Upload
others
View
0
Download
0
Embed Size (px)
Citation preview
SLIT/ROBO SIGNALING IN MONOCYTE CHEMOTAXIS AND FUNCTION: A ROLE IN VASCULAR INFLAMMATION
by
Ilya M. Mukovozov
A thesis submitted in conformity with the requirements for the degree of Master of Medical Science
Institute of Medical Science
University of Toronto
© Copyright by Ilya M. Mukovozov. 2010.
ii
Slit/Robo Signaling in Monocyte Chemotaxis and Function: A Role in Vascular Inflammation.
Ilya M. Mukovozov
Master of Medical Science (MSc)
Institute of Medical Science
University of Toronto
2010
ABSTRACT
Vascular inflammation and associated leukocyte influx is a hallmark in the pathogenesis of
atherosclerosis. In both animal models and human subjects, inhibiting monocyte
recruitment is beneficial in preventing atherosclerosis and its clinical manifestations. The
trafficking signals that recruit cells to areas of inflammation are provided by small secreted
proteins called chemokines. Chemokines play a major role in the pathogenesis of
inflammation, and redundancy among the chemokine signaling pathways means that
blocking one pathway could result in another assuming its function. Therefore, we aim to
block a cell’s response to a range of chemokine-induced directional migration signals. Slit2
treatment inhibits monocyte migration in vitro using transwell migration assays, and in vivo,
using a murine peritonitis model of inflammatory cell influx. This inhibition is shown to be
dose- and time- dependent. Furthermore, Slit2 inhibits monocyte adhesion to activated
endothelial cell monolayers. These data may suggest a therapeutic role for Slit2 in
atherosclerosis.
iii
ACKNOWLEDGEMENTS
I am most grateful to my supervisor and mentor Dr. Lisa Robinson for her
constant encouragement and guidance through these past years. Lisa’s
extraordinary passion for science, her positive energy and commitment to motivate
young minds through the Kids’ Science program, have been a constant source of
inspiration. Her patience and understanding have made my transition and
subsequent experience in the lab very enjoyable. I would also like to thank the
members of my program advisory committee, Dr. Sergio Grinstein and Dr. Thomas
Waddell for their encouragement, advice, and constructive criticism. I am especially
lucky to have worked with the incredible individuals that make up the Robinson lab,
and am thankful for their continued support. In particular, I am grateful to Dr. Yi Wei
Huang and Guang Ying Liu for their patience with me when I started working in the
lab. I would also like to thank Sajeda Patel and Dr. Swasti Chaturvedi whose
suggestions, feedback and advice made my experience all the more rewarding. I
would also like to thank all the members of Dr. Grinstein’s lab and Dr. Brumell's lab,
for their technical help, constructive criticism and friendship. I would also like to
acknowledge the friendly and welcoming environment on the 4th floor, especially
Shahab Shahnazari and the rest of the bear pack, which brought joy and laughter to
my day-to-day experiences. I would also like to thank Thomas Sabljic, Danielle
Baribeau and Stephanie Byun for their support and motivation. Finally, I would like
to thank my parents, my sister Irina and Buddy, for their love, dedication and
support throughout my life.
iv
DATA ATTRIBUTION
The data presented here was performed in collaboration with a number of
individuals. The purification of Slit2 was performed by Dr. Durocher. Dr. Huang and
Sajeda Patel were responsible for performing the experiments presented in Fig. 3.3.
In addition, Guang Ying Liu, Shirin Chahtalkhi and I performed the immunoblotting
experiments presented in figure 3.4, while I performed the subsequent analysis. Min
Rui-Crow performed the experiments presented in Fig. 3.10. Finally, the data
presented in Appendix 1 represents a study that was initiated by Soumitra Tole and
completed by me. We contributed equally to this work.
v
TABLE OF CONTENTS
LIST OF FIGURES vii LIST OF ABBREVIATIONS viii CHAPTER 1: INTRODUCTION
1.1 Inflammation 1 1.1.1 Leukocyte Trafficking and the Adhesion Cascade 1 1.1.2 Chemoattractants 4
1.2 The Monocyte 7 1.2.1 Chemotaxis 9 1.2.2 Adhesion 15 1.2.3 Phagocytosis 18 1.2.4 Monocytes and Vascular Inflammation 19
1.3 Slit2: A Guidance Cue for Cell Migration 21 1.3.1 Expression 24 1.3.2 Slit and Robo Structure 24 1.3.3 Slit2/Robo-1 Intracellular Signal Transduction 27 1.3.4 Slit/Robo in Leukocyte Trafficking 28
1.4 RHO GTPases: Rac and Cdc42 29 1.4.1 Structure and Regulation 30 1.4.2 Role of Rho GTPases in the regulation of the actin cytoskeleton 32
1.5 Rationale, Hypothesis & Objectives 33 1.5.1 Rationale 33 1.5.2 Hypothesis 35 1.5.3 Objectives 35
CHAPTER 2: MATERIALS & METHODS
2.1 Reagents and Antibodies 39 2.2 Isolation of Human Monocytes 39 2.3 Cell Culture 39 2.4 Slit2 Expression and Purification 40 2.5 Immunofluorescence 41 2.6 Transwell Migration Assay 41 2.7 Immunoblotting 42 2.8 Cdc42 & Rac2 Activation Assays 43 2.9 Adhesion 44 2.10 Murine Peritonitis 45 2.11 Phagocytosis 46 2.12 Statistical Analysis 46 CHAPTER 3: RESULTS
3.1 Monocytes express the Slit2 receptor, Robo-1. 48 3.2 Slit2 inhibits chemotaxis of human monocytic THP-1 cells. 48 3.3 Slit2 treatment inhibits activation of Rac2 and Cdc42. 49 3.4 Slit2 inhibits Akt and Erk, but not p38 MAPK pathways. 51
vi
3.5 Slit2 inhibits adhesion of monocytic THP-1 cells to activated human umbilical vein endothelial cell and human arterial endothelial cell monolayers.
52
3.6 Slit2 inhibits monocyte recruitment in vivo. 53 3.7 Slit2 does not alter monocyte phagocytosis. 55 CHAPTER 4: DISCUSSION & CONCLUSIONS
78
REFERENCES
89
APPENDIX1: The Axonal Repellent, Slit2, Inhibits Directional Migration of Circulating Neutrophils
A1.1 Abstract 123 A1.2 Introduction 124 A1.3 Materials and Methods 129 A1.4 Results 142 A1.5 Discussion 148 A1.6 Acknowledgments 155 A1.7 Authorship 156 A1.8 References 157 A1.9 Figure Legends 166
vii
LIST OF FIGURES Page
Figure 1.1 Leukocyte Adhesion Cascade. 2
Figure 1.2 Intracellular signal transduction upon chemokine GPCR activation. 13
Figure 1.3 Rho GTPases in the polarized monocyte. 16
Figure 1.4 Primary Structure of Mammalian Slit2 and Robo-1 Proteins. 25
Figure 3.1 Robo-1 is expressed by monocytes. 52
Figure 3.2 Slit2 inhibits monocyte chemotaxis. 54
Figure 3.3 Slit2 inhibits activation of Rho GTPases (Cdc42 and Rac2). 56
Figure 3.4 Slit2 inhibits Akt and Erk but not p38 MAPKs. 59
Figure 3.5 Slit2 inhibits adhesion of monocytic THP-1 cells to human umbilical vein endothelial cells.
62
Figure 3.6 Slit2 inhibits adhesion of monocytic THP-1 cells to human arterial endothelial cells.
64
Figure 3.7 Slit2 inhibits monocyte recruitment in vivo. 66
Figure 3.8 Slit2 dose-dependently inhibits monocyte recruitment in vivo. 68
Figure 3.9 Slit2 inhibits monocyte recruitment in vivo: time-course. 70
Figure 3.10 Slit2 does not affect RAW 264.7 macrophage phagocytosis. 72
viii
LIST OF ABBREVIATIONS AKT Protein Kinase B CCL5 RANTES CC-chemokine Ligand 5 CNS Central Nervous System CR1 Complement Receptor 1 CXCL4 CXC Chemokine Ligand 4 CXCR4 CXC chemokine Receptor 4 DAG Diacylglycerol DAPI 4’,6-diamidino-2-phenylindole DCs Dentritic Cells DH Dbl homology domain ECM Extracellular Matrix EGF Epidermal Growth Factor ERK Extracellular-signal Regulated Kinase Ena Enabled EPAC Exchange Factor Directly Activated by Cyclic AMP fMLP N-formyl-methionyl-leucyl-phenylalanine FKN Fractalkine GAP GTPase Activating Protein GDNF Glial Cell Line-derived Neurotrophic Factor GEF Guanine Nucleotide Exchange Factor GPCR G-Protein-Coupled Receptor GTPase Guanosine Triphosphatase HAEC Human Arterial Endothelial Cells HRP Horseradish Peroxidase HUVEC Human Umbilical Vein Endothelial Cells ICAM-1 Intercellular Adhesion Molecule 1 Ig Immunoglobulin IP3 Inositol (1,4,5)-triphosphate ITAM Immunoreceptor Tyrosine Activation Motif LFA-1 Lymphocyte Function Associated Antigen 1 LRR Leucine-Rich Repeat Mac-1 Macrophage Receptor 1, αMβ2-integrin MAPK Mitogen Activated Protein Kinase MCP-1 Monocyte Chemotactic Protein 1 Mena Mammalian Enabled MLK Myosin Light-chain Kinase OxLDL Oxidized Low Density Lipoprotein PAK1 P21-Activated Kinase PBD P21-Binding Domain PBS Phosphate Buffered Saline PDGF Platelet-Derived Growth Factor PFA Paraformaldehyde PH Pleckstrin Homology PI3K Phosphoinositide 3-kinase
ix
PI(4,5)P2 Phosphatidylinositol (4,5)-bisphosphate PI(3,4,5)P3 Phosphatidylinositol (3,4,5)-trisphosphate PLC Phospholipase C PKC Protein Kinase C PKC-ζ Protein Kinase C-ζ PSGL1 P-selectin Glycoprotein Ligand 1 SDF-1 Stromal Cell-derived Factor-1 SPA1 Signal-Induced Proliferation Associated Antigen 1 VCAM-1 Vascular Cell Adhesion Molecule VEGF Vascular Endothelial Growth Factor VLA-4 Very Late Antigen 4 VVO Vesiculo-Vacuolar organelles THP-1 Human Acute Monocytic Leukemia Cell Line TNF-α Tumor Necrosis Factor α
1
CHAPTER 1
INTRODUCTION
1.1 INFLAMMATION
1.1.1 Leukocyte Trafficking and the Adhesion Cascade
An essential function of the inflammatory response is to selectively recruit the
appropriate subsets of leukocytes to specific sites of inflammation. Leukocytes are
recruited to sites of inflammation in a series of coordinated interactions with
endothelial cells lining the vessel wall. The classical leukocyte adhesion cascade
involves three main steps: leukocyte rolling, activation and arrest, and
transmigration (Fig. 1). In the first step, circulating leukocytes are captured by
selectin-mediated rolling. Rolling is mediated by L-selectin expressed on most
leukocytes, as well as P-selectin and E-selectin, which are expressed by endothelial
cells (Kansas, G., 1996). All of the selectins interact with P-selectin glycoprotein
ligand 1 (PSGL1), although other glycoprotein ligands exist (McEver et al., 1997).
The binding of leukocyte L-selectin to PSGL1 can facilitate secondary leukocyte
capture by adherent leukocytes (Eriksson et al., 2001). The interactions of selectins
with their ligands allows leukocytes to adhere to inflamed endothelium under flow
(Alon et al., 1995). In fact, shear stress is required to support L-selectin and P-
selectin adhesion, as the rolling cells detach if flow is stopped (Finger et al., 1996;
Lawrence et al., 1997). This selectin-mediated slow rolling allows the leukocyte to
sample the repertoire of chemokines and other activation signals presented on the
luminal surface of endothelial cells.
2
Figure 1.1 Leukocyte Adhesion Cascade.
Leukocytes are recruited to sites of inflammation in a series of coordinated
interactions with endothelial cells (ECs) lining the vessel wall. The classical
leukocyte adhesion cascade involves three main steps: leukocyte rolling, activation
and arrest, and transmigration. ECM Extracellular Matrix.
3
In addition to selectins, various integrins participate in rolling. Monocytes can
roll on immobilized vascular cell-adhesion molecule 1 (VCAM-1) by engaging
integrin receptor very late antigen 4 (VLA-4; α4β1-integrin). Members of the β2-
integrins can also support rolling. Resting mouse neutrophils roll on surfaces coated
with E-selectin ligand and intercellular adhesion molecule 1 (ICAM-1). Ligation of E-
selectin induces a conformational change in lymphocyte function-associate antigen
1 (LFA-1; αLβ2-integrin) which allows it to bind to its ligand ICAM-1 (Salas et al.,
2004). In addition, it has recently been demonstrated that the mechanochemical
design of LFA-1 allows shear stress to induce and maintain a state of high ligand-
binding affinity (Astrof et al., 2006). Rolling in vivo was shown to require E-selectin
(Kunkel et al., 1996) and engagement of β2-integrins (Jung et al., 1998), LFA-1 and
macrophage receptor 1 (MAC1; αMβ2-integrin) (Dunne et al., 2002).
Subsequently, leukocytes undergo integrin-dependent arrest. This is
mediated by the binding of leukocyte integrins to immunoglobulin superfamily
members ICAM-1 and VCAM-1 on endothelial cells and is rapidly triggered by the
binding of chemokines and other chemoattractants (Campbell et al., 1996;
Campbell et al., 1998). These chemokines are secreted by activated endothelial
cells, although platelets can also deposit chemokines, such as CC-chemokine
ligand 5 (CCL5; RANTES) and CXC-chemokine ligand 4 (CXCL4) and CXCL5, onto
the inflamed endothelial lumen to trigger monocyte arrest (von Hundelshausen et
al., 2001; Huo et al., 2003). Finally, following firm arrest, leukocytes transmigrate
across the endothelial cell barrier, its associated basement membrane, and the
pericyte sheath. Leukocytes can cross the endothelium either between adjacent
4
endothelial cells (paracellular route) or directly through an endothelial cell
(transcellular route). Transcellular migration generally occurs in 'thin' parts of the
endothelium where there is less distance for the leukocyte to migrate. In addition,
caveolae containing ICAM-1 link together to form vesiculo-vacuolar organelles
(VVOs). This creates a channel inside the cell through which leukocytes can
migrate.
Although the leukocyte adhesion cascade has been divided into several
steps, these are not temporally exclusive, but instead work together to achieve the
desired effect of leukocyte arrest and diapedesis. Although leukocyte diapedesis
was described almost 200 years ago, its molecular mechanisms are only now
beginning to be fully understood (Imhof et al., 2004). In the past decade, new
insights have been gained into the signalling events that underlie integrin activation,
post-adhesion strengthening of leukocyte attachment, and the molecules involved in
diapedesis (Muller, W., 2003).
1.1.2 Chemoattractants
In vivo, there are several types of chemoattractant mediators that can recruit
leukocytes to inflammatory foci. These include bacterial components, leukotrienes,
complement factors and chemokines. C5a was the first chemoattractant to be
identified, and it is a cleaved product derived from complement component C5 (Shin
et al, 1968). Bacterial products such as fMLP (N-formyl-methionyl-leucyl-
phenylalanine) and other N-formylpeptides can also act as general
chemoattractants that non-specifically recruit leukocytes to inflammatory foci.
