Stacking of Host-induced Gene Silencing Mediated ...abap.co.in/sites/default/files/Paper-2_21.pdf · Siddhesh B Ghag §, Upendra K S ... was initiated from the shoot-tip cultures

Current Trends in Biotechnology and PharmacyVol. 9 (3) 212-221 July 2015, ISSN 0973-8916 (Print), 2230-7303 (Online)

212

AbstractPest and diseases are the main cause

of loss in productivity of major food security crops.The objective to increase food production andfeeding the increasing world population, at mosttimes is seriously compromised by these bioticconstraints. Introducing resistant traits in plantsagainst multiple pathogens is the need of thehour. New methods such as RNA interferencecan be used to develop efficient resistanceagainst several deleterious phytopathogens. RNAinterference has previously been applied tocontrol banana bunchy top virus (BBTV) andFusarium wilt disease in banana. In this study,we introduced both these ihpRNA (intron hairpinRNA) constructs in the single transgenic bananaplant by co-transformation so as to stackresistance to both the diseases. Thirty eighttransgenic lines were regenerated, out of which5 lines were found to be co-transformed. To testfor resistance to BBTV and Fusarium wiltdisease, the four out of these five co-transformedlines were challenged with viruliferous aphids andFusarium mass culture. In these bioassays, twotransgenic lines (VR19 and VR20) showed highlevel of resistance to BBTV and Fusarium wiltdisease. The two resistant lines expressing boththe silencing cassettes were characterized atmolecular level by PCR using respective T-DNAspecific primers. Further, based on these results,we propose that generation of transgenic plants

transformed with multiple silencing constructstargeted towards vital pathogen genes could turnout to be most appropriate approach to developeffective resistance against a broad array of viraland fungal pathogens.

Keywords : Banana; co-transformation; intron-hairpin-RNA; banana bunchy top disease;Fusarium wilt

IntroductionAgricultural production of the important food

security crops is under constant threat ofdamaging pests lowering the yield substantially(1). An estimated 50% of the crop productivity islost due to destructive insects and pests (2).Banana is the fourth most important food cropafter rice, wheat and maize and it is grown inover 120 countries. Banana is affected by severaldiseases caused by fungal, viral and bacterialpathogens that result in huge losses globally.Fungal pathogens like Fusarium oxysporum f.sp. cubense (Foc) and Mycosphaerella speciesand viral pathogens such as banana bunchy topvirus are the most destructive banana pathogensand also especially difficult to control viaconventional methods (3). Banana bunchy topdisease (BBTD) is caused by the member of theNanoviridae group, banana bunchy top virus(BBTV). Typical symptoms include ‘bunchy top’appearance of the infected plant wherein the

Stacking of Host-induced Gene Silencing MediatedResistance to Banana Bunchy Top Virus and Fusarium

Wilt disease in Transgenic Banana Plants

Siddhesh B Ghag§, Upendra K S Shekhawat§, Ashok B Hadapad and Thumballi RGanapathi*

Nuclear Agriculture & Biotechnology Division, Bhabha Atomic Research Centre,Trombay, Mumbai-400 085, India.§Contributed equally to this work

*For Correspondence - [email protected]

Gene Silencing Mediated Resistance


213

plant top becomes choked with a rosette ofnarrow, short, erect and brittle leaves (4). BBTVis transmitted by banana aphid, Pentalonianigronervosa Coquerel that can feed on all formsof vegetative planting material like suckers,corms and tissue cultured plants (5). Anotherdisease of banana that is of great concern is theFusarium wilt disease (also know as Panamawilt). Panama wilt caused enormous destructionof the banana plantations in prime bananagrowing regions of the world in the nineteenthcentury. Foc, a soil pathogen enters the healthybanana plant via roots and thrives in the cormtissue of the infected plant. The fungus growsfurther by overcoming the plant defenses andplugs the xylem vessels thereby causing wiltingof the plant. The infected plant shows progressiveyellowing of the leaves, discoloration of thepseudostem and finally wilts (6). There are fourraces identified as race1-4 that infect differentbanana genotypes of which the race 1 and race4 are the most significant on a global perspective.Race 1 of Foc infects the Silk and Pome varieties,whereas race 4 (tropical race 4, TR4) infects allthe varieties of banana including the race 1resistant Cavendish varieties which dominate theworld market. There are no known effectivecontrol methods available to manage thisdreadful disease of banana.

