ACTAUNIVERSITATIS

UPSALIENSISUPPSALA

2016

Digital Comprehensive Summaries of Uppsala Dissertationsfrom the Faculty of Medicine 1223

Studies of Enterovirus Infectionand Induction of Innate Immunityin Human Pancreatic Cells

MAHESH ANAGANDULA

ISSN 1651-6206ISBN 978-91-554-9572-5urn:nbn:se:uu:diva-284370

Dissertation presented at Uppsala University to be publicly examined in Rudbecklaboratoriet,Dag Hammarskjölds väg 20, 752 37 Uppsala, Uppsala, Tuesday, 7 June 2016 at 09:00for the degree of Doctor of Philosophy (Faculty of Medicine). The examination will beconducted in English. Faculty examiner: Professor Didier Hober (University Lille 2, Facultyof Medicine, CHRU Lille Institut Hippocrate Address: Loos-Lez-Lille, 59120, France).

AbstractAnagandula, M. 2016. Studies of Enterovirus Infection and Induction of Innate Immunityin Human Pancreatic Cells. Digital Comprehensive Summaries of Uppsala Dissertationsfrom the Faculty of Medicine 1223. 63 pp. Uppsala: Acta Universitatis Upsaliensis.ISBN 978-91-554-9572-5.

Several epidemiological and clinical studies have indicated a possible role of Enterovirus (EV)infection in type 1 diabetes (T1D) development. However, the exact casual mechanism of theseviruses in T1D development is not known. The aim of this thesis is to study various EVs thathave been shown to differ in their immune phenotype, lytic ability, association with inductionof islet autoantibodies, ability to replicate, cause islet disintegration and induce innate antiviralpathways in infected pancreatic cells in vitro. Furthermore, EV presence and pathogenic processin pancreatic tissue and isolated islets of T1D patients was also studied.

Studies in this thesis for first time show the detection of EV RNA and protein in recentonset live T1D patients supporting the EV hypothesis in T1D development. Further all EVserotypes studied were able to replicate in islets, causing variable amount of islet disintegrationranging from extensive islet disintegration to not affecting islet morphology at all. However,one of the EV serotype replicated in only two out of seven donors infected, highlighting theimportance of individual variation between donors. Further, this serotype impaired the insulinresponse to glucose stimulation without causing any visible islet disintegration, suggesting thatthis serotype might impaired the insulin response by inducing a functional block. Infection ofhuman islets with the EV serotypes that are differentially associated with the development ofislet autoantibodies showed the islet cell disintegration that is comparable with their degree ofislet autoantibody seroconversion. Suggesting that the extent of the epidemic-associated isletautoantibody induction may depend on the ability of the viral serotypes to damage islet cells.Furthermore, one of the EV strains showed unique ability to infect and replicate both in endoand exocrine cells of the pancreas. EV replication in both endo and exocrine cells affected thegenes involved in innate and antiviral pathways and induction of certain genes with importantantiviral activity significantly varied between different donors. Suggesting that the same EVinfection could result in different outcome in different individuals. Finally, we compared theresults obtained by lytic and non lytic EV strains in vitro with the findings reported in fulminantand slowly progressing autoimmune T1D and found some similarities. In conclusion the resultspresented in this thesis further support the role of EV in T1D development and provide moreinsights regarding viral and host variation. This will improve our understanding of the possiblecausative mechanism by EV in T1D development.

Keywords: Type 1 Diabetes, Enterovirus, Innate Immunity, Pancreas

Mahesh Anagandula, Department of Immunology, Genetics and Pathology, ClinicalImmunology, Rudbecklaboratoriet, Uppsala University, SE-751 85 Uppsala, Sweden.

© Mahesh Anagandula 2016

ISSN 1651-6206ISBN 978-91-554-9572-5urn:nbn:se:uu:diva-284370 (http://urn.kb.se/resolve?urn=urn:nbn:se:uu:diva-284370)

List of Papers

This thesis is based on the following papers, which are referred to in the text by their Roman numerals. I Krogvold, L., Edwin, B., Buanes, T., Frisk, G., Skog, O., Anagandula,

M., Korsgren, O., Undlien, D., Eike, MC., Richardson, SJ, Leete, P., Morgan, NG., Oikarinen, S., Oikarinen, M., Laiho, JE., Hyöty, H., Ludvigsson, J., Hanssen, KF., Dahl-Jørgensen, K. Detection of a low-grade Enteroviral infection in the islets of langerhans of living patients newly diagnosed with type 1 diabetes. Diabetes 64: 1682-1687.

II Anagandula, M., Richardson, SJ., Oberste, MS., Sioofy-Khojine, AB., Hyöty, H., Morgan, NG., Korsgren, O., Frisk, G. (2013) Infection of human islets of langerhans with two strains of coxsackie B virus serotype 1: Assessment of virus replication, degree of cell death and induction of genes involved in the innate immunity pathway. J Med Vi-rol. 86(8): 1402-11.

III Sarmiento, L., Frisk, G., Anagandula, M., Cabrera-Rode, E., Roivainen,

M., Cilio, CM. (2013) Expression of innate immunity genes and damage of primary human pancreatic islets by epidemic strains of Echovirus: implication for post-virus islet autoimmunity. PloS one 8: e77850.

IV Sarmiento, L., Anagandula, M., Frisk, G., Hodik, M., Barchetta, I., Ne-

tanyah, E., Cabrera-Rode, E., Cilio, CM. Field strains of Echovirus 6 in-fect human endocrine and exocrine pancreatic cells and induce pro-inflammatory innate immune responses. Manuscript.

V Hopfgarten, J., Stenwall, PA., Wiberg, A., Anagandula, M., Ingvast, S.,

Rosenling, T., Korsgren, O., Skog, O. (2014) Gene expression analysis of human islets in a subject at onset of type 1 diabetes. (2014) Actadiabetologica 51: 199-204.

VI Anagandula, M., Hyöty, H.,Frisk, G. Enterovirus-induced changes in explanted human islet of Langerhans resemble findings in islets of ful-minant and conventional type 1 diabetes. Manuscript.

Reprints were made with permission from the respective publishers.

Contents

Introduction ......................................................................................................... 9  Enteroviruses .................................................................................................. 9  

Virion structure .......................................................................................... 9  EV genome .............................................................................................. 10  EV receptors ............................................................................................ 11  EV life cycle ............................................................................................ 12  EV persistence ......................................................................................... 14  EV effect on the host cells ....................................................................... 15  EV pathogenesis ...................................................................................... 15  

Innate Immunity ........................................................................................... 16  Interferon system ..................................................................................... 16  EV interaction with innate immunity ...................................................... 17  

The Pancreas ................................................................................................. 19  Type 1 Diabetes (T1D) ................................................................................. 19  

Autoantibodies ......................................................................................... 19  Genetic factors ......................................................................................... 21  Epidemiology ........................................................................................... 21  Environmental factors ............................................................................. 22  EV Implication in T1D development ...................................................... 22  Possible Mechanisms of EV in T1D development ................................. 23  

Aims .................................................................................................................. 24  Paper-I ...................................................................................................... 24  Paper-II .................................................................................................... 24  Paper-III ................................................................................................... 24  Paper-IV ................................................................................................... 24  Paper-V .................................................................................................... 25  Paper-VI ................................................................................................... 25  

Materials and Methods ...................................................................................... 26  Virus ............................................................................................................. 26  Human explanted islets and exocrine cells (Paper II, III, IV and VI) ......... 27  Pancreatic tissue (Paper I and V) ................................................................. 28  EV Detection Methods (Paper I) .................................................................. 29  

Virus Isolation ......................................................................................... 29  Immunohistochemistry (IHC) ................................................................. 29  Polymerase chain reaction (PCR) ........................................................... 30  

Results and discussion ...................................................................................... 33  Paper I - Detection of a low-grade enteroviral infection in the islets of Langerhans of living patients newly diagnosed with type 1 diabetes ..... 33  Paper II -Infection of human islets of Langerhans with two strains of coxsackie B virus serotype 1: Assessment of virus replication, degree of cell death and induction of genes involved in the innate immunity pathway ......................................................................................................... 35  Paper III- Expression of innate immunity genes and damage of primary human pancreatic islets by epidemic strains of Echovirus: implication for post-virus islet autoimmunity ............................................. 37  Paper IV -Field strains of Echovirus 6 infect human endocrine and exocrine pancreatic cells and induce pro-inflammatory innate immune responses ....................................................................................................... 39  Paper V- Gene expression analysis of human islets in a subject at onset of type 1 diabetes ............................................................................ 41  Paper VI- Enterovirus-induced changes in explanted human islets of Langerhans resemble findings in islets of fulminant and conventional type 1 diabetes .............................................................................................. 42  

Conclusions ....................................................................................................... 45  Paper-I .......................................................................................................... 45  Paper-II ......................................................................................................... 45  Paper-III ........................................................................................................ 45  Paper-IV ....................................................................................................... 46  Paper-V ......................................................................................................... 46  Paper-VI ....................................................................................................... 46  

Acknowledgements ........................................................................................... 48  

References ......................................................................................................... 51  

Abbreviations

2'-5'OAS 2'-5'-oligoadenylate synthetase ADP Adenosine diphosphate ATP Adenosine triphosphate ATF4 Activating transcription factor 4 CARD Caspase recruitment domain CAR Coxsackievirus and Adenovirus receptor CBV Coxsackie B virus CPE Cytopathic effect CTL Cytotoxic T lymphocyte CCL5 C-C motif chemokine ligand 5 CXCL10 C-X-C motif chemokine ligand 10 CHOP C/EBP homologous protein DAF Decay accelerating factor DTZ Dithizone DiViD Diabetes Virus Detection Study dsRNA Double-stranded RNA eIF Eukaryotic initiation factor EV Enterovirus ER Endoplasmic reticulum GAD65 Glutamic acid decarboxylase 65 kDa GADA GAD65 antibody GSIS Glucose stimulated insulin secretion HLA Human leukocyte antigen IFN Interferon IRES Internal ribosome entry site IRF IFN regulatory factor IFNAR Type I Interferon Receptor ISGF 3 Interferon-stimulated gene factor 3 ICA Islet cell autoantibodies IA2 Tyrosine phosphatase-like insulinoma antigen 2 IHC Immunohistochemistry IAA Insulin autoantibody IFIH1 Interferon induced with helicase C domain 1 LCM Laser capture microdissection MAVS Mitochondrial antiviral signaling protein MDA-5 Melanoma differentiation-associated gene MHC Major histocompatibility complex

Mx1 Myxovirus resistance protein 1 mRNA Messenger RNA MYD88 Myeloid differentiation primary response gene 88 NF-κB Nuclear factor kB NOD Non-obese diabetic nPOD Network for Pancreatic Organ donors with Diabetes NLR Nucleotide-binding oligomerization domain (NOD)-like

receptor OCT Octamer transcription factor PKR Protein kinase R PAMP Pathogen-associated molecular pattern PTPN2 protein tyrosine phosphatase, non-receptor type 2 PRR Pattern recognition receptor PCR Polymerase chain reaction RNA Ribonucleic acid RANTES Regulated upon activation, normal T cell expressed, and

secreted RIG-I Retinoic acid gene I RLH RIG-I-like helicase RT-PCR Reverse transcription PCR RNAseL Ribonuclease-L STAT Signal transducer and activator of transcription ss Single-stranded TLR Toll-like receptor T1D Type 1 diabetes TRIF TIR-domain-containing adapter-inducing interferon-β UTR Un-translated region VNTR Variable number of tandem repeats VP Virus protein VPg Viral protein genome-linked

9

Introduction

Enteroviruses Virion structure Enteroviruses (EV) are small non-enveloped viruses that belong to the Pi-cornaviridae family. They consist of single stranded positive-sense RNA as their genome. The genome is encapsulated in an icosahedral protein capsid. The capsid is made up of 60 copies of the four capsid proteins (virus proteins 1-4). VP1, VP2 and VP3 make the outer surface of the capsid while VP4 is located inside the capsid. Four of these proteins together make a protomer, which is then repeated four times to make a pentamer. Twelve of these pen-tamers build the icosahedral capsid around the viral genome. The capsid protects the viral genome from external conditions and is also involved in the cell attachment. A narrow deep cleft-like structure (canyon) exists around each of the five fold axes on the capsid surface, which has been shown to be involved in the receptor-binding (1, 2).

Figure 1. Enteroviurs capsid. The illustration is adapted from www.viralzone.expasy.org with permission.

10

EV genome

The EV genome is composed of a 7.5 kb long single stranded positive sense RNA. The RNA contains an open reading frame, flanked by un-translated regions (UTRs) at the 5’ and 3’ ends. These UTR regions form extensive secondary structures that play an important role in viral RNA replication and translation by acting as contacting points for the interaction of cellular and viral proteins. The 5’ UTR also contains an internal ribosomal entry site (IRES) that directs the cap-independent translation initiation. A small pro-tein, called viral protein genome-linked (VPg), is attached at the 5’ end of the viral RNA and acts as a primer for the positive and negative strand syn-thesis during RNA replication. A poly A tail is attached at the 3’ end and acts as a template for the uridylation of the VPg protein. The coding region is divided into three parts called P1, P2 and P3 regions. P1 encodes the struc-tural proteins VP1 to VP4. The P2 and P3 regions encode the non-structural proteins involved in various functions such as polyprotein processing, RNA replication, cleavage of host cell proteins and modifying the host cell to fa-cilitate the virus lifecycle (2, 3). Functions of these proteins are summarized in Table 1 (1).

Figure 2. EV genome structure

Table 1. EV proteins and their functions

Protein

Function

VP1-VP4 2A 2B 2C 3A

Structural proteins, make the virus capsid (3) By cleaving the host translation initiation factor it will shutdown the cap dependent translation (4) Disrupts the golgi complex and secretion pathways, alter the membrane permeability and Ca+2 levels in host cells. (5, 6) Rearrangement of membranes of vesicles (7). Inhibition of cellular trafficking and secretion (8).

11

3B (VPg) 3C 3Dpol

Acts as an RNA primer for positive and negative strand synthesis (9, 10). Cleaves the host cellular proteins important for in host gene expression. By cleaving the transcription factor TATA-box binding protein inhibits the cellular transcription (11). RNA-dependent RNA polymerization, VPg uridylation (9, 12). RNA-dependent RNA polymerization, VPg uridylation (9, 12)

EV receptors EVs use a wide variety of cellular receptors to attach and infect the cell. Some of these receptors are listed in Table 2 (13, 14).

Table 2. EV receptors Species Virus Receptor Receptor family

EV-B EV-C EV-D

Coxsackie B virus Coxsackie A virus 18, 21 Echovirus1 Echovirus 6 and 7 Poliovirus Enterovirus-70

Coxsackie and Adeno virus receptor, Decay accelerating factor (CD55) Intercellular adhesion molecule 1 (ICAM1) Integrin α2β1 Decay accelerating factor (CD55) Polio virus receptor (CD155) Sialic acid

Immunoglobulin superfamily Complement control family Immunoglobulin superfamily Integrin Complement control family Immunoglobulin superfamily Carbohydrate

12

EV life cycle Cell entry and uncoating Virus attachment to the viral receptor initiates destabilization and conforma-tional changes in the virus particle. These changes result in altered virions called A particles. These particles are devoid of the VP4 protein and contain the normally internalized hydrophobic N terminus of the VP1 on the outer surface (3). These particles have a lower sedimentation coefficient and in-creased affinity for membranes than the native virion. The A particle is thought to participate in the pore formation on cell membranes to release the genome (3). Different EVs have been shown to use different pathways and mechanisms to mediate the cell entry and the release of the viral genome (15, 16). This appears to be dependent mainly on the cell type, and the recep-tor used. For example, it was shown that CBV3 uses the caveolin-dependent, dynamin independent pathway in polarized CaCo2 cells and the dynamin lipid raft dependent and clathrin caveolin independent pathway in non-polarized Hela cells (15, 16).