5
However, the main chemoattractants that specifically recruit leukocyte subsets to
inflammatory foci are a family of chemoattractant cytokines called chemokines.
Chemokines are a large family of small peptides that are structurally similar (Rossi
et al., 2000). Most are secreted, while only two, fractalkine (FKN;CX3CL1) and
CXCL16, are expressed on the cell surface. The physiological importance of FKN
expression can be highlighted in studies of cardiac allograft rejection where FKN
expression is negligible in non-rejecting cardiac isografts, but is significantly
enhanced in rejecting allografts (Robinson et al., 2000). In addition, FKN-/- mice
have reduced atherosclerosis compared to wild type littermates (Robinson et al.,
2000). Chemokine-induced signal transduction pathways are very similar. Thus, it is
the specific expression, regulation, and receptor binding patterns of each
chemokine that determine functional diversity. There are four families of
chemokines that are classified on the basis of the relative positions of their N-
terminal cysteine residues (Luster, A.,1998). Most chemokines contain four cysteine
residues and fit within the α (CXC) or the β (CC) chemokine families, although
another two families exist with lone members. FKN is a lone member in its family,
and its N-terminal cysteine residues are separated by three amino acids (CX3CL1).
The fourth family is composed only of lymphotactin (XCL1), which is a lymphocyte
specific chemokine (Kennedy et al., 1995). Most chemokines bind to
glycosaminoglycans (GAGs) on the luminal surface of endothelial cells. This binding
is required for leukocyte recruitment, since chemokines with mutations in their GAG
binding domains can induce in vitro chemotaxis, but are unable to recruit leukocytes
to the peritoneal cavity in vivo (Johnson et al., 2005).
6
The binding of chemokines to their heterotrimeric G-protein coupled
receptors (GPCRs) activates leukocyte integrins instantaneously by inside-out
signalling mechanisms (Shamri et al., 2005). They rapidly regulate integrin avidity
by increasing both integrin affinity (by a conformational change that results in
increased ligand binding energy and a decreased ligand dissociation rate), and
valency (the density of integrins per area of plasma membrane involved in
adhesion, determined by expression levels and lateral mobility) (Laudanna et al.,
2002; Constantin et al., 2000). It is through these signaling mechanisms that
chemokines act as powerful activators of integrin-mediated adhesion and leukocyte
recruitment.
In monocytes/macrophages, chemokines interact with specific serpentine
(heptahelical) receptors on the plasma membrane, which transduce signals by
coupling to heterotrimeric G proteins. Heterotrimeric G proteins are composed of an
α, β, and γ subunit. The α subunit is the GDP/GTP binding element. When bound to
GDP, the α subunit interacts with the β and γ subunits to form an inactive
heterotrimer complex that binds to the serpentine receptor. Binding of the
chemokine to the serpentine receptor induces a conformational change that causes
the exchange of GDP for GTP on the α subunit. This results in the dissociation of
the α subunit from the receptor and the release of the Gβγ complex. The free Gα
and Gβγ subunits are then free to interact with and modulate the activity of target
enzymes. Thus, chemokine binding induces the dissociation of the G protein
complex into α and βγ subunits, which bind and activate target enzymes such as
phosphatidylinositol 3-kinase (PI 3K), phospholipase C (PLC), or adenyl cyclase.
7
These enzymes play an important role in generating secondary intracellular
messengers that initiate a cascade of signaling events that culminate in cytoskeletal
mobilization required for the chemoattraction response.
1.2 The Monocyte
Mononuclear phagocytes arise in the bone marrow from dividing monoblasts
and are released into systemic circulation as nondividing monocytes (Wiktor-
Jedrzejczak et al., 1996). They circulate for several days before entering tissues
and replenishing resident macrophages and dendritic cells (DCs) (Akagawa et al.,
1996; Chapuis et al., 1997; Randolph et al., 1998). As half of the circulating
monocytes leave the bloodstream under steady-state conditions every day,
monocytes constitute a large systemic reservoir of myeloid precursors. Although
circulating monocytes give rise to tissue-resident macrophages, they also form
specialized cells such as DCs and osteoclasts, making up the mononuclear
phagocyte system (Hume et al., 2002). As precursors for microglia and osteoclasts,
monocytes play a role in the physiology of the central nervous system and in bone
remodeling (Servet-Delprat et al., 2002). Mononuclear phagocytes are important for
both innate and adaptive immunity. Their interactions with antigen-specific T
lymphocytes trigger the induction of adaptive immune responses (Geissmann et al.,
2003). Monocytes, defined as blood mononuclear cells, have "bean-shaped" nuclei
and express CD11b, CD11c, and CD14 in humans, and CD11b and F4/80 in mice
(Muller, W., 2001). Circulating monocytes are morphologically heterogeneous and
constitute approximately 5-10% of peripheral blood leukocytes (van Furth et al.,
8
1968). In humans and mice, the two principal monocyte subpopulations are the
"inflammatory" and "resident" subsets (Geissmann et al., 2003). Human
inflammatory monocytes express high levels of L-selectin and several chemokine
receptors, including CCR2 the CCL2 receptor, but low levels of CX3CR1, the FKN
receptor. On the other hand, resident human macrophages express high levels of
CX3CR1 and low to non-detectable levels of L-selectin and most chemokine
receptors, such as CCR2 (Grage-Griebenow et al., 2001). Furthermore, in humans
CD14high CD16ˉ monocytes represent the inflammatory subtype, while CD14low
CD16+ monocytes represent the resident subtype (Ziegler-Heitbrock, H., 1996). In
mice, inflammatory monocytes are characterized by expression of high levels of Ly-
6C, a glycosylphosphatidylinositol-linked cell surface protein with unknown function.
Ly-6Chigh, or "inflammatory", murine monocytes are short lived under steady-state
conditions, and are preferentially recruited to inflammatory foci, such as
atherosclerotic lesions (Sunderktter et al., 2004; Tacke et al., 2007). Ly-6Chigh
monocytes express higher levels of PSGL-1 than Ly-6Clow, or "resident" monocytes,
and thus roll at slower velocities on P-selectin and E-selectin substratum. This
property allows Ly-6Chigh monocytes to interact preferentially with atherosclerotic
endothelium, compared with Ly-6Clow monocytes (An et al., 2008). Resident
monocytes in mice express low to non-detectable levels of Ly-6C, persist longer
and repopulate several tissues, such as the liver, lung, spleen and brain after
adoptive transfer (Geissmann et al., 2003). Interestingly, Ly-6Clow CX3CR1high
monocytes show unique patrolling behavior in mice that are deficient in natural killer
cells and T lymphocytes, and are readily recruited to sites of infection (Auffray et al.,
9
2007). Although monocytes routinely emigrate from the blood to replenish tissue
macrophages, increased recruitment can be elicited by pro-inflammatory, metabolic,
and immune stimuli (van Furth et al., 1985). Following recruitment, monocytes
differentiate into macrophages and DCs, contributing to host defence and tissue
homeostasis through the clearance of senescent cells and tissue remodelling and
repair following inflammation (Gordon, S., 1986; Gordon, S., 1998). In addition to
host defense, monocytes have been implicated in atherosclerosis. The mechanisms
controlling monocyte functions will be outlined to better understand the role they
play in tissue homeostasis and host defense.
1.2.1 Chemotaxis
Chemotaxis, the directed cell migration towards external chemical gradients,
is a biological phenomenon of widespread occurrence. Chemotaxis can be
observed in many eukaryotic cells including: free-living organisms, leukocytes
(during inflammation), endothelial cells (angiogenesis), spermatocytes (fertilization)
and neurons (neurogenesis), highlighting the biological significance of this
phenomenon (Singer et al., 1986). Monocytes are amoeboid cells that move by
extending pseudopods. Chemotaxis is achieved by first polarizing or orienting the
cell in the direction of locomotion along a chemoattractant gradient. Polarization
results from preferential pseudopod extension towards areas of higher
chemoattractant concentration (Zigmond, S., 1974). Efficient chemotaxis requires
coordination of motile activities such as pseudopod formation at the leading edge of
the cell, and uropod retraction at the trailing edge.
10
During chemotaxis, macrophages extend short surface protrusions called
filopodia, or microspikes, which are membrane extensions of approximately 0.1-0.2
µm in diameter and up to 20 µm in length. These structures act as cellular tentacles
and are supported by a core bundle of actin filaments called microfilaments (Mattila
et al., 2008). In macrophages, filopodia help to support thin sheets of membrane-
enclosed cytoplasm, called lamellipodia. Lamellipodia contain actin filaments and a
meshwork of myosin II-associated microfilaments. In macrophages, as well as in
other cell types, the actin network within the lamellipodia, in association with several
structural and regulatory proteins, comprises the molecular motor which drives cell
locomotion (Jones et al., 1998). This locomotory apparatus works against cell-to-
substratum adhesions called focal contacts or focal adhesions. These molecular
structures utilize members of the integrin family of proteins to link the myosin II-
containing bundles of cytoplasmic microfilaments, called stress fibers, to proteins in
the extracellular matrix (ECM) (Critchley et al., 1999). In macrophages, integrin-
mediated contacts to the ECM take two forms: focal complexes and podosomes.
Focal complexes are structurally similar to focal adhesions but lack stress fibers
(Allen et al., 1997), while podosomes are distinct circular structures that are only
observed in cells of the myeloid lineage (DeFife et al., 1999; Correia et al., 1999;
Linder et al., 2003).
Macrophage chemotaxis can be divided into several steps: actin-driven
protrusion of filopodia and lamellipodia at the leading edge, adhesion of the leading
edge to the ECM via integrin-mediated focal interactions, actomyosin-mediated cell
contraction, release of contacts at the trailing edge of the cell, and recycling of
11
membrane receptors from the rear to the front of the cell (Allen et al., 1998; Sheetz
et al., 1999; Friedl, P., 2004; Friedl et al., 2009). The cell must integrate a number of
molecular events in order to efficiently move across a substratum. This coordination
is required for polarization and chemotaxis, and is largely mediated by the actin
cytoskeleton within the cell.
Exposure of circulating monocytes to chemoattractants leads to activation
and subsequent migration of monocytes across the endothelial barrier towards the
inflammatory foci. Monocytes/macrophages are responsive to even minuscule
gradients of extracellular signals and will undergo chemotaxis towards a variety of
stimuli. These signals include chemoattractants such as fMLP, vascular endothelial
growth factor (VEGF) and chemokines such as macrophage chemotactic protein 1
(MCP-1;CCL2) and stromal cell-derived factor-1α (SDF-1α;CXCL12) (Gyetko et al.,
1994; Barleon et al., 1996). Binding of the chemoattractant to its cell-surface
receptor activates intracellular signaling cascades, which mobilize the actin
cytoskeletal machinery. Subsequently, the cell polarizes forming actin-rich filopodia
and lamellipodia at the 'front' of the cell and a tail-like uropod at the cell rear. The
generation and maintenance of cell polarity and actin cytoskeleton remodelling are
necessary processes for efficient monocyte chemotaxis.
The SDF-1α receptor (CXCR4), like other chemokine receptors, is a
glycosylated seven-transmembrane domain GPCR. It has an associated
heterotrimeric GDP/GTP binding protein complex made up of α, β and γ subunits.
Several mechanisms for activation of GPCRs have been proposed (Gether, U.,
2000; Ulloa-Aguirre et al., 1999). Small molecule agonists can bind within the
12
transmembrane helices and cause receptor activation, while larger molecules bind
to the extracellular surface leading to a conformational change that is transmitted to
an intracellular Gαβγ complex. This event is followed by exchange of GTP for GDP
in the Gα protein and its subsequent dissociation from the Gβγ complex, followed
by the activation of downstream signaling pathways. Both the Gα subunit and Gβγ
complex interact with several downstream effectors to generate cell polarity and
drive migration, although these signaling events also prime the cell for other
immune functions. Furthermore, the various immune functions of the leukocyte are
not temporally exclusive as they are dependent on complex interactions between
intracellular signaling events.
Ligation of GPCRs leads to the activation of four major signaling pathways
(Fig. 2): PLC, PI3K, mitogen-activated protein kinases (MAPKs) and Rho guanosine
triphosphatases (GTPases). Each of these pathways is involved in cell activation
and/or the generation of cell polarity. Once the Gα subunit dissociates, the Gβγ
complex activates PLC, which in turn cleaves phosphatidylinositol (4,5)-
bisphosphate (PI(4,5)P2) to generate inositol (1,4,5)-triphosphate (IP3) and
diacylglycerol (DAG). Generation of IP3 leads to the mobilization of intracellular
calcium stores from the endoplasmic reticulum and DAG activates protein kinase C
(PKC) (Li et al., 2000).
A convincing role for PI3Ks in GPCR signaling and chemotaxis has been
established (Li et al., 2000; Sasaki et al., 2000; Hirsch et al., 2000; Servant et al.,
2000; Jin et al., 2000). Although there are at least four Class I PI3K isoforms in
mammalian cells (Vanhaesebroeck et al., 1999), only a single Class IB variant,
13
Figure 1.2 Intracellular signal transduction upon chemokine GPCR activation.
Chemokine binding to GPCRs induced a conformational change that results in the
dissociation of Gα subunits from the Gβγ complex. This leads to rapid outside-in
signaling resulting in the activation of four major signaling pathways that influence
monocyte chemotaxis, adhesion and phagocytosis: PLC, PI3K, MAPKs and Rho
GTPases. Each of these pathways contributes to the generation of cell polarity
and/or modulation of integrin avidity.
14
containing a p110γ catalytic subunit complexed with a 101 kDa regulatory protein,
has been shown to interact with G-proteins in leukocytes. Since chemokine
responses in leukocytes, such as phagocytosis, are sensitive to pertussis toxin, it
was believed that chemokine receptors are coupled to a Gαi subunit (Boulay et al.,
1997). However, there is also data implicating other families of G-protein α subunits
in chemokine-mediated signaling (Amatruda et al., 1993), in addition to Gβγ
subunits (Clapham et al., 1993). While there is evidence that Class IB PI3K is
responsive to activation by Gα subunits (Murga et al., 1998), it has also been shown
that p110γ is activated via interactions with the Gβγ subunits (Neptune et al., 1997).
Regardless of how PI3K is activated, the outcome leads to phosphorylation of
membrane PI(4,5)P2 by activated PI3K, resulting in the generation of PI(3,4,5)P3 at
the plasmalemma.
In addition, the Gβγ complex also activates PI3Kγ which activates Src-family
kinases and generates PI(3,4,5)P3 from membrane PI(4,5)P2 (Krugmann et al.,
1999). Src-family kinases phosphorylate adapter proteins such as Shc, resulting in
the recruitment of Ras GTPases and subsequent activation of MAPK pathways
(Kintscher et al., 2000). Although the p38 and Erk MAPK pathways are involved in
chemotaxis and adhesion, the most important biochemical events for cell
polarization are the production of PIP3 and activation of Rho GTPases at the
leading edge of the cell.
The PI3K dependent production of PIP3 at the cell membrane allows for the
recruitment of Rho GTPases, Rac, and Cdc42 to the cell membrane. The
localization of PIP3, Rac and Cdc42 then stimulate the polymerization of actin, a
15
process necessary for the formation of lamellipodia at the front of the cell (Fig 1.3).
