction digests, mutT was located on a 0.9-kb fragment produced by digesting the 7.0-kb insert of pSK6 with PuuII in agreement with the results of Akiyama et al. (6). Two hybrid plasmids were isolated, pSK25 and pSK26, with the 0.9-kb fragment ligated in opposite orienta-

t A S K 0 2 1 E € E E E

1 1 I I I 1 I

B H H S H H B

B I

L

I Y

1

K E Y - h DNA - Plasmid ONA

-E . co l i DNA

-

FIG. 1. Construction of plasmids carrying mutT. For details of the individual steps, see text. The restriction sites were as follows: E , EomHI; E, EcoRI; H, HindIII; P, PuuII; S, Sun.

TABLE I Influence of plasmid constructs on the m u t T phenotype

Bacterial strain” Plasmid Mutation frequencp

NalR StrepR

TX48 (mutT) SB3

7.6 <1 1800 1400

SB3 pBR322 1140 784 SB3 pDPT487 802 - SB3 pSK5 8.9 SB3 pSK6 SB3

6.7 1.7 pSK25 11.2

SB3 pSK26 4.3 1.1 1.1

c -

SB3 is a m u t T transductant of TX48 (see “Microbial Strains”). * The frequencies reported for the hybrid plasmids are the mean

values of five to 10 individual determinations. NalR and &repR are colonies resistant to nalidixic acid and streptomycin, respectively.

Not determined because pDPT487 already contains a strepto- mycin resistance factor.

mutT Mutator Gene of E. coli 8955

tion into pBR322. Both complemented mutTwhen introduced into SB3 (Table I). These two plasmids also complemented ES768 (lo), a strain of E. coli carrying a Mu insertion in the mutT gene (data not shown).

Overproduction of the mutT Protein The experiments of Akiyama et al. (6) indicated that only

one open reading frame is present on the 0.9-kb PuuII frag- ment and that insertions of transposons into the nucleotide sequences coding this region inactivate the mutT gene. We have put the mutT gene under control of the lac promoter by ligating the PuuII 0.9-kb fragment into the SmaI site of pUC18. Cells harboring plasmids pSK35 or pSK36, carrying the fragment in opposite orientations, were grown to mid-log phase, and the lac promotor was activated with IPTG. Only one of the plasmids, pSK36, produced large amounts of the 15,000-Da protein coded by mutT (Fig. 2). From restriction maps of pSK35 and pSK36 (not shown), it may be concluded that mutT is transcribed in the clockwise direction as also indicated by the results of Akiyama et al. (6).

Purification of the mutT Protein Cell Growth and Preparation of Extract-SB3 cells carrying

plasmid pSK36 were grown at 37 "C to an A m of 0.8 in Luria broth supplemented with 25 pg/ml of ampicillin. At this point, IPTG was added to a final concentration of 0.5 mM, and the culture was incubated an additional 16 h. Cells were harvested in a continuous flow centrifuge and either used immediately or stored at -70 "C. Typically, 3-4 g of cells were obtained per liter of culture. For large scale preparations, 200 g were suspended in 400 ml of Buffer A (50 mM Tris, pH 7.5, 1 mM EDTA, 5 mM dithiothreitol), and the cells were ruptured by three passages through a Manton-Gaulin press. The extracts were clarified by centrifugation at 12,000 x g for 30 min, and the supernatant was diluted to a protein concentration of 10 mg/ml with Buffer A yielding 1500 ml of Fraction I.

Fractionation with Streptomycin-To Fraction I was added, gradually with mixing, %o volume of 10% streptomycin sul- fate, and 10 min after the last addition, the precipitate was removed by centrifugation and discarded. The clear superna- tant was Fraction 11.

Ammonium Sulfate Fractionation-Fraction I1 was brought to 30% saturation in ammonium sulfate (19), equilibrated for 30 min, and the precipitate was removed by centrifugation and discarded. The supernatant was adjusted to 60% satura- tion and equilibrated for 2 h. The precipitate (after centrifu- gation) was dissolved in 100 ml of Buffer A (Fraction 111).