Translation EV carries out the RNA replication and translation in the cytoplasm of the

infected cells. Once the viral genome enters into the cell, VPg is cleaved by cellular unlinkase enzyme (2). The viral RNA is then translated into a single poly protein via a cap-independent mechanism by using the IRES. The new-ly synthesized poly protein is first cleaved into three precursor proteins P1, P2 and P3. The P1 protein is then further cleaved into structural proteins VP0, VP1 and VP3. Proteins P2 and P3 undergo subsequent cleavages to produce non-structural proteins (2A, 2B, 2C, 3A, 3B, 3C, 3CD, 3Dpol). All these non-structural proteins carry out various functions (summarized in Table 1) to facilitate the virus replication cycle (2, 3).

RNA Replication Replication of EV RNA occurs on the membranous vesicles, which are formed by rearrangement of cellular membranes by the viral proteins 2B and 2C. It is hypothesized that these membranes act as scaffolds for RNA stabili-zation and also to facilitate a proper positioning and concentration of viral replication proteins to efficiently catalyze RNA synthesis (1).

Viral RNA replication starts with the synthesis of the negative strand by using the genomic RNA as template. This is carried out by 3D pol at the 3’ poly A tract of the genomic RNA by using uridinylated VPg protein as pri-mer. The newly synthesized negative strand RNA then serves as a template for the production of new positive strand RNA. A single negative strand RNA can produce several positive RNA strands. During RNA replication, ds RNA exist as an intermediate form. These newly formed positive RNA

13

strands can be packed into virions or can be translated to produce viral pro-teins (2, 3).

Assembly and Release The assembly of new virions starts with the cleavage of P1 precursor protein into VP0, VP1 and VP3. These three proteins form a protomer and five pro-tomers make the 5S pentamer. Twelve of these pentamers assemble to form the procapsid, which encapsulates the viral genome. The final step involves the cleavage of VP0 protein into VP2 and VP4 to produce the full-matured virion. The newly formed virions are released by cell lysis during a lytic infection. During non-lytic infection it is believed that the viral particles are released in vesicles (3, 17).

Figure 3 EV infectious cycle

14

EV persistence EVs generally cause cytolytic infection due to their ability to affect different host cell functions. However, several studies have showed that EVs can also cause persistent infections. It has been shown that EVs can develop persis-tence both in vitro and in vivo in various organs such as heart, skeletal mus-cle and also in different types of cultured cells [18,19,20,21]. The mecha-nism of EV persistence is not totally understood however; both viral and cellular determinants, as well as the host immune response, are thought to play important roles in driving EV persistence. EVs depend on host factors for their infectious cycle; availability of these factors can affect the outcome of infection. It has been shown that the same EV strain can cause non-lytic or lytic infection in different cell cultures (18), indicating the importance of cellular environment in outcome of the infection. The status of the host cell cycle is also attributed to the development of EV persistence. Feuer et al reported maximum level of CBV protein expression and replication in pro-liferating cells (cells at G1/S phase) and very low amount of viral protein with minimum level of infectious virus in non dividing quiescent cells (cells at G0)(19). It was postulated that cellular factors required for EV replication might be optimal in proliferating cells resulting in productive infection, while absence of these factors in non-dividing quiescent cells might favor persistence.

Mutations in viral receptors have been observed in cells that harbor EV persistence (20). In addition to cellular factors, mutations in the EV genome have also been shown to contribute to EV persistence. Mutations in the cap-sid-coding region have been shown to result in EV persistence in neuroblas-toma and Hep-2c cells (21, 22). These mutations were thought to affect the EV interaction with its receptor, affecting virus binding and capsid confor-mational changes further resulting in the EV persistence. After the acute lytic infection, EVs have been shown to develop deletions in the 5’UTR region (23, 24). These terminally deleted mutants are associated with lower replication rate and absence of cytopathic effect. These terminally deleted viruses have also been detected in in vivo studies in heart and pancreas of mice 30 days post infection (23, 25). In addition to these defective variants, EVs were also shown to persist through dsRNA complex in muscle cells (26). EV persistence has been associated with several chronic syndromes such as dilated cardiomyopathy, type 1 diabetes, post-polio syndrome and chronic fatigue syndrome (18, 27-30).

EV persistence in myocytes was shown to induce morphological and structural alteration in infected myocytes. In cardiomyocytes transfected with a CBV3 cDNA mutant, with genome replication resembling restricted persistent virus replication, cytopathic effects were induced (31). This sug-gests that a low-level of viral replication, without formation of infectious progeny virus, is sufficient to induce myocyte injury. Experiments with

15

transgenic mice with heart muscle-specific expression of the CBV3 mutant that synthesizes the viral plus- and minus-strand RNA without formation of infectious viral progeny was shown to induce myocardial interstitial fibrosis, hypertrophy, and degeneration of myocytes, resembling the clinical features of dilated cardiomyopathy in humans (32). These studies indicate that re-stricted persistent viral replication is sufficient to alter the myocyte function. EV persistence is also implicated in T1D development. EV persistence asso-ciated with chronic inflammation was reported in gut mucosa of T1D pa-tients (29). Prolonged persistent replication of EV in human pancreatic islet cells has also been shown in vitro (33). Further, EV persistence in a pancre-atic ductal cell line was shown to disturb the islet-like cell aggregates for-mation (34), suggesting that EV persistence in ductal cells could affect the trans differentiation of ductal cells into endocrine cells (34).

EV effect on the host cells EVs exert profound effects on host cell biology to facilitate its replication cycle. One of the characteristics of EV is its ability to shutdown the cellular cap-dependent translation to maximize its IRES-driven protein synthesis. EVs accomplish this through the cleavage of eIF4G, one of the key compo-nents of the cap dependent translation initiation complex (35, 36). In addi-tion to translation, EVs were also shown to affect the host transcription. EV 3C protease has been shown to cleave several factors and regulators such as TATA box-binding protein, octamer binding protein (OCT-1) and cyclic AMP-responsive element-binding protein that are essential for cellular DNA-dependent RNA polymerase activity (37). Another prominent feature of EV is rearrangement of intra-cellular membranes to form membranous vesicles associated with viral RNA synthesis (38, 39). EV proteases can cleave and down regulate the key factors involved in host innate and adap-tive immune response (40). EVs were also shown to induce both apoptotic and necrotic pathways in infected cells (41, 42). Several morphological fea-tures such as rounding up of the cells and a highly distorted nucleus with condensed chromatin have been observed in EV-infected cells (43).

EV pathogenesis EVs transmit through the fecal oral route. They initially replicate in the gas-trointestinal tract, resulting in mild viremia, and the majority of infections are controlled at this stage without causing any symptoms. Further replica-tion occurs in regional lymph nodes, resulting in dissemination of virus into blood through the lymphatic vessels and thoracic duct. Subsequent dissemi-nation of virus from blood into various organs such as the CNS, heart and muscle can results in severe complications like aseptic meningitis, myocardi-tis, and paralytic poliomyelitis (37, 44). The factor that determines why the

16

EV infection is asymptomatic in some individuals and severely pathogenic in others is not understood. The host genetic constitution, immunological statuses along with viral factors are thought to influence the outcome of in-fection.

Innate Immunity The innate immune system plays an important role as the first line of defense mechanism against microbial infections. Innate sensing of viral infection is usually activated through the recognition of different viral pathogen-associated molecular patterns (PAMPs) by a variety of pattern recognition receptors (PRRs). Sensing of viruses occurs mainly through three different families of receptors: Toll-like receptors (TLR), RIG-I like receptors (RLR) and Nucleotide-binding oligomerization domain (NOD) like receptors (NLR) (45). Sensing of viral PAMPs through TLR and RLR leads to the activation of different adaptor proteins such as IPS-1 (MDA5/RIG-I), MYD88 (all TLRs except TLR3) and TRIF (TLR3), which further leads to the activation of different kinases. Upon activation, these kinases phosphory-late the transcription factors such as NF-κB, IRF3 and IRF7. Phosphorylated transcription factors then translocate into the nucleus and bind to interferon stimulated response element (ISRE), resulting in the induction of type I IFN and pro-inflammatory chemokines (46).

Interferon system The interferons are a family of cytokines involved in eliciting different anti-viral effects. These are divided into three groups: type I consisting of IFN α and β, type II consisting of IFN γ, and type III including IFN λ. Type I inter-ferons (IFN α / β) are induced by viral infection and play a major role in antiviral defense. Upon induction, type I IFNs bind to the common hetero-dimeric receptor composed of IFN α receptor 1 and 2 (IFNAR1 and IF-NAR2), which leads to dimerization of these subunits and subsequent phos-phorylation of the associated Janus kinases JAK1 and TYK2. Activated ki-nase then phosphorylates the STATs which leads to the binding of the STAT complex to IRF9 to form IFN-stimulated gene factor 3 (ISGF3). After for-mation, ISGF3 translocates into the nucleus and binds to interferon-stimulated response element (ISRE) in the promoters of interferon-stimulated genes (ISGs), resulting in the transcription of more than 300 ISGs with different antiviral activities leading to establishment of an antiviral state (47-49).

17

EV interaction with innate immunity An intact innate immune response is crucial for control and clearance of EV infection; mice lacking innate immune components have been shown to be more susceptible to EV infection than wild type mice (50, 51). Several viral sensors are shown to be involved in sensing the EV infection (51-54). Among toll like receptors, TLR 3, 7 and 8 have been implicated in sensing EV infections (52, 53). TLR 7 and 8, known to sense ss-RNA have been shown to detect CBV infection in human cardiac cells (52, 53). A synergic effect of TLR7/8 sensing of CBV was shown to induce an inflammatory response and thought to be involved in myocardial tissue damage(53).

Although protective, the role of these receptors in controlling the EV in-fection is not known. In addition, TLR4 has also been proved to be involved in sensing EV infection in a pancreatic cell line (55). In in vivo studies using mouse models it was demonstrated that TLR3 plays an important role in limiting the EV infection (56). Infection with EV showed increased virus titer and mortality in TLR 3 knockout mice (TLR3KO) compared to wt mice (56, 57). Furthermore, it was also shown that TLR3 signaling on macro-phages is critical in controlling the EV in mice (57). In addition to TLRs, the cytoplasmic RNA helicase MDA5 has also been shown to play a critical role in sensing and controlling EV infection (51). The viral sensor MDA5 has been shown to detect EV infection through double stranded RNA, which forms as an intermediate during EV replication (54). Mice deficient in MDA5 and its adaptor molecule MAVS showed early mortality and reduced type I IFN induction compared to wt mice upon EV infection (51). In vitro infection with CBV also showed that the expression of genes encoding MDA5 and RIG-I was increased in isolated pancreatic human islets in vitro (58, 59).

The type I IFN response plays a critical role in limiting and inhibiting in-fection. It has been shown that mice lacking type I IFN receptor (IFNR) showed higher and early mortality than wt mice upon EV infection (50). In in vitro experiments using cultured cells it was shown that pre-treating these cells with type I and II IFNs can inhibit EV replication (60). IFNs exert their antiviral activity through the up-regulation of ISGs. Among these several ISGs such as PKR and OAS have been shown to exert their antiviral activity against EV (61). EVs have developed several strategies to counteract the innate immune response. EVs have been shown to interfere with several aspects of innate immune pathways, from sensing of infection to IFN induc-tion and to evade the antiviral activity. Degradation of MDA5 and RIG-I proteins was demonstrated in cells after infection with poliovirus (62, 63).

It has been shown that EV-3C protease can cleave the adaptor proteins MAVS and TRIF to block the IFN signaling (64). It has also been shown that EV72-3C protease can cleave the transcription factor IRF7 to attenuate the IFN signaling. In addition, it was also shown that EV71 can disrupt the

18

interferon signaling by targeting IFNAR1. EVs are also known to shutdown the host cap-dependent translation and disrupt the intra-cellular trafficking, which also will interfere with the innate immune pathways (65).

Figure 4. EV innate sensing pathways

19

The Pancreas The pancreas is a long flat oval shaped gland, which lies deep in the abdo-men. It contains both endocrine and exocrine functions. The exocrine frac-tion constitutes up to 80% of the pancreas and these exocrine cells synthe-size and release the digestive enzymes into duodenum to digest the carbohy-drates, lipids and proteins (66). The endocrine fractions contain highly vas-cularised small island-like structures called islets of Langerhans and constitute about 1-2% of the pancreas. Edouard Laguesse, a histologist who deduced islets endocrine function, coined the term Islets of Langerhans in memory of Paul Langerhans who was the first to describe them as island of cells (66). Islets contain five different types of endocrine cells. These are insulin-secreting beta cells, glucagon-secreting alpha cells, somatostatin-secreting delta cells, pancreatic polypeptide-secreting PP cells, and ghrelin-secreting epsilon cells. Of these cells, beta cells comprise the majority of islet mass (up to 55%) followed by alpha cells (33%) and other endocrine cells (66, 67). However, the relative proportion of these endocrine cells has been shown to vary between different islets (68). In addition to these endo-crine cells, islets also contain several non-endocrine cells such as endothelial cells, fibroblasts, macrophages and dendritic cells (66). In humans, these endocrine cells are heterogeneously organized without any obvious pattern, in contrast to mice which have a beta cell core followed by a non-beta cell rim (66, 67).

Type 1 Diabetes (T1D) Type 1 diabetes (T1D) is a chronic metabolic disorder resulting from the selective destruction of insulin-producing β-cells in the pancreas (69). Insu-lin is a hormone that regulates the blood sugar levels. Lack of sufficient in-sulin in T1D patients due to beta cell loss results in high blood-glucose lev-els, which will eventually lead to serious health complications such as ke-toacidosis, kidney failure and blindness (70-72). The etiology of T1D is mul-ti factorial and thought to develop as a result of a combination between genes and environmental factors.

Autoantibodies One of the hallmarks of T1D is the appearance of auto-antibodies against the antigens Glutamic acid decarboxylase (GAD), Zinc transporter protein 8 (ZnT8), Tyrosine phosphate (IA-2) and Insulin. Studies have shown that 70-80% of newly diagnosed patients with T1D have at least one of these anti-bodies (73). The risk of progression to clinical onset of T1D in autoantibody positive individuals appears to be associated with multiple number and high-

20

er titer of antibodies (73, 74) Even though auto-antibodies are useful in pre-diction and classification of the T1D the exact role of these antibodies in disease pathogenesis is not understood. Apart from insulin, the T1D-related auto-antigens are not beta cell-specific, and it is possible that auto-antibodies appear as a response to beta cell damage leading to exposure of antigens that were previously hidden intracellularly.

Glutamic acid decarboxylase 65 (GAD) GAD65 is an enzyme that catalyzes the α-decarboxylation of L-glutamic acid to synthesize neurotransmitter γ-aminobutyricacid (GABA) (75). GAD65 is expressed in pancreatic islet β cells, ovaries, testis and in GABA neurons (76). In pancreatic islet β cells, it is stored in synaptic vesicles (76), but the role of this enzyme in islet β cells is not known (77, 78). It has been shown that autoantibodies against GAD65 are present in 70-80% of T1D patients (79).

Tyrosine phosphate (IA-2) IA-2 is a transmembrane protein that belongs to the protein tyrosine phos-phatase family (80). In pancreatic islet β cells it is located on the insulin secretory granule membrane (81). It is estimated that about 55-75% of newly diagnosed T1D patients are positive for IA-2 auto antibodies (82). The prev-alence of these antibodies varies with the age and HLA type. Highest fre-quency was reported in younger children and in patients with DR4 HLA type (79, 83).