On the other hand, at the back of the cell, Rho-kinase phosphorylation results in
inactivation of myosin light chain phosphatase, leading to increased myosin light-
chain kinase (MLK) dependent activation of myosin (Nguyen et al., 1999). These
biochemical conditions favour the formation of actomyosin bundles, contraction, de-
adhesion from the substratum and tail retraction (Ridley, A., 2001; Bokoch, G.,
2005). Interestingly, mutual inhibition of leading edge and trailing edge proteins
allows for the maintenance of cell polarity (Fenteany et al., 2004). To prevent the
accumulation of PIP3 at the trailing edge, PTEN dephosphorylates PI(3,4,5)P3 to
PI(4,5)P2. The lack of PIP3 in the back of the cell decreases the activation and
recruitment of Rho GTPases and subsequent actin polymerization, allowing the
formation of actomyosin bundles and tail retraction (Worthylake et al., 2001). Actin
polymerization at the leading edge coupled to tail retraction in the back allows for
directed leukocyte chemotaxis.
1.2.2 Adhesion
Firm adhesion of leukocytes to activated endothelium is required for
leukocyte transmigration, and is an integrin-dependent process. Integrins are large
transmembrane glycoproteins that anchor the cell's cytoskeleton to other cells or to
the ECM. These large protein complexes are heterodimers composed of α and β
subunits. The β2 family of integrins, only expressed on leukocytes, includes LFA-1
and Mac-1. These are responsible for firm adhesion and arrest on endothelial cells,
16
Figure 1.3 Rho GTPases in the polarized monocyte.
The PI3K dependent production of PIP3 at the cell membrane allows for the
recruitment of Rho GTPases, Rac, and Cdc42 to the cell membrane. The
localization of PIP3, Rac and Cdc42 stimulates the polymerization of actin, a
process necessary for the formation of lamellipodia at the front of the cell. At the
back of the cell, Rho-kinase phosphorylation results in inactivation of myosin light
chain phosphatase, leading to increased myosin light-chain kinase (MLK)
dependent activation of myosin.
17
and later attachment with ECM components. LFA-1 and Mac-1 can both bind
VCAM-2 and ICAM-1 (Ley et al., 2007).
Chemokines are powerful activators of integrin-mediated firm adhesion.
GPCR stimulation results in rapid inside-out signaling cascades that result in a net
increase in the average integrin affinity and valency (Chan et al., 2003; Carman et
al., 2003). Although the signaling cascades downstream of GPCRs are incompletely
understood, several pathways have been at least partially elucidated. For example,
PLC is known to be recruited after GPCR signaling. Recruitment and activation of
PLC results in the production of IP3 and DAG followed by an increase in intracellular
calcium. This calcium flux and the production of DAG activates guanine nucleotide
exchange factors (GEFs), such as Vav1 and CALDAG1, and results in the
recruitment and activation of Rho GTPases (Constantin et al., 2000; Vielkind et al.,
2005; Crittenden et al., 2004). Thus, Rho GTPases are also involved in the
signaling cascades linking GPCR activation and changes in integrin affinity. For
example, chemokine-mediated conformational changes in LFA-1 are induced by
GTPases RhoA (Giagulli et al., 2004) and Rap-1 (Shimonaka et al., 2003). Once
recruited and activated, Rho GTPases associate with actin binding proteins,
including talin-1 and α-actinin, to modulate integrin affinity (Sampath et al., 1998;
Jones et al., 1998; Brakebusch et al., 2003). Thus, chemokine-mediated changes in
integrin affinity are dependent on interactions with the actin cytoskeleton.
In addition to GPCR-dependent inside-out signaling, binding of ligands to
integrins also induces outside-in signaling cascades (Ley et al., 2007). Paxillin is a
scaffold protein for signaling molecules that can bind integrins. Ligand induced
18
integrin clustering activates Src-family kinases. These phosphorylate paxillin
allowing the recruitment of downstream effectors, such as ADP-ribosylating factor
GTPase activating protein (ArkGAP) and PAK interacting exchange factor (PIX).
ArfGAP inactivates Rac, while PIX activates Cdc42 (DeMali et al., 2003). Src-family
kinases also activate Vav1, a Cdc42 and Rac GEF (DeMali et al., 2003). Thus, Rho
GTPases are required for the mobilization of the actin cytoskeleton to form and
maintain adhesive contacts. Both GPCR-induced inside-out signaling and ligand-
induced outside-in signaling modulate the activity of Rho GTPases to mobilize the
actin cytoskeleton for adhesion.
1.2.3 Phagocytosis
Phagocytosis is a cellular process in which solid particles are engulfed by the
cell membrane to form internal phagosomes. Although this process can be used for
the acquisition of nutrients and to clear dead cells and debris, in leukocytes, this is a
major mechanism used to clear invading microorganisms. Although phagocytosis of
uncoated particles can occur, the efficiency of phagocytosis is greatly enhanced by
the binding of opsonins, such as complement factors or Igs, to the surface of a
particle. Opsonins can be recognized by receptors on the leukocyte surface,
including Fc (Ravetch et al., 1991) and complement receptors (Brown, E., 1991),
which mobilize the actin cytoskeleton and aid in the subsequent internalization.
Fc receptors facilitate the engulfment of Ig coated particles. These receptors
are members of the multichain immune recognition receptor family. Their signaling
parallels signaling via T and B cell antigen receptors, which signal via homologous
19
cytoplasmic sequences, called immunoreceptor tyrosine activation motif (ITAM)
(Strzelecka et al., 1997; Imboden et al., 1985). Fc receptor activation results in
recruitment of PI3K, which converts PI(4,5)P2 to PIP(3,4,5)P3 and DAG. DAG is also
produced by PLC and activates PKC (Botelho et al., 2000). Phagocytosis requires
normal signaling through phosphoinositide kinases and PLC (Greenberg et al.,
2003). Ultimately, Fc receptor ligation leads to actin mobilization and membrane
remodeling, which is mediated by Rho GTPases. GEFs, such as Vav-1, contain a
pleckstrin homology (PH) domain with a high affinity for PI(3,4,5)P3, promoting their
recruitment to membrane PI(3,4,5)P3 at sites of Fc receptor ligation (Bustelo, X.,
2002). Recruitment of GEFs results in localized activation of Rho GTPases Rac and
Cdc42, which mobilize the actin machinery to extend pseudopods to engulf the
particle (Greenberg et al., 2002). For example, Fcγ phagocytosis results in
activation of the Rho GTPases Cdc42 and Rac (Caron et al., 1998).
Complement-derived opsonins, such as C3b, can be generated by both the
classical and the alternative pathways. Complement receptor 1 (CR1) on the
surface of leukocytes recognizes and binds C3b. Unlike the active phagocytosis
seen in Fc receptor-mediated engulfment, complement-mediated phagocytosis is
slow and gentle (Greenberg et al., 2002). The phagocytic ability of monocytes is
important for host defence. In addition, monocyte phagocytosis of oxidized low
density lipoprotein (OxLDL) is implicated in the formation of foam cells in
atherosclerotic lesions.
1.2.4 Monocytes and Vascular Inflammation
20
Atherosclerosis is an inflammatory disease that can be characterized by
intense immunological activity in the vessel wall. It is the major cause of coronary
heart disease (CHD) the leading cause of death in North America (Castelli et al.,
1984; Pasternak et al., 2004). The process of atherogenesis is also involved in
cerebrovascular atherosclerotic disease, and in the aortic artery, renal artery and
peripheral vasculature. Thus, the pathogenesis of atherosclerosis is wide ranging
and threatens human health worldwide (Murray et al., 1997). Atherosclerosis
involves the formation of vessel lesions, called plaques, that are characterized by
lipid accumulation, inflammation, cell death and fibrosis. Over time, these plaques
can mature and grow in size. The main complications of atherosclerosis result from
plaques that occlude the vessel, causing stenoses by limiting blood flow and
starving the downstream tissues of oxygen and nutrients. In some instances, the
plaque may rupture, sending an embolus down the vessel and exposing the
prothrombotic material in the plaque to the blood. This may also result in an abrupt
formation of a thrombotic clot, which can occlude the vessel at the site of plaque
rupture (Libby et al., 2002). In the coronary vessels, this can lead to a myocardial
infarction. Atherosclerosis in the carotid vessels can result in ischaemic stroke and
transient ischaemic attacks.
Atherosclerotic plaques are composed of a mixture of immune cells (mainly
macrophages and T lymphocytes), extracellular matrix, lipids and lipid-rich debris.
This accumulation of immune cells and lipids in the intima is located between the
vascular endothelial cells and the smooth muscle cells of the vascular media.
Although the cellular compositions of plaques changes with time, lipid-laden
21
macrophages , or foam cells, tend to outnumber other cell types. The immune cells
in the plaque become activated and produce proinflammatory cytokines such as
tumor necrosis factor α (TNF-α) and interferon-γ (IFNγ). This proinflammatory
environment induces the vascular endothelial cells to express increased leukocyte
adhesion molecules, allowing monocyte and other immune cells to transmigrate into
the plaque. In addition, vascular endothelial cells increase adhesion molecule
expression in response to cholesterol accumulation in the intima (Cybulsky et al.,
1991). Macrophage colony-stimulating factor (M-CSF) produced by endothelial cells
and smooth muscle cells (Rajavashisth et al., 1990) allows monocytes to
differentiate into macrophages in the plaque (Smith et al., 1995). In addition,
atherosclerotic plaques produce the chemokine FKN, which can be shed by
proteolysis. Shed FKN can engage its receptor CX3CR1 on blood-borne monocytes
and macrophages, stimulating their recruitment to the atherosclerotic vessel wall
(Combadire et al., 2003; Lesnik et al., 2003). Thus, the recruitment of immune cells,
especially monocytes, initiates the formation of atherosclerotic plaques. Since the
recruitment of monocytes to the vessel wall is pivotal to atherogenesis, targeting the
recruitment of monocytes to the subintima may produce clinical benefits and slow
the atherogenetic process.
1.3 SLIT2: A GUIDANCE CUE FOR CELL MIGRATION
During the development of the central nervous system (CNS), neurons must
migrate and project axons over long distances. Most axons emanating from the
CNS must cross the midline and then project longitudinally towards their synaptic
22
targets. The molecular mechanisms that guide this pathfinding include: contact
attraction, chemoattraction, contact repulsion and chemorepulsion. These
mechanisms act simultaneously in a coordinated manner to direct axonal
pathfinding (Tessier-Lavigne et al., 1996). Generally, guidance cues can either
promote or repress migration of neurons and axonal projections. For example,
netrins are diffusible chemotropic factors that attract commissural axons to the
midline (Kennedy et al., 1994). The Slit family of secreted proteins, together with
their cell-surface receptor Roundabout (Robo), act to repel neurons during CNS
development. Once commissural axons have crossed the midline, midline glial cells
express Slit to prevent the axons from re-crossing the midline. Drosophila Slit
mutants exhibit midline defects, such as collapse of the regular scaffold of
commissural and longitudinal axon tracts in the embryonic CNS (Rothberg et al.,
1988; Rothberg et al., 1990). A similar defect is observed in Robo mutants, where
projecting axon tracts cross the midline repeatedly (Kidd et al., 1998).
Recent studies demonstrate a role for Slit and Robo as guidance cues
outside of the CNS. For example, in Drosophila mesoderm migration, myocyte
precursors migrate away from the midline towards peripheral target sites where they
fuse to form muscle fibers. In Slit and Robo mutants, these cells do not migrate
away from the midline and instead fuse across the midline (Rothberg et al., 1990).
Interestingly, this defect can be reversed by expressing Slit protein in midline cells
(Kramer et al., 2001). Slit and Robo signaling also plays a role in nephrogenesis.
The proper localization of the kidney is dependent on the formation of a structure
called the ureteric bud. This process requires secretion of glial cell line-derived
23
neurotrophic factor (GDNF) by nearby mesenchymal cells. Slit and Robo knockout
mice display abnormal patterns of GDNF secretion and develop multiple ureteric
buds and multiple urinary collecting systems, implicating Slit and Robo in
nephrogenesis (Ray, L., 2004). Furthermore, variations in the human Robo gene
have been associated with familial vesicoureteral reflux (Bertoli-Avella et al., 2008),
a condition with improper insertion of ureters into the bladder resulting in retrograde
flow of urine from the bladder to the kidney. Therefore, Slit and Robo appear to play
a role in normal human urinary tract formation.
In addition to its role in embryogenesis, Slit also plays a role in the mature
organism. A recent study demonstrated Slit2-mediated inhibition of aortic smooth
muscle cell migration toward a gradient of platelet-derived growth factor (PDGF)
(Liu et al., 2006). This inhibition was shown to be mediated by suppressing the
activation of small GTPase Rac1. Furthermore, Slit2 can prevent breast cancer cell
metastasis. Both Robo and the chemokine receptor CXCR4 are expressed by some
human breast cancer cells, allowing them to migrate towards gradients of SDF-1α.
The lungs may produce high levels of SDF-1α, promoting breast cancer metastasis
to this tissue. Slit2 inhibited the chemotaxis, adhesion and chemoinvasion of breast
cancer cells (Prasad et al., 2004). Several other studies have demonstrated a role
for Slit2 as a tumor suppressor. Slit2 was shown to inhibit colony formation in lung,
colorectal and breast cancer cell lines (Dallol et al., 2002). Furthermore, Slit2 was
often epigenetically silenced in more aggressive forms of these and other cancers
(Dallol et al., 2003; Dallol et al., 2003; Dickinson et al., 2004). Therefore, these
studies imply a role for Slit and Robo in the adult organism and in cancer biology.
24
1.3.1 Expression
The expression of the Slit genes has been demonstrated in many organisms,
including Drosophila (Battye et al., 1999), Caenorhabditis elegans (Hao et al.,
2001), Xenopus (Chen et al., 2000), Gallus gallus domesticus (Holmes et al., 2001;
Vargesson et al., 2001), mice (Holmes et al., 1998; Piper et al., 2000), rats (Marillat
et al., 2002) and humans (Itoh et al., 1998). In mammals, there are three members
of the Slit family. Although Slit1 is predominantly expressed in the developing CNS
(Yuan et al., 1999), Slit2 and Slit3 are expressed outside the CNS, in the lung,
kidney and heart tissues (Wu et al., 2001). Importantly, Slit expression persists in
the adult organisms, suggesting a role for the Slit family beyond embryogenesis.
Expression of Robo has been demonstrated in Drosophila (Kidd et al., 1998),
mice (Yuan et al., 1999) and humans (Kidd et al., 1998). There are four isoforms of
Robo in mammals. Robo-1 has been shown to be most highly expressed in tissues
outside the CNS, including human leukocytes (Wu et al., 2001). Interestingly, the
tissue expression of Slit and Robo is relatively complementary, suggesting a
functional relationship in the adult organism (Yuan et al., 1999).
1.3.2 Slit and Robo Structure
The Slit family of proteins contains an N-terminal signal peptide, four leucine-
rich repeats (LRRs), nine epidermal growth factor (EGF) repeats and a C-terminal
cysteine knot (Fig 1.4) (Rothberg et al., 1988; Rothberg et al., 1990; Rothberg et al.,
1992). The EGF repeats and LRR allow the Slit proteins to interact with ECM
25
Figure 1.4 Primary Structure of Mammalian Slit2 and Robo-1 Proteins..