Both the diseases of banana viz. Fusariumwilt and BBTD can reduce the yield from abanana plantation by 50 - 100% which can havesignificant impact on the economic and socialconditions of small and marginal farmers indeveloping countries especially where this cropalso serves as a cash crop (7, 8). Developmentof resistant cultivars is an alternative strategy tomanage these diseases. Banana breeding iscomplicated due the triploid nature of the eliteedible cultivars and unavailability of naturalresistance in the available gene pool. Thus,stacking of novel genes imparting resistance tomultiple pathogens is considered as the bestapproach to effectively control several deleteriousplant diseases in a single line (9-13). In the lastcouple of years, RNA interference, mediated by

small interfering RNA (siRNA), has been adoptedas the strategy of choice for control of severalplant pathogens (14). Several proof-of-principlestudies have lately been published whichdemonstrated development of disease resistancein plants by achieving silencing of importantpathogen genes (15-18, 5). This concept knownas “host induced gene silencing” (HIGS) is basedon the recently unearthed evidence that there isa free flow exchange of RNA between the hostand the pathogen in early stages of diseasedevelopment (19). We have conducted two suchstudies wherein host coded hairpin RNAexpression cassettes were used in planta togenerate siRNAs specifically targeted towardsvital pathogen genes thereby leading to inhibitionof pathogen growth in case of simulated infection(bioassay). In one of these studies, the transgenicbanana plants expressing the intron hairpin RNA(ihpRNA) construct designed to silence the viralmaster replication initiation protein (Rep) (20)showed resistant to BBTV infection more than 6months post-inoculation with viruliferous aphid(5). In another study, transgenic banana plantsexpressing ihpRNA construct targeted againstthe velvet protein gene of Foc imparted high levelof resistance to Fusarium wilt disease of banana(18). Velvet protein (21) used in the above studywas a suitable candidate for silencing because itis considered to be one of the most importantgeneral pathogenecity proteins involved in allaspects of pathogenesis and diseasedevelopment (22).

In the present study, an attempt has beenmade to introduce T-DNAs from both theseconstructs (ihpRNA-Rep and ihpRNA-VEL) in asingle banana plant by co-transformation toimpart effective resistance against both BBTVand Fusarium wilt disease (Fig. 1). Embryogeniccell suspension cultures of banana were co-transformed with two ihpRNA constructs targetedagainst viral Rep gene and Foc velvet proteingene. Further, transgenic banana plants havingboth the T-DNAs were identified and subjectedto BBTV and Foc bioassays.

Siddhes et al


214

cultures were subcultured after every eight-daysusing fresh medium and sieved through an 85µmsieve before being used for Agrobacterium-mediated genetic transformation. ihpRNA-Rep(5) and ihpRNA-VEL (18) binary vector constructswere mobilized separately into Agrobacteriumtumefaciens EHA 105 by electroporation.

Co-transformation : A single Agrobacteriumcolony of each construct (ihpRNA-Rep andihpRNA-VEL) was inoculated in liquid mediumcontaining 0.75% w/v yeast extract and 0.8% w/v nutrient broth supplemented with 50 mgL-1

kanamycin. The bacterial cultures were incubatedovernight at 27ºC with an orbital shaking of 180rpm. Both the overnight grown Agrobacteriumcultures were resuspended in the same liquidmedium supplemented with kanamycin andgrown for further 4-5 hours under the sameconditions until an OD

600 nm of ~ 0.6-0.8 was

reached. The Agrobacterium suspension cultureswere centrifuged at 6,500 g for 10 minutes andresuspended in M2 medium (24) added with 100μM acetosyringone (ACS) as describedpreviously (25). Further, the two Agrobacteriumcultures were mixed in the ratio of 1:1 andvortexed thoroughly to obtain a uniformsuspension culture. The Agrobacteriumsuspension culture so obtained was used forcocultivation with banana ECS cultures. Thecocultivated cells were aspirated onto sterileglass filter discs and were then transferred ontosemi-solid M2 medium supplemented with 100μM ACS as described previously (23). The platescontaining the cocultivated cells were incubatedin dark for three days at 23±2 ºC followed bytransfer on same medium supplemented withcefotaxime (400 mgL-1). Further, the cells weretransferred onto embryo induction mediumsupplemented with cefotaxime (400 mgL-1) andhygromycin (5 mgL-1). The embryos growing onthe selection medium were subcultured for threerounds after every three-week. The embryoswere germinated and shoots developed weremultiplied to obtain clonal copies of the sametransgenic line followed by rooting and hardeningin green house as described previously (25).