Zinc Transporter 8 (ZnT8) ZnT8 is a dimeric membrane protein. In islet β cells it is located in insulin secretory granule and acts as a zinc transporter (84, 85). ZnT8 auto antibod-ies have been detected in 60-70% of T1D patients (86). Its frequency is in-versely related to the age of onset of T1D. Highest frequency was reported in children below 10 years (86).

Insulin Insulin is a polypeptide hormone produced by the β cells of the islets of Langerhans. It is essential for the intracellular transport of glucose into tis-sues. Insulin is composed of two polypeptide chains, A and B, which are connected by a disulfide bridge. Insulin is synthesized as its precursor mole-cule pre-proinsulin on the ribosomes of the rough endoplasmic reticulum. Cleavage of signal polypeptide from pre-proinsulin forms the proinsulin. It is transported to Golgi where it is converted to an insulin hexamer molecule by excision of C-peptide(87). Antibodies against insulin have been found in 70-80% of newly diagnosed T1D patients (79).

21

Genetic factors Several genetic factors such as HLA, Insulin, PTPN2, CTLA-4, IL-2RA, and IF1H1 (MDA5) are associated with predisposition to T1D (88-90).

Human Leukocyte Antigen (HLA) HLA is one of the major genetic loci associated with T1D development. In humans, HLA is located on the chromosome 6p21. It is estimated that this region alone contributes to around 40-50% of the overall genetic risk to de-velop T1D (91). HLA is divided into class I, II and III regions. HLA class I molecules are encoded by genes A, B and C and these molecules are ex-pressed on most of the nucleated cells. DP, DQ and DR genes encode HLA class II molecules and expression of these molecules was found on most of the antigen presenting cells. The main function of these molecules is presen-tation of processed antigen to immune cells (89, 92). Different combinations of HLA class II genes are associated with susceptibility vs. protection to-wards development of T1D.

Insulin Susceptibility to T1D in the insulin locus was mapped to variable tandem repeats (VNTR) in the insulin promoter region. Tandem repeats occur in three variable sizes such as shorter (class, I, 26-63 repeats), intermediate (class II,80) and longer repeats (Class III 141-209) (93). Functional studies showed that class I VNTR repeats are associated with lower insulin expres-sion in thymus, which is thought to result in the less efficient negative selec-tion of insulin specific T lymphocytes. In contrast class III VNTR allels are associated with higher insulin expression in thymus there by more efficient in the deletion of insulin specific T cells and in turn induction of immune tolerance.(94) It has been reported that presence of class I/I homozygous genotype is associated with 2-5 fold risk of developingT1D (89).

Interferon induced with helicase domain 1 (IF1H1) In humans IF1H1, present on chromosome 2, encodes a cytoplasmic helicase (95). It is involved in recognition of dsRNA generated during replication of RNA viruses (96). Single nucleotide polymorphisms in this gene are associ-ated with the susceptibility vs. protection towards T1D development. It has been shown that individuals with susceptible genotypes had higher IF1H1 gene expression levels. In contrast, protective IF1H1 variants showed re-duced function when expressed in cell lines (97, 98).

Epidemiology The incidence of T1D has been increasing worldwide and according to pub-lished data; there was a pooled increase of 3.0% per year in 37 populations

22

all over the world. The incidence rate is highly varied among different coun-tries(99). Highest incidence rate was reported from Finland, with nearly 60 per 100 000 in 2006, and lowest in Zunyi (China) and Carcass (Venezuela), with 0.1/100 000 per year (99). Several epidemiological reports also reported a variation of incidence according to season, where the highest number of cases were diagnosed in the autumn and winter and lowest in the spring (100).

Environmental factors Even though T1D has a strong genetic component, the rapid increase of T1D incidence all over the world, the low concordance rates to develop T1D be-tween monozygotic twins (50%) and dizygotic twins (10%) (101, 102) and the increase of incidence of T1D in low risk HLA groups (103) cannot be explained by genetics and support the role of environmental factors in T1D development. Several environmental factors such as viruses (enterovirus, rotavirus, mumps virus, cytomegalo virus, and rubella virus), gut microbiota, dietary factors (Cow milk, wheat protein), toxins and vitamin D deficiency are implicated in the role of T1D development (92).

EV Implication in T1D development Several epidemiological and experimental studies emphasized the associa-tion of EV infections in T1D development. In 1969, Gamble et al. showed that serum from T1D patients had higher CBV neutralizing antibody titers than in control subjects. Further they also reported a coincidence of seasonal variation of T1D cases with EV infections (100, 104). In 1974, Yoon et al. isolated CBV4 from the pancreas of a 10-year-old child who died of diabetic ketoacidosis. In addition they also showed that infection with this strain lead to hyperglycemia, β-cell necrosis and inflammation of islets of Langerhans in mice (105). Several cross sectional studies have also reported that EV RNA is more frequently found in blood and serum of T1D patients than con-trols (29). Studies also showed that the antiviral cytokine IFN α up-regulated in T1D patients (106).

In prospective studies from Finland, where they followed non diabetic siblings of T1D children until they developed clinical onset or auto antibod-ies, revealed that EV infections are more frequent in children who became diabetic than others (107). This was further confirmed by another study in Finland where they followed risk HLA children and reported that EV infec-tions are more frequent in children who turned autoantibody positive than in others (108). Further other studies observed that EV protein 1 (VP1) was found in multiple islets of 44 out of 72 (61% ) T1D cases versus 3 islets out of 50 (6%) in controls (109). Studies from Japan demonstrated the presence of EV RNA and also up-regulation of several viral sensors in pancreata of

23

patients who died from fulminant type 1 diabetes (110). It has also been shown that several EV serotypes can infect and replicate in islets in vitro (111). Infection with different serotypes and strains of a serotype of EVs also caused up-regulation of several chemokines such as CXCL10, CCL5 in vitro (58). It has also been shown that serum of T1D patients contains higher level of CXCL10 compared to controls (112). In conclusion, all these data from epidemiological, animal and pancreas studies support a casual relationship of EV infections in T1D development. However more studies are needed to show the casual role of EV in T1D development

Possible Mechanisms of EV in T1D development The exact mechanism of viruses in T1D development is poorly understood. However several mechanisms are hypothesized.

Direct damage Direct infection with EV can destroy the insulin-producing β-cells by virus-induced cytolysis. It was shown that several EV serotypes and clinical iso-lates can infect, replicate and destroy the human islets in vitro (58, 111). Alternatively, persistent infection with virus can impair the β-cell function in several possible ways. For example continuous replication of virus can dam-age the β cell function and eventually release of insulin.

Bystander Mechanism According to this mechanism, infection of β-cells leads to inflammation induced tissue damage, which in turns results in the release of sequestered islet antigens. Presentation of these antigens may activate and recruit auto reactive T lymphocytes that evoke β-cell damage (113).

Molecular Mimicry It was observed that there was partial sequence homology between islet-cell auto antigens (GAD-65, IA-2/IAR, and HSP-60) and EV proteins (2c, VP1and VP0) (114). This leads to speculation that similarity between these proteins may lead to generation of antiviral Cytotoxic T lymphocytes that cross react with islet cell proteins and in turn causes β-cell death. However most of the studies disproved this hypothesis.

24

Aims

The overall aim of this thesis is to study different EV strains on their ability to replicate, cause cytopathic effect/islet disintegration and induce innate antiviral pathways in explanted human islet of Langerhans and in exocrine cells clusters. In addition, the presence of EV RNA, protein and pathological changes in pancreatic tissue of T1D donors was investigated.

Paper-I The aim of this study was to investigate the presence of EV genome, EV protein and the expression of MHC1 in islets and biopsies col-lected from live recent onset T1D patients.

Paper-II To study the effect of infection with two different strains of CBV-1 on the induction of cytopathic effect/islet disintegration and genes involved in the viral sensing pathways leading to the synthesis of chemokines and cytokines in explanted purified, human islets.

Paper-III In this study we have used three different Echovirus serotypes; these were associated with development of diabetes-related autoantibodies during meningitis epidemics in Cuba. The effect of these serotypes on beta cell function and their ability to cause islet cell disintegration and induction of innate immunity genes in human islets of Langer-hans were studied.

Paper-IV In this study, three echoviruses that were found to have islet tropism in Paper-III were used, along with strains of Echovirus 6, endemic in Cuba, with the aim to analyze their tropism and ability to replicate and cause induction of antiviral genes in human exocrine and endo-crine cells.

25

Paper-V The aim was to characterize islets with a large number of endocrine cells displaying signs of hydropic degeneration in pancreatic tissue collected from a T1D donor. Also the study aimed at examining the feasibility of using islet tissue microdissected by laser capture tech-nology to quantitatively analyze gene expression.

Paper-VI The aim was to study the effect of lytic and non-lytic CBV strains to mimic fulminant or more slowly progressing type 1 diabetes. By comparing our findings on in vitro-infected islets with previously re-ported clinical findings, we aimed investigating whether some of the clinical manifestations of these two subtypes of T1D could be ex-plained by islet infection with lytic and non-lytic EVs.

26

Materials and Methods

In this section some of the materials and methods, and rationale for using those, are described. More detailed and thorough information about the methods is described in the material and methods section of the respective papers.

Virus

The strains CBV-1-7-10796 and CBV-1-11-10802 were isolated in Argenti-na during 1983 and 1998 respectively, by Centers for Disease Control and Prevention (CDC), Atlanta, USA. These two strains were selected because they have showed difference in their ability to induce innate immune re-sponses in peripheral blood mononuclear cells in vitro (115). The CBV-1-7-10796 strain was shown to be weakly immunogenic and the CBV-1-11-10802 strain strongly immunogenic (116). CBV-1-3 was isolated in the USA. The CBV-4 strain, VD2921, was isolated from a patient suffering from aseptic meningitis, plaque purified, and the plaques previously shown to cause a non-lytic infection in explanted human islets (111) were used. The Echovirus serotypes 4, 16 and 30 were isolated from stool samples of chil-dren during Cuban meningitis epidemics in the years 1986, 2000, and 2001, respectively (117). These three serotypes were associated with development of islet autoantibodies during these meningitis epidemics (118-120). Echovi-rus-6, endemic in Cuba, was isolated from the stools of sporadic cases of viral meningitis in Cuba during the years 1991 (E6/91), 1992 (E6/92), 1993 (E6/93), 1994 (E6/94), 1996 (E6/96), 2011(E6/11) and 2012 (E6/12).

27

Table 3. Serotypes of EVs and strains of serotypes included in the thesis Serotype

Strain

Paper

CBV1

CBV-1-11-10802 CBV-1-7-10796

Paper II and paper VI

CBV-1-3

Paper VI

CBV4

VD2921

Paper VI

Echovirus 4

Echovirus 4

Paper III and Paper IV

Echovirus 6

Echovirus 6

Paper IV

Echovirus 16

Echovirus16

Paper III and Paper IV

Echovirus 30

Echovirus30

Paper III and Paper IV

Human explanted islets and exocrine cells (Paper II, III, IV and VI) Most studies have used animal models or immortal cell lines to study EV-induced innate immunity pathways (121, 122). Although these models are useful in analyzing certain aspects, they may not reflect the effect of such infections in primary human cells. Especially when studying EV induced innate immunity in the context of T1D pathogenesis, these models may not mirror the complex environment of islets of Langerhans. Islets contain sev-eral endocrine and non-endocrine cells, all expressing different markers, receptors and immune or antiviral genes (123). In addition, recent studies have indicated that the expression of certain immune and antiviral genes differs between different islet endocrine cell types (124). In this context, it is

28

important to use primary human pancreatic islets of Langerhans to study the EV-induced innate immunity in order to gain more insights into the role of EV in T1D pathogenesis.

In this thesis, explanted human pancreatic islets and exocrine cell clusters from brain dead organ donors were used. The islets of Langerhans and exo-crine cells were isolated from pancreata obtained from brain dead organ donors using a protocol approved by the local ethics committee. Islets are principally isolated for the purpose of clinical transplantation, however, when the islet volume is too low for transplantation they are used for re-search purpose with consent from organ donors or close relatives. The purity of the islets after isolation varies, ranging from 10% to 90%. In order to avoid exocrine contamination in the islet preparations, or endocrine contam-ination in the exocrine cell preparations, we have, in all studies, further puri-fied islets and exocrine cells by handpicking with a micropipette under a light microscope. Islet purity was determined by using dithizone (DTZ) (Sigma–Aldrich Sweden AB, Stockholm, Sweden) staining. DTZ is a zinc-chelating agent known to selectively stain pancreatic beta cells because of their high zinc content (125). Islets after isolation and after additional purifi-cation can be seen in Figure 5.

Figure 5. Islets stained with dithizone appeared red in color A) before purification B) after purification

Pancreatic tissue (Paper I and V) Studies of human pancreata from individuals with T1D have been very lim-ited due to lack of availability of suitable tissue samples. However, the building of biobanks of organ donor pancreata such as nPOD, and laparo-scopic pancreatic tail resections in the DiViD study, have made such tissue available for studies of T1D. Analysis of pancreatic tissue from T1D pa-

29

tients, close to onset, is important as it will enable us to study the endocrine and non endocrine cells in their endogenous environment. In paper V we studied the pancreatic tissue collected from an organ donor with T1D and from one non-T1D organ donor. The donor with T1D was 40-year-old healthy male who died due to complications associated with onset of T1D. The control donor was a 26-year-old healthy male without any pancreatic disease. Tissue samples were collected from the head and body of the pan-creas and fixed in 4% PFA. In paper I we had a rare opportunity to study pancreatic tissue that was obtained from six living subjects with recent onset of T1D development. More details regarding the donors and methods used for collecting the tissue are described in elsewhere (126).

EV Detection Methods (Paper I) Virus Isolation EV isolation using cell cultures is regarded as the golden standard for detect-ing EV infections. However, due to its time consuming and labor-intensive nature, it is often replaced by easier and quicker molecular methods. The main advantage of virus isolation is that it allows the study of the viral iso-late (virus phenotype) in more detail to understand its molecular and patho-genic characteristics. However, isolation proved to be less sensitive com-pared with molecular methods (127, 128). In addition, isolation might be not possible when the viral titers are very low or during slowly replicating non-cytopathic persistent infections. In paper I, we have used the cell lines HeLa, Green monkey kidney (GMK), EndoC-βH1 and Rhabdomyosarcoma (RD) cells, cultured as monolayer, for virus isolation. These cell lines were inocu-lated with the culture medium collected from cultured islets and exocrine cell clusters at different time points post islet isolation. The inoculated cells were screened for the presence of cytopathic effect under light microscope, all isolates were passaged once on the same cell line.

Immunohistochemistry (IHC) IHC is the most widely used method to detect protein in tissue samples. It is also the most commonly used method to detect EV proteins in tissue from patients. In addition to detecting the viral proteins, this method enables us to study the localization of virus in different cells types in tissue by double staining for specific marker for different cell types. We have employed the monoclonal antibody clone 5D8/1(Dako) directed against EV-P1 in our stud-ies. This antibody recognizes a peptide sequence located between 42 to 50 residues of the VP1 capsid protein, which is highly conserved among several

30

EV species (129) and this antibody was shown to detect different EV sero-types in infected cell cultures (130, 131).

Polymerase chain reaction (PCR) PCR has been proven to be the most sensitive method among all EV detec-tion methods (132). Studies have shown that it is possible to detect less than 20 viral particles by using 5’UTR semi-nested PCR (133).

However, the sensitivity of the PCR was shown to vary depending on the serotype (134). In addition PCR sensitivity might also vary depending on the sample type (amount of tissue inhibitors). In our study (Paper I), we have used a semi nested PCR targeting the 5’UTR of the EV genome and the pri-mers used are listed in table 3. The advantage of targeting this region of the virus genome is that it is highly conserved among many EV serotypes and therefore primers can be designed to detect most EV types. However, since the region is conserved among EV, this region cannot be used to genotype the virus. The regions that were detected by PCR and IHC were depicted in Figure 6.