Mammalian Slit2 contains four leucine rich repeats (LRRs), nine epidermal growth
factor (EGF) repeats, a laminin G (G) domain, and a cysteine rich C terminus. The
Robo-1 receptor contains five immunoglobulin (Ig) repeats, three fibronectin (FN)
type III, a transmembrane Domain (TM) and four conserved cytoplasmic (CC)
signaling motifs.
26
components, such as glypican-1 (Ronca et al., 2001), enabling them to act as
localized, non-diffusible, signaling molecules. Furthermore, Slit2 can be cleaved
after the fifth EGF repeat by proteases to form N-terminal (Slit-N) and C-terminal
(Slit-C) fragments (Brose et al., 1999; Wang et al., 1999). The N-terminal fragment
includes the first 1118 amino acids and contains the four LRRs and the first five
EGF repeats, while the C-terminal fragment contains the remaining residues (Brose
et al., 1999). Importantly, it is the four LRRs that are necessary and sufficient for
interaction with the Robo receptor and downstream signaling (Battye et al., 1999).
Therefore, both the full length protein and the N-terminal Slit2 fragment can bind
Robo receptors to repel migrating cells and projecting axons (Nguyen Ba-Charvet et
al., 2001). Although the cleavage of Slit2 does not eliminate its activity, it may play a
role in its diffusion, since N-Slit appears to be more tightly associated with the cell
membrane. In rat neural tissue both the N-terminal and C-terminal fragments of Slit
were shown to bind heparan sulfate proteoglycan glypican-1 (Liang et al., 1999),
although the C-terminal fragment bound with higher affinity, suggesting a possible
regulatory mechanism for its diffusion.
Robo is a single-pass type-1 receptor and signaling molecule for the Slit
family of proteins. The extracellular region of Robo-1 contains five immunoglobulin
(Ig) repeats and three fibronectin type III domains. The cytoplasmic region of Robo-
1 contains four conserved cytoplasmic signaling motifs, CC0, CC1, CC2 and CC3
(Kidd et al., 1998; Zallen et al., 1998). Only the Ig domains of Robo are required to
bind to the LRRs in full length and N-terminal Slit2 (Battye et al., 2001; Chen et al.,
27
2001; Nguyen Ba-Charvet et al., 2001). The cytoplasmic CC motifs of Robo are
required for its response to Slit (Bashaw et al., 2000).
1.3.3 Slit2/Robo-1 intracellular signal transduction
Studies of neuronal tissue have demonstrated that Robo-1 can signal
through two pathways that lead to mobilization and remodeling of the cytoskeleton:
Enabled (Ena) protein and Rho GTPases. Both of these pathways require the CC
motifs in the cytoplasmic domain of Robo to signal.
Ena and its mammalian homologue (Mena) are members of a family of
proteins that are believed to link signal transduction to localized remodeling of the
actin cytoskeleton by binding to profilin, an actin binding protein which regulates
actin polymerization (Lanier et al, 1999; Wills et al., 1999). The bacteria Listeria
monocytogenes utilizes the Ena proteins for actin-based motility (Laurent et al,
1999). Ena was demonstrated to be a substrate for the Abelson kinase (Gertler et
al., 1989). Ena and Abelson can both bind to Robo. Ena binds to the CC1 motifs
while Abelson binds to the CC3 motif (Bashaw et al., 2000). Impairing Ena binding
reduced Robo function while mutations in Abelson results in Robo hyperactivity
(Bashaw et al., 2000).
A second pathway through which Slit/Robo mediates cell repulsion is through
modulation of Rho GTPase activity. A family of GTPase activating proteins, Slit
Robo GTPase activating proteins (srGAPs), were shown to bind Robo (Wong et al.,
2001). The SH3 domain of these proteins is required to bind to the CC3 motif of
Robo, while the GAP domain has activity for the Rho GTPases Rac, Cdc42 and
28
Rho (Wong et al., 2001). This suggests a model where Slit ligation of Robo induces
the recruitment of srGAP followed by inactivation of Rho GTPases and inhibition of
actin remodeling and cell motility. The literature supporting the role of Rho GTPases
in cell motility is consistent with this model.
1.3.4 Slit and Robo in leukocyte trafficking
Both neuronal and leukocyte cell migration require the recognition of
guidance cues, polarization of the cell and mobilization of the actin cytoskeleton.
Thus, a conservation of cell migration guidance mechanisms was proposed when
Slit2 was found to inhibit leukocyte migration, in addition to its well established role
in neuronal guidance (Guan et al., 2003; Kanellis et al., 2004; Prasad et al., 2007).
The first study to demonstrate Slit-mediated inhibition of leukocyte migration
was published in Nature by Wu et al., 2003. This study utilized transwell migration
assays to demonstrate Slit-mediated inhibition of chemotaxis of rat lymph node cells
to gradients of MCP-1 and neutrophil-like HL-60 cells to fMLP gradients (Wu et al.,
2003). Subsequently, Kanellis et al. demonstrated Slit2-mediated inhibition of
chemotaxis towards MCP-1 and fMLP in rat-derived macrophages (Kanellis et al.,
2004). Another study showed that Slit2 inhibited migration of dendritic cells (DCs)
(Guan et al., 2003). Although these early studies implicated Slit2 in modulation of
leukocyte chemotaxis, clear evidence for this role was lacking in primary human
cells. However, in 2007, Prasad et al. were able to demonstrate that Slit2 can inhibit
chemotaxis and transendothelial migration of primary CD4+ T lymphocytes and the
human Jurkat T cell line (Prasad et al., 2007).
29
These results are indicative of a role for Slit2 in human leukocyte
chemotaxis, as Slit2 has been shown to inhibit migration of human DCs and
lymphocytes. Furthermore, we have shown that Slit2 inhibits the in vitro chemotaxis
of primary human neutrophils, and the in vivo recruitment of mouse neutrophils
(Tole et al., 2009). Importantly, we have demonstrated that Slit2 inhibits neutrophil
chemotaxis towards a range of chemokines, both in vivo and in vitro, including
fMLP, IL-8, C5a and FKN (Tole et al., 2009). Therefore, Slit2 may have a
therapeutic role as a universal inhibitor of leukocyte migration.
1.4 RHO GTPases: Rac and Cdc42
Small GTPases of the Rho family are a part of the Ras superfamily of small
GTP-binding proteins. They are pivotal regulators of many signaling networks that
are activated by a diverse variety of receptor types. To date, over 20 mammalian
Rho GTPases have been characterized, and these can be grouped into 6 different
classes: Rac (Rac1, Rac2, Rac3, RhoG), Rho (RhoA, RhoB, RhoC), Cdc42
(Cdc42Hs, G25K, TC10), Rnd (Rnd3/RhoE, Rnd1/Rho6, Rnd2/Rho7), RhoD, and
TFF (Aspenström, P., 1999; Kjoller et al., 1999). When activated, Rho GTPases
regulate many important processes in all eukaryotic cells, including actin
cytoskeleton dynamics, transcriptional regulation, cell cycle progression, and
membrane trafficking. The activation, and hence the activity of Rho GTPases is
regulated by outside-in signals from a variety of receptor types, including GPCRs,
tyrosine kinase receptors, cytokine receptors and adhesion receptors. Rho
GTPases play an critical role in leukocytes as regulators of signaling networks that
30
allow these cells to perform specialized functions, such as chemotaxis, adhesion
and phagocytosis.
1.4.1 Structure and Regulation
All Rho GTPases contain two main structural domains, the C-terminal 'CAAX'
motif and a catalytic GTP domain. The 'CAAX' motif undergoes post-translational
processing, involving carboxy-terminal proteolysis of the AAX residues followed by
carboxyl-methylation. The modified C-terminal domain can then attach to
membrane lipids and facilitates membrane association and subcellular localization
of Rho GTPases (Gutierrez et al., 1989; Casey et al., 1989; Fujiyama et al., 1990).
The catalytic domain contains two regions, switch I and switch II. These domains
correspond to different structural conformations in the GTP-bound and GDP-bound
forms. Rho GTPases function as molecular switches by cycling between GDP-
bound and GTP-bound forms. When bound to GDP, Rho GTPases are inactive.
Upstream signaling events leading to the exchange of GDP for GTP switches the
protein to an active state. The active form of the protein can transduce signals via
interactions with downstream targets or effector molecules to produce a cellular
response. The intrinsic GTPase activity of Rho GTPases completes the cycle, by
hydrolyzing GTP, returning the GTPase to its inactive GDP-bound state.
There are three classes of molecules that interact with Rho GTPases and are
capable of regulating their activation state: guanine nucleotide exchange factors
(GEFs), GTPase-activating proteins (GAPs), and guanine nucleotide dissociation
inhibitors (GDIs). GEFs catalyze the exchange of GDP for GTP, leading to the
31
activation of Rho GTPases. GEFs stimulate the release of GDP allowing GTP,
which is present at higher concentrations in cells than GDP, to bind and activate
GTPases. To date, over 69 mammalian GEFs for Rho GTPases have been
identified (Rossman et al., 2005). They are characterized by the presence of a Dbl
homology domain (DH), which is capable of interacting with both the switch I and
switch II regions and catalyses the exchange of GDP for GTP. In addition, many of
these DH-domain containing proteins, such as Vav, contain a PH domain. The PH
domain allows GEFs to bind phosphoinositides, such as PIP3. This allows GEFs to
be localized to the plasma membrane where they can interact with other Rho
GTPase interacting proteins. Thus, GEFs promote the activation of Rho GTPases
and also facilitate their interaction with downstream effector molecules. On the other
hand, GAPs enhance the intrinsic GTPase activity of Rho GTPases, resulting in the
suppression of their activity. Although GTPases posses intrinsic GTPase activity,
the actual rate of GTP hydrolysis is relatively slow. Therefore, the interaction with a
GAP is required for efficient GTP hydrolysis, as this accelerates the cleavage step
by several orders of magnitude (Vetter et al., 2001). To date, more than 70
eukaryotic RhoGAPs have been discovered, 35 of these can be found in humans
(Tcherkezian et al., 2007). There exists a large diversity in the primary sequences of
the various GAPs. However, each one contains a Rho GAP domain with a
conserved tertiary structure composed of α helices and a catalytically critical
'arginine finger' which stabilizes the formation of the transition state during GTP
hydrolysis (Nassar et al., 1998). In addition, the Rho GAP domain can interact with
both the switch I and switch II regions on the GTPase domain (Gamblin et al.,
32
1998). This interaction allows GAPs to facilitate the intrinsic hydrolysis of GTP,
resulting in the inactivation of Rho GTPases. Finally, GDIs associate with Rho
GTPases in their inactive GDP-bound state and inhibit their activation by GEFs. In
addition, GDIs have also been shown to bind to GTP-bound GTPases, such as Rho
GTPase, and suppress GTPase activity (Oloffson, B., 1999). Finally, there is
evidence that GDIs can bind to isoprenyl moieties on the C-terminus of GTPases in
order to sequester them in the cytosol (Keep et al., 1997). The role of GDIs in
partitioning GTPases between the membrane and cytosol may be physiologically
more important than the inhibition of their activation. It is possible that the GDI-
mediated partitioning of GTPases may provide a storage pool of Rho GTPases that
may be readily utilized upon cell activation. Ultimately, the function of GDIs is to
prevent the activation of Rho GTPases, prevent their interaction with membranes,
and inhibit their downstream signaling networks.
1.4.2 Role of Rho GTPases in the regulation of the actin cytoskeleton
Rho GTPases are pivotal regulators of signaling networks that are activated
by chemokine and cytokine receptors, along with other receptor types, and result in
the mobilization of the cytoskeleton (Machesky et al., 1997). Actin polymerization is
a common response of motile cells to chemoattractants, and occurs following the
activation of Rho GTPases (Carson et al., 1986; Hall et al., 1989; Howard et al.,
1984). The movement of eukaryotic cells relies on coordinated extension of actin-
rich lamellipodia in the leading edge and retraction of the uropod at the rear of the
cell. The extension of lamellae in the leading edge involves rapid turnover of actin
33
filaments (Symons et al., 1991; Wang, Y., 1985). More stable actin-myosin cables
can be found in more established protrusions and in the middle and rear of the cell
(DeBiasio et al., 1988). Thus, cell motility requires the coordinated polymerization of
actin in protrusions at the leading edge and contraction of actin-myosin cables at
the middle and rear of the cell. In addition, other factors such as recycling of the
plasma membrane and integrin-mediated adhesion are important for cell motility
(Bretscher, M., 1996; Martenson et al., 1993; Yamada et al., 1995; Mitra et al.,
2005). Furthermore, coordinated actin assembly is important for integrin-mediated
adhesion and phagosome formation (Defacque et al., 2000; Calderwood et al.,
2000). All of these processes are dependent on coordinated mobilization of the
actin cytoskeleton, and are regulated by deployment of actin-binding proteins by
activated Rho GTPases. Rho GTPases are in an ideal position to control cell
motility and morphological changes in response to extracellular stimuli, such as
chemokine gradients. For example activation of Rho in fibroblasts results in the
assembly of stress fibers and focal adhesions (Ridley et al., 1992). The activation of
Rac causes extension of lamellipodia and assembly of small focal complexes
(Nobes et al., 1995; Ridley et al., 1992). Finally, activation of the Cdc42 Rho
GTPase leads to the formation of filopodial extensions (Nobes et al., 1995).
1.5 Rationale, Hypothesis & Objectives
1.5.1 Rationale
34
Monocyte recruitment and proliferation in the subintima is a hallmark of
atherosclerosis and vascular inflammation. The trafficking signals that recruit
monocytes to sites of inflammation are provided by chemoattractants. Although we
can target certain individual chemoattractants and their receptors, redundancy
exists in the chemokine signaling pathways that allow other pathways to
compensate for the loss of one or more. Therefore, it would be more efficient to
knock-out chemoattractant-mediated cell recruitment with a universal inhibitor of
chemokine GPCR signaling pathways.
The Slit family of proteins have long been known to act as inhibitors of cell
migration and axon projection in the CNS. More recent studies have implicated a
role for Slit2/Robo-1 signaling in diverse cell types, including leukocytes, both in
vitro and in vivo (Dallol et al., 2002; Guan et al., 2003; Kanellis et al. 2004; Liu et al.,
2006; Prasad et al., 2004; Prasad et al., 2007). Furthermore, we have demonstrated
Slit2-mediated inhibition of circulating human and mouse neutrophils to several
chemoattractant gradients (Tole et al., 2009). These data suggest that Slit2 may
inhibit cellular migration outside of the CNS, implying that the guidance mechanisms
controlling cell migration may be conserved across cell types. Indeed, Slit2 was also
shown to inhibit the chemotaxis of circulating human neutrophils induced by several
classes of chemoattractants, including: fMLP, IL-8 and C5a (Tole et al., 2009). In
addition, Slit2 was shown to dramatically decrease neutrophil recruitment in an in
vivo model of murine peritonitis induced by sodium periodate or other
chemoattractants (C5a, mouse inflammatory protein 2). However, limited data is
available on the effect of Slit2 on monocyte migration and function. Studies in
35
neuronal cells have implicated the Rho GTPases in the Slit2-mediated inhibition of
migration. In human neutrophils, Slit2 was shown to inhibit the activation of Rho
GTPases, Cdc42 and Rac2, after fMLP stimulation (Tole et al., 2009). Since Rho
GTPases are important regulators of the cytoskeleton, the effects of Slit2 may go
beyond affecting the migration of a cell to include modulation of other functions such
as adhesion or phagocytosis, as these functions all involve actin cytoskeleton
remodelling.