Fig. 1. Schematic representation of generation of co-transformed multiple disease resistant transgenicbanana plants.

Materials and methodsPlant material and binary vectors : Previouslyestablished embryogenic cell suspension (ECS)cultures of banana cv. Rasthali were used fortransformation experiments. This ECS culturewas initiated from the shoot-tip cultures of cv.Rasthali as described before (23). The ECS



215

Genomic DNA PCR : The transgenic bananaplants regenerated on hygromycin selectionmedium were sorted out based on preliminaryGUS staining results and further analyzed usinggenomic DNA PCR using primers designed toamplify hygromycin phosphotransferase (hpt)gene to check for the presence of at least one T-DNA in the banana genome. Genomic DNA wasisolated from young banana leaves usingGenElute Plant Genomic DNA Miniprep Kit(Sigma, USA). Subsequently, another PCR setwas carried out using primers specific for VSP(soybean vegetative storage protein) 3’ UTR andnos (nopaline synthase) 3’ UTR (Supplementarytable S1) of the ihpRNA-Rep and ihpRNA-VELconstructs respectively to identify the co-transformed transgenic lines.

BBTV bioassay : The BBTV infected bananaplants were maintained under containedcontrolled conditions. The aphid coloniesobtained from the banana growing fields in Indiawere reared in a controlled growth chamber at25 ± 0.5oC and 12 h light/dark photoperiod.Mature aphids were fed on BBTV infectedbanana leaves for 24 hours and then transferredonto the transformed banana plants in vitro at25 ± 0.5oC and 12 h light/dark photoperiod (5).After the inoculation-access periods the in vitromaintained plants were transferred to soil andsubsequently all plants were sprayed withinsecticide confidor (Bayer Crop Science). All theinoculated banana plantlets were grown in aninsect-proof growth chamber maintained at 25 ±0.5oC and 12 h light/dark photoperiod. The BBTDsymptoms were monitored after 3 and 6 monthsfrom inoculation of viruliferous aphids.

Foc bioassay : Foc race 1 was isolated fromthe infected corm tissue of banana obtained fromthe banana growing regions of India. This Focrace 1 culture was grown in potato dextrose broth(PDB) for 5 days at 30ºC with an orbital shakingof 160-180 rpm. After 5-days, the spores wereseparated using cheesecloth and spore countwas adjusted to 8 X 105 ml-1 usinghaemocytometry. The spores were inoculated in

an autoclaved mixture of sand and maize branin the ratio of 19:1 and incubated at roomtemperature for 4-weeks (25). Green-househardened transgenic and untransformed controlbanana plants were replanted in the mixture ofsoil and mass culture (1:1). The plants werescreened for Fusarium wilt symptoms six-weekpost-infection (18). For untransformed controlsand each transgenic line, a minimum of fourreplicates were screened for Foc infection twiceand representative plants were photographed.

ResultsRegeneration of co-transformed bananaplants : Embryogenic cell suspension culturesof banana cv. Rasthali co-cultivated with 1:1mixture of two different Agrobacterium culturesharboring binary vectors ihpRNA-Rep andihpRNA-VEL developed into whitish embryos onembryo induction medium supplemented with theantibiotic hygromycin at a concentration of 5 mgL-

1 (Fig. 2a). The untransformed cells necrosed inpresence of the antibiotic. After repeatedsubculture on the embryo induction mediumadded with antibiotic, the putatively transformedembryos matured and subsequently germinatedon the medium containing 0.5 mgL-1 6-benzylaminopurine (BAP). The shoots soobtained were transferred to shoot multiplicationmedium containing BAP (2 mgL-1) to get multiplecopies of the same transformation event (Fig.2b). Each shoot was separately rooted in the 1-naphthaleneacetic acid [NAA] based medium for4-weeks (Fig. 2c) and used for inoculation-access of BBTV followed by hardening in greenhouse under controlled conditions or the rootedplants were first hardened in green house for 2months (Fig. 2d) followed by challenging themwith Foc mass culture. Totally, 38 independenttransformed lines were regenerated from the co-transformation experiment. All the transformedplants obtained looked phenotypically similar tothe untransformed control plants. The transgeniccharacter was determined by GUS assay andPCR amplification. Out of 38 putativelytransformed lines, 36 lines tested positive forGUS assay but all the 38 lines were PCR positive.