Table 4. Primers used for EV detection by using 5´ UTR semi nested PCR Location in 5UTR Primer sequence 1st PCR EVfw (sense) GCCCCTGAATGCGGCTAAT 450-468 nt ECBV5 (antisense) GATGGCCAATCCAATAGCT 640 nt 2nd PCR EVfw (sense) GCCCCTGAATGCGGCTAAT 450-468 nt EV rev (antisense) ATTGTCACCATAAGCAGCCA 596 nt

31

Figure 6. Schematic representation of EV genome A) indicating the locations de-tected by PCR and VP1 antibody B) representation of the positions of the primers used in this study.

32

33

Results and discussion

Paper I - Detection of a low-grade enteroviral infection in the islets of Langerhans of living patients newly diagnosed with type 1 diabetes EVs have long been associated with T1D development. Several studies have supported this hypothesis by detecting the EV protein, genome and neutraliz-ing antibodies, in different samples such as stool, blood, and serum of T1D patients (104, 135, 136). However, studies in the pancreas are limited due to lack of well-preserved tissue. Detection of the virus in the pancreatic islets would be particularly important since it would provide a mechanistic explana-tion of EVs role in the T1D pathogenic process. However, due to the anatomic location of the pancreas, it has been difficult to obtain pancreatic samples. In this study we had a unique opportunity to study the EV presence in pancreatic tissue collected from living T1D subjects through pancreatic tail resection.

This study showed that three out of six patients were positive for EV-RNA in the culture medium of isolated islet cells with PCR in both labs in Uppsala and Tampere. Culture medium from islets isolated from one patient was only positive by PCR run in Tampere whereas culture medium from exocrine cells from the same patient was positive in Uppsala. All PCR products were se-quenced in the 5’UTR of the EV genome and obtained partial nucleotide se-quences were compared to reference EV strains available in GenBank. Data-base results revealed a perfect match with EV sequences. EV protein (EV-P1) positive cells were detected in the islets of all six T1D patients whereas this protein was detected only in two out of nine controls. Failure to isolate virus, absence of cytopathic effect in isolated endocrine and exocrine from biopsies and detection of low level of viral RNA and protein suggest that these patients might harbor a persistent infection. It has recently been shown that EV persists in the absence of cytopathic virus in mice pancreas through the evolution from cytolytic to non cytolytic EV variants due to genomic deletions in the 5’ UTR region (137). When the whole tissue (flash-frozen or stored in RNAlater) was analyzed, EV RNA was detected in only one of the six patients, and this pa-tient was also found positive in culture medium. Even though the rest of the patients were found negative in pancreatic whole tissue, we cannot exclude that these patients might have had EV infection in other parts of the tissue. The presence of EV in tissue has been shown to be focal during infection, and us-ing more biopsies also showed to increase the positivity in myocarditis pa-

34

tients (138, 139). This might also be the case in these patients that EV infec-tion might be limited to some areas, and that analyzing more tissue might have allowed the finding of more patients positive for EV in the pancreas. However, due to limited availability of tissue, we were not able to use more than one part of a biopsy. In two patients that were found positive for EV by detecting EV-P1 cells by IHC analysis, no signal was obtained by PCR. One possible expla-nation for the lack of EV genome detection in spite of detecting EV protein might be due to PCR inhibitors in tissue that might have decreased the PCR sensitivity. Another explanation could be that the positivity obtained with IHC was from another part of the pancreatic resection and due to the focal presence of these viruses in tissue it is possible that this might have caused the differ-ence in positivity between the methods.

In addition to presence of EV this study also shows the hyper expression of MHC1 in all six patients. This is in line with the previous finding showing up regulation of MHC1 in T1D patients (140, 141). However what causes the MHC1 up regulation is not known. It has been hypothesized that IFN alpha released from the beta cells could be responsible for this up regulation. In sup-port of this, IFN has been detected in T1D patients (140). EV persistence in islets was shown to induce IFN alpha in in vitro infected islets (142). It seems likely that EV presence could induce IFN alpha which subsequently up regu-late MHC, perhaps resulting in autoimmune beta cell death.

In conclusion, this study that for first time shows the detection of EV RNA and protein in live T1D patients, demonstrates that EV can spread to the pancreas; however, further studies are needed to prove a casual relationship between EV and T1D development.

Table 5. Detection of EV RNA, Protein and MHC-1 expression in T1D patients Case Age/Se

x Diagno-sis to biopsy

EV-RT-PCR (Uppsala & Tampere) Culture Biopsy Medium

EV-P1 (IHC) (Exeter &Tampere)

Expression of HLA

1 25/F 4 Negative Negative Positive Hyper expressed

2 24/M 3 Positive Negative Positive Hyper expressed

3 34/F 9 Negative Negative Positive Hyper expressed

4 31/M 5 Positive Negative Positive ++ Hyper expressed

5 24/F 5 Positive Negative Positive Hyper expressed

6 35/M 5

Negative** Positive Positive Hyper expressed

** Positive in exocrine fraction in Uppsala and in endocrine fraction in Tampere ++ Positive in Tampere negative in Exeter

35

Paper II -Infection of human islets of Langerhans with two strains of coxsackie B virus serotype 1: Assessment of virus replication, degree of cell death and induction of genes involved in the innate immunity pathway In this study, we used two CBV-1 strains that are previously shown to differ in their induction of innate immunity in peripheral blood mononuclear cells (143) and investigated if these two strains also differ in their ability to cause cytopathic effect and innate antiviral gene induction in primary isolated hu-man pancreatic islets. We showed that one of the CBV-1 strains (CBV-1-11) caused more cytopathic effect (islet disintegration) than the other CBV-1 strain (CBV-1-7). This can be explained by the fact that even a single point mutation in the EV genome has been shown to affect the virulence of the virus (144).

CBVs have mainly been shown to be sensed by the innate immune sen-sors TLR3 and MDA5. However, the relative importance of these factors seems to differ between different cell types (145). In this study, we showed that TLR3 expression is minimal at the mRNA level and almost absent at the protein level in islet cells; The absence of TLR3 in the endocrine cells might indicate that MDA5 plays the primary role in sensing the CBV in islets of Langerhans. In addition, we showed that infection with both of these CBV-1 strains caused the up regulation of genes encoding CXCL10 (IP10) and CCL5 (RANTES). These chemokines are implicated in the immunopatholo-gy of several inflammatory and autoimmune diseases (146) and have been shown to be elevated in serum of T1D patients (147). In addition, CXCL10 has been shown to be expressed in pancreata of fulminant T1D cases (148). In NOD and transgenic RIP-lymphocytic choriomeningitis virus (LCMV) models of autoimmune diabetes, selective and extensive expression of CXCL10 was shown to attract the activated T lymphocytes (149). In rat in-sulin promotor (RIP)-GP mice model, infection with lymphocytic chori-omeningitis virus was shown to induce CXCL10 leading to expansion of auto-aggressive T cells and their migration into the islets leading to impair-ment of beta cell function (150, 151). It has also been shown that treating human islets with CXCL10 decreases the insulin synthesis (152). It seems likely that the induction of CXCL10 in vivo upon EV infection of islets would attract T-lymphocytes to the islets. This might lead to insulitis and possibly to immune-mediated damage.

Furthermore, both of these strains specifically reduced the expression of the gene encoding insulin while the glucagon gene expression was not af-fected. This, together with the detection of dsRNA in insulin positive but not in glucagon positive cells, indicates that these CBV-1 strains specifically replicated in beta cells. However, it is not known why only beta cells, rather than alpha cells, are productively infected but recent studies with purified rat

36

alpha and beta cells showed that alpha cell express higher basal and induc-tion levels of antiviral genes than beta cells resulting in an antiviral state in the latter, thus virus replication will be affected (124). Infection with both of these strains resulted in the induction of genes involved in innate antiviral pathways and the gene induction levels did not differ between the strains. This might be surprising as one could expect that infection with more lytic strains would lead to less gene expression due to rapid cell death. However, islets consist of several types of endocrine cells so it seems possible that some of the genes induced might be a secondary effect of the infection and origin from other endocrine cells in the islets.

One of the important findings in this study was that expression level of some of the innate immunity genes (IFN-β, MDA5, IP-10), that are im-portant in induction of an antiviral state, varied between different donors. IFN-β was shown to be important in controlling CBV infection in mice (153). IFN-β treatment of dilated cardiomyopathy (DCM) patients with EV persistence was also shown to eliminate EV genome from these patients (154). It is tempting to speculate that, if this situation replicates in vivo, the individual with lower expression of these genes might not be able to clear the infection efficiently and this might result in prolonged virus replica-tion/virus persistence and beta cell death. MDA5 is a cytoplamic sensor of dsRNA, a replication intermediate formed during replication of RNA viruses (155), including EV (156). Activation of MDA5 induces antiviral pathways to limit the viral infection (157). Studies using MDA5-deficient mice have showed an increased mortality after EV infection (158), demonstrating the important role of MDA5 in controlling the EV infection. Variation of this gene between donors might influence the outcome of the infection. It is pos-sible that lower expression of MDA5 and other antiviral genes in vivo results in impaired EV sensing, leading to systemic spread of the virus. CXCL10 is important for the recruitment of auto-aggressive T cells to pancreatic islets (151). Inhibition of CXCL10 has been shown to decrease diabetes incidence in mice (149). Further, the pancreatic CXCL10 mRNA expression level was shown to positively correlate with the insulitis frequency in a NOD mice model (159). Transgenic mice expressing CXCL10 in β cells show sponta-neous infiltration of lymphocytes as well as impairment of β cell function (160). The variation of this gene expression upon EV infection, leading to differential secretion of protein in vivo, might influence the infiltration of T cells and further determine the extent of insulitis and beta cell damage.

In conclusion, differential expression of these antiviral genes between dif-ferent donors suggest that the same infection could have a different outcome in two different individuals, which might also explain why systemic EV infections initiate changes leading to the development of type 1 diabetes in certain individuals but not in others.

37

Paper III- Expression of innate immunity genes and damage of primary human pancreatic islets by epidemic strains of Echovirus: implication for post-virus islet autoimmunity Autoantibodies against islet cell antigens can be detected in the serum of T1D patients even years before clinical onset of T1D and they are used as predictive markers for developing T1D (161). However, factors triggering the induction of islet autoantibodies are not known. Recent studies from Cuba reported sero-conversion to islet cell autoantibodies during three echovirus (echovirus16, echovirus 30, echovirus 4) epidemics, suggesting that EV infections may be one of the factors that initiate the development of islet autoimmunity (119, 162). Interestingly, the prevalence of these islet cell autoantibodies also varied between different epidemics. Prevalence of ICA was moderate during echovirus 4 epidemic and high during echovirus 16 and 30 epidemics. In addition to ICA, autoantibodies against insulin (IAA) and glutamic decarboxylase (GADA) were also detected during echovirus 16 and echovirus 30 epidemics (118-120).

In this study, explanted human pancreatic islets from seven organ donors were infected with echovirus serotypes 4, 16 and 30. The viral replication, islet disintegration/cytopathic effect, beta cell function, and induction of innate immunity genes were studied. echovirus 16 and 30, which were asso-ciated with higher prevalence of autoantibodies, caused cytopathic ef-fect/islet disintegration in all donors and there was no apparent difference between these serotypes. Islets infected with any of these serotypes showed signs of cytopathic effect already day one post infection and this was more pronounced day three-post infection, whereas in islets infected with echovi-rus 4, which is associated with moderate prevalence of autoantibody induc-tion, no cytopathic effect/islet disintegration in islets from any of the donors were seen. Both echovirus 16 and 30 replicated in the islets infected from all seven donors with clear titer increase from day zero to day three post infec-tion. Further, detection of EV-P1 and dsRNA in insulin-positive cells sug-gested the selective replication of these strains in beta cells. Echovirus 4 was replicated only in islets from two of the seven donors, with a titer increase between day three and five post infection. Despite that, no signs of cyto-pathic effect/islet disintegration were detected.

Viral replication ability has been shown to depend on both genetics of the virus and host determinants. The human islets used in the present study were obtained from different organ donors with different genetic background, and therefore, variability in the level of viral replication between different donors can be expected. However, selective replication of echovirus 4 in two donors and complete absence of replication in the other donors suggest that the is-

38

lets from these two donors express the receptors or other factors that are required for the echovirus 4 replication.

The non-cytolytic replication of echovirus 4 seems to be islet or beta cell specific since further experiments with beta cell lines also showed the simi-lar results to what was obtained in isolated islets (163). However, infection of non beta cell lines such as GMK and human rhabdomyosarcoma (RD) cells showed clear cytopathic effect, suggesting that the absence of cyto-pathic effect is beta cell specific. This beta cell specific non-cytolytic repli-cation has also been reported for other EV strains (33). Studies have indicat-ed that both viral genomic changes and availability of cellular factors could influence the outcome of the EV cytolytic ability. It has been shown that CBV undergoes lytic replication in immortalized cells lines while preferen-tially establishing non lytic slowly replicating persistent infection in primary cells, hypothesizing that differential expression levels of specific cellular factors in primary cells might favor the non-cytopathic persistent infection over the lytic (164). It might be possible that lack of host factors in insulin producing cells might favor the productive non-cytopathic echovirus infec-tion in beta cells.

Infection with any of the three echoviruses affected the glucose-stimulated insulin secretion significantly compared to mock infected control islets. However, the effect was higher with echovirus 16 and echovirus 30 compared to echovirus 4. Effect of echovirus 30 and 16 infection can be expected due to islet cell disintegration. However the effect of echovirus 4 on glucose induced insulin secretion despite not inducing any islet disinte-gration suggests that this virus might cause a functional block. This also suggests that even non-cytolytic productive infection can impair the insulin secretion. Interestingly, impairment of insulin secretion without reduction in insulin content was reported in T1D patients (165). Further, this study also shows that infection with echovirus 16 and echovirus 30 resulted in the in-duction of innate antiviral genes. However, infection with echovirus 4 did not cause any induction of the genes evaluated.

In conclusion, cytolytic properties of these serotypes might explain the difference in the prevalence of islet autoantibody development during differ-ent Echovirus epidemics in Cuba.

39

Table 6. Effect of Echovirus infection on virus replication and islet disintegration in explanted human islets

ECHO virus sero-type

Prevalence of ICA during epidemics

Viral replication in infected isolated islets (n=7)

Cytopathic effect in infected isolated islets (n=7)

Echoviru 4

36.1%

Replicated in 2/7 donors

Did not cause cyto-pathic effect/islet disintegration in islets from any donor

Echovirus 16

92.1%

Replicated in all donors

Caused cytopathic effect/islet disinte-gration in all donors

Echovirus 30

87.5%

Replicated in all donors

Caused cytopathic effect/islet disinte-gration in all donors

Paper IV -Field strains of Echovirus 6 infect human endocrine and exocrine pancreatic cells and induce pro-inflammatory innate immune responses Considerable evidence implies the involvement of both endocrine and exo-crine pancreas in T1D patients. In support of this, various studies reported signs of inflammation, fibrosis and atrophy in the exocrine pancreas of T1D patients (166) (167). However, the causative mechanism behind the patho-logical changes in endocrine and exocrine pancreas of T1D patients is not known. EVs are implicated as one of the major environmental factors that trigger or accelerate the T1D. However most of the studies have investigated the effect of EV strains in the endocrine islets of Langerhans and very little is known about their tropism and effect on pancreatic exocrine cells (59, 168, 169). To address this, we have infected human pancreatic isolated exo-crine cells with different strains of echovirus 6 and further studied their tro-pism and if infection resulted in induction of innate inflammatory molecules in these cells.

