Phylogeny of Five Fungus-like Protoctistan Phytophthora Species, Inferred from the Internal Transcribed Spacers of Ribosomal DNA’

Steven B. Lee2 and John W. Taylor Department of Plant Biology, University of California, Berkeley

Ribosomal DNA variation was used to study evolutionary relationships among five fungal-like protoctistan Phytophthom species. On the basis of morphological and ecological characteristics, four of these species-P. palmivoru, P. megukaryu, P. capsici, and P. citrophthora-were once thought to be related. Variation within a species was extensively studied in a fifth, outgroup species-P. cinnamomi- known, on the basis of ecological, isozyme, and mitochondrial DNA studies, to be variable. Internal transcribed spacer regions (ITS I, between the 18s and 5.8s rDNAs; and ITS II, between the 5.8s and 25s rDNAs) from 27 isolates of these five species were analyzed by polymerase chain reaction amplification and direct sequencing. Intraspecific variability was undetected or low. Interspecific nucleotide difference was 0.3%-14.6%, and comparisons of variable regions permitted the evaluation of phylogenetic relationships among species. Both neighbor-joining and parsimony analysis of ITS variability support a close relationship between cacao isolates of P. cupsici and P. citrophthora and a common lineage for P. palmivora and P. mega- karya. Large distance values were estimated between P. cinnamomi and the other species. Inferred relationships based on ITS variability were compared with those based on other characters. The catalog of sequences provides the information nec- essary to design taxon-specific probes potentially useful in taxonomic, ecological, and population-level studies.

Introduction

Phytophthora contains some of the world’s most important and destructive plant pathogens, such as P. injstans, the cause of late blight on potato, and P. cinnamomi, the cause of root rot on a large number of hardwoods. The current classification system in Phytophthora relies mainly on morphology of the sporangium and gametangia, with species being separated into six morphologically defined groups (Newhook et al. 1978; Waterhouse et al. 1983; Stamps et al. 1990). Morphological plasticity and overlap of phenotype among species makes classification difficult ( Brasier 1983, 199 1; Erwin 1983; Hansen 1987; Shaw 1988) and complicates the use of morphology for estimating interspecific relatedness. Species with similar morphology but independent lineages may be grouped together, or, in other cases, inconsistent morphological characters can be used to infer relationships in more than one way. Until recently, the use of mating tests to define biological species has not been possible, because of the difficulty of germinating oospores (Shattock et al. 1986a, 1986h). As a result, several nonmor-

1. Key words: molecular evolution, rDNA, internal transcribed spacers, fungi, Phytophthoru, PCR.

2. Present address: Department of Biological Sciences, University of Northern Colorado, Greeley, Colorado 80639.

Address for correspondence and reprints: Steven B. Lee, Department of Biology, University of Northern Colorado, Greeley, Colorado 80639.

n-ro/. Biol. Ewl. 9(4):636-653. 1992. 0 1992 by The University of Chmgo. All rights reserved. 0737-403X/92/0904-0006$02.00

636

Phylogeny of Phyfophthoru, Inferred from -EDNA ITS 637

phological approaches have been used to investigate relationships in Phytophthora (Erwin 1983; Shaw 1988; Brasier 1991).

We have used ribosomal DNA internal transcribed spacer (rDNA ITS) variation to study evolutionary relationships among four Phytophthora species similar in mor- phology and associated with the black pod disease of cacao ( Theobroma cacao). Three of these species are segregates of the “P. palmivora complex” (Griffin 1977; Brasier and Griffin 1979): P. palmivora E. J. Butler, P. megakarya C. Brasier and A. Griffin, and P. capsici Leonian (Brasier and Griffin 1979). The fourth is P. citrophthora R. E. Smith and E. H. Smith, and a fifth is the outgroup species, P. cinnamomi Rand. The species are delimited by thorough studies of their cytology, morphology, and biochemistry (Sansome et al. 1975; Brasier and Griffin 1979; Kaosiri and Zentmyer 1980; Zentmyer 1980; Old et al. 1984; Hardham et al. 1986)) but their interrelationships are unknown. These fungi were chosen for the opportunity to compare nucleic acid characters with those already known and to go beyond species delimitation to phy- logenetic relationships.

Intraspecific ITS variability was examined in 17 isolates of P. cinnamomi because this species is known to be variable in other characteristics. Phytophthora cinnamomi is heterothallic with Al and A2 mating types, causes root rot on many economically important hosts, and is notorious for its devastation of Eucalyptus forests in western Australia ( Weste and Marks 1987). The predominance of the A2 type worldwide ( Arentz and Simpson 1986)) the ability of only A2 mating type isolates to self-fertilize in response to Trichoderma (Brasier 1975), and the different host ranges of Al and A2 (von Broembsen 1984; von Broembsen and Kruger 1985; Arentz and Simpson 1986; Zentmyer 1988) have led to the suggestion that Al and A2 are becoming re- productively isolated as a consequence of host specialization and geographical dispersal by man (Brasier 1978; Hansen 1987). The isozyme electrophoretic patterns of Al isolates from Papua New Guinea are highly variable, whereas those of the A2 isolates are not, consistent with their proposed reproductive isolation (Old et al. 1984). We hypothesized that ITS differences would be detected between these mating type isolates and corroborate their divergence.

Molecular approaches provide a new set of characters likely to produce greater phylogenetic accuracy than that obtainable by weighted analysis of morphological criteria (e.g., see Ho 1982; Brasier 199 1) . Isozyme and protein electrophoretic analysis have provided a bounty of information on genetic variability within and among Phy- tophthora species (Erselius and de Vallavieille 1984; Old et al. 1984; Tooley et al. 1985, 1989; Hansen et al. 1986; Bielenin et al. 1988; Nygaard et al. 1989; Spielman et al. 1990; Oudemans and Coffey 199 1 a, 199 1 b, 199 lc). Restriction-fragment-length polymorphism (RFLP) analysis of mitochondrial and nuclear DNA have been in- vestigated and also have been used to estimate intra- and interspecific relatedness in Phytophthora (Klimczak and Prell 1984; Forster et al. 1987, 1988, 1990b; Schumard- Hudspeth and Hudspeth 1990; Forster and Coffey 199 1; Mills et al. 199 1) . For the present study, we used a more precise technique, sequencing of rDNA. rDNA sequence comparisons can generate a large number of characters for phylogenetic inference and should provide a more accurate measurement of genetic distances between species.

rDNA nucleotide sequence comparisons provide a means for analyzing phylo- genetic relationships over taxonomic levels ranging from species (Jorgensen and Cluster 1988) to kingdoms (Pace et al. 1986; Gouy and Li 1989; Forster et al. 1990a; Bruns et al. 199 1; Hendriks et al. 199 1; Schlegel 199 1). rDNA consists of highly conserved regions interspersed with variable regions, making it an ideal candidate for molecular evolutionary studies (White et al. 1990). ITS regions evolve fast and may vary among

638 Lee and Taylor

species within a genus or among populations (Mandal 1984; Jorgensen and Cluster 1988; Gonzalez et al. 1990a, 1990b; Gardes et al. 199 1).

On the basis of comparative studies using well-established molecular markers, ITS regions appear to be useful for evolutionary inference. Similar tree topologies were inferred from ITS I and 28s rRNA comparisons among hominids (Gonzalez et al. 1990b). Polymerase chain-reaction amplification (PCR) and direct sequencing (Saiki et al. 1985; Mullis and Faloona 1987; White et al. 1990) made it possible to compare the ITS of many more isolates than could have been compared by the tra- ditional cloning approach.

ITS I and ITS II regions were sequenced ( 176-233 bases and 417-436 bases, respectively) from 27 isolates representing five species. ITS variability was analyzed using parsimony methods (Felsenstein 1988; Swofford 1988) and neighbor-joining (NJ ) analysis (Saitou and Nei 1987 ) to generate a phylogenetic tree among these five species. The sequence data will facilitate the design of DNA probes specific to a group of closely related species, single species, or even single strains. These probes should be useful in studies of evolutionary and population biology and agriculture.