Siddhes et al


216

the transgenic banana plants. Among these, fourco-transformed lines (VR18, VR19, VR20 andVR23) were selected for bioassay studies.

Enhanced resistance to BBTV infection : Theselected co-transformed transgenic rootedbanana plants possessing both the T-DNAs wereeach inoculated with 10 viruliferous aphids after24 hours of acquisition-access to BBTV infectedbanana leaf. Untransformed control plants at thesame growth stage were also inoculated with theviruliferous aphids in similar manner. Theseplants were then maintained in containedgreenhouse conditions and observed for BBTDsymptoms. After 3 months of BBTV assay, theuntransformed control plants showed BBTVinfection symptoms such as stunted growth, shortnarrow leaves and rosette pattern whereas noneof the 4 co-transformed lines (VR18, VR19, VR20and VR23) showed BBTD symptoms 3-monthspost-inoculation (Fig. 4a). The plants weremaintained further under same conditions for 6months without any visible BBTD symptomsindicating that the ihpRNA-Rep construct waseffectively transcribed and processed intorespective siRNAs that imparted resistance toBBTV and these did not have any deleteriouseffects in the transgenic plants.

Improved resistance to Fusarium wilt disease: Four selected co-transformed lines weresubjected to Foc bioassay following theacclimatization of plants in green-house for 2-months. The untransformed control plantsshowed typical Fusarium wilt disease symptomdevelopment 4-weeks post-infection. There wasyellowing of the older leaves, cracking anddiscoloration of the pseudostem. Out of the 4 co-transformed lines, VR18 behaved similar to theuntransformed control wherein there wasyellowing of the leaves followed by discolorationand cracking of pseudostem and eventuallywilting. VR20 and VR23 showed mild to moderatesymptoms but no wilting. Line VR19 was healthyand did not show any symptoms of Fusarium wiltdisease (Fig. 4b). VR19 and VR20 co-transformed lines were further maintained for 6-

Fig. 2. Generation of transformed banana plants.Embryogenic cell suspension cultures of banana cv.Rasthali were co-cultivated with 1:1 ratio ofAgrobacterium cultures harboring ihpRNA-Rep andihpRNA-VEL binary vectors. The putative transformedcells developed into embryos on the hygromycinsupplemented medium (a). The plantlets developedby somatic embryogenesis pathway were multipliedin medium containing BAP (b). The shoots wereseparated and rooted in NAA based medium (c) andhardened in green house for 2 months (d).

A single band of 788 bp matching the codingsequence of hpt gene was amplified in all thetransgenic lines whereas it is absent in theuntransformed controls.

To select the co-transformed plants, hptPCR positive lines were tested for second roundof PCR using specific primers to detect thepresence of both the T-DNAs in the transgeniclines. The PCR products checked on 1% w/vTAE-agarose gels showed the presence of 497bp and 316 bp bands corresponding to the VSP3’ UTR and nos 3’ UTR of the ihpRNA-Rep (Fig.3a) and ihpRNA-VEL (Fig. 3b) constructsrespectively. Out of the 38 PCR positive lines, 5lines showed presence of both the T-DNAs in



217

Fig. 3. Genomic DNA PCR for determination of transgenic nature and co-transformation event. All the38 lines regenerated were tested for the co-transformation event by performing genomic DNA PCR usingprimers specific for the T-DNA regions of each ihpRNA-Rep (a) and ihpRNA-VEL (b) constructs. The PCRproducts obtained using genomic DNA from the transgenic lines (VR1-38) were checked on 1% TAE-agarosegel along with the 1 kb DNA marker (M).