We have showed that only one of the echovirus serotypes (echovirus 6) could replicate in both exocrine and endocrine cells. In contrast, the other echovirus serotypes (4, 16 and 30) that were shown to infect endocrine cells in paper III did not replicate in exocrine cells. All seven field-isolates of echovirus 6 caused clear cytopathic effect/islet disintegration and they repli-cated both in endocrine and exocrine cells with no significant difference in titer increase between endocrine and exocrine cells. Previous studies with CBV strains showed minor viral titer increase when exocrine cell cultures were infected, and this was shown to be due to embedded endocrine cells

40

(170). However, in our study, a clear titer increase of echovirus 6 and con-versely viral titer decrease of other islet tropic echovirus serotypes indicated that the viral titer increase was solely due to echovirus 6 replication in exo-crine cells and a not results from embedded endocrine cells. Further, electron microscopic detection of virus particles in the cytoplasm and in enclosed vacuoles in echovirus 6 infected exocrine cells proves the echovirus 6 repli-cation in exocrine cells. In contrast, infection with the other three echovirus serotypes did not result in any viral titer increase and cytopathic effect/islet disintegration in exocrine cells. This lack of tropism for acinar cells has also been reported for CBV strains (170).

This result shows the unique ability of echovirus 6 to infect and replicate in both exocrine and endocrine pancreatic cells. Virus tropism and replica-tion ability depends on several factors such as the presence of the appropri-ate virus receptor, availability of cellular factors essential for virus replica-tion and viral genomic regions that were able to interact with receptor and cellular factors. Several studies have indicated that even a single or few ami-no acid changes in the viral genome can influence the receptor usage and tissue tropism. A single amino acid change in the VP1 region of a CBV6 strain was shown to change the viral phenotype to use DAF as a receptor (171). Furthermore, experiments with chimeric viruses, constructed by ex-changing 5’UTR of different EVs, have been shown to alter the tissue tro-pism in mice (172), demonstrating that genomic regions in the 5’ UTR could influence the tissue tropism and replication. It might be possible that echovi-rus 6 has other genetic determinants than other EV strains that facilitate use of the exocrine cellular factors, which enables its replication in exocrine cells.

This study further demonstrates the induction of genes involved in viral sensing (MDA5), antiviral defense (OAS1 and IFNB) and chemokines (CXCL10 and CCL5) in both echovirus 6 infected exocrine and endocrine cells, suggesting that, like endocrine cells, exocrine cells are also equipped with a machinery to detect and respond to echovirus 6 infection. Further, the expression of chemokines suggests that infection of exocrine pancreatic cells also might result in attraction of immune cells. The mere induction of genes does not show that the corresponding protein is synthesized and genes cod-ing for antiviral proteins will either not be processed due to block of CAP dependent translation, or some of the cellular proteins involved in the antivi-ral pathway will be cleaved by some of the virus proteins (173-175). Effi-cient virus replication is not possible in a cell with an antiviral state, thus this cannot be the case in any of our studies of explanted islets.

41

Paper V- Gene expression analysis of human islets in a subject at onset of type 1 diabetes Swollen islet cells have been documented already at the beginning of the last century by Weichselbaum, and it has been referred to as hydropic degenera-tion (176, 177). This phenomenon was also further reported by Gepts. This kind of islets were also observed in the pancreas of depancretized diabetic dogs (178), alloxan-induced diabetic rabbits(179), in bank voles infected with Ljugan virus (180) and in dogs and cats treated with anterior pituitary extract (181). The hydropic cells are hypothesized to develop due to accu-mulation of cellular edema. However, the characterizations of these cells are not yet reported. In this study we had a unique opportunity to study the pan-creatic tissue and isolated islets obtained from cadaver pancreases of a T1D donor and compare it to a non-diabetic control. Formalin-fixed and paraffin-embedded pancreatic biopsies and isolated isles were obtained from one T1D and one healthy donor. Islet-enriched tissue samples from these pancre-atic sections were extracted by using Laser Capture Micro dissection (LCM). IHC analysis showed several hydropic cells in almost all examined islets in sections from the T1D donor whereas it rarely appeared in the control donor. We carried out this study with two major aims, first, to characterize the islets from T1D donors and, second, to investigate the feasibility of using RNA extracted from microdissected islets from frozen pancreatic tissue for gene expression analysis.

To characterize the islets from T1D patients, genes involved in ER stress, beta cell function, cell death and inflammation were analyzed by qPCR in both microdissected and isolated islets from T1D and control donors. In-creased mRNA levels of genes encoding the chemokine MCP1 and MHC class I were found in both LCM samples and isolated islets of T1D com-pared to control samples. Hyper expression of MHC1 was reported in Paper-I and also in other studies. This result further support those observations (140). Genes encoding ER stress transcription factors ATF4 and CHOP were found to be increased in islets from T1D donor whereas mRNA levels of these genes were undetectable in islets from control donor. Increased levels of CHOP protein was also previously reported in islets of T1D patients (182). Our study further confirms this and also suggests partial ER stress response in this donor. However, further more extensive analysis is needed to confirm this observation. There were no obvious differences in genes in-volved in inflammation or apoptosis between islets from T1D and control donors. In addition, staining for cleaved caspase-8 also showed no evidence of apoptosis in control or T1D islets. These data show that there is no obvi-ous sign of inflammation and apoptosis in hydropic degenerated swollen islets from a T1D subject compared to islets from a control donor, indicating that these cells are responding normally to high glucose and finally exhaust-ed by beta cell depletion.

42

It is well known that the pathological features in T1D patients are uneven-ly distributed over the different lobes of pancreas (141). Using the whole tissue for molecular analysis makes the interpretation difficult and even un-dermines some of the important changes. The advantage of using LCM is that it allows us to extract the selective population or regions of the tissue. However intact RNA extraction from microdisected pancreatic tissue is par-ticularly challenging due to high abundance of RNases in pancreas. Even though using intact RNA is optimal for gene expression analysis sometimes it might be desirable to use even the degrade samples since the tissue availa-bility from the T1D pancreas is very rare. This study shows the possibility of performing qPCR analysis on the RNA extracted from microdisected pan-creatic tissue in spite of degradation.

Paper VI- Enterovirus-induced changes in explanted human islets of Langerhans resemble findings in islets of fulminant and conventional type 1 diabetes Fulminant Type 1 diabetes is a unique subtype of T1D mostly described in the Japanese population and characterized by extensive islet cell lysis (183). In contrast, this dramatic islet cell death has not been observed in the pan-creas of conventional T1D patients. EV infections are associated with the etiology of both fulminant and conventional T1D (109, 184). However the causative mechanism of either is not known but it seems likely that the ful-minant variant could be caused by an acute lytic virus infection. After ob-serving the similarities and differences between the findings in fulminant and conventional T1D with our results obtained with lytic CBV-1 strain in PAPER-III and the low grade persistent kind of infection in PAPER- I. We hypothesized that EVs capability to cause more lytic vs non-lytic infection and the nature of virus induced host immune response may have implications on the pathogenesis of these subtypes of T1D. To mimic the fulminant T1D situation we have used three CBV-1 strains that has been shown to cause lytic infection in human explanted islets and to mimic the slowly progressing conventional type 1 diabetes (TD1) we have used a strain of CBV4 which has been shown to cause non lytic persistent infection in explanted islets. All CBV strains replicated in the islets but only the lytic CBV strains caused cytopathic effect/islet disintegration whereas the non-lytic CBV4 strain did not cause any disintegration of the islets. Some of the innate and antiviral proteins that were detected in fulminant and conventional T1D were induced by both lytic and non-lytic CBV.

Genes encoding OAS2 and MX1 were induced by all CBV strains. These proteins were shown to induce an antiviral state in infected cells (185). OAS convert ATP into 2', 5’-linked oligomers of adenosine and these oligomers

43

activate the latent form of RNaseL leading to degradation of both viral and cellular RNA to inhibit the viral replication (186, 187). OAS pathway has been shown to be protective against CBVs during infection of isolated mu-rine pancreatic islets (188). PKR is a protein kinase that is induced by inter-feron and activated by dsRNA. Upon activation, it phosophorylates transla-tion initiation factor eIF-2α, leading to inhibition of protein translation to inhibit the virus replication. The gene encoding PKR was induced by both CBV-1-11 and by the CBV-4 strains. PKR was also detected in the EV-P1 positive beta cells of T1D patients. The gene encoding IRF7 was induced only by the lytic CBV-1-11 strain. IRF7 is an important transcriptional factor that belongs to the interferon regulatory factors. IRF7 resides in the cytosol and, following activation, it translocates to the nucleus, where with other co-activators it initiates IFN mRNA synthesis (46). Hyper expression of IRF7 was detected in fulminant T1D patients. Some of the results obtained with lytic and non lytic strains compared with the reported findings in fulminant and slowly progressing T1D are summarized in Table 8.

Table 7. Clinical characteristics of fulminant and conventional T1D (189).

Fulminant Type 1 Diabetes

Conventional Type 1 Diabe-tes

Onset

Abrupt onset with flu like symptoms

Slow onset

Elevated pancreatic enzyme in serum

Present

Absent

Autoantibodies

Mostly absent

Present

Hemoglobin A1c levels

Slightly elevated

Markedly elevated

44

Table 8. Comparison between the T1D and FT1D Results from the present study

Finding in islets infected with lytic CBV strains

Finding in Ful-minant T1D cases

Finding in islets infected with non-lytic CBV strain

Finding in Con-ventional T1D cases

Islet cell lysis

Detected (190)

Detected (191)

Not detected

Not detected

Expression of PKR

mRNA expres-sion levels were up regulated

Unknown

mRNA expres-sion levels were up regulated

The protein was detected in EV-P1 positive beta cell (109)

Expression of TLR4 and NOD2

Not affected

TLR4 was only detected in monocytes (184)

Not affected

Unknown

Expression of IRF7

mRNA expres-sion levels were up regulated

Hyper express-ion was detected (110)

IRF7 not affec-ted

Unknown

Results from the previous studies

Detection of the EV-P1 protein

Detected (192)

Detected (184)

Detected (33)

Detected (109)

Hyper express-ion of MDA5, RIG-I

mRNA expres-sion levels were up regulated

Hyper expres-sion of proteins were detected (110)

mRNA expres-sion levels were up regulated

Hyper expression was not detected

Expression of IRF7, IFN (α/β)

mRNA expres-sion levels were up regulated

Hyper express-ion was detected (184)

IRF7 not affect-ed, IFN not analyzed

Expression of type I IFN was detected (193)

Expression of CXCL10

mRNA expres-sion levels were up regulated (192) CXCL10 secreted from infected islets

Expression was detected (184)

CXCL10 secret-ed from infected islets (194)

Expression was detected (195)

45

Conclusions

Paper-I • All six T1D patients were positive for EV with at least one of the

methods independently in two labs. • EV RNA was detected in 4/6 patients and EV-P1 positive cells

were detected in all six patients. • All six T1D patients were found negative for other viruses (rhino-

virus, norovirus, rotavirus, and paraechovirus) analyzed. • MHC-I hyper expression was observed in all six T1D patients.

Paper-II • The CBV-1-11 strain caused more cytopathic effect/islet disinte-

gration than the CBV-1-7 strain in explanted human pancreatic is-lets.

• Infection of islets with any of the CBV-1 strains resulted in the in-duction of genes involved in innate and antiviral pathways.

• Expression of the genes encoding IFN-β (P < 0.007), CXCL10 (P < 0.037) and MDA5 (P < 0.042) varied between different donors.

Paper-III • Infection of human explanted islets with three echovirus serotypes

that were differentially associated with induction of islet cell auto-antibodies showed a correlation between their islet autoantibody induction and their ability to cause islet cell disintegration in ex-planted islets.

• Echovirus 30 and 16, that were associated with higher prevalence of autoantibody-induction, replicated and caused cytopathic ef-fect/islet disintegration in explanted islets from all donors.

• Echovirus 4 that was associated with lower autoantibody induc-tion replicated only in islets from 2/7 donors and did not cause cy-topathic effect/islet disintegration.

46

• Infection with all three serotypes of echovirus impaired the glu-cose stimulated insulin secretion, also echovirus 4 despite not causing any islet disintegration.

Paper-IV • All seven-field isolates of echovirus 6 replicated and caused cyto-

pathic effect in both human endocrine and exocrine cells. • Electron microscopy of echovirus 6 infected endocrine and exo-

crine cells showed the presence of virus particles in both. • The epidemic echovirus 4, 16 and 30, associated with induction of

islet autoantibodies, were not able to infect and replicate in human exocrine cells.

• Infection with echovirus 6 induced a massive degradation of cyto-plasm and formation of empty vacuoles in exocrine cells.

• Infection with echovirus 6 affected the glucose-induced insulin secretion and also led to accumulation of echovirus 6 particles in close proximity to insulin granules.

Paper-V • There were no significant signs of apoptosis, inflammation and

ER stress in islets of a T1D donor despite cells showing swollen hydropic morphology.

• Gene expression analysis is feasible on RNA extracted from tissue microdissected from frozen pancreatic tissue that had been stored for several years.

Paper-VI • All CBV strains replicated in explanted islets but only the lytic

CBV-1 strain caused cytopathic effect/islet disintegration whereas the non-cytolytic CBV-4 did not show any islet disintegration.

• Infection with all CBV strains caused the induction of the genes encoding MX1 and OAS2.

• Only one of the lytic CBV-1 strains caused induction of IRF7 gene expression.

 

47

 

48

Acknowledgements

I would like to convey my gratitude and sincere appreciation to everyone who has helped and supported me during the past years First I would like to express my sincere gratitude to my supervisor Gun Frisk for believing in me and accepting me as a PhD student in your group. Thanks for always taking the time to listen and discuss everything from science to life. For your patience in correcting my writing countless times and especially for supporting me when I needed the most. My Co-supervisor Oskar Skog I can’t thank enough for your continuous support and help right from my Master’s project to PhD thesis, and also, for all the discussions and valuable inputs and proofreading my thesis. I am also deeply thankful to My Co-supervisor Magnus Essand for your helping nature, kindness and your willingness to come forward to help me in the most difficult times. I would like to thank Catharina Sevensson for your concern and valuable suggestions. I truly admire both your scientific, administrating skills and caring nature. I would like to thank Karin Forsberg Nilsson and Claes Wadelius for all your effort to make sure that everything goes smooth for my PhD defense. Monika Hodik and Therese Reosenling, I was fortunate to have both of you in lab during my PhD, Thanks for all the discussions, lunches, help and kindness. I really wished that both of you would have stayed some more time. I wish I had been more in touch with you than I was… Heikki Hyötty thanks for willing to help during the final stages of my PhD. Sofia Nordling thanks for your kind words. Luis Sarmiento, friend and coauthor, for the nice collaboration and for be-ing cheerful always, I really enjoyed working with you.

49

Anna Wiberg, thanks for your patience listening to my stories!! And also for answering all my stupid questions. Marcus Lundberg thanks for your company in the lab and the numerous discussions we had...Your suggestions were also very helpful. I would like to thank all my colleagues Enida Kuric (Thanks for your tips how to survive post PhD), Marie Karlsson (helping with Endo Cells and for you kind nature), Per-Anton Stenwall,Marcus Bergström, Maja Ericsson, peter, Johan Olerud, Magnus Ståhle, Andrew Friberg, Anna-Maria Ullbors, Karin Fonnaland, Sofie Ingvast, Thank you very much for all your company during these years. Sana Asif thanks for all the discussion ranging from Bollywood to cricket and life in general, Ram Thanks for all your help, discussions and fun times! Many thanks to all my collaborators Sami Oikarinen, Noel G. Morgan, Sarah J. Richardson Corrado M. Cilio, Lars Korngold, Knut Dahl-Jørgensen . I would like to thank all my friends here in Uppsala and in India Last but not least I would like to thank my family for always supporting and believing in me

50

51

References

1. Fields BN, Knipe DM, Howley PM. Fields virology. 5th ed. Philadelphia: Wolters Kluwer Health/Lippincott Williams & Wilkins; 2007.