1.5.2 Hypothesis
We hypothesize that Slit2/Robo-1 signaling can inhibit
monocyte/macrophage chemotaxis and modulate immune functions such as
adhesion to endothelial cells and phagocytosis of Ig-opsonized beads. We
hypothesize that Slit2 exerts its effects by suppressing the activity of Rho GTPases
Rac and Cdc42. However, we hypothesize that Slit2/Robo-1 signaling will have no
effect on the activation of MAPKs, as was observed in primary human neutrophils
(Tole et al., 2009). In addition, we hypothesize that Slit2, administered to mice
intraperitoneally or intravenously will inhibit monocyte/macrophage recruitment to
the peritoneal cavity, in vivo, in a murine model of sodium periodate-induced
inflammation.
1.5.3 Objectives
The first objective of this study is to determine if monocytes/macrophages
express the Slit2 receptor Robo-1. Monocytes/macrophages must express the
36
receptor in order to be responsive to the effects of Slit2. Next, the effect of Slit2 on
monocyte/macrophage chemotaxis will be characterized in vitro using transwell
chemotaxis assays and treatment with the monocyte/macrophage chemoattractant
SDF-1α. In addition, the intracellular signaling cascades that mediate Slit2/Robo-1
signaling in monocytes/macrophages will be investigated by observing the role of
Slit2 on Rho GTPases Cdc42 and Rac1, and on the Akt, Erk, and p38 MAPKs. Pull-
down assays for activated, or GTP-bound, Rho GTPases will be performed,
following incubation with Slit2 and activation with SDF-1α. To determine the effect
of Slit2 on MAPKs, western blots for phosphorylated and total MAPKs will be
performed, following incubation of monocytes/macrophages with Slit2 and treatment
with SDF-1α. The effect of Slit2 on monocyte/macrophage adhesion to activated
endothelial cells will also be investigated. Confluent endothelial cell monolayers will
be activated with a proinflammatory cytokine (TNF-α), and the adhesion of
monocytes/macrophages following incubation with Slit2 will be tested. Furthermore,
the effect of Slit2 on monocyte/macrophage recruitment in vivo using a murine
model of sodium periodate induced peritonitis will be conducted. Slit2 will be
administered intraperitoneally or intravenously an hour prior to the induction of
peritonitis, and peritoneal lavages will be performed to determine the number of
recruited monocytes/macrophages. In addition, the dose of Slit2 required to
optimally inhibit monocyte/macrophage recruitment in vivo will be determined by
performing a dose-response experiment using the murine peritonitis model and
intravenously administered Slit2. Furthermore, a time-course experiment will be
performed by administering Slit2 at 1 day, 4 days, and 10 days prior to inducing
37
peritonitis, to determine the biological half-life of intravenously administered Slit2.
Finally, the effect of Slit2 on other monocyte/macrophage functions involving Rho
GTPases, such as phagocytosis, will be investigated. To do this, phagocytosis
assays will be conducted with Ig-opsonized latex beads, and the
monocyte/macrophage phagocytosis following incubation with Slit2 will be
quantified.
38
CHAPTER 2
MATERIALS & METHODS
2.1 Reagents and antibodies
Unless otherwise stated, reagents were purchased from Sigma-Aldrich.
Monocyte isolation kit was purchased from StemCell Technologies. The following
primary antibodies were used: anti human Robo-1 (ab7279, Abcam, Cambridge,
MA), anti-myc 9E10 (Covance, QC, Canada), anti-human Cdc42 (Cell Signaling,
Danvers, MA), anti-human Rac1 (Upstate Biotechnology, Lake Placid, NY). The
following secondary antibodies were used: Cy-3 conjugated anti rabbit IgG, Cy-2
conjugated anti-human IgG, and horseradish peroxidase-conjugated anti rabbit IgG
(Jackson Immunoresearch Laboratories, Bar Harbor, ME). MAPK Antibodies were
purchased from Invitrogen Canada (Burlington, Ontario, Canada).
2.2 Isolation of human monocytes
Blood from healthy volunteers was obtained on each day of experimentation.
The monocytes were isolated using a Polymorphprep gradient separation solution
(Axis-Shield, Norway) and an EasySep® Negative Selection kit (StemCell
Technologies). A volume of blood was gently layered over an equal volume of
Polymorphprep solution, and centrifuged at 460 g for 35 minutes at an acceleration
of 2 units and deceleration of 0 units in order to prevent cell activation . The lower
layer containing peripheral blood mononuclear cells (PBMCs) was collected,
washed in cold PBS with 2% fetal bovine serum (FBS) and 1mM EDTA and
centrifuged at 260 g, room temperature for 5 min. When redness could still be seen
39
in the pellet, indicating the presence of red blood cells, an additional wash in cold
PBS with 2% FBS and 1 mM EDTA was performed. The EasySep® Negative
Selection procedure was performed according to the manufacturer‟s protocols.
Briefly, PBMCs (5x107 cells/mL) are labelled with EasySep® Human Monocyte
Enrichment Cocktail (50µg/mL cells)(StemCell Technologies) for 10 minutes at 4
°C. The Negative Selection Enrichment Cocktail contains a combination of
monoclonal antibodies that were purified from hybridoma culture supernatant by
affinity chromatography using Protein A or Protein G Sepharose. These antibodies
are bound in bispecific Tetrameric Antibody Complexes which are directed against
cell surface antigens on human leukocytes (CD2, CD3, CD16, CD19, CD20, CD56,
CD66b, CD123, glycophorin A) and dextran. These mouse monoclonal antibodies
are of the IgG1subclass. In addition, this cocktail also contains an FcR blocker to
prevent non-specific binding of monocytes. The antibody subclass of the FcR
blocker is IgG2b. The cells were then labelled with EasySep® Magnetic
Microparticles (50 µg/mL cells)(StemCell Technologies) for 5 minutes at 4 °C. The
Magnetic Microparticles contain a suspension of magnetic dextran iron particles in
TRIS buffer. Then, the EasySep® magnet was used to remove the magnetically
labelled cells, while the pure monocytes are poured off. The purified monocytes
were then resuspended in ice cold PBS with 2% FBS and 1 mM EDTA for
subsequent experiments. Experiments were performed within 1-2 hours of cell
isolation. Cell viability was determined to be >98% by Trypan blue staining
2.3 Cell culture
40
Human acute monocytic leukemia (THP-1) cells were cultured in RPMI-1640
(Sigma Chemical, St Louis, MO) supplemented with 5% FBS. Primary human
umbilical vein endothelial cells (HUVECs) and human arterial endothelial cells
(HAECs) were grown in endothelial basal medium 2 (EBM-2) supplemented with
Clonetics® EGM-2 SingleQuots® (Lonza, Walkersville, MD) These include: 10mL
FBS, 2mL of recombinant human fibroblast growth factor-B, 0.5mL of ascorbic acid,
0.5mL of recombinant human vascular endothelial growth factor, 0.5mL of
recombinant human epidermal growth factor, 0.5mL heparin, 0.2mL hydrocortisone,
0.5mL recombinant insulin-like growth factor-1, and 0.5mL gentamicin sulfate
amphotericin-B for 500mL of EBM-2. Only low passage cells (up to passage 11)
were used for adhesion experiments. Once cellular confluency was reached, cells
were passaged and/or seeded into 96-well clear bottom tissue culture plates for
adhesion experiments.
2.4 Slit2 expression and purification
Stable human embryonic kidney 293 cell line expressing full-length or N-
terminal human Slit2 with a His tag at its carboxyl terminus was used for Slit2
purification. Recombinant Slit2 was purified by Sylvie Perret and Dr. Yves Durocher
at the National Research Council of Canada. The presence of purified Slit2 was
confirmed by immunoblotting with poly anti-His antibody (Sigma A-7058). Following
purification, Slit2 was aliquotted, snap frozen and stored at -80 °C for future use.
Aliquots were never re-frozen or used after storage at 4 °C. In the experiments
described below, Slit2 was generally used at a concentration of 4.6 µg/ml diluted in
41
ice cold PBS. Endotoxin concentrations in our Slit2 preparation ranged from 0.2-0.8
ng/ml, yielding final experimental concentrations of 12-40 pg/ml which are well
below those thought to activate leukocytes (Moore et al., 2000). To verify this, we
added similar concentrations of endotoxin in neutrophil Transwell assays, and found
that such levels of endotoxin had no effect on neutrophil migration (Tole et al.,
2009).
2.5 Immunofluorescence
Primary human monocytes, murine RAW 264.7 macrophages and THP-1
cells were allowed to settle onto fibronectin-coated coverslips and allowed to adhere
for 3 minutes at room temperature (RT). The cells were then fixed with 4%
paraformaldehyde (PFA) for 10 minutes at RT. The cells were stained with rabbit
anti-Robo-1 (1µg/ml) for 2 hours at RT, washed with phosphate buffered saline
(PBS) and then incubated with Cy3-conjugated anti-rabbit secondary antibody for 1
hour at RT. A Leica DMIRE2 spinning disc confocal microscope (Leica
Microsystems, Toronto, Ontario, Canada) equipped with a Hamamatsu back-
thinned EM-CCD camera and Volocity software (Improvision Inc., Lexington, MA)
was used to capture images.
2.6 Transwell migration assay
Human THP-1 cells (1x106 cells/mL, 100 µL/condition) were incubated with
PBS vehicle or Slit2 at concentrations ranging from 46 ng/mL to 4.6 µg/ml for 10
minutes at 37°C and 5% CO2. The cells were then loaded into the top chamber of a
42
5 µm Transwell insert (Corning Life Sciences, Corning, NY) designed for a 24-well
plate. A glass coverslip was placed in the bottom well. The bottom chamber was
filled with 600 µL of serum-free RPMI-1640 alone or with SDF-1α (100ng/mL) in the
presence or absence of Slit2. Monocytes were allowed to migrate into the bottom
chamber for 3.5 hours at 37°C and 5% CO2. Following incubation, the monocytes
were rapidly spun down onto the coverslips (by centrifugation of the entire plate at
100 g, 1 min), fixed with 4% PFA, washed with PBS and labeled with DAPI dye for
visualization of cell nuclei. A Leica DMIRE microscope was used to take
representative high-power (40X) images and total number of cells was counted in at
least 10 random fields. The data represent the mean values ± SEM from at least 4
independent experiments.
2.7 Immunoblotting
THP-1 cells were serum starved overnight, resuspended in serum-free
RPMI-1640 (1x106 cells/mL) and incubated with either PBS vehicle or Slit2 (4.6
µg/mL) for 10 min at 37°C, 5% CO2. The cells were subsequently activated with
SDF-1α (100ng/mL) for 0, 2 and 5 minutes. The cells were then washed with 1 mL
of ice cold PBS. Next, the cells were lysed using ice-cold lysis buffer (50 mM Tris,
pH 7.5, 10% glycerol, 100 mM NaCl, 1% NP-40, 5 mM MgCl2, 1 mM DTT, 1 mM
PMSF, 1/100 protease inhibitor cocktail and 1 mM NaVO3). Protein samples were
added to 6x SDS gel loading buffer (1% ß-mercaptoethanol, 1% SDS, 30% glycerol,
0.0012% bromophenol blue, Tris HCl 0.28 M, pH 6.8). Samples were centrifuged
briefly at 10,000 rpm for 1 min. Protein gels were electrotransferred to poly-
43
vinyldene fluoride (PVDF) membranes (Millipore) in transfer buffer (25 mM Tris
base, 190 mM Glycine, 0.05% SDS, and 20% methanol) for 1.5 hr at 350 A at 4°C.
Membranes were probed for i) phosphorylated and total Akt, ii) phophorylated and
total Erk, and iii) phophorylated and total p38 MAP kinase. The membranes were
always probed with antibody detecting the phophorylated protein first, stripped, and
then reprobed with the antibody detecting total protein as a loading control.
Immunoreactive bands were visualized by enhanced chemiluminescence
(Amersham Biosciences, UK Ltd, Buckinghamshire, UK) and the signal captured
onto Kodak-Biomax film (Rochester, NY, USA). Image J software (NIH, Bethesda,
MA, USA) was used for densitometry analysis, and subsequent statistical analysis
was performed using Microsoft Excel.
2.8 Cdc42 and Rac2 activation assays
The pull-down assay for the Rho GTPases Cdc42 and Rac1 was performed
as previously described (Benard et al., 1999; Tole et al., 2009) with slight
modifications. The phosphate binding domain (PBD; 67-150 aa) of PAK1 in pGEX-
4T3 vector was expressed as a GST fusion protein in BL21 (DE3) E. coli cells. The
GST-PBD fusion protein was affinity purified using glutathione sepharose 4B beads
(GE Healthcare). THP-1 cells (1x107 cells/sample) diluted in 500 µL 37°C warmed
HEPES-HBSS were incubated with PBS vehicle or with 4.6 µg/ml Slit2 at 37°C and
5% CO2 for 10 minutes. Cells were then stimulated with SDF-1α (100ng/mL) for 0,
2, or 5 minutes at 37°C and the reactions were stopped by adding 500 µL ice-cold
lysis buffer. Samples were centrifuged at maximal speed in a bench-top centrifuge
44
for 5 min at 4°C and an aliquot of supernatant was used as a loading control. The
remaining supernatants were added to GST-PBD glutathione beads (20 mg
beads/sample). Samples were rotated at 4°C for 1 hour, washed 3 times with cold
wash buffer (50 mM Tris, pH 7.5, 40 mM NaCl, 0.5% NP-40, 30 mM MgCl2, 1 mM
DTT, 1 mM PMSF, 0.1 mM NaVO3 ) and added with 20 µLof 2 x Laemmli loading
buffer. The samples were then run on SDS-PAGE and transferred onto a 0.2 mm
PVDF membrane (Millipore). Cdc42 and Rac2 were detected using rabbit anti-
human Cdc42 (Cell Signaling, Danvers, MA) and rabbit anti-human Rac2 (Upstate
Biotechnology, Lake Placid, NY) primary antibodies and goat anti-rabbit HRP-
conjugated secondary antibodies. Densitometry analysis was performed on the
blots using Image J software (NIH, Bethesda, MA, USA). The data represent the
mean values ± SEM from 3 independent experiments.
2.9 Adhesion
Primary human endothelial cells (HUVECs and HAECs) were seeded
(~1x104 cells/well) in 96-well tissue culture plates and grown to confluence. Once
confluence was confirmed using a light microscope, the wells were aspirated and
replenished with endothelial basal medium 2 alone or with TNF-α (20 ng/mL). The
plates are then incubated at 37°C and 5% CO2 for 4 hours. THP-1 cells were
simultaneously labeled with Calcein AM at 37°C and 5% CO2 for 30 mins. After
labeling, monocytic THP-1 cells were washed once in 45 mL of PBS, pelleted (1500
rpm, 5 min) and resuspended in serum-free RPMI-1640 at 1x106 cells/mL. THP-1
cells were then incubated with PBS in the presence or absence of Slit2 (4.6 ug/mL)
45
at 37°C and 5% CO2 for 10 mins. The THP-1 cells were allowed to settle onto the
endothelial cell monolayers (1x105 cells/well) and incubated at 37°C and 5% CO2
for 30 mins. The plates were then centrifuged (100g, 1 min) upside down to remove
non-adherent cells. A fluorescent plate reader was used to measure the
fluorescence intensity of each well (494-517 nm for Calcein AM). Fluorescence
intensities are normalized to the unstimulated condition. The data represent the
mean values ± SEM from at least 4 independent experiments.