~ ~ ~ 1 0 - 3 R 1 2 3 4 5 6 7 8 9 R

45

29

20. I

14.2

FIG. 2. Overproduction of mutT protein by pSR36. Cells harboring the indicated plasmids were grown at 37 'C to an A m of 0.8 and induced with IPTG. At intervals, aliquota of the cultures were centrifuged, the cells were disrupted, and the extracts equivalent to 4 X lo' cells were electrophoresed in a 20% polyacrylamide denaturing gel (15). In each set, the first, second, and third lanes represent aliquots taken at 0,4, and 8 h after addition of the inducer. Lunes 1- 3, pUC18 with no insert; lanes 4-6, pSK36, and lanes 7-9, pSK35 both carrying the mutT gene in opposite orientations. The reference proteins (lanes R ) in order of increasing M, were a-lactalbumin, trypsin inhibitor, carbonic anhydrase, and egg albumin.

Gel Filtration-20 ml of Fraction I11 were applied to a Sephadex G-100 column (20 cm2 X 54 cm) previously cali- brated with protein molecular weight standards. The column was developed with Buffer A containing 50 mM NaCl, and mutT was eluted at a region characteristic for a protein of approximately 15,000 Da, suggesting that the native protein exists as a monomer. Fractions containing most of the mutT protein were pooled and concentrated by precipitation from 80% ammonium sulfate yielding 16 ml of Fraction IV.

First Chromatography on DEAE-cellulose-Fraction IV was applied to a column of DEAE-cellulose (7 cm2 X 15 cm) previously equilibrated with Buffer A. It was washed with 2 column volumes of the same buffer and then 4 volumes of 0.1 M NaCl in Buffer A. The mutT protein was subsequently eluted when the concentration of NaCl was raised to 0.15 M. Each fraction containing more than 10% of the total mutT protein (as estimated by gel electrophoresis) was pooled (Frac- tion V).

Second Chromatography on DEAE-cellulose-It was ob- served that some minor protein impurities present in Fraction V could be removed by re-chromatography on DEAE-cellulose at a lower pH. Accordingly, Fraction V was dialyzed against 20 mM potassium phosphate, pH 6, and applied to a column equilibrated with the same buffer and having the same dimen- sions as the column used above. After washing with 2 column volumes each of phosphate buffer and buffer containing 50 mM NaCl, the mutT protein was eluted by raising the NaCl concentration in phosphate buffer to 100 mM. Fractions were pooled as above yielding approximately 20 mg of Fraction VI.

At this stage, the mutT protein was in a highly purified form as judged by gel electrophoresis (Fig. 3). A further indication of the purity of the protein and its identity with the mutT gene product was provided by amino acid analysis of Fraction VI. The amino acid composition closely followed that predicted from the nucleotide sequence of the gene (6), and the 20 amino acids of the N-terminal region were exactly as predicted (Table 11). Although there are several potential initiation sites for translation of the mutT gene, N-terminal analysis indicates clearly that the first of the four ATG codons in the sequence (position 164) is the start signal as predicted by Akiyama et al. (6).

The procedure for the isolation of the mutT polypeptide is relatively straightforward and yields large amounts of a highly purified 15,000-Da protein. From 30 g of cells containing the expression vector, pSK36, over 20 mg of protein were ob- tained, which indicates that the mutT gene product accounts

A B

A4,xIO-q R 1 2 3 R 1 2 3

45

29 I

20.

14.2 I

FIG. 3. Polyacrylamide gel electrophoresis of native and denatured mutT protein fractions. Approximately 5 pg of total protein were applied to each of the lanes of a 20% polyacrylamide gel. A, denaturing conditions (15): lane 1, Fraction I (crude extract); lane 2, Fraction IV (gel filtration); lane 3, Fraction VI (second DEAE- cellulose). The proteins in the reference ( R ) lanes were the same as in Fig. 2. B, native conditions: lanes 1 and 3, carbonic anhydrase (a ) and a-lactalbumin ( b ) ; lane 2,5 pg of Fraction VI.