Material and Methods Isolates and Sources

Source, species, designated isolate numbers, geographical origin, mating type, host association, and providers of Phytophthora palmivora, P. megakarya, P. capsici, P. citrophthora, and P. cinnamomi are listed in table 1.

Growth Condition

The isolates were maintained on V8-C (V8 juice filtered through cheesecloth and pH adjusted with 5 g CaC03/354 ml; Ribeiro 1978), 1.5% agar slants at 17°C and were transferred every 6 mo. Relative growth rate and colony morphology were ob- served 2-4 d after transferring one 0.5-cm cube/slant to a V8-C, 1.5% agar Petri plate maintained at 20°C. Plate cultures 2-4 d old provided sufficient amounts of mycelia (2-4-cm diameter colonies; 0.05 g dry weight) for DNA extraction.

DNA Extraction

The 2-4-cm-diameter colonies, scraped from V8-C agar, were frozen in liquid nitrogen. Frozen mycelia were either lyophilized or directly ground in liquid nitrogen by using a mortar and pestle. Lyophilized mycelia were ground to a fine powder, and DNA was extracted by the method of Lee and Taylor ( 1990).

PCR Amplification

rDNA ITS was amplified by PCR as previously described, starting with 0. l- 1 .O ng of total genomic DNA (White et al. 1990) and using an automated thermal cycler (Perkin Elmer Cetus). The nucleotide sequences of the primers are as follows: ITSl, TCCGTAGGTGAACCTGCGG; ITM, GCTGCGTTCTTCATCGATGC; ITS3, GCATCGATGAAGAACGCAGC; and ITS4, TCCTCCGCTTATTGATATGC. ITS 1 and ITS3 are 5 ‘-3’ primers. ITS2 and ITS4 are 3 ‘-5’ primers. All the primer sequences are written 5 ‘-3’. Spacer I (between the 18s and 5.8s rDNAs) is flanked by primers ITS1 and ITS2, and spacer II (between the 5.8s and 28s rDNAs) is flanked by primer pair ITS3 and ITS4, as previously described (White et al. 1990).

Thermal cycling parameters used were an initial denaturation at 96°C for 2 min, followed by 25-35 cycles consisting of denaturation at 96°C for 1 min, annealing at 55°C for 1 min, and extension at 72°C for 2 min. A final extension at 72°C for 10

Table 1

Phylogeny of Phytophthora , Inferred from rDNA ITS 639

Isolates of Ph~fophfhoru Used in Present Study

MATING HOST

SPECIES AND ISOLATE’ (origin) Type Association

P. palmivora: ~255 (Costa Rica) p55 1 (Jamaica) pll82(Florida) .._.__..__.._

P. megakarya:

A2 Al A2

p1662 (Nigeria) _. _. p1664 (Nigeria)

P. citrophthora:

Al Al

p316 (New South Wales) p3 18 (Australia) p449 (Brazil)

P. capsici: ~495 (Brazil) ._ ., ., p561 (MF4) (Brazil) ~622 (MF4) (Brazil) ~623 (MF4) (Brazil) ~3025 (Chile) __ __ .,

P. cinnamomi:

. . . A2 . .

Al A2 Al A2 . . .

al 19 (Manki, Papua New Guinea) Al al22 (Oksapmin, Papua New Guinea) Al al23 (Giluwe, Papua New Guinea) Al al25 (Giluwe, Papua New Guinea) Al a 138 (Ourimbah, New South Wales) Al

p2 100 (California) ~2121 (Madagascar) _. _. _. ~2264 (Australia) p2404(Taiwan) __ .., p2 110 (Sumatra) p2 144 (Ohio) p22 13 (New Zealand) ~2288 (California) p24 11 (California) a2423 (Ourimbah, New South Wales) ~2472 (California) ~440 (South Africa)

Al Al Al Al A2 A2 A2 A2 A2 A2 A2 A2

Theobroma cacao T. cacao Morrenia odorata

T. cacao T. cacao

Citrus sp. Citrus sp. T. cacao

Hevea brasiliensis Piper nisi-urn T. cacao T. cacao Capsicum annuum

Castanopsis sp. soil Araucaria sp. soil Nothofagus sp. soil Nothofagus sp. soil Eucalyptus sp. soil

and Pinus radiata needle bait

Camelia sp. Persea americana Yucca sp. Citrus sp. Cinnamomum sp. Azalea sp. Soil trap Pinus radiata Juglans sp. P. radiata needle bait Persea americana Persea americana

’ Isolates preceded with a “p” or “c” were provided by M. Coffey (University of California, Riverside) and isolates preceded with an “a” were provided by M. Dudzinsky (CSIRO, Canberra).

min was done at the end of the amplification. Negative controls (no DNA template) were done in every experiment to test for the presence of contamination of reagents and reaction mixtures by sample DNA or previously amplified DNA.

Length and Restriction Analysis of Amplified Spacers

DNA from amplification reactions was directly electrophoresed in composite gels of 3% Nu-Sieve agarose (FMC)/ 1% SeaKem agarose at 5 V/cm. The gels were stained for 15 min in ethidium bromide (0.5 pg/ml), were destained for 15 min in distilled water, and were photographed under ultraviolet light. For restriction analysis, - 1 pg

640 Lee and Taylor

of DNA from amplification reactions was digested according to the manufacturer’s recommendations (Bethesda Research Labs, Gaithersburg, MD). The digested DNA was electrophoresed and visualized as described above.

Sequencing Reactions

For direct DNA sequencing, single-stranded template was obtained by the asym- metric amplification method (Gyllensten and Erlich 1988) with a primer ratio of 50: 2.5 pmol and 35 cycles, as described elsewhere (White et al. 1990), or by strand separation using biotin-streptavidin columns as described by Mitchell and Merill ( 1989). For each isolate we started with > lo5 copies of template. Single-stranded template was generated in both directions either for the entire region (primers ITS 1 and 4) or for the ITS I and ITS II regions separately (primer pairs ITSl, 2; and ITS3, 4). DNA was sequenced either by using “S-dATP in the dideoxynucleotide chain- termination method ( Sanger et al. 1977 ) as modified by Tabor and Richardson ( 1987 ) or by Taq DNA polymerase in a procedure described by Brow ( 1990). For each isolate, sequencing was done in both directions, with the exception of P. citrophthora, for which sequencing was done in one direction several times. Samples were run on 42-cm, 5% acrylamide wedge gels with a constant temperature of 50°C at 1,500 V. DNA sequences were read from autoradiographs produced after 6-72 h exposure of Kodak X-OMAT film to the dried gel.

Computer-assisted Alignment and Sequence Analysis

DNA sequences were read directly into a computer using the program COM- PUGEN and an automated gel reader (Compugen, St. Louis). Sequences were aligned (Needleman and Wunsch 1970; Sobel and Martinez 1985) by using the alignment subroutines GENALIGN and GENED (Intelligenetics, Mountain View, Calif.). Gaps were introduced manually into the sequences to increase their aligned similarity. The combined ITS I and ITS II data set had 679 aligned nucleotide positions, some of which were scored as deletions or unknowns in one or more taxa. Areas in which alignments were ambiguous were ignored in phylogenetic analysis. Cladistically in- formative positions were identified by inspection and were defined as those positions at which at least two different characters were each shared by two taxa, e.g., taxa 1 and 2 share A, and taxa 3 and 4 share G ( Nei 1987 ) .

Calculation of Nucleotide Differences and Nucleotide Substitutions

Pairwise nucleotide differences were determined from interspecific alignments. All unalignable and undetermined sites were ignored. Gapped areas were ignored except in three cases (P. megasperma nucleotide 14 in fig. 2a and nucleotides 200 and 378 in fig. 2b). These sites were included in the parsimony analyses. The total number of aligned bases was 169 and 337 for ITS I and ITS II, respectively. Proportion of nucleotide differences (p) was calculated as p = rid/n,, where nd and n are the number of positions at which nucleotides differ between the two sequences and the total number of nucleotide positions compared, respectively ( Nei 1987 ) .