2.10 Murine peritonitis
Experimental murine peritonitis was carried out as previously described with
slight modification (Lotero et al., 2001; Jiang et al., 2005; Viriyakosol et al., 2005).
All procedures were performed in accordance with the Guide for the Humane Use
and Care of Laboratory Animals and were approved by The Hospital for Sick
Children Research Institute Animal Care Committee. For the experiments in Fig.
3.7, Slit2 (1.8 µg/mouse) was administered intraperitoneally to BALB/c mice
(Chares River Canada) an hour prior to sodium periodate induced peritonitis. For
the experiments in Fig. 3.8 and 3.9, CD1 mice were utilized. For the dose-titration
experiments presented in Fig. 3.8, Slit2 (4.6 µg, 460 ng or 46 ng) was administered
intravenously via tail-vein injection. For the time-course experiments presented in
Fig 3.9, we administered Slit2 intravenously (1.8 µg/mouse) at 1 day, 4 days, and
10 days prior to inducing peritonitis with sodium periodate (1mg/mouse) injected
intraperitoneally. For the experiments in Fig 3.7 and Fig. 3.8, peritonitis was induced
an hour after Slit2 or PBS treatment, with an intraperitoneal injection of sodium
46
periodate (1mg/mouse). Peritoneal lavages were performed after 24 hours with 5
mL of cold PBS containing 2% FBS. The cells were washed, red blood cells lysed
and hemocytometer counts performed. The data represent the mean values ± SEM
from at least 4 independent experiments.
2.11 Phagocytosis
Monocyte phagocytosis was performed as previously described (Yan et al.,
2007) with slight modifications. Human IgG (1 mg/ml) was coated onto 3.8 µm latex
beads for 2 hours at room temperature. RAW 264.7 macrophages were incubated
with Slit2 (600 ng/ml) or control medium (equal volume) for 10 minutes, exposed to
the latex beads, centrifuged (1000 rpm for 30s) to initiate phagocytosis, and plated
onto fibronectin-coated (20 µg/ml) coverslips. Phagocytosis was terminated after 30
min and external beads were labeled on ice using anti human Cy-2 conjugated
secondary antibody. Slit2 or control medium were present throughout the course of
phagocytosis. Images of at least 10 random fields were acquired using a Leica
deconvolution microscope. To determine the number of ingested particles, total
beads were counted using DIC and the number of external, fluorescently-labeled
beads were subtracted. The phagocytic index (number of ingested beads/ number
of cells) was used as an outcome measure.
2.12 Statistical analysis
Analysis of variance (ANOVA) followed by Bonferonni post-hoc tests were
performed using SPSS statistical software to analyze the data from adhesion
47
experiments. In all other cases, the Student‟s t-test was used. Significant difference
was considered for p<0.05. Graphic representation show mean ± SEM as variance
bars.
48
CHAPTER 3
RESULTS
3.1 Monocytes express the Slit2 receptor, Robo-1.
Immunoblotting confirmed Robo-1 protein expression in primary human
monocytes, mouse RAW 264.7 macrophages and human THP-1 monocytic cells.
Furthermore, immunofluorescence staining confirmed the presence of Robo-1 on
the surface of primary human monocytes and human monocytic THP-1 cells, co-
localizing with a membrane marker (Fig. 3.1). Collectively, these data demonstrate
that primary human monocytes, mouse RAW 264.7 macrophages and human
monocytic THP-1 cells express the Slit2 receptor, Robo-1.
3.2 Slit2 inhibits chemotaxis of human monocytic THP-1 cells.
The neuronal literature has clearly demonstrated the role of Slit2 as a
repellent of neuronal cells and projecting axons. More recent studies have shown
that Slit2 may act as a general chemorepellent, since it was shown to inhibit the
chemotaxis of diverse cell types, including: smooth muscle cells (Liu, et al., 2006),
DCs (Guan, et al. 2003), T lymphocytes (Prasad, et al., 2007), RAW 264.7
macrophages (Kanellis, et al., 2004) and primary human neutrophils (Tole et al.,
2009). Since human monocytes also expressed Robo-1, we hypothesized that Slit2
also inhibits monocyte chemotaxis.
Transwell migration assays were performed to determine the effect of Slit2
on monocyte chemotaxis. Human monocytic THP-1 cells were utilized for these
experiments. THP-1 cells failed to migrate in the absence of the chemokine SDF-1α
49
(Fig. 3.2A&C). When SDF-1α (100 ng/mL) was added to the bottom chamber,
monocytic THP-1 cell migration to the lower chamber was significantly increased
(Fig. 3.2B), p<0.01. To test the effect of Slit2 on monocytic THP-1 cell chemotaxis,
we incubated the cells with Slit2 (4.6 µg/ml) for 10 minutes and tested their ability to
migrate when Slit2 (4.6 µg/ml) alone (Fig. 3.2C) or Slit2 with SDF-1α (100 ng/mL)
(Fig. 3.2D) was added to the bottom chamber. In the absence of a chemokine
gradient, monocytic THP-1 cells pre-treated with Slit2 failed to migrate to the bottom
chamber (Fig. 3.2C). However, Slit2 treated cells exhibited decreased chemotaxis in
the presence of a chemokine gradient (Fig. 3.2D), p<0.01. In addition, we tested the
effect of N-Slit2, a cleaved N-terminal fragment containing all four LRR required for
signaling, on the chemotaxis of monocytic THP-1 cells. Monocytic THP-1 cells
treated with N-Slit2 also exhibited decreased chemotaxis in the presence of a
chemokine gradient (Fig. 3.2D), p<0.01. These data demonstrate that both the full
length Slit2 and N-Slit2 can inhibit SDF-1α-mediated chemotaxis of monocytic THP-
1 cells, but no effect on monocytic THP-1 cell chemotaxis is observed in the
absence of a chemokine gradient.
3.3. Slit2 treatment inhibits activation of Rac2 and Cdc42
Slit2 has been shown to inhibit migration of neuronal cells via recruitment to
the intracellular domain of Robo of a novel family of Slit Robo Rho GTPase
activating proteins (srGAPs). srGAPs convert the active GTP-bound forms of Rho
GTPases, Cdc42 and Rac1, to their inactive GDP-bound forms. (Wong et al., 2001).
In a study of vascular smooth muscle cell migration, Slit2 was shown to suppress
50
the activation of Rac1 (Liu et al., 2006). Rac1 and Cdc42 have been demonstrated
to play critical roles in leukocyte polarization and chemotaxis. HL-60 cells
transfected with dominant-negative construct of Cdc42 show impaired migration
(Srinivasan et al., 2003). Therefore, we hypothesized that the observed decrease in
monocyte chemotaxis may be due to Slit2-mediated inactivation of Rac1 and/or
Cdc42. We utilized the p21-binding domain (PBD) of PAK1, which only binds to
active GTP-bound forms of Rac1 and Cdc42 (Benard et al., 1999), conjugated to
GST beads (GST-PBD) in order to pull down activated forms of Rac1 and Cdc42.
Human monocytic THP-1 cells were incubated with PBS in the presence or absence
of Slit2 (4.6 µg/mL) for 10 minutes and then stimulated with SDF-1α (100 ng/mL) for
2 minutes. Activated Rho GTPases were pulled down using GST-PBD beads.
Subsequently, immunoblotting was performed for Cdc42 and Rac1. Unstimulated
monocytic THP-1 cells had low basal levels of activated Rac1 and Cdc42.
Stimulation with SDF-1α led to a 6.4 fold increase (†, p<0.05) in GTP-bound Cdc42
and a 21.6 fold (†, p<0.05) increase in GTP-bound Rac1, compared with
unstimulated cells (Fig. 3.3). Slit2 treatment alone had no effect on baseline
activation of Rac1 and Cdc42 (Fig. 3.3). However, Slit2 treatment significantly
reduced SDF-1α mediated activation of Cdc42 and Rac1 (Fig. 3.3). Monocytic THP-
1 cells incubated with Slit2 had a 3.8 fold (†, p<0.05) increase in GTP-bound Cdc42
and a 12.2 fold (†, p<0.05) increase in GTP-bound Rac1, compared to unstimulated
cells. These data suggest that a disruption in SDF-1α-mediated Rho GTPase
activation is involved in Slit2-mediated inhibition of monocytic THP-1 cell
51
chemotaxis towards SDF-1α. The data represent the mean values ± SEM from 4
independent experiments.
3.4. Akt and Erk, but not p38 MAPK pathways are affected by Slit2 treatment.
The signal transduction pathways leading from chemoattractant receptor
activation to chemotaxis are not fully understood. Generally, chemoattractant
receptor stimulation activates several MAPK pathways including: PI3K/Akt, Erk and
p38. In neutrophils, PI3K-dependent production of PIP3 and subsequent recruitment
and activation of Akt MAPK at the leading edge is important for migration (Heit et
al., 2002). Another study in human monocytes demonstrated that an inhibitor of
MEK inhibited MAPK activation and MCP-1-mediated chemotaxis (Yen et al., 1997).
In fact, MCP-1-mediated chemotaxis of monocytic THP-1 cells was shown to be Erk
MAPK dependent (Kintscher et al., 2000). Thus, MAPK inhibitors can arrest
chemotaxis. Therefore, we tested the effect of Slit2 on chemoattractant-induced
activation of Akt, Erk and p38 MAPK pathways in human monocytic THP-1 cells.
Stimulation with SDF-1α induced robust activation of the Akt and Erk MAPK
pathways (Fig. 3.4A). However, no activation of the p38 MAPK was observed (Fig
3.4A & D). Stimulation with SDF-1α for 5 minutes led to a 2.9 fold increase (†,
p<0.05) in phosphorylated Akt and a 3.2 fold (†, p<0.05) increase in phosphorylated
Erk, compared with unstimulated cells (Fig. 3.4A-C). Incubation with Slit2 alone had
no effect on baseline activation of Akt, Erk and p38 MAPKs (Fig. 3.3). However,
incubation with Slit2 significantly reduced SDF-1α-mediated activation of Akt and
Erk MAPKs at 5 minutes, although no effect was observed for p38 MARK (Fig. 3.3).
52
Monocytic THP-1 cells incubated with Slit2 had a 1.7 fold (†, p<0.05) increase in
phosphorylated Akt and a 1.9 fold (†, p<0.05) increase in phosphorylated Erk,
compared to unstimulated cells. Therefore, incubation with Slit2 decreased the
activation of Akt and Erk MAPKs (Fig. 3.4A-C) at 5 minutes after SDF-1α
stimulation. However, incubation with Slit2 had no effect on the p38 MAPK pathway
(Fig. 3.4A & D). These results suggest that Slit2 treated monocytes might have a
defect in the synthesis of PIP3 and subsequent recruitment and activation of Akt
MAPK.
3.5. Slit2 inhibits adhesion of monocytic THP-1 cells to activated human
umbilical vein endothelial cell and human arterial endothelial cell monolayers.
After their initial recruitment, monocytes must firmly arrest on the
endothelium and undergo diapedesis to reach inflammatory foci. Integrins on the
surface of leukocytes bind to Ig superfamily members such as ICAM-1 and VCAM-1
on the surface of endothelial cells (Ley et al., 2007). Rho GTPases participate in
many cellular processes that transmit signals from the cell surface to influence the
activity of the actin cytoskeleton (Sechi et al., 2000). Leukocyte adhesion to
endothelial cells requires outside-in signaling which can be initiated by integrin
ligation and clustering, which is partially dependent on Rho GTPases (Ley et al.,
2007). Since Slit2 inhibits the activation of Cdc42 and Rac2 Rho GTPases, we
tested the effect of Slit2 on adhesion of monocytic THP-1 cells to endothelial cells.
Endothelial cells were activated with TNF-α for 4 hours in order to simulate
inflammation and increase endothelial expression of adhesion molecules. Monocytic
53
THP-1 cells were allowed to adhere for 30 minutes and the plates centrifuged
upside down at 100xg for 1 min to remove non-adherent cells. For HUVECs (Fig.
3.5), Slit2 treatment alone had no effect on cell adhesion, whereas TNF-α
stimulation of endothelial monolayers increased baseline adhesion to almost 400%,
p<0.005 (Fig. 3.5). When monocytic THP-1 cells were incubated with Slit2,
adhesion was abolished to near baseline levels, P<0.05 (Fig. 3.5). Since adhesion
characteristics differ for different types of endothelial cells, we wanted to use cell
types similar to those affected in human cardiovascular disease. Therefore, we
utilized primary HAECs to confirm our findings from HUVECs. The same trend was
observed for HAECs (Fig. 3.6), Slit-treatment alone had no effect of cell adhesion,
while TNF-α stimulation of endothelial monolayers increased baseline adhesion by
over 200%, p<0.01 (Fig. 3.6). When monocytic THP-1 cells were incubated with
Slit2, adhesion was abolished to near baseline levels, P<0.005 (Fig. 3.6). These
data suggest that Slit2 may play a role in monocyte adhesion to vascular and
arterial endothelium under inflammatory conditions.
3.6 Slit2 inhibits monocyte recruitment in vivo.
We showed that Slit2 inhibits monocyte chemotaxis and adhesion to
activated endothelial cells. Thus, we wanted to investigate the functional relevance
of these observations. To study the effects of Slit2 on monocyte recruitment in vivo,
we used a previously described mouse model of chemical irritant peritonitis (Jiang
et al., 2005; Viriyakosol et al., 2005). Sodium periodate injection alone induced
peritonitis, with robust monocyte recruitment compared to control mice (Fig.3.7,
54
p<0.001). Intraperitoneal administration of Slit2 diminished monocyte recruitment
nearly four-fold (Fig. 3.7; p<0.001). Next, we wanted to test whether the effect of
Slit2 is dose-dependent. Again, injection of sodium periodate alone induced
vigorous peritonitis when compared to control (Fig. 3.8, p<0.05). Slit2 significantly
inhibited monocyte recruitment at doses of 4.6 and 0.46 µg (Fig. 3.8, p<0.05).
Although administration of 46 ng of Slit2 decreased monocyte recruitment by half,
this effect was not statistically significant (Fig. 3.8). Finally, we performed a time-
course experiment to determine the duration of Slit2 biological activity following
intravenous administration. Again, female CD1 mice were utilized for these
experiments. Slit2 (1.8 µg/mouse) was administered intravenously at 10 days, 4
days and 1 day prior to induction of experimental peritonitis. Sodium periodate
alone induced vigorous peritonitis when compared to control (Fig 3.9, p<0.001).
Intravenous administration of Slit2 one day before peritonitis completely abolished
cell recruitment to baseline (Fig 3.9, p<0.001). When Slit2 was administered
intravenously 4 days prior to the induction of peritonitis, monocyte recruitment was
again significantly inhibited (Fig 3.9, p<0.01). However, pre-treatment with Slit2 at
10 days prior to induction of peritonitis had no effect on monocyte recruitment.