Table S1. Primers used in the present study

PCR Reaction Primer Sequence (5’-3’)

Amplification ofhygromycin phosphotransferasegene Fw GTCCTGCGGGTAAATAGCTG

Rv ATTTGTGTACGCCCGACAGT

Amplification of soybean Fw GCACTATTCAAATAGGAGCATTAGCVSP 3’ UTR Rv CTTCAAGACGTGCTCAAATCACTAT

Amplification of nos 3’ UTR Fw CTACCGAGCTCGAATTTCCCCGATCGTT(reverse primer binds in vector Rv TTTCACACAGGAAACAGCTATGAbackbone)

Siddhes et al


218

months to observe for any Fusarium wilt diseasesymptoms. These plants remained free of anyFusarium wilt symptom 6-months post-infectionindicating that ihpRNA-VEL overexpressing lineseffectively controlled Foc infection (Fig. 4c).

DiscussionMultigene manipulation is an important tool

to incorporate two or more important agronomictraits in plants (26). Transgenic approaches fordeveloping crops resistant to a particularphytopathogen have already proved effective inseveral crops against wide array of pathogens(27). Today, the emphasis is towards developingtransgenic crops with multiple qualitative traitsso as to enable the plant to resist severalpathogens together. In the present study,transgenic banana plants were developed byintroducing resistance to two important diseasesof banana, BBTD and Fusarium wilt disease byco-transforming these plants with two differentihpRNA constructs to silence the expression ofBBTV Rep gene and Foc velvet protein gene.

Banana is an important food security cropand it is grown as monocultures throughout theworld (3). As a result, the plantations are alwaysunder the threat of a disease epidemic. Bananaproduction is severely affected by twoeconomically important diseases namely BBTDand Fusarium wilt disease (28). Management ofthese diseases is warranted as both thesediseases spread easily and there are no knownnatural resistant edible cultivars. Geneticresistance is the most effective and sustainablemethod for controlling these diseases. Genetictransformation of elite edible banana varietieshas gained importance due to difficult breedingstrategies and involvement of huge expenditure(29). In this study, two different T-DNAscontaining the silencing cassettes targetedagainst the BBTV Rep gene and Foc velvetprotein gene were introduced in the super-virulentstrain of Agrobacterium tumefaciens. TheAgrobacterium cultures harboring the respectiveT-DNAs were mixed in the ratio of 1:1 so as toobtain co-transformed banana plants. Banana

Fig. 4 BBTV and Foc bioassay. Four co-transformed lines were subjected to BBTV and fungalbioassay wherein all the four lines displayed BBTVresistance whereas two lines out of four showedresistance to Fusarium wilt. The representativephotograph of the two lines (VR-19 and VR20)displaying resistance to BBTV (a) and Fusarium wilt(b) are shown along with the untransformed control(UC). VR19 and VR20 transgenic banana linesshowing no wilt symptoms 6 months post infection(c).



219

being a monocot, Agrobacterium-mediatedgenetic transformation is a difficult task even incase of single gene transformations. In our co-transformation experiments, we were able toregenerate four co-transformed lines out of thetotal of 38 lines. The four co-transformed lineswere subjected to BBTV and Foc bioassay undergreenhouse conditions. The in vitro developedplantlets were inoculated with the active aphidcultures which were previously allowed to feedon the BBTV infected banana leaf. The controlplants started showing BBTV symptoms such asstunted growth, shortening and narrowing of theleaf lamina and choking of the leaves on the top4-weeks post-inoculation. Even after the periodof 3-months all the four co-transformed lines(VR18, VR19, VR20 and VR23) did not show anysymptoms of BBTV infection indicating that thetransgenic banana plants were able to suppressthe expression of BBTV Rep gene which resultedin effective resistance.

In another set of experiments, the co-transformed plants were challenged with Focmass culture and observed for diseasedevelopment. Six-week post-infection, VR19 linewas healthy and showed no signs of Focinfection. The other plants showed some level ofFoc disease symptom development. The twobest performing co-transformed lines (VR19 andVR20) obtained from the Foc bioassay studieswere maintained under greenhouse conditionsfor further 6-months and they did not show anyBBTV or Fusarium wilt symptoms. These twolines (VR19 and VR20) effectively resisted boththe pathogens because they completely silencedthe BBTV Rep gene and Foc velvet protein genesat the transcriptional level. Further, even thoughwe used two T-DNAs having same marker andreporter cassettes, we did not observe any growthdeformities in the regenerated transgenic bananaplants.