Distances were inferred from sequences by using the one-parameter model of Jukes and Cantor ( 1969). The number of nucleotide substitutions per site (d) was estimated from d = -(3/4)ln[ 1 - (y3)p], under the following two assumptions: ( 1) that substitution rates among the four types of nucleotides are equal and (2) that the frequencies of the bases are equal. Distances for ITS I, ITS II, and the combined data are listed in matrices in table 2). The d values were multiplied by 100 and indicate substitutions per 100 sites.

Phylogeny of Phyfophthora , Inferred from rDNA ITS 64 1

Table 2 d between Phytophthora Sequences

P. citrophthora

316 318 449 P. capsici P. palmivora P. megakarya P. cinnamomi

P. citrophthora: 316 1.3 1.3 1.1 8.7 12.4 8.5 318 2.4 1.6 1.3 8.7 12.4 8.7 449 4.2 3.1 0.3 9.0 12.0 9.4

P. capsici 4.2 3.6 3.6 8.7 12.4 9.0 P. palmivora 12.1 13.6 12.8 12.1 10.8 12.0 P. megakarya 9.5 9.5 8.8 10.2 4.9 14.6 P. cinnamomi _. 12.1 13.6 13.6 14.3 12.8 10.8

P. citrophthora: 316 318 1.6 449 2.2 2.0

P. capsici 2.0 2.0 1.3 P. palmivora 9.8 10.2 10.2 9.8 P. megakarya 11.4 11.4 11.1 11.7 8.9 P. cinnamomi 9.6 10.2 10.6 10.6 12.4 13.4

NOTE.-Values were calculated as described in Material and Methods and are expressed as d X 100. The upper matrix gives values for ITSI and ITS2 individually: values for ITS1 are below the diagonal, and those for ITS2 are above the diagonal; (the total number of aligned bases was 169 and 337 for ITS I and ITS II, respectively). The lower matrix gives values for the combined data set of ITS1 and ITS2.

Construction of Phylogenetic Trees

Topology and branch lengths of phylogenetic trees were evaluated by using the NJ method (NJTREE; Saitou and Nei 1987; Studier and Keppler 1988) provided by M. Nei (Institute of Molecular Evolutionary Genetics, Pennsylvania State University, University Park). Parsimony analysis [phylogenetic analysis using parsimony (PAUP) 3.0 ( Swofford 1988 ) , DNAPARS, DNAPENNY, and phyzogenetic inference package using parsimony (PHYLIP) 3.1 (Felsenstein 1988)] was also used to investigate the tree topology. Confidence limits for branches of the most parsimonious tree were estimated by bootstrap analysis with 1,000 interactions (DNABOOT, PHYLIP 3.1). The informative sites were also used to evaluate the tree topology among the four morphologically similar species-P. palmivora, P. megakarya, P. capsici, and P. ci- trophthora-by using the winning-sites test (Prager and Wilson 1988).

Results

Primers ITS 1 and ITS4 were used to amplify spacers I and II as a single fragment from all isolates listed in table 1. RsaI restriction digests of these fragments were used to survey intra- and interspecific variation. Within Phytophthora cinnamomi, P. pal- mivora, P, megakarya, and P. capsici, virtually no ITS variation was detected by restriction analysis. However, between different species, restriction-fragment-length variation was detected (fig. 1) . Sequence analysis generally confirmed the results from restriction analysis, except that in some cases additional variation could be detected (fig. 2).

Phylogeny of Phytophthora , Inferred from rDNA ITS 643

isolate 495 and Piper isolate 56 1 differed 1.1% and 0.5% in ITS I and ITS II, respectively [ 2/ 176 and 2/417 (no. of differences/total no. of aligned sites)]. The nucleotide positions at which intraspecific heterogeneity was detected are shown in figure 2. The identity of the Heveu and Piper isolates was not challenged by the low amount of variability, so the common sequence of the cacao isolates was used for the final in- terspecific comparisons (fig. 2 ) . The ITS sequence of isolate 3025 was not completed and is not shown.

P. citrophthora

Three P. citrophthora isolates were analyzed: one from cacao isolate 449 and two from citrus isolates 3 18 and 3 16 (table 1). Unlike the case for all other species examined, RsaI ITS restriction-fragment patterns were not identical among these isolates (fig. 1). Intraspecific length variation was detected for both ITS regions. ITS I of isolates 449, 3 16, and 3 18 were 176 bp, 186 bp, and 196 bp, respectively. ITS II of isolate 3 18 measured 427 bp. ITS II for isolates 449 and 3 16 were estimated to be 420 and 4 17 bp, on the basis of restriction analysis and partial sequence analysis.

ITS I and ITS II sequence differences between P. citrophthoru isolates were 2.4%- 4.2% and 1.3%-1.6%, respectively. Unlike P. cinnamomi, where one sequence was representative of many phenotypically diverse isolates, no sequence of P. citrophthora could be deemed representative, and all three were included in the phylogenetic analysis.

Conserved Pattern of Repeats near rDNA Termini

Conserved patterns of repeats, which are near the 3 ’ and 5 ’ ends of each ITS region and which were first recognized as common to mouse, Xenopus laevis, yeast, and rat (Goldman et al. 1983), are also present in the transcribed spacers of several Phytophthoras. We were able to detect direct four-nucleotide repeats at the 3 ’ ends of 18s and 5.8s rRNAs; however, in Phytophthora the repeats were spaced farther apart than those previously reported (e.g., CCAC.. 14N..CCAC, found at the 3 ’ terminus of 18s rDNA; see fig. 2a).

Interspecific ITS Variability

ITS I and ITS II consensus sequences of P. cinnamomi, P. palmivora, P. mega- kuryu, and P. cupsici (two cacao isolates) were aligned with sequences of three isolates of P. citrophthoru (fig. 2). To find the most likely tree topology, the data were analyzed by parsimony and distance methods. For parsimony analysis, 34 informative sites ( 12 from ITS I and 22 from ITS II) were used (fig. 2). For NJ, the distance matrices of the Jukes and Cantor ( 1969) corrected distance values (i.e., d) were used (table 2).

Phylogenetic relationships were first evaluated by parsimony analysis using one isolate of P. citrophthoru at a time (three combinations of five taxa). Evaluation of tree topology was performed with separate and combined ITS data sets. Results from all combinations of five taxa and data sets support one most parsimonious tree relating the five Phytophthora species (fig. 3).

A close relationship is indicated between cacao isolates of P. capsici and P. ci- trophthora, and a common lineage for P. palmivora and P. megakarya was also sup- ported. Confidence limits for internal branches were estimated by using 1,000 iterations in bootstrap analysis (DNABOOT, PHYLIP 3.1). Branches C and D were strongly supported, by 98% and lOO%, respectively. Winning-sites tests (Prager and Wilson 1988) using the informative sites of P. megakarya, P. palmivora, P, capsici, and any isolate of P. citrophthora also strongly support the same relationships among these four taxa, compared with the other two possible topologies (data not shown).