8956 mutT Mutator Gene of E. coli

TABLE I1 Amino acid analysis of mutTprotein

N Terminus Predicted: H2N-MetLysLysLeuGln I leAlaVal G l y I l e I l eArg AsnGluAsnAsnGlu I l e P h e I le

ATGAAAAAGCTGCAAATTGCGGTAGGTATTATTCGCAACGAGAACAATGAAATCTTTATA Found : H Z N - M e t L y s L y s L e u G l n I l e A l a V a l G l y I l e I l e A r g A s n G l u A s n A s n G l u I l e P h e I l e

Composition

Predicted Found residueslmol

Ala 9 Arg

9.3 7

Asx 7.2

10 CY8

10.5 0

GlY 0

10 11.4 Glx 23 His 3

24.4

Ile 9 2.2

Leu 9.3

11 10.6 LYS 8 Met

7.9 4

Phe 4.2

7 Pro

6.0 9

Ser 9.2

Thr 2 2.4 4 3.7

Trp 5 TYr 1 Val 7

1.0 5.3

a Not determined.

D -

TABLE I11 Specificity of mutT nucleoside triphosphatase

Each subunit was present a t 3.4 mM and was assayed under standard conditions using 7 milliunits (0.3 pg) of purified mutT protein.

Substrate Pi formed Relative rate nmol %

dGTP 140 dCTP

(100) 42 30

dTTP 10 dATP

7 3 2

GTP 66 47 CTP 27 19 UTP 24 17 ATP 4 3

dGDP 77 55 dGMP 0 0

for approximately 1% of the total protein in the amplified cells.

Some Characteristics of the mutT Protein

Several properties associated with proteins involved in DNA replication and repair were examined with the purified mutT protein. It did not bind to DNA cellulose columns and remained in the supernatant fraction of extracts precipitated with streptomycin sulfate. It revealed no DNA polymerase activity on gapped DNA (20) and no nuclease activity on double- or single-stranded E. coEi DNA under conditions in which positive controls were highly active. However, a very feeble ATPase activity at pH 7.5 was observed, which was investigated further. Determination of the pH optimum showed that the ATPase could be increased 25-fold by incu- bation at pH 9.0, but the most surprising result was observed when the substrate specificity was investigated. ATP was one of the least favored of the common nucleoside triphosphates. Table I11 shows that dGTP is hydrolyzed at 30 times the rate of ATP, and it is the best of all substrates tested. The four

.- a

20

SLICE #

FIG. 4. Co-migration of purified mutT protein and enzy- matic activities in a polyacrylamide gel. Approximately 7 pg of purified mutT protein were run through a 15% polyacrylamide gel. One lane was stained with Coomassie Brilliant Blue, and a parallel lane was cut out and sliced into 10,5-mm slices. Each slice was eluted by manual maceration in 150 pl of 50 mM Tris-HC1, pH 8.0, and incubation at 0 'C overnight. Each slice was assayed for dGTPase (lined area) and ATPase (solid area) under standard assay conditions. Approximately 55% of the total activity applied to the gel was recovered.

common deoxy- and ribonucleoside triphosphates are grouped separately for comparison. In both groups, the activity toward triphosphates containing guanine is highest and cytosine is next. Included for comparison is dGDP which is hydrolyzed at 55% of the rate of dGTP, and dGMP which is not hydro- lyzed at all. Neither native nor single-stranded DNA stimu- lates the triphosphatase.

Several factors support the hypothesis that these enzymatic activities are associated with the product of the mutT gene. The protein has been highly purified through several steps in a purification procedure involving gel filtration, ammonium sulfate precipitation, and ion exchange chromatography, and only one band is seen on analytical gels. This single band

mutT Mutator

accounts for 100% of the dGTPase activity recovered from the gel, as shown in Fig. 4. Also note that the much lower ATPase activity is confined to the same reaction, suggesting that it resides in the same protein. When activities toward GTP, dGDP, dCTP, and CTP were measured in this same fraction (slice 5, Fig. 4), they were present in the same ratios as in the protein applied to the gel (data not shown). This is consistent with the notion that the mutT nucleoside triphos- phatase is responsible for all of these activities. Additional evidence that this enzymatic activity is coded for by the mutT gene derives from the observation that the dGTPase is in- creased 15-fold after induction of cells carrying plasmid pSK36 (pUC18 with the mutT insert) as compared to a control culture containing pUC18 alone (data not shown). On the other hand, we have not seen a difference in total triphospha- tase activities between crude extracts of mutT- and mutT+ cells. Perhaps this is due to the plethora of nucleotidases in E. coli which might be expected to mask changes in the activity of a minor component.