ConclusionsStacking of genes in economically important

crops vulnerable to serious pathogens offerspotential alternative for imparting resistance tomultiple pathogens in the single crop plant. In

this study, we extended gene pyramiding strategyin combination with RNA interference technologyto curb the two most important diseases ofbanana. The plant showed resistance to bothBBTV and Fusarium wilt disease whenchallenged under greenhouse conditions. Theseplants also resisted infection symptoms for 6-months after which the experiment wasterminated. Thus, in this study we revalidated thepotential of using genes and sequences fromtarget pathogens for imparting effectiveresistance against multiple pathogens in a singletransgenic line by simply co-transforming suitablebinary vectors.

AcknowledgementsAuthors would like to thank Dr. S. P. Kale,

Head, Nuclear Agriculture & BiotechnologyDivision, BARC for his support andencouragement.

Conflict of interest : The authors declare thatthey have no conflict of interest

Supplementary material : Supplementary tableS1: Primers used in the present study

References1. Strange, R.N. and Scott, P.R. (2005). Plant

Disease: A Threat to Global Food Security.Annu. Rev. Phytopathol. 43: 83-116.

2. Dhaliwal, G.S., Jindal, V. and Dhawan, A.K.(2010). Insect Pest Problems and CropLosses: Changing Trends. Indian Journalof Ecology. 37: 1-7.

3. Bakry, F., Carreel, F., Jenny, C., and Horry,J.P. (2009). Genetic improvement ofbanana. In: Jain SM, Priyadarshan PM(eds.) Breeding Plantation Tree Crops:Tropical Species. Berlin: Springer Science& Business Media. pp 3-51.

4. Dale, J. (1987). Banana bunchy top, aneconomically important tropical plant virus.Adv. Virus. Res. 33: 301-325.

5. Shekhawat, U.K.S., Ganapathi, T.R. andHadapad, A.B. (2012). Transgenic banana

Siddhes et al


220

plants expressing small interfering RNAstargeted against viral replication initiationgene display high-level resistance tobanana bunchy top virus infection. J. Gen.Virol. 93: 1804-1813.

6. Ploetz, R.C. (2006). Fusarium wilt ofbanana is caused by several pathogensreferred to as Fusarium oxysporum f.sp. cubense. Phytopathology. 96: 653.

7. Huang, Y.H., Wang, R.C., Li, C.H., Zuo,C.W., Wei, Y.R., Zhang, L. and Yi, G.J.(2012). Control of Fusarium wilt in bananawith Chinese leek. Eur. J. Plant. Pathol. 134:87-95.

8. Mukwa, L.F.T., Muengula, M., Zinga, I.,Kalonji, A., Iskra-Caruana, M.L. andBragard, C. (2014). Occurrence andDistribution of Banana bunchy top virusRelated Agro-Ecosystem in South Western,Democratic Republic of Congo. Am. J.Plant. Sci. 5: 647-658.

9. Remy, S., François, I., Cammue, B.P.A.,Swennen, R. and Sági, L. (1998). Co-transformation as a potential tool to createmultiple and durable disease resistance inbanana (Musa spp.). Acta. Hort. (ISHS).461: 361-366.

10. Halpin, C. (2005). Gene stacking intransgenic plants - the challenge for 21stcentury plant biotechnology. PlantBiotechnol. J. 3: 141-155.

11. Que, Q., Chilton, M.D., de Fontes, C.M.,He, C., Nuccio, M., Zhu, T., Wu, Y., Chen,J.S. and Shi, L. (2010). Trait stacking intransgenic crops: challenges andopportunities. GM Crops. 1: 220–229.

12. Zhu, S.X., Li, Y., Vossen, J.H., Visser, R.G.F.and Jacobsen, E. (2012). Functionalstacking of three resistance genes againstPhytophthora infestans in potato.Transgenic Res. 21: 89-99.

13. Jo, K-R., Kim, C-J., Kim, S-J., Kim, T-Y.,Bergervoet, M., Jongsma, M.A., Visser,

R.G.F., Jacobsen, E. and Vossen, J.H.(2014). Development of late blight resistantpotatoes by cisgene stacking. BMCBiotechnol. 14: 50.