644 Lee and Taylor

Phytophthora

SDS&L ___I= I______ 16 s - t VW"

megakarya CGTAGGTGAACCTGCGGAAGGATCATTACCCACACCT~AA-CTTTCCACGTG~CCGTATCAACCT 39 palmivora NNNNNNNNNNN .,...................,.........-...................... AAC 39 cinnamomi . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ..A................. . . . . . ..c 40 CapSid . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A........................C 40 Citro 449 NNNNNNNNNNNNNNNNNNNNN.....................A ...................... ..C 40 citro 318 NNNNNNNNNN................................A ...................... ..C 40 citro 316 NNNNNNNNNNNN...................... . . . . . . ..A....T................... c 40

%% #% % megakarya --TTAGTTGGGGGTCTTTTTC-GGCGGCGGCTGCTGGTTTAATTACTGGCGGTT~TGCT~GA-GAG 103 palmivora --..............C....-...............C..C...G.......C..... T.....-... 103 cinnamomi AA...........C..GC.CTG...........Tc.A.G.c.~GTc.A...c........c.TG.C. 108 CapSiCi TT~~~,~~~~~~~~~~~G~~A___________~~~~________~~__~~~________________~ 61 citro 449 T*...............GG.A________--____-_______-___-_______-____________ 61 citro 318 TT......N.N...G..GC.T--------------------------...--A.TT.....A.CC.C . 80 citro 316 TT.....N.NN ,I ...... GC~T_~___~___~_____~_~~_______~~~__~.TT...______ ...

*t t *t % mcgakarya --CCCTATCA-TGGCGAGCGTTTGG6CT----TCGG----TCTGAACTAGTAGC-----TTTTTTA~ 155 palmivora --.T......-.................----....----.............. -----......... 155 cinnamomi GG........C...............TCCCTC....GGGAA....G . . . . . . . . --CTC.C....... 174 capsici --.......!-......AT......A..----....----....GG.G......-TTTT.G ....... 117 citro 449 --........-......AT......A..----....----....GG........-TTTT.G ....... 117 Citro 318 --........-......AT......A..----....----....GG........TTTTT.G....... 137 citro 316 --........-......ATNNNN..A..----....----....GG........-TTTT.G....... 127

5.8s u$_I **** 1.

megakarya CCCATTCATTATTACTGATTATACTGTGGGGACGAAAGTCTCTGCTTTT~CTAGATAGC~CTTTCA 214 palmivora . . . . . ..T....A..............A........................................ 214 cinnamomi . . . . . ..TG..A......AC...................G . . . . . . . . . . . . . . . . . . . . . . . . . . . . 233 capsid . . . . ..TCAC.AB....................................................... 176 citro449 . . . . ..T.CG.A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . N....N...NNN 176 citro 318 . . . . ..T.AC.A..............................N................NNNNNNNNN 196 citro 316 . . . . . ..TAC.A............NNN...............N................ NNNNNNNNN 186

+ + caps 495. 561 T T

FIG. 2.-Interspecific alignments of ITS I (a) and ITS II (b) of the following Phytophthoru species: P. megakarya, both identical sequences (megakarya); P. pulmivoru, three identical sequences (palmivora); P. cinnamomi, 15 identical sequences (cinnamomi); P. cupsici, identical sequences from isolates 622 and 623 (capsici) ; and P. citrophthoru, three sequences, each different, from isolates 449, 3 18, and 3 16 ( P. citro) . A dot ( - ) indicates identity with the P. megukatyu sequence. A dash (-) indicates introduced gaps. A capital “N” indicates undetermined nucleotides. An asterisk (*) above the interspecific alignments indicates infor- mative sites ( 12 from ITS I and 23 from ITS II) as defined in Materials and Methods. A pound sign (#) above the interspecific sequences indicates sites that appear informative but that were excluded because alternative alignments are possible at these positions. Underlining in the P. cinnamomi common sequence, along with a plus sign (+) below the alignment, indicates sites of ITS II heterogeneity detected between 2264 and the other P. cinnamomi isolates. (cinn 2264), and nucleotide substitutions or deletions are indicated below each plus sign. A caret sign (A) below the alignment indicates a short insertion detected at position 399 in the P. cinnamomi 2264 sequence. Underlining in the P. capsici common sequences indicates sites of ITS I and ITS II heterogeneity between the Cacao isolates (622 and 623) and the Hevea (495) and Piper (56 1) isolates of P. cupsici, and the base differences are indicated by the plus sign below the alignments (caps 495 and caps 56 1) . The two “vvvv” series above the sequence indicate short direct repeats.

NJ analyses using the combined data (table 2, lower matrix) support a tree (fig. 4) with the same topology as that seen in the parsimony and bootstrap tree (fig. 3). NJ analyses using either ITS I or ITS II separately also support the same topology, but distances between taxa for the two data sets differ (data not shown), The discrep- ancy in the distance values inferred from ITS I and ITS II may not be significant, as their confidence limits were not calculated.

Phytophthora citrophthora isolates and P. capsici have the smallest ITS I and ITS II nucleotide distance values [d = 0.3-4.1 (expressed as substitutions/ 100 sites)]. The largest distance values were observed between P. cinnamomi and P. capsici in

Phytophthora

sxze!ss

P5.8s_ l t

megakarya CAGTGTCCGTMATCAAACTT=~~~~~~~~=~~~~~~~~*~~~~~~~~~-~~~~*~~~~~~~~~~~

palmivora . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ..A............T-....G...........

cinnamomi . . . . . . . . . . . . . . . . . . . . . ..C.C........................T...~......C...

CapSki . . . . . . . . . . . . . . . . . . . . . ..C..........................--...G........... citro 449 . . . . . . . . . . . . . . . . . . . . . ..C..........................-....G........... Citro 318 NNNNNN.................C...........................-....G........... citro 316 NNNNNMVNNN.............C...........................-N...G.......~...

++ cinn 2264 AC

I 44 # ** l tt

megakarya AGGTGTCTTGCGGCTGGC---CTTCGGGTC--GGCTGTGTGAGTCCCTTG~TGTACTG~CTGTACT Palmivora .A...............T---......A..--.....;......T...................... cinnamomi . . . . . . . . . . . ..Ec..~---......BCT--......_............................. capsici .A..........~.T.TC--.........--.....C......T..T................... citro 449 .A.... . . . . ..TG.T.TC--.........-- . . . ..C......T..T................... Citro 318 .A...........T.T.TGTG.......C.GA.....C......T ...................... citro 316 .A...........G-T.TC--.........--.T...C......T......NNNN ............

++ + + ++ cinn 2264 C - G C C caps 561 GT

. * t*t t

megakarya TCTCTTTGCTCGAAAAGTRAAGC-TTGCTTGTTGTGGAGGCTGCTTGTGT~CCAGTC-~CGACTAG palmivora . . . . . . . . . ..C.....CGTG..G.....GA................C...G......T......C.. cinnamomi . . . . . . . . . . . . . . . ..CGTGA.G..._.G..............C..TA.GG......-......CG. capsici . . . . . . . . . . . . . . . ..CGTG.TG.....G..............C..C'..GG......-......CG. CitrO 449 . . . . . . . . . . . . . . . ..C.TG.TG.....G..............C..C..GG......-......CG. Citro 318 ............... ..CGTG.TG ... ..G..............C..C..GG......-......CG. citro 316 ............... ..CGTG.TG.....G ............ ..C..C..GG......-......CG.

+ cinn 2264 T

* *

“egakarya TTTGTCTGCTGTGGCG-TTAAT~AGGAGTGTTCGATTCGCGGTATGATTGGCTTCGGCTG~CAGM palmivora . . . . . . . . . . . . . . ..- . . . . . . . . . . . . . . . . . . . . . . . . . . . . ..G...................C CinnamOni . . . . . . . . . ..C....T... . . . . . . . . . . . . . . . . . . . . . . . . . ..G.................A_G capsici . . . . . . . . . ..C....T..............................G......NN..........-G Citro 449 ......... ..C....T ............................ ..G..................- G

CitrO 318 ......... ..C....T. ........................... ..G..................- G citro 316 . . . . . . . . . ..C....T..............................G..................-G

cinn 2264 T

l t l * 11 l # megakarya -GCTTATTGGGCGTTTTTCCTGCTATGGCGGTATGAAGTAGTTATGTG-GGCTTGGCT palmivora -........MTA...C.T.A...G...T.......-T.G...........C.A....-A........

cinnamomi C.........AT.,.S........G........S.G~G...........C.G..C~........E

CapSid C........TAT.C..........G.....TG...GGC.G...........C.G....T......... citro 449 C........TAT.C..........G.....TG...G~.G...........C.G....T......... citro 318 C........TAT.C..........G.....TG...GGC.G...........C.G....T......... citro 316 C........TAT.C..........G.....TG...GU:.G...........C.G....T.........