Thus, these data indicate that Slit2 has very potent effects on in vivo monocyte
recruitment, with persistent biological activity even when administered 4 days prior
to an inflammatory insult. This suggests that local or systemic administration of Slit2
may be used to alleviate monocyte recruitment in inflammation and atherosclerosis.
Because Slit2 is heavily glycosylated, it is relatively 'sticky' and may achieve high
55
local concentrations by interacting with ECM components such as glypican-1
(Ronca et al., 2001).
3.7 Slit2 does not alter monocyte phagocytosis.
Monocytes/macrophages are professional antigen presenting cells and can
therefore internalize and destroy pathogens and cellular debris. They can also
internalize opsonized or non-opsonized targets. This is mediated by Fc receptors for
Igs and the integrin Mac-1 for complement components (Aderem et al., 1999). Rho
GTPases were shown to be required for calcium signaling and phagocytosis by Fcγ
receptors in macrophages (Hackam et al., 1997; Caron et al., 1998). Since Slit2
inhibits the activation of Rho GTPases, we tested the effect of Slit2 on monocyte
phagocytosis. RAW macrophages were centrifuged together with IgG-opsonized
latex beads to initiate phagocytosis for 10 minutes. External beads were
subsequently fluorescently labeled and images of at least 10 random fields were
captured. Slit2 treatment had no effect on the phagocytic index (number of ingested
particles/ number of cells) of RAW 264.7 macrophages (Fig 3.10A&B; Min Rui-Crow
performed these experiments).
56
57
Figure 3.1 Slit2 is expressed by monocytes.
Robo-1 expression has been confirmed in primary human monocytes and
human monocytic THP-1 cells. A, western blotting for Robo1 protein in murine
RAW 264.7 macrophages, human monocytic THP-1 cells and primary human
monocytes. B, Surface immunofluorescence staining showing the
co-localization of cell surface Robo-1 and a membrane marker. These results
confirm the presence of the Robo-1 receptor on the surface of monocytic
THP-1 cells, RAW 264.7 macrophages and primary human monocytes.
58
59
Figure 3.2 Slit2 inhibits monocyte chemotaxis.
Monocyte chemotaxis was studied in vitro using a Transwell membrane inserts. A,
Human monocytic THP-1 cells failed to migrate in the absence of SDF-1α (Fig.
3.2A). When SDF-1α (100 ng/mL) was added to the bottom chamber, THP-1 cells
exhibited increased migration to the lower chamber (Fig. 3.2A) (†, p<0.001). To test
the effect of Slit2 on THP-1 chemotaxis, we incubated the cells with Slit2 (4.6 µg/ml)
for 10 minutes and tested their ability to migrate when Slit2 (4.6 µg/ml) alone (Fig.
3.2A) or Slit2 with SDF-1α (Fig. 3.2A) was added to the bottom chamber. In the
absence of a chemokine gradient, THP-1 cells incubated with Slit2 failed to migrate
to the bottom chamber (Fig. 3.2A). Slit2 treatment decreased chemotaxis towards
an SDF-1α gradient (Fig. 3.2A) (†, p<0.001). B, THP-1 cells were incubated with
full-length Slit2, N-terminal Slit2 or PBS vehicle for 10 minutes prior to migration.
Slit2 and the chemokine SDF-1α were added to the bottom well only. After 3.5
hours, the number of migrated cells was quantified microscopically. Both the full
length protein and the N-terminal fragment of Slit2 were able to inhibit THP-1 cell
chemotaxis towards an SDF-1α gradient (†, p<0.001).
60
61
Figure 3.3 Slit2 inhibits activation of Rho GTPases (Cdc42 and Rac1).
Human monocytic THP-1 cells were incubated with PBS alone or containing
Slit2 (4.6 μg/mL) for 10 minutes and stimulated with SDF-1α (100ng/mL) for
2 minutes and lysates collected. GTP-bound or activated Cdc42 and Rac1 were
pulled down using GST-PBD beads. A, Western blots showing the activation of
Rho GTPases Cdc42 and Rac1 with SDF-1α stimulation. B&C, The graphs
depicts the band intensities normalized to the loading controls. Unstimulated
monocytic THP-1 cells had low basal levels of activated Rac1 and Cdc42.
Stimulation with SDF-1α led to a 6 fold increase (†, p<0.05) in GTP-bound Cdc42
and a 21 fold (†, p<0.05) increase in GTP-bound Rac1, compared with unstimulated
cells. Slit2 treatment alone had no effect on baseline activation of Rac1 and Cdc42.
However, Slit2 treatment significantly reduced SDF-1α mediated
activation of Cdc42 and Rac1. Monocytic THP-1 cells incubated with Slit2
had a 4 fold (†, p<0.05) increase in GTP-bound Cdc42 and a 12 fold
(†, p<0.05) increase in GTP-bound Rac1, compared to unstimulated cells.
The data represent the mean values ±SEM from 4 independent experiments.
62
63
Figure 3.4 Slit2 inhibits Akt and Erk but not p38 MAPKs.
Human monocytic THP-1 cells were incubated with PBS vehicle or containing Slit2
(4.6 μg/mL) for 10 minutes and stimulated with SDF-1α (100ng/mL) for 5 minutes
and lysates collected. A, Western blots showing the activation of Erk, Akt and p38
MAPKs over time with SDF-1α stimulation. Blotting with phospho antibodies was
performed first, then the membranes were stripped and reprobed with antibodies for
the total protein to use for loading controls. B&C&D, Graphs depict the band
intensities normalized to the loading controls. Stimulation with SDF-1α induced
robust activation of the Akt and Erk MAPK pathways (Fig. 3.4A&B&C). However, no
activation of the p38 MAPK was observed (Fig 3.4A&D). Stimulation with SDF-1α
for 5 minutes led to a 2.9 fold increase (†, p<0.05) in phosphorylated Akt and a 3.2
fold (†, p<0.05) increase in phosphorylated Erk, compared with unstimulated cells
(Fig. 3.4A&B&C). Incubation with Slit2 alone had no effect on baseline activation of
Akt, Erk and p38 MAPKs (Fig. 3.4). However, incubation with Slit2 significantly
reduced SDF-1α-mediated activation of Akt and Erk MAPKs at 5 minutes, although
no effect was observed for p38 MARK (Fig. 3.4). Monocytic THP-1 cells incubated
with Slit2 had only a 1.7 fold (†, p<0.05) increase in phosphorylated Akt and a 1.9
fold (†, p<0.05) increase in phosphorylated Erk. Therefore, incubation with Slit2
decreased the activation of Akt and Erk MAPKs (Fig. 3.4A&B&C) at 5 minutes after
SDF-1α stimulation. However, incubation with Slit2 had no effect on the p38 MAPK
pathway (Fig. 3.4A&D). The data represent the mean values ±SEM from 8
independent experiments.
64
65
Figure 3.5 Slit2 inhibits adhesion of monocytic THP-1 cells to human
umbilical vein endothelial cells.
HUVEC monolayers were stimulated with TNF-α for 4 hours and human
monocytic THP-1 cells were incubated with PBS vehicle alone or containing
Slit2 (4.6µg/mL) for 10 minutes. Slit-treatment alone had no effect on cell
adhesion, while adhesion to activated endothelial monolayers increased
from baseline to almost 400% (†, p<0.005). When THP-1 cells were
incubated with Slit2, adhesion was abolished to near baseline levels (‡, P<0.05).
66
67
Figure 3.6 Slit2 inhibits adhesion of monocytic THP-1 cells to human
arterial endothelial cells.
HAEC monolayers were activated with TNF-α for 4 hours and human monocytic
THP-1 cells were incubated with PBS vehicle alone or containing Slit2 (4.6µg/mL).
Slit2 treatment alone had no effect of cell adhesion, whereas TNF-α stimulation of
the endothelial monolayers increased baseline adhesion by over 200% (†, p<0.01).
When monocytic THP-1 cells were incubated with Slit2, adhesion was
abolished to near baseline levels (‡, p<0.005).
68
69
Figure 3.7 Slit2 inhibits monocyte recruitment in vivo.
Monocyte recruitment was determined in vivo using a model of murine peritonitis.
PBS alone or containing Slit2 (1.8µg/mouse) was administered intraperitoneally one
hour prior to sodium periodate induced peritonitis. Sodium periodate (1mg/mouse)
was injected intraperitoneally and peritoneal lavages were performed after 24 hours.
Sodium periodate alone induced vigorous peritonitis, reflected in the robust
monocyte recruitment (†, p<0.001). Intraperitoneal pretreatment with 1.8µg of Slit2
significantly inhibited monocyte recruitment (†, p<0.001) (n=5).
70
71
Figure 3.8 Slit2 dose-dependently inhibits monocyte recruitment in vivo.
Monocyte recruitment was determine in vivo using a model of murine peritonitis.
Slit2 was administered intravenously via tail-vein injections at 4.6 µg/mouse, 460
ng/mouse and 46 ng/mouse prior to sodium periodate induced peritonitis. Sodium
periodate (1 mg/mouse) was injected intraperitoneally and peritoneal lavages were
performed after 24 hours. Sodium periodate alone induced vigorous peritonitis,
reflected in the robust monocyte recruitment (†, p<0.05). However, pre-treatment
with 4600 ng or 460 ng of Slit2 significantly diminished monocyte recruitment (†,
p<0.05).
72
73
Figure 3.9 Slit2 inhibits monocyte/macrophage recruitment in vivo:
time-course.
Monocyte/macrophage recruitment was studied in an in vivo model of murine
peritonitis. Slit2 (1.8 µg/mouse) was administered intravenously via tail-vein
injections at 1, 4 and 10 days prior to sodium periodate induced peritonitis. Sodium
periodate (1 mg/mouse) was injected intraperitoneally and peritoneal lavages were
performed after 24 hours. Sodium periodate alone induced vigorous peritonitis,
reflected in the high number of recruited monocytes/macrophages (†, p<0.001).
Intravenous pre-treatment with Slit2 at 1 day and 4 days prior to induction of
peritonitis significantly diminished monocyte/macrophage recruitment († ,p<0.001)
at 1 day and (‡ ,p<0.01) at 4 days.
74
75
Figure 3.10 Slit2 does not affect RAW 264.7 macrophage phagocytosis.
Murine RAW 264.7 macrophages were centrifuged together with IgG-
opsonized latex beads to initiate phagocytosis for 10 minutes. External
beads were then fluorescently labeled and images of at least 10 random
fields were captured. A, Representative images of control and Slit2
treated RAW macrophages performing IgG-mediated phagocytosis. B, Slit2
treatment had no effect on the phagocytic index (number of ingested
particles/ number of cells) of RAW 264.7 macrophages.
76
CHAPTER 4
DISCUSSION & CONCLUSIONS
The aim of this project was to determine the effect of Slit2 on monocyte
chemotaxis, adhesion, and phagocytosis in vitro. Furthermore, we wanted to
determine whether Slit2 can inhibit monocyte recruitment in vivo. We have shown
that primary human monocytes and human monocytic THP-1 cells express the Slit2
receptor, Robo-1, and that Slit2 blocks monocyte migration in response to a SDF-1α
gradient. This finding is consistent with observations in the literature on the effect of
Slit2 on Robo-1 expressing cells. In fact, Slit2 has been shown to inhibit the
chemotaxis of a number of human hematopoetic cell types, including T-cells and
DCs (Guan et al., 2003; Kanellis et al., 2004; Prasad et al., 2007). In addition, we
have previously demonstrated that Slit2 inhibited the chemotaxis of circulating
human neutrophils (Tole et al., 2009).
Although Slit2 has been demonstrated to inhibit the chemotaxis of diverse
cell types, the mechanisms underlying its actions are not understood completely.
Chemotaxis is a complex process in which the cell polarizes to form a wide lamella
at the leading edge and a tail-like uropod in the trailing edge. Forward propulsion is
dependent on rapid turnover and polymerization of actin filaments. We have
previously shown that treatment of circulating human neutrophils with Slit2 reduced
chemokine-mediated generation of free barbed ends required for actin
polymerization at the leading edge (Tole et al., 2009; Glogauer et al., 2000). This
observation is consistent with previous findings in neuronal cells linking Slit2/Robo-1
signaling with proteins that are involved in the mobilization of the actin cytoskeleton,
77
such as Ena and srGAP (Bashaw et al., 2000; Wong et al., 2001). srGAP activates
Rho GTPases Rac and Cdc42, which are important for actin turnover in migrating
cells. Cdc42 is responsible for maintaining directionality, by driving the formation of
filopodia to sample extracellular cues, while Rac drives actin assembly in
lamellipodia required for forward propulsion during chemotaxis (Srinivasan et al.,
2003). We have found that Slit2 inhibits chemokine-mediated activation of Cdc42 in
human monocytic THP-1 cells. Our finding is consistent with studies in neuronal
cells and in our previous studies in primary human neutrophils, where Slit2 was
shown to inhibit activation of Cdc42, preventing these cells from undergoing
directional migration up a chemotactic gradient (Wong et al., 2001; Tole et al.,
2009). Furthermore, we have shown that Slit2 decreased chemokine-mediated
activation of Rac1 in monocytic THP-1 cells. Our observation is consistent with
Slit2-mediated suppression of Rac activation in studies of human vascular smooth
muscle cells and human T lymphocytes (Liu et al., 2006; Kanellis et al.,
2004;Prasad et al., 2007). Indeed, we have previously shown that Slit2 suppressed
the activation of Rac in circulating human neutrophils (Tole et al., 2009).
GPCR-mediated signaling in monocytes, as in other leukocytes, leads to
rapid phospholipid metabolism and the activation of MAPK pathways, including Akt,
Erk, and p38. Disruption of these pathways, using chemical inhibitors, has been
shown to inhibit chemotaxis (Heit et al., 2001). We have shown that Slit2 inhibited
chemokine-induced activation of Akt MAPK. This suggests that Slit2 may affect
phospholipid metabolism, specifically the generation of PIP3 at the plasma
membrane, which is required for the recruitment and activation of Akt MAPK. Our
78
observation is consistent with a previous report which found that in human breast
cancer cells, Slit2 inhibited chemokine-mediated activation of PI3K, and subsequent
activation of Akt MAPK (Prasad et al., 2004). Moreover, Slit2 was also shown to
inhibit SDF-1α-induced activation of Akt in Jurkat T cells (Prasad et al., 2007).
However, this trend in Slit2-mediated inhibition of SDF-1α-induced Akt MAPK
activation is inconsistent with our study in circulating human neutrophils, where Slit2
was shown to have no effect on the fMLP-induced activation of Akt, Erk and p38
MAPKs (Tole et al., 2009). We have also found that Slit2 inhibited SDF-1α-induced
activation of Erk MAPK. This finding is consistent with a study in human breast
cancer cells, where Slit2 inhibited SDF-1α-induced activation of Erk MAPK (Prasad
et al., 2004). However, our observation is inconsistent with studies in granulocytic
cells (Wu et al., 2001) and in our previous report in circulating human neutrophils,
where no Slit2-mediated inhibition in Erk MAPK activation was observed (Tole et al.,
2009). Finally, we have shown that Slit2 did not affect SDF-1α-induced p38 MAPK
activation, consistent with findings on Jurkat T lymphocytes and in our previous
report in circulating human neutrophils (Prasad et al, 2007; Tole et al., 2009). These
differential effects of Slit2 on MAPK activity may be attributable to differences in cell
types used or in the chemoattractants used for stimulation. For example, our
previous study on circulating human neutrophils utilized the bacterial product fMLP
to stimulate the MAPK pathways, while this study utilized the chemokine SDF-1α.