2. Tracy S, Chapman, Nora M., Mahy, Brian W.J. The coxsackie B viruses. New York: Springer-Verlag,; 1997.

3. Howley BNFDMKPM. Fields virology. Philadelphia: Wolters Kluwer Health/Lippincott Williams & Wilkins; 2007.

4. Ventoso I, MacMillan SE, Hershey JW, Carrasco L. Poliovirus 2A proteinase cleaves directly the eIF-4G subunit of eIF-4F complex. FEBS Lett. 1998;435(1):79-83.

5. Beske O, Reichelt M, Taylor MP, Kirkegaard K, Andino R. Poliovirus infec-tion blocks ERGIC-to-Golgi trafficking and induces microtubule-dependent disruption of the Golgi complex. J Cell Sci. 2007;120(Pt 18):3207-18.

6. Campanella M, de Jong AS, Lanke KW, Melchers WJ, Willems PH, Pinton P, et al. The coxsackievirus 2B protein suppresses apoptotic host cell responses by manipulating intracellular Ca2+ homeostasis. J Biol Chem. 2004;279(18):18440-50.

7. Cho MW, Teterina N, Egger D, Bienz K, Ehrenfeld E. Membrane rearrange-ment and vesicle induction by recombinant poliovirus 2C and 2BC in human cells. Virology. 1994;202(1):129-45.

8. Doedens JR, Giddings TH, Jr., Kirkegaard K. Inhibition of endoplasmic reticu-lum-to-Golgi traffic by poliovirus protein 3A: genetic and ultrastructural analy-sis. J Virol. 1997;71(12):9054-64.

9. Nomoto A, Detjen B, Pozzatti R, Wimmer E. The location of the polio genome protein in viral RNAs and its implication for RNA synthesis. Nature. 1977;268(5617):208-13.

10. Pettersson RF, Ambros V, Baltimore D. Identification of a protein linked to nascent poliovirus RNA and to the polyuridylic acid of negative-strand RNA. J Virol. 1978;27(2):357-65.

11. Clark ME, Lieberman PM, Berk AJ, Dasgupta A. Direct cleavage of human TATA-binding protein by poliovirus protease 3C in vivo and in vitro. Mol Cell Biol. 1993;13(2):1232-7.

12. Paul AV, Peters J, Mugavero J, Yin J, van Boom JH, Wimmer E. Biochemical and Genetic Studies of the VPg Uridylylation Reaction Catalyzed by the RNA Polymerase of Poliovirus. J Virol. 2003;77(2):891-904.

13. Evans DJ, Almond JW. Cell receptors for picornaviruses as determinants of cell tropism and pathogenesis. Trends Microbiol. 1998;6(5):198-202.

14. Racaniello VR. Cell receptors for picornaviruses. Curr Top Microbiol Immu-nol. 1990;161:1-22.

15. Patel KP, Coyne CB, Bergelson JM. Dynamin- and lipid raft-dependent entry of decay-accelerating factor (DAF)-binding and non-DAF-binding cox-sackieviruses into nonpolarized cells. J Virol. 2009;83(21):11064-77.

52

16. Coyne CB, Bergelson JM. Virus-induced Abl and Fyn kinase signals permit coxsackievirus entry through epithelial tight junctions. Cell. 2006;124(1):119-31.

17. Richards AL, Jackson WT. Behind closed membranes: the secret lives of pi-cornaviruses? PLoS Pathog. 2013;9(5):e1003262.

18. Frisk G. Mechanisms of chronic enteroviral persistence in tissue. Curr Opin Infect Dis. 2001;14(3):251-6.

19. Feuer R, Mena I, Pagarigan R, Slifka MK, Whitton JL. Cell cycle status affects coxsackievirus replication, persistence, and reactivation in vitro. J Virol. 2002;76(9):4430-40.

20. Pavio N, Couderc T, Girard S, Sgro JY, Blondel B, Colbere-Garapin F. Ex-pression of mutated poliovirus receptors in human neuroblastoma cells persis-tently infected with poliovirus. Virology. 2000;274(2):331-42.

21. Pelletier I, Couderc T, Borzakian S, Wyckoff E, Crainic R, Ehrenfeld E, et al. Characterization of persistent poliovirus mutants selected in human neuroblas-toma cells. Virology. 1991;180(2):729-37.

22. Duncan G, Colbere-Garapin F. Two determinants in the capsid of a persistent type 3 poliovirus exert different effects on mutant virus uncoating. J Gen Virol. 1999;80 ( Pt 10):2601-5.

23. Chapman NM, Kim KS, Drescher KM, Oka K, Tracy S. 5' terminal deletions in the genome of a coxsackievirus B2 strain occurred naturally in human heart. Virology. 2008;375(2):480-91.

24. Kim KS, Chapman NM, Tracy S. Replication of coxsackievirus B3 in primary cell cultures generates novel viral genome deletions. J Virol. 2008;82(4):2033-7.

25. Tracy S, Smithee S, Alhazmi A, Chapman N. Coxsackievirus can persist in murine pancreas by deletion of 5' terminal genomic sequences. J Med Virol. 2015;87(2):240-7.

26. Tam PE, Messner RP. Molecular mechanisms of coxsackievirus persistence in chronic inflammatory myopathy: viral RNA persists through formation of a double-stranded complex without associated genomic mutations or evolution. J Virol. 1999;73(12):10113-21.

27. Chia JK, Chia AY. Chronic fatigue syndrome is associated with chronic enter-ovirus infection of the stomach. J Clin Pathol. 2008;61(1):43-8.

28. Julien J, Leparc-Goffart I, Lina B, Fuchs F, Foray S, Janatova I, et al. Postpolio syndrome: poliovirus persistence is involved in the pathogenesis. J Neurol. 1999;246(6):472-6.

29. Oikarinen M, Tauriainen S, Oikarinen S, Honkanen T, Collin P, Rantala I, et al. Type 1 diabetes is associated with enterovirus infection in gut mucosa. Dia-betes. 2012;61(3):687-91.

30. Satoh M, Nakamura M, Akatsu T, Shimoda Y, Segawa I, Hiramori K. Toll-like receptor 4 is expressed with enteroviral replication in myocardium from pa-tients with dilated cardiomyopathy. Lab Invest. 2004;84(2):173-81.

31. Wessely R, Henke A, Zell R, Kandolf R, Knowlton KU. Low-level expression of a mutant coxsackieviral cDNA induces a myocytopathic effect in culture: an approach to the study of enteroviral persistence in cardiac myocytes. Circula-tion. 1998;98(5):450-7.

32. Wessely R, Klingel K, Santana LF, Dalton N, Hongo M, Jonathan Lederer W, et al. Transgenic expression of replication-restricted enteroviral genomes in heart muscle induces defective excitation-contraction coupling and dilated car-diomyopathy. J Clin Invest. 1998;102(7):1444-53.

53

33. Yin H, Berg AK, Westman J, Hellerstrom C, Frisk G. Complete nucleotide sequence of a Coxsackievirus B-4 strain capable of establishing persistent in-fection in human pancreatic islet cells: effects on insulin release, proinsulin synthesis, and cell morphology. J Med Virol. 2002;68(4):544-57.

34. Sane F, Caloone D, Gmyr V, Engelmann I, Belaich S, Kerr-Conte J, et al. Cox-sackievirus B4 can infect human pancreas ductal cells and persist in ductal-like cell cultures which results in inhibition of Pdx1 expression and disturbed for-mation of islet-like cell aggregates. Cell Mol Life Sci. 2013;70(21):4169-80.

35. Aminev AG, Amineva SP, Palmenberg AC. Encephalomyocarditis viral pro-tein 2A localizes to nucleoli and inhibits cap-dependent mRNA translation. Vi-rus Res. 2003;95(1-2):45-57.

36. Ohlmann T, Rau M, Pain VM, Morley SJ. The C-terminal domain of eukaryot-ic protein synthesis initiation factor (eIF) 4G is sufficient to support cap-independent translation in the absence of eIF4E. Embo J. 1996;15(6):1371-82.

37. Racaniello VR. Picornaviruses. New York: Springer-Verlag; 1990. 38. Wang J, Ptacek JB, Kirkegaard K, Bullitt E. Double-membraned liposomes

sculpted by poliovirus 3AB protein. J Biol Chem. 2013;288(38):27287-98. 39. Semler BL, Wimmer E. Molecular biology of picornaviruses: Washington D.C.

; [Great Britain] : ASM Press, c2002. 40. Liu Y, Zhang Z, Zhao X, Yu R, Zhang X, Wu S, et al. Enterovirus 71 inhibits

cellular type I interferon signaling by downregulating JAK1 protein expression. Viral Immunol. 2014;27(6):267-76.

41. Belov GA, Romanova LI, Tolskaya EA, Kolesnikova MS, Lazebnik YA, Agol VI. The major apoptotic pathway activated and suppressed by poliovirus. J Vi-rol. 2003;77(1):45-56.

42. Romanova LI, Belov GA, Lidsky PV, Tolskaya EA, Kolesnikova MS, Evstafieva AG, et al. Variability in apoptotic response to poliovirus infection. Virology. 2005;331(2):292-306.

43. Rasilainen S, Ylipaasto P, Roivainen M, Bouwens L, Lapatto R, Hovi T, et al. Mechanisms of beta cell death during restricted and unrestricted enterovirus in-fection. J Med Virol. 2004;72(3):451-61.

44. Tracy S, Chapman NM, Mahy BWJ. The Coxsackie B viruses. Berlin ; New York: Springer-Verlag; 1997. 311 p. p.

45. Takeuchi O, Akira S. Innate immunity to virus infection. Immunol Rev. 2009;227(1):75-86.

46. Abbas AK, Lichtman AH, Pillai S. Cellular and molecular immunology. 7th ed. Philadelphia: Elsevier/Saunders; 2012. x, 545 p. p.

47. Honda K, Taniguchi T. IRFs: master regulators of signalling by Toll-like re-ceptors and cytosolic pattern-recognition receptors. Nat Rev Immunol. 2006;6(9):644-58.

48. Platanias LC. Mechanisms of type-I- and type-II-interferon-mediated signal-ling. Nat Rev Immunol. 2005;5(5):375-86.

49. Acheson NH. Fundamentals of molecular virology. 2nd ed: Hoboken, NJ : John Wiley & Sons, ©2011.; 2011.

50. Wessely R, Klingel K, Knowlton KU, Kandolf R. Cardioselective infection with coxsackievirus B3 requires intact type I interferon signaling: implications for mortality and early viral replication. Circulation. 2001;103(5):756-61.

51. Wang JP, Cerny A, Asher DR, Kurt-Jones EA, Bronson RT, Finberg RW. MDA5 and MAVS mediate type I interferon responses to coxsackie B virus. J Virol. 2010;84(1):254-60.

54

52. Wang JP, Asher DR, Chan M, Kurt-Jones EA, Finberg RW. Cutting Edge: Antibody-mediated TLR7-dependent recognition of viral RNA. J Immunol. 2007;178(6):3363-7.

53. Triantafilou K, Orthopoulos G, Vakakis E, Ahmed MA, Golenbock DT, Lep-per PM, et al. Human cardiac inflammatory responses triggered by Coxsackie B viruses are mainly Toll-like receptor (TLR) 8-dependent. Cell Microbiol. 2005;7(8):1117-26.

54. Feng Q, Hato SV, Langereis MA, Zoll J, Virgen-Slane R, Peisley A, et al. MDA5 detects the double-stranded RNA replicative form in picornavirus-infected cells. Cell Rep. 2012;2(5):1187-96.

55. Triantafilou K, Triantafilou M. Coxsackievirus B4-induced cytokine produc-tion in pancreatic cells is mediated through toll-like receptor 4. J Virol. 2004;78(20):11313-20.

56. Negishi H, Osawa T, Ogami K, Ouyang X, Sakaguchi S, Koshiba R, et al. A critical link between Toll-like receptor 3 and type II interferon signaling path-ways in antiviral innate immunity. Proc Natl Acad Sci U S A. 2008;105(51):20446-51.

57. Richer MJ, Lavallee DJ, Shanina I, Horwitz MS. Toll-like receptor 3 signaling on macrophages is required for survival following coxsackievirus B4 infection. PLoS One. 2009;4(1):e4127.

58. Anagandula M, Richardson SJ, Oberste MS, Sioofy-Khojine AB, Hyoty H, Morgan NG, et al. Infection of human islets of langerhans with two strains of coxsackie B virus serotype 1: Assessment of virus replication, degree of cell death and induction of genes involved in the innate immunity pathway. J Med Virol. 2013.

59. Ylipaasto P, Smura T, Gopalacharyulu P, Paananen A, Seppanen-Laakso T, Kaijalainen S, et al. Enterovirus-induced gene expression profile is critical for human pancreatic islet destruction. Diabetologia. 2012;55(12):3273-83.

60. Hultcrantz M, Huhn MH, Wolf M, Olsson A, Jacobson S, Williams BR, et al. Interferons induce an antiviral state in human pancreatic islet cells. Virology. 2007;367(1):92-101.

61. Flodstrom-Tullberg M, Hultcrantz M, Stotland A, Maday A, Tsai D, Fine C, et al. RNase L and double-stranded RNA-dependent protein kinase exert com-plementary roles in islet cell defense during coxsackievirus infection. J Immu-nol. 2005;174(3):1171-7.

62. Barral PM, Morrison JM, Drahos J, Gupta P, Sarkar D, Fisher PB, et al. MDA-5 is cleaved in poliovirus-infected cells. J Virol. 2007;81(8):3677-84.

63. Barral PM, Sarkar D, Fisher PB, Racaniello VR. RIG-I is cleaved during pi-cornavirus infection. Virology. 2009;391(2):171-6.

64. Mukherjee A, Morosky SA, Delorme-Axford E, Dybdahl-Sissoko N, Oberste MS, Wang T, et al. The coxsackievirus B 3C protease cleaves MAVS and TRIF to attenuate host type I interferon and apoptotic signaling. PLoS Pathog. 2011;7(3):e1001311.

65. Dodd DA, Giddings TH, Jr., Kirkegaard K. Poliovirus 3A protein limits inter-leukin-6 (IL-6), IL-8, and beta interferon secretion during viral infection. J Vi-rol. 2001;75(17):8158-65.

66. Islam MSe. Islets of Langerhans. Second edition. ed. 67. Litwack Ge. The pancreatic beta cell. 68. Bosco D, Armanet M, Morel P, Niclauss N, Sgroi A, Muller YD, et al. Unique

arrangement of alpha- and beta-cells in human islets of Langerhans. Diabetes. 2010;59(5):1202-10.

55

69. Diagnosis and classification of diabetes mellitus. Diabetes Care. 2010;33 Suppl 1:S62-9.

70. Sustained effect of intensive treatment of type 1 diabetes mellitus on develop-ment and progression of diabetic nephropathy: the Epidemiology of Diabetes Interventions and Complications (EDIC) study. Jama. 2003;290(16):2159-67.

71. Vauzelle-Kervroedan F, Delcourt C, Forhan A, Jougla E, Hatton F, Papoz L. Analysis of mortality in French diabetic patients from death certificates: a comparative study. Diabetes Metab. 1999;25(5):404-11.

72. Maahs DM, Rewers M. Editorial: Mortality and renal disease in type 1 diabetes mellitus--progress made, more to be done. J Clin Endocrinol Metab. 2006;91(10):3757-9.