++ + +++ + + cinn 2264 CT T GCT G T

t "egakarya TTTG~TGTGC-TCGCTC-T~G~GTAGAGTGGCGACTTTGGTTGTC~GGGTCGATCCATTT-GGG palmivora . . . . . ..TG..T.T....T.................G...C..C....................-... cinnamoni . . . . ..CCG..GGT.T..T..........G......G...C..C....................-... C.SPSiCi . . . . . ..CG..T.T....T.................G...C..C....................T... Citro 449 ..... ..CG..T.T .. ..T...:.............G...C..C....................T ... citro 318 ..... ..CG..T.T....T.................G...C..C.......T............T ... CitIo 316 ..NN...CG..T.T....T ............... ..G...C..C....................T ...

28 s_ "egakarya ANNTT-GTGTGTA------------------CTTC-GGTATT palmivora .NN..-....A..------------------....-..C.........A.................. cinnamoni .AC.CT....C.-CTGC~CTTG~TG._G~...G-.......A.................N capsici .AG..T.....A-------------------....-...GC.......N......N.....NNNNNN Citro 449 .NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN~~~NNNNNNNNNN~N~N citro 318 .AN..ANN....GCGC---------------T...GA..G........N.................. Citro 316 .AN-GT......GCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN~~~~~~~~~N~

+++++ ++ ++ + cinn 2264 (TGT) ----G -C -G A

FIG. 2 (Continued)

55

55 56 54 55 55 55

117 117 118 117 118 122 117

183 185 185 194 185 189 184

250 252 253 252 253 257 252

316 317 321 319 320 324 317

381 304 388 387 388 392 384

L.ELu 411 414

436 417 431 432 426

646 Lee and Taylor

citrophthora capsici

megakarya

D

cinnamomi - palmivora FIG. 3.-Unrooted phylogenetic tree among five species of Phytophthora. The tree was inferred by

parsimony analyses of rDNA internal transcribed spacers. Confidence limits of branches C and D were estimated at 98% and lOO%, respectively, by using bootstrap analysis as described in Material and Methods. Branches A-C, have three separate values that correspond to their distances when each P. citrophthora isolate-449, 3 18, and 3 16-is considered separately (data not shown).

ITS I (d = 14.3; table 2) and between P. cinnamomi and P. megakarya in ITS II (d = 14.6; table 2).

Discussion

Our results show that ITS sequence variation was low within species of the “Phy- tophthora palmivora complex”-i.e., P. palmivora, P. megakarya, and P. capsici- but are high enough between species to support their separation (Brasier and Griffin 1979; Kaosiri and Zentmyer 1980; Panabieres et al. 1989; Forster and Coffey 199 1; Oudemans and Coffey 199 1 b, 199 1 c). ITS variability was analyzed by using parsimony, NJ, and winning-sites methods. All methods support both a close relationship between cacao isolates of P. capsici and P. citrophthora and a common lineage for P. palmivora and P. megakarya. Large distance values were estimated between P. cinnamomi and the other species. Molecular-based relationships are consistent with species affinities that can be inferred from morphology (Newhook et al. 1978; Waterhouse et al. 1983; Stamps et al. 1990).

Intraspecific ITS Variation

Differences between Al and A2 mating types of P. cinnamomi have led others to suggest that the two mating types are no longer interbreeding (Hansen 1987). If this is true, then one would expect ITS differences to correlate with mating type. However, 15 of 17 A 1 and A2 isolates from a wide host and geographical range had identical ITS. Thus ITS homogeneity cannot be used to support A l-A2 reproductive isolation. It is possible that reproductive isolation may have occurred too recently for ITS nucleotide change to accumulate-and, therefore, that the absence of ITS vari- ability does not provide strong evidence against a recent mating-type isolation.

No intraspecific ITS variation was detected among three isolates of P. palmivora or between two of P. megakarya. However, in 2 of 17 P. cinnamomi isolates (2404 and 2264) low amounts of intraspecific variation were detected. Low amounts of ITS intraspecific variability were also detected between the cacao isolates (622 and 623)

Phylogeny of Phytophthoru, Inferred from rDNA ITS 647

2.99

2.23 3.79 palmivora

I 5.11 megaka ya

I 6.23 cinnamomi

II

II

II

II

II

II

VI

Q‘ c

l-2

1-2

l-2

1-2

1

1

0

Citrus

CaCaO

ChCaO

CaCaO

CiICiIO

Wide PIG. 4.-Tree showing relative genetic distances as estimated by NJ using the Jukes and Cantor ( 1969)

corrected distance values (i.e., d) of the combined ITS data set (table 2) for Phytophthora species. Host association, sporangial apex type, and Waterhouse Group (Waterhouse et al. 1983) for each taxon are also indicated.

and the Hevea and Piper isolates (495 and 56 1, respectively) of P. capsici and among the cacao isolate (449 ) and citrus-species isolates ( 3 18 and 3 16) of P. citrophthora.

The significance of ITS variation within morphological species is difficult to eval- uate because isolates of different species with similar morphology are sometimes grouped together (Brasier and Griffin 1979; Kaosiri and Zentmyer 1980). Although parsimony analysis indicated that the closest relationship of P. cinnamomi isolate 2264 was to other isolates of P. cinnamomi (data not shown), no other species with morphology similar to that of P. cinnamomi were examined.

Molecular distances within P. citrophthora were approximately the same as dis- tances between the P. citrophthora isolate (449) and the P. capsici isolates (622 and 623). These species are morphologically similar, and their molecular similarity suggests that these P. capsici and P. citrophthora isolates are not members of distinct species. ITS variation between isolates of P. capsici and P. citrophthora is too low (below the 80% level in parsimony analysis with 1,000 bootstrapped samples) to provide significant phylogenetic resolution.

The extent of ITS intraspecific variability correlates with that of other molecular characters. The cacao isolate (449) and citrus isolate ( 3 18) of P. citrophthora can be distinguished by different ITS sequence, as well as by their mtDNA restriction-fragment

648 Lee and Taylor

patterns ( Forster et al. 19906) and isozyme differences (Oudemans and Coffey 199 1 b) . Furthermore, a cloned DNA probe from P. citrophthoru will hybridize to isolates obtained from a variety of hosts (including citrus isolate 3 18 ) but not to those obtained from cacao (including isolate 449; Goodwin et al. 1990).

ITS Evolution

Intraspecific ITS variation is also low in ( 1) other Oomycetes [ ~2.0% in Phy- tophthora parasitica and < 1 .O% in Perosclerospora sacchari (M. Wiglesworth, personal communication)], (2) other fungi [ ~2.0% within the basidiomycetes Laccuria bicolor (Gardes et al. 199 1 ), < 1 .O% in Suillus grevillei (T. Bruns, personal communication ), and < 1 .O% in Tuluromycesflavus (M. Berbee, personal communication)], ( 3) plants [ < 1 .O% rice (Takaiwa et al. 1985 )] , and (4) animals [ < 1 .O% in humans (Gonzalez et al. 1990b)]. Within each Phytophthoru species studied, the G+C content of ITS I nearly equals that of ITS II, (e.g., 46.7% for ITS I and 49.8% for ITS II of P. megukarya), as has been observed in 19 of 20 other fungi, plants, and animals (Torres et al. 1990). G-C balance has been interpreted as support for molecular coevolution of both ITSs (Gonzalez et al. 1990a; Torres et al. 1990).