How would a defect in this protein relate to the replication error characteristic of the mutT phenotype? The high, uni- directional AT + CG transversion seen in mutT- cells may be explained by an A-G mispair in which an incoming G pairs with a template A, or a C-T mispair in which an incoming C pairs with a template T as follows (see Topal and Fresco (21)):

Perhaps the mutT nucleoside triphosphatase monitors this misadventure during replication. It may not be coincidental that the highest activity of the enzyme is directed at dGTP, and this is followed by dCTP in the deoxynucleoside triphos- phate series (Table 111). Recently, Schaaper and Dunn (22) have concluded from in vitro studies on the replication of M13mp2 DNA that A-G rather than T-C mispairs occur in extracts of mutT- cells. Is the dGTPase activity in the mutT protein involved in preventing or repairing this error? Does the protein act in concert with other members of the replica-

Gene of E. coli 8957

tion apparatus, and are the other nucleoside triphosphatase activities important or ancillary to the process? We have recently cloned the rnutT- gene' and are in the process of constructing expression vectors for production of its protein. The availability of substantial quantities of the native and mutant proteins should facilitate incisive experiments aimed at elucidating how mutT functions in DNA replication.

REFERENCES 1. Cox, E. C. (1976) Annu. Rev. Genet. 10 , 135-156 2. Treffers, H. P., Spinelli, V., and Belser, N. 0. (1954) Proc. Natl.

3. Yanofsky, C., Cox, E. C., and Horn, V. (1966) Proc. Natl. Acad.

4. Cox, E. C., and Yanofsky, C. (1969) J. Bacterwl. 100,390-397 5. Cox, E. C. (1973) Genetics 7 3 , (suppl.) 67-80 6. Akiyama, M., Horiuchi, T., and Sekiguchi, M. (1987) Mol. Gen.

Genet. 206,9-16 7. Miller, J. H. (1972) Experiments in Molecular Genetics, Cold

Spring Harbor Laboratory, Cold Spring Harbor, NY 8. Maniatis, T., Fritsch, S . F., and Sambrook, J. (1982) Molecular

Cloning, A Laboratory Manwl , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

Acad, S C ~ . U. 5. A. 4 0 , 1069-1071

Sci. U. S . A. 65,274-281

9. Siegel, E. C., and Kamel, F. (1974) J. Bacteriol. 117,994-1001 10. Conrad, S. E., Dussik, K. T., and Siegel, E. C. (1976) J. Bacteriol.

11. Oliver, D. B., and Beckwith, J. (1982) J. Bacteriol. 160,686-691 12. Rownd, R., Nakaya, R., and Nakamura, A. (1966) J. Mol. Biol.

13. Morrison, D. A. (1979) Methods Enzymol. 68,326-331 14. Tabak, H. F., and Flavell, R. A. (1978) Nucleic Acids Res. 6 ,

15. Laemmli, U. K. (1970) Nature 227, 680-685 16. Bradford, M. M. (1976) Anal. Bwchem. 72,248-254 17. Ames, B. N., and Dubin, D. T. (1960) J. Biol. Chem. 2 3 6 , 769-

18. Bachmann, B. J. (1983) Microbiol. Reu. 4 7 , 180-230 19. Green, A. A., and Hughes, W. L. (1955) Methods Enzymol. 1,67-

20. Olesin, A. E., and Koerner, J. F. (1964) J. Bwl. Chem. 239,2935-

21. Topal, M. D., and Fresco, J. R. (1976) Nature 2 6 3 , 285-289 22. Schaaper, R. M., and Dunn, R. L. (1987) J. Biol. Chem. 262 ,

126,1018-1023

17,376-393

2321-2332

775

90

2943

16267-16270

* G. H. Lew, S . K. Bhatnagar, G. S . Brush, S . Quirk, and M. J. Bessman, unpublished results.