73. Verge CF, Gianani R, Kawasaki E, Yu L, Pietropaolo M, Jackson RA, et al. Prediction of type I diabetes in first-degree relatives using a combination of in-sulin, GAD, and ICA512bdc/IA-2 autoantibodies. Diabetes. 1996;45(7):926-33.

74. Verge CF, Gianani R, Kawasaki E, Yu L, Pietropaolo M, Chase HP, et al. Number of autoantibodies (against insulin, GAD or ICA512/IA2) rather than particular autoantibody specificities determines risk of type I diabetes. J Auto-immun. 1996;9(3):379-83.

75. Fenalti G, Law RH, Buckle AM, Langendorf C, Tuck K, Rosado CJ, et al. GABA production by glutamic acid decarboxylase is regulated by a dynamic catalytic loop. Nat Struct Mol Biol. 2007;14(4):280-6.

76. Sorenson RL, Garry DG, Brelje TC. Structural and functional considerations of GABA in islets of Langerhans. Beta-cells and nerves. Diabetes. 1991;40(11):1365-74.

77. Kash SF, Condie BG, Baekkeskov S. Glutamate decarboxylase and GABA in pancreatic islets: lessons from knock-out mice. Horm Metab Res. 1999;31(5):340-4.

78. Baekkeskov S, Aanstoot HJ, Christgau S, Reetz A, Solimena M, Cascalho M, et al. Identification of the 64K autoantigen in insulin-dependent diabetes as the GABA-synthesizing enzyme glutamic acid decarboxylase. Nature. 1990;347(6289):151-6.

79. Sabbah E, Savola K, Kulmala P, Reijonen H, Veijola R, Vahasalo P, et al. Disease-associated autoantibodies and HLA-DQB1 genotypes in children with newly diagnosed insulin-dependent diabetes mellitus (IDDM). The Childhood Diabetes in Finland Study Group. Clin Exp Immunol. 1999;116(1):78-83.

80. Lan MS, Wasserfall C, Maclaren NK, Notkins AL. IA-2, a transmembrane protein of the protein tyrosine phosphatase family, is a major autoantigen in in-sulin-dependent diabetes mellitus. Proc Natl Acad Sci U S A. 1996;93(13):6367-70.

81. Notkins AL, Lu J, Li Q, VanderVegt FP, Wasserfall C, Maclaren NK, et al. IA-2 and IA-2 beta are major autoantigens in IDDM and the precursors of the 40 kDa and 37 kDa tryptic fragments. J Autoimmun. 1996;9(5):677-82.

82. Hawa MI, Fava D, Medici F, Deng YJ, Notkins AL, De Mattia G, et al. Anti-bodies to IA-2 and GAD65 in type 1 and type 2 diabetes: isotype restriction and polyclonality. Diabetes Care. 2000;23(2):228-33.

83. Savola K, Bonifacio E, Sabbah E, Kulmala P, Vahasalo P, Karjalainen J, et al. IA-2 antibodies--a sensitive marker of IDDM with clinical onset in childhood and adolescence. Childhood Diabetes in Finland Study Group. Diabetologia. 1998;41(4):424-9.

84. Chimienti F, Favier A, Seve M. ZnT-8, a pancreatic beta-cell-specific zinc transporter. Biometals. 2005;18(4):313-7.

56

85. Chimienti F, Devergnas S, Favier A, Seve M. Identification and cloning of a beta-cell-specific zinc transporter, ZnT-8, localized into insulin secretory gran-ules. Diabetes. 2004;53(9):2330-7.

86. Salonen KM, Ryhanen S, Harkonen T, Ilonen J, Knip M. Autoantibodies against zinc transporter 8 are related to age, metabolic state and HLA DR geno-type in children with newly diagnosed type 1 diabetes. Diabetes Metab Res Rev. 2013;29(8):646-54.

87. Wilcox G. Insulin and insulin resistance. Clin Biochem Rev. 2005;26(2):19-39. 88. Van der Auwera BJ, Schuit FC, Weets I, Ivens A, Van Autreve JE, Gorus FK.

Relative and absolute HLA-DQA1-DQB1 linked risk for developing type I di-abetes before 40 years of age in the Belgian population: implications for future prevention studies. Hum Immunol. 2002;63(1):40-50.

89. Pociot F, McDermott MF. Genetics of type 1 diabetes mellitus. Genes Immun. 2002;3(5):235-49.

90. Jahromi MM, Eisenbarth GS. Genetic determinants of type 1 diabetes across populations. Ann N Y Acad Sci. 2006;1079:289-99.

91. Noble JA, Valdes AM, Cook M, Klitz W, Thomson G, Erlich HA. The role of HLA class II genes in insulin-dependent diabetes mellitus: molecular analysis of 180 Caucasian, multiplex families. Am J Hum Genet. 1996;59(5):1134-48.

92. van Belle TL, Coppieters KT, von Herrath MG. Type 1 diabetes: etiology, immunology, and therapeutic strategies. Physiol Rev. 2011;91(1):79-118.

93. Bell GI, Horita S, Karam JH. A polymorphic locus near the human insulin gene is associated with insulin-dependent diabetes mellitus. Diabetes. 1984;33(2):176-83.

94. Pugliese A, Zeller M, Fernandez A, Jr., Zalcberg LJ, Bartlett RJ, Ricordi C, et al. The insulin gene is transcribed in the human thymus and transcription levels correlated with allelic variation at the INS VNTR-IDDM2 susceptibility locus for type 1 diabetes. Nat Genet. 1997;15(3):293-7.

95. Smyth DJ, Cooper JD, Bailey R, Field S, Burren O, Smink LJ, et al. A ge-nome-wide association study of nonsynonymous SNPs identifies a type 1 dia-betes locus in the interferon-induced helicase (IFIH1) region. Nat Genet. 2006;38(6):617-9.

96. Kato H, Takeuchi O, Sato S, Yoneyama M, Yamamoto M, Matsui K, et al. Differential roles of MDA5 and RIG-I helicases in the recognition of RNA vi-ruses. Nature. 2006;441(7089):101-5.

97. Liu S, Wang H, Jin Y, Podolsky R, Reddy MV, Pedersen J, et al. IFIH1 poly-morphisms are significantly associated with type 1 diabetes and IFIH1 gene expression in peripheral blood mononuclear cells. Hum Mol Genet. 2009;18(2):358-65.

98. Shigemoto T, Kageyama M, Hirai R, Zheng J, Yoneyama M, Fujita T. Identifi-cation of loss of function mutations in human genes encoding RIG-I and MDA5: implications for resistance to type I diabetes. J Biol Chem. 2009;284(20):13348-54.

99. Karvonen M, Viik-Kajander M, Moltchanova E, Libman I, LaPorte R, Tuomilehto J. Incidence of childhood type 1 diabetes worldwide. Diabetes Mondiale (DiaMond) Project Group. Diabetes Care. 2000;23(10):1516-26.

100. Gamble DR, Taylor KW. Seasonal incidence of diabetes mellitus. Br Med J. 1969;3(5671):631-3.

101. Barnett AH, Eff C, Leslie RD, Pyke DA. Diabetes in identical twins. A study of 200 pairs. Diabetologia. 1981;20(2):87-93.

57

102. Kaprio J, Tuomilehto J, Koskenvuo M, Romanov K, Reunanen A, Eriksson J, et al. Concordance for type 1 (insulin-dependent) and type 2 (non-insulin-dependent) diabetes mellitus in a population-based cohort of twins in Finland. Diabetologia. 1992;35(11):1060-7.

103. Fourlanos S, Varney MD, Tait BD, Morahan G, Honeyman MC, Colman PG, et al. The rising incidence of type 1 diabetes is accounted for by cases with lower-risk human leukocyte antigen genotypes. Diabetes Care. 2008;31(8):1546-9.

104. Gamble DR, Kinsley ML, FitzGerald MG, Bolton R, Taylor KW. Viral anti-bodies in diabetes mellitus. Br Med J. 1969;3(5671):627-30.

105. Yoon JW, Austin M, Onodera T, Notkins AL. Isolation of a virus from the pancreas of a child with diabetic ketoacidosis. N Engl J Med. 1979;300(21):1173-9.

106. Foulis AK, Farquharson MA, Meager A. Immunoreactive alpha-interferon in insulin-secreting beta cells in type 1 diabetes mellitus. Lancet. 1987;2(8573):1423-7.

107. Lonnrot M, Salminen K, Knip M, Savola K, Kulmala P, Leinikki P, et al. En-terovirus RNA in serum is a risk factor for beta-cell autoimmunity and clinical type 1 diabetes: a prospective study. Childhood Diabetes in Finland (DiMe) Study Group. J Med Virol. 2000;61(2):214-20.

108. Hyoty H, Hiltunen M, Knip M, Laakkonen M, Vahasalo P, Karjalainen J, et al. A prospective study of the role of coxsackie B and other enterovirus infections in the pathogenesis of IDDM. Childhood Diabetes in Finland (DiMe) Study Group. Diabetes. 1995;44(6):652-7.

109. Richardson SJ, Willcox A, Bone AJ, Foulis AK, Morgan NG. The prevalence of enteroviral capsid protein vp1 immunostaining in pancreatic islets in human type 1 diabetes. Diabetologia. 2009;52(6):1143-51.

110. Aida K, Nishida Y, Tanaka S, Maruyama T, Shimada A, Awata T, et al. RIG-I- and MDA5-initiated innate immunity linked with adaptive immunity acceler-ates beta-cell death in fulminant type 1 diabetes. Diabetes. 2011;60(3):884-9.

111. Frisk G, Diderholm H. Tissue culture of isolated human pancreatic islets in-fected with different strains of coxsackievirus B4: assessment of virus replica-tion and effects on islet morphology and insulin release. Int J Exp Diabetes Res. 2000;1(3):165-75.

112. Nicoletti F, Conget I, Di Mauro M, Di Marco R, Mazzarino MC, Bendtzen K, et al. Serum concentrations of the interferon-gamma-inducible chemokine IP-10/CXCL10 are augmented in both newly diagnosed Type I diabetes mellitus patients and subjects at risk of developing the disease. Diabetologia. 2002;45(8):1107-10.

113. Horwitz MS, Ilic A, Fine C, Rodriguez E, Sarvetnick N. Presented antigen from damaged pancreatic beta cells activates autoreactive T cells in virus-mediated autoimmune diabetes. J Clin Invest. 2002;109(1):79-87.

114. Vreugdenhil GR, Geluk A, Ottenhoff TH, Melchers WJ, Roep BO, Galama JM. Molecular mimicry in diabetes mellitus: the homologous domain in cox-sackie B virus protein 2C and islet autoantigen GAD65 is highly conserved in the coxsackie B-like enteroviruses and binds to the diabetes associated HLA-DR3 molecule. Diabetologia. 1998;41(1):40-6.

115. Hamalainen S, Nurminen N, Ahlfors H, Oikarinen S, Sioofy-Khojine AB, Frisk G, et al. Coxsackievirus B1 reveals strain specific differences in plasmacytoid dendritic cell mediated immunogenicity. J Med Virol. 2014.

58

116. Hamalainen S, Nurminen N, Ahlfors H, Oikarinen S, Sioofy-Khojine AB, Frisk G, et al. Coxsackievirus B1 reveals strain specific differences in plasmacytoid dendritic cell mediated immunogenicity. J Med Virol. 2014;86(8):1412-20.

117. Sarmiento L, Mas P, Goyenechea A, Palomera R, Morier L, Capo V, et al. First epidemic of echovirus 16 meningitis in Cuba. Emerg Infect Dis. 2001;7(5):887-9.

118. Cabrera-Rode E, Sarmiento L, Molina G, Perez C, Arranz C, Galvan JA, et al. Islet cell related antibodies and type 1 diabetes associated with echovirus 30 epidemic: a case report. J Med Virol. 2005;76(3):373-7.

119. Cabrera-Rode E, Sarmiento L, Tiberti C, Molina G, Barrios J, Hernandez D, et al. Type 1 diabetes islet associated antibodies in subjects infected by echovirus 16. Diabetologia. 2003;46(10):1348-53.

120. Diaz-Horta O, Bello M, Cabrera-Rode E, Suarez J, Mas P, Garcia I, et al. Echovirus 4 and type 1 diabetes mellitus. Autoimmunity. 2001;34(4):275-81.

121. Flodstrom M, Tsai D, Fine C, Maday A, Sarvetnick N. Diabetogenic potential of human pathogens uncovered in experimentally permissive beta-cells. Diabe-tes. 2003;52(8):2025-34.

122. Nair S, Leung KC, Rawlinson WD, Naing Z, Craig ME. Enterovirus infection induces cytokine and chemokine expression in insulin-producing cells. J Med Virol. 2010;82(11):1950-7.

123. Seino S, Bell GI. Pancreatic beta cell in health and disease. Tokyo: Springer; 2008. xv, 474 p. p.

124. Marroqui L, Lopes M, dos Santos RS, Grieco FA, Roivainen M, Richardson SJ, et al. Differential cell autonomous responses determine the outcome of cox-sackievirus infections in murine pancreatic alpha and beta cells. Elife. 2015;4:e06990.

125. Latif ZA, Noel J, Alejandro R. A simple method of staining fresh and cultured islets. Transplantation. 1988;45(4):827-30.

126. Krogvold L, Edwin B, Buanes T, Ludvigsson J, Korsgren O, Hyoty H, et al. Pancreatic biopsy by minimal tail resection in live adult patients at the onset of type 1 diabetes: experiences from the DiViD study. Diabetologia. 2014;57(4):841-3.

127. Singh S, Chow VT, Phoon MC, Chan KP, Poh CL. Direct detection of entero-virus 71 (EV71) in clinical specimens from a hand, foot, and mouth disease outbreak in Singapore by reverse transcription-PCR with universal enterovirus and EV71-specific primers. J Clin Microbiol. 2002;40(8):2823-7.

128. Guney C, Ozkaya E, Yapar M, Gumus I, Kubar A, Doganci L. Laboratory diagnosis of enteroviral infections of the central nervous system by using a nested RT-polymerase chain reaction (PCR) assay. Diagn Microbiol Infect Dis. 2003;47(4):557-62.

129. Samuelson A, Forsgren M, Johansson B, Wahren B, Sallberg M. Molecular basis for serological cross-reactivity between enteroviruses. Clin Diagn Lab Immunol. 1994;1(3):336-41.

130. Samuelson A, Forsgren M, Sallberg M. Characterization of the recognition site and diagnostic potential of an enterovirus group-reactive monoclonal antibody. Clin Diagn Lab Immunol. 1995;2(3):385-6.

131. Oikarinen M, Tauriainen S, Penttila P, Keim J, Rantala I, Honkanen T, et al. Evaluation of immunohistochemistry and in situ hybridization methods for the detection of enteroviruses using infected cell culture samples. J Clin Virol. 2010;47(3):224-8.

59

132. Laiho JE, Oikarinen M, Richardson SJ, Frisk G, Nyalwidhe J, Burch TC, et al. Relative sensitivity of immunohistochemistry, multiple reaction monitoring mass spectrometry, in situ hybridization and PCR to detect Coxsackievirus B1 in A549 cells. J Clin Virol. 2016;77:21-8.

133. Oberste MS, Pallansch MA. Establishing evidence for enterovirus infection in chronic disease. Ann N Y Acad Sci. 2003;1005:23-31.

134. Thoelen I, Moes E, Lemey P, Mostmans S, Wollants E, Lindberg AM, et al. Analysis of the serotype and genotype correlation of VP1 and the 5' noncoding region in an epidemiological survey of the human enterovirus B species. J Clin Microbiol. 2004;42(3):963-71.

135. Frisk G, Fohlman J, Kobbah M, Ewald U, Tuvemo T, Diderholm H, et al. High frequency of Coxsackie-B-virus-specific IgM in children developing type I di-abetes during a period of high diabetes morbidity. J Med Virol. 1985;17(3):219-27.