Some areas of the ITSs are highly conserved among Phytophthora species (fig. 2). Interspersions of highly conserved tracts with divergent regions suggests that some areas are subject to stronger selective pressures ( Michot et al. 1983; Torres et al. 1990 ) . Sequences bordering mature rRNA termini are likely to function in pre-rRNA pro- cessing (Veldman et al. 1980, 198 1; Goldman et al. 1983). Conserved patterns of repeats, near the 3 ’ and 5 ’ ends of each ITS region and first recognized as common to mouse, Xenopus luevis, yeast, and rat (Goldman et al. 1983), are also present in the transcribed spacers of several Phytophthora species. The chance occurrence of short simple repeats might explain an entirely random distribution of repeats (Levinson and Gutman 1987) but does not seem likely to explain their apparent widespread positional conservation in animals, plants, and fungi (Goldman et al. 1983).

The ITSs and 25/288 rRNA of some eukaryotes share similar sequence char- acteristics: small simple DNA repeat motifs in variable regions (Hancock and Dover 1988; Gonzalez et al. 1990~; Tort-es et al. 1990). Simple repeat motifs are also present in Phytophthora ITS [e.g., see fig. 2a, P. megakarya,. nucleotide positions 58-7 1 (CGG, CGG, CGG, CTG, CTG)] . Simple repeats are often generated by replication slipped- strand mispairing (Levinson and Gutman 1987). However, in Drosophila melano- gaster, ITSs did not show elevated levels of simplicity and therefore are probably not due to slippage replication (Tautz et al. 1988).

Interspecific ITS Variation

Both P, citrophthora and species in the P. palmivora complex (i.e., P. palmivora, P. megakarya, and P. capsici) have papillate sporangia and amphigynous gametangia ( Newhook et al. 1978 ) , and each has been associated with black pod of cacao ( Brasier et al. 198 1; Gregory and Maddison 198 1; Kellam and Zentmyer 198 1) . Although the latter three are distinguishable by chromosome number and type, sporangial pedicel length, and colony morphology, these widely differing characters could not be used to infer evolutionary relationships among them (Brasier and Griffin 1979 ) .

The P. palmivora, P. megakarya, and P. capsici (MF4) isolates can be distin- guished by ITS restriction analysis with RsaI (fig. 1). Their ITS variability provides further support for their separation into distinct species based on other characters (Brasier and Griffin 1979; Kaosiri and Zentmyer 1980; Panabieres et al. 1989). Phy- tophthora cinnamomi isolates are also easily distinguished from the other Phytophthora

Phylogeny of Phytophthora , Inferred from rDNA ITS 649

species, by using RsaI restriction-fragment patterns. Rapid species identification of some Phytophthoru isolates may be possible by using restriction analysis of PCR- amplified ITS. This method has been used to identify isolates of Cryptoccocus species (Vilgalys and Hester 1990).

Large ITS distances between P. cinnamomi and the other species are consistent with their traditional morphological grouping (fig. 4). P. cinnamomi, a group VI species, has nonpapillate, internally proliferating sporangia. The other species in group II have papillate sporangia (Newhook et al. 1978).

ITS distances support relationships among the group II species that can also be inferred from their morphology (fig. 4). ITS distances values were lowest between pairs of P. citrophthoru and P. cupsici isolates. These isolates both have irregularly shaped, sometimes bipapillate sporangia (Newhook et al. 1978; Ribeiro 1978; Stamps et al. 1990). These isolates also differ from P. pulmivoru and P. megukaryu isolates, which have ovoid-ellipsoid, unipapillate sporangia and share a common lineage on the basis of ITS comparisons. These results support the use of the sporangial apex type in the grouping of species of Phytophthora and provide further evidence that the ITS regions are useful for investigating interspecific relatedness in this genus.

Acknowledgments

We thank Drs. Tom White and Tom Bruns for their help and advice in imple- menting PCR and direct sequencing in our laboratory. We are grateful to Drs. Tom Bruns, Joe Hancock, Tom White, and the late Allan Wilson for their comments and careful reading of the manuscript. This work was supported in part by USDA and Mycological Society of America Fellowships to S.B.L. and by NSF BSR grant 870039 1 to J.W.T. and NIH grant A128545-02 to J.W.T.

LITERATURE CITED

ARENTZ, F., and J. A. SIMPSON. 1986. The distribution of Phytophthora cinnamomi in Papua New Guinea and notes on it’s origin. Trans. Br. Mycol. Sot. 87289-295.

BIELENIN, A., S. N. JEFFERS, W. F. WILCOX, and A. L. JONES. 1988. Separation by protein electrophoresis of six species of Phytophthora associated with deciduous fruit crops. Phyto- pathology 78: 1402- 1408.

BRASIER, C. M. 1975. Stimulation of sex organ formation in Phytophthoru by antagonistic species of Trichoderma. I. The effect in vitro. N. Phytol. 74:183-194.

-. 1978. Stimulation of oospore formation in Phytophthoru by antagonistic species of Trichoderma and its ecological implications. Ann. App. Biol. 89: 135- 139.

-. 1983. Problems and prospects in Phytophthoru research. Pp. 351-364 in D. C. ERWIN, S. BARTNICKI-GARCIA, and P. H. TSAO, eds. Phytophthora: its biology, taxonomy, ecology and pathology. The American Phytopathological Society, St. Paul.

-. 199 1. Current questions in Phytophthura systematic% the role of the population ap preach. Pp. 104-128 in J. A. LUCAS, R. C. SHATTOCK, D. S. SHAW, and L. R. CQC%X, eds. Phytophthora. British Mycological Society Symposium vol. 17. Cambridge University Press, Cambridge.

BRASIER, C. M., and M. J. GRIFFIN. 1979. Taxonomy of ‘Phytophthora palmivora’ on cacao. Trans. Br. Mycol. Sot. 72: 11 I-143.

BRASIER, C. M., M. J. GRIEL~N, and A. C. MADDISON. 1981. The cocoa black pod Phytophthoras Pp. 18-30 in P. H. GREGORY and A. C. MADDISON, eds, Epidemiology of Phytophthora on cocoa in Nigeria. Final report of the International Cocoa Black Pod Research Project. Phy- topathological paper 25. Commonwealth Mycological Institute, Kew Surrey, England.

BROW, M. A. D. 1990. Sequencing with Taq DNA polymerase. Pp. 189-196 in M. A. INNIS,

650 Lee and Taylor

D. H. GELFAND, J. J. SNINSKY, and T. J. WHITE, eds. PCR protocols: a guide to methods and applications. Academic Press, San Diego.

BRUNS, T. D., T. J. WHITE, and J. W. TAYLOR. 1991. Fungal molecular systematics. Annu. Rev. Ecol. Syst. 22:525-564.

ERSELIUS, L. J., and C. DE VALLAVIEILLE. 1984. Variation in protein profiles of Phytophthoru: comparison of six species. Trans. Br. Mycol. Sot. 83:463-472.

ERWIN, D. C. 1983. Variability within and among species of Phytophthoru. Pp. 149-165 in D. C. ERWIN, S. BARTNICKI-GARCIA, and P. H. TSAO, eds. Phytophthora: its biology, tax- onomy, ecology and pathology. The American Phytopathological Society, St. Paul.

FELSENSTEIN, J. 1988. PHYLIP 3.1. Department of Genetics, University of Washington, Seattle. F~RSTER, H., and M. D. COFFEY. 1991. Approaches to the taxonomy of Phytophthora using

polymorphisms in mitochondrial and nuclear DNA. Pp. 164-183 in J. A. LUCAS, R. C. SHATTOCK, D. S. SHAW, and L. R. COOKE, eds. Phytophthora. British Mycological Society Symposium vol. 17. Cambridge University Press, Cambridge.

FORSTER, H., M. D. COFFEY, H. ELWOOD, and M. L. SOGIN. 1990~. Sequence analysis of the small subunit ribosomal RNAs of three zoosporic fungi and implications for fungal evolution. Mycologia 82:306-3 12.

F~RSTER, H., T. G. KINSCHERF, S. A. LEONG, and D. P. MAXWELL. 1987. Molecular analysis of the mitochondrial genome of Phytophthoru. CWT. Genet. 12~2 15-2 18.