14. Duan, C-G., Wang, C-H. and Guo, H-S.(2012). Application of RNA silencing to plantdisease resistance. Silence. 3: 5doi:10.1186/1758-907X-3-5.

15. Huang, G.Z., Allen, R., Davis, E.L., Baum,T.J. and Hussey, R.S. (2006). Engineeringbroad root-knot resistance in transgenicplants by RNAi silencing of a conserved andessential root-knot nematode parasitismgene. Proc. Natl. Acad. Sci. USA. 103:14302-14306.

16. Mao, Y.B., Cai, W.J., Wang, J.W., Hong,G.J., Tao, X.Y., Wang, L.J., Huang, Y.P. andChen, X.Y. (2007). Silencing a cottonbollworm P450 monooxygenase gene byplant-mediated RNAi impairs larvaltolerance of gossypol. Nat. Biotechnol. 25:1307-1313.

17. Panwar, V., McCallum, B. and Bakkeren,G. (2013). Host-induced gene silencing ofwheat leaf rust fungus Puccinia triticinapathogenicity genes mediated by the Barleystripe mosaic virus. Plant. Mol. Biol. 81:595-608.

18. Ghag, S.B., Shekhawat, U.K.S. andGanapathi, T.R. (2014). Host induced post-transcriptional hairpin RNA-mediated genesilencing of vital fungal genes confersefficient resistance against Fusarium wilt inbanana. Plant Biotechnol. J. 12: 541-553.

19. Knip, M., Constantin, M.E. and Thordal-Christensen, H. (2014). Trans-kingdomCross-Talk: Small RNAs on the Move. PLoSGenet. 10: e1004602.

20. Beetham, P.R., Hafner, G.J., Harding, R.M.,and Dale, J.L. (1997). Two mRNAs aretranscribed from banana bunchy top virusDNA-1. J. Gen. Virol. 78: 229-236.



221

21. Bayram, O., and Braus, G.H. (2012).Coordination of secondary metabolism anddevelopment in fungi the velvet family ofregulatory proteins. FEMS Microbiol. Rev.36: 1-24.

22. Ma, L.J., Geiser, D.M., Proctor, R.H.,Rooney, A.P., O’Donnell, K., Trail, F.,Gardiner, D.M., Manners, J.M. and Kazan,K. (2013). Fusarium pathogenomics. Annu.Rev. Microbiol. 67: 399-416.

23. Ganapathi, T.R., Higgs, N.S., Balint-Kurti,P.J., Arntzen, C.J., May, G.D. and Van Eck,J.M. (2001). Agrobacterium-mediatedtransformation of embryogenic cellsuspensions of the banana cultivar Rasthali(AAB). Plant Cell Rep. 20: 157-162.

24. Cote, F.X., Domergue, R., Monmarson, S.,Schwendiman, J., Teisson, C. and Escalant,J.V. (1996). Embryogenic cell suspensionsfrom the male flower of Musa AAA cv. GrandNain. Physiol. Plant. 97: 285-290.

25. Ghag, S.B., Shekhawat, U.K.S. andGanapathi, T.R. (2012). Petunia floral

defensins with unique prodomains as novelcandidates for development of Fusariumwilt resistance in transgenic banana plants.PLoS ONE. 7: e39557.

26. Naqvi, S., Farre, G., Sanahuja, G., Capell,T., Zhu, C. and Christou, P. (2009). Whenmore is better: multigene engineering inplants. Trends Plant Sci. 15: 48-56.

27. Collinge, D.B., Jørgensen, H.J., Lund, O.S.and Lyngkjaer, M.F. (2010). Engineeringpathogen resistance in crop plants: currenttrends and future prospects. Annu. Rev.Phytopathol. 48: 269-291.

28. Ploetz, R.C. (2004). Diseases and pests: Areview of their importance andmanagement. Infomusa. 13: 11-16.

29. Heslop-Harrison, J.S. and Schwarzacher,T. (2007). Domestication, genomics and thefuture for banana. Ann. Bot. 100: 1073-1084.

Siddhes et al

Documents

Stacking of Host-induced Gene Silencing Mediated ...abap.co.in/sites/default/files/Paper-2_21.pdf · Siddhesh B Ghag §, Upendra K S ... was initiated from the shoot-tip cultures