136. Hyoty H, Taylor KW. The role of viruses in human diabetes. Diabetologia. 2002;45(10):1353-61.

137. Tracy S, Smithee S, Alhazmi A, Chapman N. Coxsackievirus can persist in murine pancreas by deletion of 5' terminal genomic sequences. J Med Virol. 2015;87(2):240-7.

138. Luppi P, Rudert W, Licata A, Riboni S, Betters D, Cotrufo M, et al. Expansion of specific alphabeta+ T-cell subsets in the myocardium of patients with myo-carditis and idiopathic dilated cardiomyopathy associated with Coxsackievirus B infection. Hum Immunol. 2003;64(2):194-210.

139. Li Y, Bourlet T, Andreoletti L, Mosnier JF, Peng T, Yang Y, et al. Enteroviral capsid protein VP1 is present in myocardial tissues from some patients with myocarditis or dilated cardiomyopathy. Circulation. 2000;101(3):231-4.

140. Foulis AK. The pathology of islets in diabetes. Eye (Lond). 1993;7 ( Pt 2):197-201.

141. Rodriguez-Calvo T, Suwandi JS, Amirian N, Zapardiel-Gonzalo J, Anquetil F, Sabouri S, et al. Heterogeneity and Lobularity of Pancreatic Pathology in Type 1 Diabetes during the Prediabetic Phase. J Histochem Cytochem. 2015;63(8):626-36.

142. Chehadeh W, Kerr-Conte J, Pattou F, Alm G, Lefebvre J, Wattre P, et al. Per-sistent infection of human pancreatic islets by coxsackievirus B is associated with alpha interferon synthesis in beta cells. J Virol. 2000;74(21):10153-64.

143. Hamalainen S, Nurminen N, Ahlfors H, Oikarinen S, Sioofy-Khojine AB, Frisk G, et al. Coxsackievirus B1 reveals strain specific differences in plasmacytoid dendritic cell mediated immunogenicity. J Med Virol. 2014;86(8):1412-20.

144. Ramsingh AI, Collins DN. A point mutation in the VP4 coding sequence of coxsackievirus B4 influences virulence. J Virol. 1995;69(11):7278-81.

145. Kemball CC, Alirezaei M, Whitton JL. Type B coxsackieviruses and their interactions with the innate and adaptive immune systems. Future Microbiol. 2010;5(9):1329-47.

146. Maes M, Stevens WJ, DeClerck LS, Bridts CH, Peeters D, Schotte C, et al. A significantly increased number and percentage of B cells in depressed subjects: results of flow cytometric measurements. J Affect Disord. 1992;24(3):127-34.

147. Jamali Z, Nazari M, Khoramdelazad H, Hakimizadeh E, Mahmoodi M, Kari-mabad MN, et al. Expression of CC chemokines CCL2, CCL5, and CCL11 is associated with duration of disease and complications in type-1 diabetes: a study on Iranian diabetic patients. Clin Lab. 2013;59(9-10):993-1001.

60

148. Tanaka S, Nishida Y, Aida K, Maruyama T, Shimada A, Suzuki M, et al. En-terovirus infection, CXC chemokine ligand 10 (CXCL10), and CXCR3 circuit: a mechanism of accelerated beta-cell failure in fulminant type 1 diabetes. Dia-betes. 2009;58(10):2285-91.

149. Christen U, McGavern DB, Luster AD, von Herrath MG, Oldstone MB. Among CXCR3 chemokines, IFN-gamma-inducible protein of 10 kDa (CXC chemokine ligand (CXCL) 10) but not monokine induced by IFN-gamma (CXCL9) imprints a pattern for the subsequent development of autoimmune disease. J Immunol. 2003;171(12):6838-45.

150. Christen U, Benke D, Wolfe T, Rodrigo E, Rhode A, Hughes AC, et al. Cure of prediabetic mice by viral infections involves lymphocyte recruitment along an IP-10 gradient. J Clin Invest. 2004;113(1):74-84.

151. Frigerio S, Junt T, Lu B, Gerard C, Zumsteg U, Hollander GA, et al. Beta cells are responsible for CXCR3-mediated T-cell infiltration in insulitis. Nat Med. 2002;8(12):1414-20.

152. Schulthess FT, Paroni F, Sauter NS, Shu L, Ribaux P, Haataja L, et al. CXCL10 impairs beta cell function and viability in diabetes through TLR4 sig-naling. Cell Metab. 2009;9(2):125-39.

153. Deonarain R, Cerullo D, Fuse K, Liu PP, Fish EN. Protective role for interfer-on-beta in coxsackievirus B3 infection. Circulation. 2004;110(23):3540-3.

154. Kuhl U, Pauschinger M, Schwimmbeck PL, Seeberg B, Lober C, Noutsias M, et al. Interferon-beta treatment eliminates cardiotropic viruses and improves left ventricular function in patients with myocardial persistence of viral ge-nomes and left ventricular dysfunction. Circulation. 2003;107(22):2793-8.

155. Triantafilou K, Vakakis E, Kar S, Richer E, Evans GL, Triantafilou M. Visual-isation of direct interaction of MDA5 and the dsRNA replicative intermediate form of positive strand RNA viruses. J Cell Sci. 2012;125(Pt 20):4761-9.

156. Feng Q, Hato SV, Langereis MA, Zoll J, Virgen-Slane R, Peisley A, et al. MDA5 detects the double-stranded RNA replicative form in picornavirus-infected cells. Cell Rep. 2012;2(5):1187-96.

157. Wang JP, Cerny A, Asher DR, Kurt-Jones EA, Bronson RT, Finberg RW. MDA5 and MAVS mediate type I interferon responses to coxsackie B virus. J Virol. 2010;84(1):254-60.

158. Huhn MH, McCartney SA, Lind K, Svedin E, Colonna M, Flodstrom-Tullberg M. Melanoma differentiation-associated protein-5 (MDA-5) limits early viral replication but is not essential for the induction of type 1 interferons after Cox-sackievirus infection. Virology. 2010;401(1):42-8.

159. Oikawa Y, Shimada A, Kasuga A, Morimoto J, Osaki T, Tahara H, et al. Sys-temic administration of IL-18 promotes diabetes development in young nonobese diabetic mice. J Immunol. 2003;171(11):5865-75.

160. Rhode A, Pauza ME, Barral AM, Rodrigo E, Oldstone MB, von Herrath MG, et al. Islet-specific expression of CXCL10 causes spontaneous islet infiltration and accelerates diabetes development. J Immunol. 2005;175(6):3516-24.

161. Pihoker C, Gilliam LK, Hampe CS, Lernmark A. Autoantibodies in diabetes. Diabetes. 2005;54 Suppl 2:S52-61.

162. Cabrera-Rode E, Sarmiento L, Molina G, Perez C, Arranz C, Galvan JA, et al. Islet cell related antibodies and type 1 diabetes associated with echovirus 30 epidemic: a case report. J Med Virol. 2005;76(3):373-7.

163. Sarmiento L, Medina A, Aziz K, Anagandula M, Cabrera-Rode E, Fex M, et al. Differential effects of three echovirus strains on cell lysis and insulin secretion in beta cell derived lines. J Med Virol. 2016;88(6):971-8.

61

164. Kim KS, Chapman NM, Tracy S. Replication of coxsackievirus B3 in primary cell cultures generates novel viral genome deletions. J Virol. 2008;82(4):2033-7.

165. Dotta F, Censini S, van Halteren AG, Marselli L, Masini M, Dionisi S, et al. Coxsackie B4 virus infection of beta cells and natural killer cell insulitis in re-cent-onset type 1 diabetic patients. Proc Natl Acad Sci U S A. 2007;104(12):5115-20.

166. Williams AJ, Thrower SL, Sequeiros IM, Ward A, Bickerton AS, Triay JM, et al. Pancreatic volume is reduced in adult patients with recently diagnosed type 1 diabetes. J Clin Endocrinol Metab. 2012;97(11):E2109-13.

167. Gaglia JL, Guimaraes AR, Harisinghani M, Turvey SE, Jackson R, Benoist C, et al. Noninvasive imaging of pancreatic islet inflammation in type 1A diabetes patients. J Clin Invest. 2011;121(1):442-5.

168. Ylipaasto P, Klingel K, Lindberg AM, Otonkoski T, Kandolf R, Hovi T, et al. Enterovirus infection in human pancreatic islet cells, islet tropism in vivo and receptor involvement in cultured islet beta cells. Diabetologia. 2004;47(2):225-39.

169. Skog O, Korsgren O, Frisk G. Modulation of innate immunity in human pan-creatic islets infected with enterovirus in vitro. J Med Virol. 2011;83(4):658-64.

170. Hodik M, Lukinius A, Korsgren O, Frisk G. Tropism Analysis of Two Cox-sackie B5 Strains Reveals Virus Growth in Human Primary Pancreatic Islets but not in Exocrine Cell Clusters In Vitro. Open Virol J. 2013;7:49-56.

171. Smura T, Natri O, Ylipaasto P, Hellman M, Al-Hello H, Piemonti L, et al. Enterovirus strain and type-specific differences in growth kinetics and virus-induced cell destruction in human pancreatic duct epithelial HPDE cells. Virus Res. 2015;210:188-97.

172. Harvala H, Kalimo H, Dahllund L, Santti J, Hughes P, Hyypia T, et al. Map-ping of tissue tropism determinants in coxsackievirus genomes. J Gen Virol. 2002;83(Pt 7):1697-706.

173. Mukherjee A, Morosky SA, Delorme-Axford E, Dybdahl-Sissoko N, Oberste MS, Wang T, et al. The coxsackievirus B 3C protease cleaves MAVS and TRIF to attenuate host type I interferon and apoptotic signaling. PLoS Pathog. 2011;7(3):e1001311.

174. Lamphear BJ, Yan R, Yang F, Waters D, Liebig HD, Klump H, et al. Mapping the cleavage site in protein synthesis initiation factor eIF-4 gamma of the 2A proteases from human Coxsackievirus and rhinovirus. J Biol Chem. 1993;268(26):19200-3.

175. Gallie DR. A tale of two termini: a functional interaction between the termini of an mRNA is a prerequisite for efficient translation initiation. Gene. 1998;216(1):1-11.

176. Gepts W. Pathologic anatomy of the pancreas in juvenile diabetes mellitus. Diabetes. 1965;14(10):619-33.

177. Toreson WE. Glycogen infiltration (so-called hydropic degeneration) in the pancreas in human and experimental diabetes mellitus. Am J Pathol. 1951;27(2):327-47.

178. Volk BW, Lazarus SS. Ultramicroscopy of dog islets in growth hormone dia-betes. Diabetes. 1962;11:426-35.

179. Toreson WE. Glycogen infiltration (so-called hydropic degeneration) in the pancreas in human and experimental diabetes mellitus. Am J Pathol. 1951;27(2):327-47.

62

180. Blixt M, Niklasson B, Sandler S. Characterization of beta-cell function of pan-creatic islets isolated from bank voles developing glucose intolerance/diabetes: an animal model showing features of both type 1 and type 2 diabetes mellitus, and a possible role of the Ljungan virus. Gen Comp Endocrinol. 2007;154(1-3):41-7.

181. Zini E, Osto M, Franchini M, Guscetti F, Donath MY, Perren A, et al. Hyper-glycaemia but not hyperlipidaemia causes beta cell dysfunction and beta cell loss in the domestic cat. Diabetologia. 2009;52(2):336-46.

182. Marhfour I, Lopez XM, Lefkaditis D, Salmon I, Allagnat F, Richardson SJ, et al. Expression of endoplasmic reticulum stress markers in the islets of patients with type 1 diabetes. Diabetologia. 2012;55(9):2417-20.

183. Tanaka S, Aida K, Nishida Y, Kobayashi T. Pathophysiological mechanisms involving aggressive islet cell destruction in fulminant type 1 diabetes. Endocr J. 2013;60(7):837-45.

184. Kobayashi T, Nishida Y, Tanaka S, Aida K. Pathological changes in the pan-creas of fulminant type 1 diabetes and slowly progressive insulin-dependent di-abetes mellitus (SPIDDM): innate immunity in fulminant type 1 diabetes and SPIDDM. Diabetes Metab Res Rev. 2011;27(8):965-70.

185. Sadler AJ, Williams BR. Interferon-inducible antiviral effectors. Nat Rev Im-munol. 2008;8(7):559-68.

186. Justesen J, Ferbus D, Thang MN. Elongation mechanism and substrate speci-ficity of 2',5'-oligoadenylate synthetase. Proc Natl Acad Sci U S A. 1980;77(8):4618-22.

187. Chebath J, Benech P, Revel M, Vigneron M. Constitutive expression of (2'-5') oligo A synthetase confers resistance to picornavirus infection. Nature. 1987;330(6148):587-8.

188. Flodstrom-Tullberg M, Hultcrantz M, Stotland A, Maday A, Tsai D, Fine C, et al. RNase L and double-stranded RNA-dependent protein kinase exert com-plementary roles in islet cell defense during coxsackievirus infection. J Immu-nol. 2005;174(3):1171-7.

189. Imagawa A, Hanafusa T, Miyagawa J, Matsuzawa Y. A proposal of three dis-tinct subtypes of type 1 diabetes mellitus based on clinical and pathological ev-idence. Ann Med. 2000;32(8):539-43.

190. Elshebani A, Olsson A, Westman J, Tuvemo T, Korsgren O, Frisk G. Effects on isolated human pancreatic islet cells after infection with strains of enterovi-rus isolated at clinical presentation of type 1 diabetes. Virus Res. 2007;124(1-2):193-203.

191. Sayama K, Imagawa A, Okita K, Uno S, Moriwaki M, Kozawa J, et al. Pancre-atic beta and alpha cells are both decreased in patients with fulminant type 1 diabetes: a morphometrical assessment. Diabetologia. 2005;48(8):1560-4.

192. Anagandula M, Richardson SJ, Oberste MS, Sioofy-Khojine AB, Hyoty H, Morgan NG, et al. Infection of human islets of Langerhans with two strains of Coxsackie B virus serotype 1: assessment of virus replication, degree of cell death and induction of genes involved in the innate immunity pathway. J Med Virol. 2014;86(8):1402-11.

193. Huang X, Yuang J, Goddard A, Foulis A, James RF, Lernmark A, et al. Inter-feron expression in the pancreases of patients with type I diabetes. Diabetes. 1995;44(6):658-64.

194. Moell A, Skog O, Ahlin E, Korsgren O, Frisk G. Antiviral effect of nicotina-mide on enterovirus-infected human islets in vitro: effect on virus replication and chemokine secretion. J Med Virol. 2009;81(6):1082-7.

63

195. Roep BO, Kleijwegt FS, van Halteren AG, Bonato V, Boggi U, Vendrame F, et al. Islet inflammation and CXCL10 in recent-onset type 1 diabetes. Clin Exp Immunol. 2010;159(3):338-43.

Acta Universitatis UpsaliensisDigital Comprehensive Summaries of Uppsala Dissertationsfrom the Faculty of Medicine 1223

Editor: The Dean of the Faculty of Medicine

A doctoral dissertation from the Faculty of Medicine, UppsalaUniversity, is usually a summary of a number of papers. A fewcopies of the complete dissertation are kept at major Swedishresearch libraries, while the summary alone is distributedinternationally through the series Digital ComprehensiveSummaries of Uppsala Dissertations from the Faculty ofMedicine. (Prior to January, 2005, the series was publishedunder the title “Comprehensive Summaries of UppsalaDissertations from the Faculty of Medicine”.)

Distribution: publications.uu.seurn:nbn:se:uu:diva-284370

ACTAUNIVERSITATIS

UPSALIENSISUPPSALA

2016