. 1988. Estimation of relatedness between Phytophthoru species by analysis of mito- chondrial DNA. Mycologia 80:466-478.

FORSTER, H., P. OUDEMANS, and M. D. COFFEY. 1990b. Mitochondrial and nuclear DNA diversity within six species of Phytophthoru. Exp. Mycol. 14: 18-3 1.

GARDE& M., T. J. WHITE, J. A. FORTIN, T. D. BRUNS, and J. W. TAYLOR. 1991. Identification of indigenous and introduced symbiotic fungi in ectomycorrhizae by amplification of nuclear and mitochondrial ribosomal DNA. Can. J. Bot. 69:180-190.

GOLDMAN, W. E., G. GOLDBERG, L. H. BOWMAN, D. STEINMETZ, and D. SCHLESSINGER. 1983. Mouse rDNA: sequences and evolutionary analysis of spacer and mature RNA Regions. Mol. Cell. Biol. 3:1488-1500.

GONZALEZ, I. L., C. CHAMBERS, J. L. GORSKI, D. STAMBOLIAN, R. D. SCHMICKEL, and J. E. SYLVESTER. 1990~. Sequence and structure correlation of human ribosomal transcribed spacers. J. Mol. Biol. 212:27-35.

GONZALEZ, I. L., J. E. SYLVESTER, T. F. SMITH, D. STAMBOLIAN, and R. D. SCHMICKEL. 19906. Ribosomal RNA gene sequences and hominoid phylogeny. Mol. Biol. Evol. 7:203-2 19.

GOODWIN, P. H., B. C. KIRKPATRICK, and J. M. DUNIWAY. 1990. Identification of Phytophthoru citrophthoru with cloned DNA probes. Appl. Environ. Microbial. 56:669-674.

GOUY, M., and W. -H. LI. 1989. Molecular phylogeny of the kingdoms Animalia, Plantae, and Fungi. Mol. Biol. Evol. 6:109-122.

GREGORY, P. H., and A. C. MADDISON. 198 1. The International Black Pod Research Project. Pp. 7-l 1 in P. H. GREGORY and A. C. MADDISON, eds. Epidemiology of Phytophthora on cocoa in Nigeria. Final Report of the International Cocoa Black Pod Research Project. Phy- topathological paper 25. Commonwealth Mycological Institute, Kew Surrey, England.

GRIFFIN, M. J. 1977. Cocoa Phytophthoru Workshop, Rothamsted Experimental Station, England, 24-26 May, 1976. Pest News Summaries Cent. Overseas Pest Res. 23:107-l 10.

GYLLENSTEN, U. B., and H. A. ERLICH. 1988. Generation of single stranded DNA by the polymerase chain reaction and its application to direct sequencing of the HLA-DQ locus. Proc. Natl. Acad. Sci. USA 85:7652-7656.

HANCOCK, J. M., and G. A. DOVER. 1988. Molecular coevolution among cryptically simple expansion segments of eukaryotic 26 /28S rRNAs. Mol. Biol. Evol. 5:377-39 1.

HANSEN, E. M. 1987. Speciation in Phytophthoru: evidence from the Phycophthoru meguspermu complex. Pp. 325-337 in A. D. RAYNER, C. M. BRASIER, and D. MOORE, eds. Evolutionary biology of the Fungi. Cambridge University Press, Cambridge.

HANSEN, E. M., C. M. BRASIER, D. S. SHAW, and P. B. HAMM. 1986. The taxonomic structure

Phylogeny of Phytophthora, Inferred from rDNA ITS 65 I

of Phytophthora megasperma: evidence for emerging biological species groups. Trans. Br. Mycol. Sot. 4~557-573.

HARDHAM, A. R., E. SUZAKI, and J. L. PERKIN. 1986. Monoclonal antibodies to isolate-, species-, and genus-specific components on the surface of zoospores and cysts of the fungus Phytophthora cinnamomi. Can. J. Bot. 64:3 1 l-32 1.

HENDRIKS, L., R. DE BAERE, Y. VAN DE PEER, J. NEEFS, A. GORIS, R. DE WACHTER. 199 1. The evolutionary position of the rhodophyte Porphyra umbilicalis and the basidiomycete Leucosporidium scotii among other eukaryotes as deduced from complete sequences of small ribosomal subunit RNA. J. Mol. Evol. 32:167-177.

Ho, H. H. 1982. Affinity groups among plant pathogenic species of Phytophthora in culture. Mycopathologia 79: 14 1 - 146.

JORGENSEN, R., and P. CLUSTER. 1988. Modes and tempos in the evolution of nuclear ribosomal DNA: new characters for evolutionary studies and new markers for genetic and population studies. Ann. MO. Bot. Gard. 75:1238-1247.

JUKES, T. H., and C. R. CANTOR. 1969. Evolution of protein molecules. Pp. 21-132 in H. N. MUNRO, ed., Mammalian protein metabolism. Academic Press. New York.

KAOSIRI, T., and G. A. ZENTMYER. 1980. Protein, esterase and peroxidase patterns in the Phytophthora palmivora complex from cacao. Mycologia 72:988-1000.

KELLAM, M. K., and G. A. ZENTMYER. 198 1. Isolation of Phytophthora citrophthora from cocoa in Brazil. Phytopathology 71:230.

KLIMCZAK, L. J., and H. H. PRELL. 1984. Isolation and characterization ofmitochondrial DNA of the oomycetous fungus Phytophthora infestans. CWT. Genet. 8:323-326.

LEE, S. B., and J. W. TAYLOR. 1990. Isolation of DNA from fungal mycelia and single spores. Pp. 282-287 in M. A. INNIS, D. H. GELFAND, J. J. SNINSKY, and T. J. WHITE. PCR protocols: a guide to methods and applications. Academic Press, San Diego.

LEVINSON, G., and G. A. GUTMAN. 1987. Slipped-strand mispairing: a major mechanism for DNA sequence evolution. Mol. Biol. Evol. 4:203-22 1.

MANDAL, R. K. 1984. The organization and transcription of eukaryotic ribosomal RNA genes. Pp. 115-l 58 in Progress in nucleic acid research and molecular biology. Vol. 31. Academic Press, San Diego.

MICHOT, B., J. -P. BACHELLERIE, and F. RAYNAL. 1983. Structure of mouse rRNA precursors: complete sequence and potential folding of the spacer regions between 18s and 28s rRNA. Nucleic Acids Res. 11:3375-339 1.

MILLS, S. D., H. FORSTER, and M. D. COFFEY. 1991. Taxonomic structure of Phytophthora cryptogea and P. drechsleri based on isozyme and mitochondrial DNA analysis. Mycol. Res. 95:31-48.

MITCHELL, L. G., and C. R. MERRIL. 1989. Affinity generation of single-stranded DNA for dideoxy sequencing following the polymerase chain reaction. Anal. Biochem. 178:239-242.

MULLIS, K. B., and F. A. FALOONA. 1987. Specific synthesis of DNA in vitro via a polymerase catalysed chain reaction. Methods Enzymol. 155:335-350.

NEEDLEMAN, S. B., and C. D. WUNSCH. 1970. A general method applicable to the search for similarities in the amino acid sequence of two proteins. J. Mol. Biol. 48:443-453.

NEI, M. 1987. Molecular evolutionary genetics. Columbia University Press, New York. NEWHOOK, F. J., G. M. WATERHOUSE, and D. J. STAMPS. 1978. Tabular key to the species of

Phytophthora de Bary. Mycology paper 143. Commonwealth Mycological Institute, Kew Surrey, England.

NYGAARD, S. L., C. K. ELLIOTT, S. J. CANNON, and D. P. MAXWELL. 1989. Isozyme variability among isolates of Phytophthora megasperma. Phytopathology 79:773-780.

OLD, K. M., G. F. MORAN, and J. C. BELL. 1984. Isozyme variability among isolates of Phy- tophthora cinnamomi from Australia and Papua New Guinea. Can. J. Bot. 62:2016-2022.

OUDEMANS, P., and M. D. COFFEY. 199 la. Isozyme comparisons within and among worldwide sources of three morphologically distinct species of Phytophthora. Mycol. Res. 95: 19-30.

-. 199 1 b. Relationships between Phytophthora species: evidence from isozyme analysis. Pp. 184-203 in J. A. LUCAS, R. C. SHATTOCK, D. S. SHAW, and L. R. COOKE, eds. Phyto-

652 Lee and Taylor

phthora. British Mycological Society Symposium vol. 17. Cambridge University Press, Cam- bridge.

-. 199 1 c. A revised systematics of twelve papillate Phytophthoru species based on isozyme analysis. Mycol. Res. 95:1025-1046.

PACE, N. I., G. I. OLSEN, and C. R. WOESE. 1986. Ribosomal RNA phylogeny and the primary lines of evolutionary descent. Cell 45:325-326.

PANABIERES, F., A. MARAIS, F. TRENTIN, P. BONNET, and P. Rlccl. 1989. Repetitive DNA polymorphism analyses as a tool for identifying Phytophthoru species. Phytopathology 79: 1105-l 109.

PRAGER, E. M., and A. C. WILSON. 1988. Ancient origin of lactalbumin from lysozyme: analysis of DNA and amino acid sequences. J. Mol. Evol. 27:326-335.

RIBEIRO, 0. K. 1978. A source book of the genus Phytophthoru. J. Cramer, Vaduz, Liechtenstein. SAIKI, R. K., S. SCHARF, F. FALOONA, K. B. MULLIS, G. T. HORN, H. A. ERLICH, and N.

ARNHEIM. 1985. Enzymatic amplification of b-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230: 1350- 1354.

SAITOU, N., and M. NEI. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406-425.

SANGER, F., S. NICKLEN, and A. R. COUL~ON. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74~5463-5467.

SANSOME, E., C. M. BRASIER, and M. J. GRIFFIN. 1975. Chromosome size differences in Phy- tophthora palmivora, a pathogen of cocoa. Nature 255~704-705.

SCHLEGEL, M. 199 1. Protist evolution and phylogeny as discerned from small subunit ribosomal RNA sequence comparisons. Eur. J. Protistol. 27:207-2 19.

SCHUMARD-HUDSPETH, D. S., and M. HUDSPETH. 1990. Genomic rearrangements in Phyto- phthoru mitochondrial DNA. Curr. Genet. 17~4 13-4 15.

SHATTOCK, R. C., P. W. TOOLEY, and W. E. FRY. 1986~. Genetics of Phytophthoru infestans: characterization of single-oospore cultures from A 1 isolates induced to self by intraspecific stimulation. Phytopathology 76:407-4 10.

-. 1986b. Genetics of Phytophthora infestans: determination of recombination, segregation and selfing by isozyme analysis. Phytopathology 76:4 1 O-4 13.

SHAW, D. S. 1988. The Phytophthora species. Adv. Plant Pathol. 6:27-5 1. SOBEL, E., and H. M. MARTINEZ. 1985. A multiple sequence alignment program. Nucleic Acids

Res. 14:363-374. SPIELMAN, L. J., J. A. SWEIGARD, R. C. SHADS, and W. E. FRY. 1990. The genetics of Phytp

phthora infestam: segregation of allozyme markers in F2 and backcross progeny and the inheritance of virulence against potato resistance genes R2 and R4 in Fl progeny. Exp. Mycol. 1457-69.

STAMPS, D. J., G. M. WATERHOUSE, F. J. NEWHOOK, and G. S. HALL. 1990. Revised tabular key to the species of Phytophthoru. Mycology paper 162. CAB International, Wallingford Oxon.

STUDIER, J. A., and K. J. KEPPLER. 1988. A note on the neighbor-joining algorithm of Saitou and Nei. Mol. Biol. Evol. 5:729-73 1.

SWOFFORD, D. L. 1988. PAUP 3.0. Illinois Natural History Survey, Champaign. TABOR, S., and C. C. RICHARDSON. 1987. DNA sequence analysis with a modified bacteriophage

T7 DNA polymerase. Proc. Natl. Acad. Sci. USA 84~4767-477 1. TAKAIWA, F. K. GONO, and M. SUGIURA. 1985. Nucleotide sequence of the 17S-25s spacer

region from rice rDNA. Plant Mol. Biol. 4~355-364. TAUTZ, D., J. M. HANCOCK, D. A. WEBB, C. TAUTZ, and G. A. DOVER. 1988. Complete

sequences of the rRNA genes of Drosophila melanogaster. Mol. Biol. Evol. 5:366-376. TOOLEY, P. W., W. E. FRY, and M. J. VILLARREAL-GONZALEZ. 1985. Isozyme characterization

of sexual and asexual Phytophthoru infestans populations. J. Hered. 76:43 l-435. TOOLEY, P. W., C. D. THERRIEN, and D. L. RITCH. 1989. Mating type, race composition,

nuclear DNA content, and isozyme analysis of peruvian isolates of Phytophthoru infestans. Phytopathology 79:478-48 1.

TORRES, R. A., M. GANAL, and V. HEMLEBEN. 1990. GC balance in the internal transcribed spacers ITS 1 and ITS 2 of nuclear ribosomal RNA genes. J. Mol. Evol. 30:170-181.

Phylogeny of Phytophthora, Inferred from rDNA ITS 653

VELDMAN, G. M., R. C. BRAND, J. KLOOTWIJK, and R. J. PLANTA. 1980. Some characteristics of processing sites in ribosomal precursor RNA of yeast. Nucleic Acids Res. 8:2907-2920.

VELDMAN, G. M., J. KLOOTWIJK, H. VAN HEERIKHUIZEN, and R. J. PLANTA. 1981. The nu- cleotide sequence of the intergenic region between 5.8s and 26s rRNA genes of the yeast ribosomal RNA operon: possible implications for the interaction between 5.8s and 26s rRNA and the processing of the primary transcript. Nucleic Acids Res. 9:4847-4862.

VILGALYS, R., and M. HESTER. 1990. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J. Bacterial. 172:4238-4246.

VON BROEMBSEN, S. L. 1984. Occurrence ofPhytophthora cinnamomi on indigenous and exotic hosts in South Africa, with special reference to the south western Cape Province. Phytophy- lactica 16:221-225.

VON BROEMBSEN, S. L., and F. J. KRUGER. 1985. Phytophthoru cinnamomi associated with mortality of native vegetation in South Africa. Plant Dis. 69:7 15-7 17.

WATERHOUSE, G. M., F. J. NEWHOOK, and D. J. STAMPS. 1983. Present criteria for classification of Phytophthora. Pp. 139- 147 in D. C. ERWIN, S. BARTNICKI-GARCIA, and P. H. TSAO, eds. Phytophthora: its biology, taxonomy, ecology and pathology. The American Phytopathological Society, St. Paul.

WEST& G., and G. C. MARKS. 1987. The biology of Phytophthora cinnamomi in -Australasian forests. Annu. Rev. Phytopathol. 25:207-229.

WHITE, T. J., T. BRUNS, S. LEE, and J. TAYLOR. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp. 3 15-322 in M. A. INNIS, D. H., GELFAND, J. J. SNINSKY, and T. J. WHITE, eds. PCR protocols: a guide to methods and applications. Academic Press, San Diego.

ZENTMYER, G. A. 1980. Phytophthora cinnamomi and the diseases it causes. Am. Phytopathol. Sot. Monogr. lO:l-96.

-. 1988. Origin and distribution of four species of Phytophthora. Trans. Br. Mycol. Sot. 91:367-378.

MASATOSHI NEI, reviewing editor

Received April 24, 199 1; revision received January 14, 1992

Accepted January 14, 1992