This is further supported by the consistency of our findings with those in human
breast cancer cells, where SDF-1α was also utilized for MAPK activation.
79
In order to be recruited from circulation and extravasate, monocytes must
undergo a series of coordinated interactions with vascular endothelial cells. During
acute inflammation, or in chronic inflammatory conditions such as atherosclerosis,
the local cytokine microenvironment activates vascular endothelial cells to express
increased levels of adhesion molecules. These activated endothelial cells are able
to efficiently capture circulating leukocytes, including monocytes, facilitating their
arrest and diapedesis across the vessel wall. To determine if Slit2 affects monocyte
adhesion, we performed adhesion assays using endothelial monolayers activated
with the proinflammatory cytokine TNF-α. We have shown that Slit2 inhibited
adhesion of monocytic THP-1 cells to activated endothelial monolayers, specifically
HUVECs and HAECs. Our observations are consistent with a study of human
breast cancer cells which found that Slit2 inhibited CXCL12-mediated adhesion to
ligands such as fibronectin and collagen (Prasad et al., 2004). Furthermore, Slit2
has previously been shown to block Jurkat T cell adhesion to activated HUVEC
monolayers. Consistent with this line of evidence is a recent report showing that the
Slit/Robo pathway functions to antagonize E-cadherin-mediated cell adhesion of
Drosophila cardioblasts during development (Santiago-Martnez et al., 2008). Since
Rho GTPases are also involved in the actin mobilization required for cell adhesion,
it is likely that the signaling events downstream of Slit2/Robo-1 influence the ability
of the cell to form adhesive contacts. Further studies should explore the effect of
Slit2 on the adhesion of monocytes to Ig superfamily ligands, ICAM-1 and VCAM-1,
which are important in physiological cell adhesion. In addition, GPCR-mediated
activation of monocytes during rolling induces outside-in and inside-out signaling
80
pathways which lead to changes in integrin avidity on monocytes. Thus, future
studies should also explore the effect of Slit2 on transient upregulation of monocyte
integrin affinity induced by chemokines and other chemoattractants, using the
methods of Chan et al. (2003).
Signals elicited by chemokines and other chemoattractants activate
leukocyte β1- and β2-integrins, resulting in tight adhesion to the vascular
endothelium and induction of cytoskeleton-driven leukocyte migration. Many
chemokines can bind to transmembrane heparan sulphate proteoglycans on the
luminal surface of the endothelium in order to be presented to leukocytes
(Spillmann et al., 1998; Halden et al., 2004). When chemokines bind to these
proteoglycans, the chemokine receptor binding site remains exposed (Proudfoot et
al., 2000). This allows the chemokine to interact with its chemokine receptor
expressed on leukocytes in order to elicit a rapid integrin activation signal. Complex
signaling networks regulate the affinity of integrins, via spatial separation and
unfolding of the two integrin chains, and the avidity of integrins, by increasing lateral
mobility and clustering (Kim et al., 2003).
RAP1 and RAP2 are small GTPases of the RAS family that play an important
role in chemokine-mediated inside-out signaling, which activates the integrins LFA-1
and VLA-4 (Katagiri et al., 2000; McLeod et al., 2004). RAP1 is expressed by most
haematopoietic cells, cycling between an inactive GDP-bound form and an active
GTP-bound form. Like other GTPases, its activity is regulated by the GEF exchange
factor directly activated by cyclic AMP (EPAC) and the GAPs signal-induced
proliferation associated antigen 1 (SPA1) and RAPGAPII (Bos, L., 2003). Recent
81
reports have shown that CCL21 and SDF-1α rapidly activate RAP1 to its active,
GTP-bound, form (Bos, L., 2003, Shimonaka et al., 2003). The chemokine-mediated
activation of RAP1 induces LFA-1- and VLA-4-dependent adhesion and migration
(McLeod et al., 2004; Shimonaka et al., 2003). This is controlled by leukocyte
adhesion to ICAM-1 and VCAM-1 expressed by activated endothelial cells. The
importance of RAP1 is highlighted in studies of leukocytes transfected with
constitutively active RAP1, which are able to adhere and migrate independently of a
chemokine signal (Shimonaka et al., 2003; Tohyama et al., 2003). Furthermore,
transfection with RAP1 GAPs, SPA1 or RAPGAPII, blocks integrin-mediated cell
adhesion and migration. RAP1 modulates integrin affinity by binding to RAPL. This
complex then activates integrins by binding to a conserved GLY-PHE-PHE-LYS-
ARG motif on the integrin α-chain. Interestingly, overexpression of RAPL has been
shown to activate integrin-mediated cell adhesion, while overexpression of a RAPL
mutant that is incapable of binding RAP1 inhibits adhesion (Katagiri et al., 2003).
Therefore, the chemokine-induced activation of RAP1 is important for the signaling
networks that activate leukocyte integrins. In order to gain a better mechanistic
understanding of the Slit2-mediated inhibition of monocyte adhesion to activated
endothelium, future studies should explore the effect of Slit2/Robo-1 signaling on
the activation of RAP1 and on the activity and localization of its GEFs and GAPs.
In addition to RAP1 and RAPL, there are other signaling networks that
contribute to the rapid chemokine-induced integrin activation. Talin is a cytoskeletal
protein consisting of a globular head and a rod-like domain. The head domain can
bind to the ASN-PRO-XAA-TYR/PHE motif on the β-chain of integrins. This binding
82
activates the integrin by keeping the cytoplasmic domains of the α- and β-chains
separated, allowing the unfolding of the extracellular domain and exposure of the
ligand-binding pocket (Kim et al., 2003; Tadokoro et al., 2003). Although the
mechanism by which talin regulates chemokine-mediated integrin activation is
incompletely understood, it is believed to be required for integrin activation
downstream of several signaling pathways (Tadokoro et al., 2003). Furthermore, the
protease calpain can cleave talin between the head and rod domains. Once
cleaved, the head domain has a six fold higher affinity for the integrin β-chain than
does the intact molecule, allowing for more efficient integrin activation (Calderwood,
A., 2004). This cleavage may allow for further regulation of talin-mediated integrin
activation. In addition, the binding of phosphoinositol phosphate kinase type Iγ to
talin regulates talin-integrin interactions by enhancing the binding affinity of talin for
the integrin β-chain (Di Paulo et al., 2002; Ling et al., 2002; Martel et al., 2001).
Finally, phosphorylation of a tyrosine residue on the integrin talin-binding motif by
SRC-family kinases prevents talin-mediated integrin activation (Datta et al., 2002;
Sakai et al., 2001). Thus, talin may play a regulatory role in the chemokine-induced
integrin-mediated leukocyte adhesion. Future experiments to elucidate the
mechanism by which Slit2/Robo-1 signaling inhibits monocyte adhesion to activated
endothelial cells should include an investigation of talin. Specifically, the effect of
Slit2/Robo-1 signaling on talin phosphorylation and cleavage should be addressed.
Another important regulatory signaling pathway leading to integrin activation
involves RhoA. RhoA is a member of the RAS superfamily of GTPases, and is
involves in integrin activation, membrane ruffling, stress fiber formation and cell
83
migration (Alblas et al., 2001; Ridley et al., 1994; Laudanna et al., 2002). Several
studies have demonstrated that blocking RhoA or its downstream targets increases
monocyte adhesion to ICAM-1 ligand (Worthylake et al., 2003; Smith et al., 2003).
The effect of RhoA is complex, as it is activated by both chemokines and ligand-
bound integrins on adherent cells. Several RhoA-interacting adaptors are required
for β2-integrin-dependent adhesion to ICAM-1, and these provide another
mechanism for the tuning of integrin-mediated adhesion induced by chemokines.
Thus, RhoA regulates integrin-mediated adhesion via the activation of integrins, the
regulation of lateral integrin mobility in the plasma membrane and the effect on the
actin cytoskeleton. Future experiments to shed light on the mechanism by which
Slit2/Robo-1 signaling inhibits monocyte adhesion to activated endothelial cells
should include an investigation of RhoA activity. In addition, the effect of Slit2/Robo-
1 signaling on RhoA GAPs and GEFs should be addressed.
Another signaling network regulating integrin-mediated leukocyte adhesion
via the modulation of cell polarity involves atypical protein kinase C-δ (PKC-δ)
(Wang et al., 2003; Etienne-Manneville et al., 2003). Chemokines induce the kinase
activity of PKC-δ, via its interaction with PI3K and RhoA, resulting in its targeting to
the plasma membrane where it leads to increased integrin mobility (Giagulli et al.,
2004). This is required for the clustering of activated integrins, leading to high
integrin avidity, allowing leukocytes to rapidly induce firm adhesion during rolling.
Furthermore, it has been shown that further activation of adherent cells by
chemokines results in PKC-δ localization to the lamellipodium (Wang et al., 2003).
Therefore, PKC-δ plays a role in leukocyte polarity and in the reinforcement of
84
integrin-mediated cell adhesion. Future experiments into the mechanism by which
Slit2/Robo-1 signaling inhibits monocyte adhesion should include an investigation of
PKC-δ. Specifically, the effect of Slit2/Robo-1 signaling on PKC-δ activation and
membrane targetting should be addressed.
Since we found that Slit2 can inhibit monocyte chemotaxis and adhesion in
vitro, we next sought to investigate if it will work in vivo. To test the in vivo
recruitment of monocytes to inflammatory foci, we used a sodium periodate-induced
model of experimental murine peritonitis. When Slit2 is administered
intraperitoneally, it gets absorbed systemically (Kanellis et al., 2004). We have
shown that when Slit2 was administered intraperitoneally an hour prior to inducing
peritonitis, monocyte recruitment to the peritoneal cavity was significantly abolished.
This supports our previous observation which demonstrated that Slit2 administered
intraperitoneally was able to effectively diminish neutrophil recruitment in the same
murine model of experimental peritonitis induced by sodium periodate (Tole et al.,
2009). Thus, Slit2 may inhibit the recruitment of different subsets of leukocytes in
vivo. Moreover, we have previously shown that Slit2 can inhibit the recruitment of
neutrophils in vivo to diverse chemoattractants administered intraperitoneally,
including MIP-1 and C5a (Tole et al., 2009). To determine the dose of Slit2 required
to exert an optimal biological effect, we administered Slit2 intravenously at
decreasing doses (46 ng - 4.6 µg). We have found that Slit2 was able to exert a
significant effect on monocyte recruitment in vivo even when administered at 460
ng/mouse, although the effect wore off with further dilution. Furthermore, due to the
potent effect of Slit2 on leukocyte recruitment in vivo, we sought to determine the
85
timing of Slit2 administration required to induce an optimal biological effect. We
found that Slit2 significantly abolished monocyte recruitment when administered 1
day or 4 days prior to induction of peritonitis, although the effect of Slit2 was slightly
diminished at 4 days, compared to the effect at 1 day. Literature on the exogenous
application of Slit2 is scarce. These findings suggests that Slit2 can persist in the
circulation in order to exert a biological effect for up to 4 days. Due to its extensive
glycosylation and hence 'stickiness', Slit2 may associated with GAGs on the
endothelial lumen. This is consistent with findings that human full-length Slit2 and
N-terminal Slit2 are tightly associated with the cell membrane (Brose et al., 1999).
This property allows Slit2 to be concentrated on the endothelial lumen, where it can
signal and exert an effect on leukocytes as they interact with the vessel wall. In
addition, the extensive glycosylation on Slit2 may confer protection from
degradation by proteases, which may further increase its biological half life.
Phagocytosis is a vital monocyte/macrophage function required for innate
and adaptive immunity. Once monocytes are recruited to inflammatory foci, they
must engulf pathogens for immune clearance or antigen presentation. Since Rho
GTPases are involved in the actin mobilization required to form pseudopods and
engulf particles, we speculated that Slit2 might have an effect on monocyte
phagocytosis. To determine the effect of Slit2 on monocyte phagocytosis, we
performed phagocytosis assays with Ig-opsonized latex beads. We have found that
Slit2 had no effect on monocyte phagocytosis. Although this finding was surprising,
since Rho GTPases Rac and Cdc42 are involved in phagocytosis, this finding is
consistent with a recent report demonstrating that Slit2 treatment had no effect on
86
neutrophil phagocytosis of Ig-opsonized latex beads (unpublished observations).
This observations may be due to the fact that Slit2 only acts on polarized or
polarizing cells. Thus, further studies are needed to elucidate the precise effect of
Slit2 on leukocyte phagocytosis.
In our current study, we have shown that Slit2 can inhibit the chemotaxis of
monocytic THP-1 cells to gradients of SDF-1α. It is likely that this inhibition is
mediated by the ability of Slit2 to inhibit Rho GTPases Cdc42 and Rac1, and
therefore, the polymerization and turnover of actin, and mobilization of the actin
cytoskeleton. Consistent with this hypothesis is our observation that Slit2 inhibited
the adhesion of monocytic THP-1 cells to activated endothelial cells, since adhesion
is also dependent on Rho GTPase-mediated actin mobilization. However, it is
surprising that Slit2 had no effect on monocyte phagocytosis, as this process is also
dependent on Rho GTPases-mediated dynamic actin regulation. Although further
studies into the mechanism of Slit2 action is necessary, our data strongly support
the use of Slit2 as a novel anti-inflammatory agent. Currently, many anti-
inflammatory agents act via general suppression of immune activation and function,
and thus have serious side effects. Although Slit2 may also have
immunosuppressive effects, targeted local delivery of Slit2 could be utilized to
prevent localized inflammatory cell recruitment and the associated tissue damage,
while preserving the overall function of the immune system in the host. Our data
demonstrate that Slit2 can selectively inhibit monocyte recruitment and adhesion to
the vessel wall, while preserving vital immune functions such as phagocytosis.
87
REFERENCES
Aderem, A., & Underhill, D. M. (1999). Mechanisms of phagocytosis in
macrophages. Annual Review of Immunology, 17, 593-623.
Akagawa, K. S., Takasuka, N., Nozaki, Y., Komuro, I., Azuma, M., Ueda, M., et al.
(1996). Generation of CD1䗩 dendritic cells and tartrate-resistant acid
phosphatase-positive osteoclast-like multinucleated giant cells from human
monocytes. Blood, 88(10), 4029-4039.
Alblas, J., Ulfman, L., Hordijk, P., & Koenderman, L. (2001). Activation of rhoa and
ROCK are essential for detachment of migrating leukocytes. Molecular Biology
of the Cell, 12(7), 2137-2145.
Allen, W. E., Jones, G. E., Pollard, J. W., & Ridley, A. J. (1997). Rho, rac and
Cdc42 regulate actin organization and cell adhesion in macrophages. Journal of
Cell Science, 110(6), 707-720.
Allen, W. E., Zicha, D., Ridley, A. J., & Jones, G. E. (1998). A role for Cdc42 in
macrophage chemotaxis. The Journal of Cell Biology, 141(5), 1147-1157.
Alon, R., Hammer, D. A., & Springer, T. A. (1995). Lifetime of the P-selectin-
carbohydrate bond and its response to tensile force in hydrodynamic flow.
Nature, 374(6522), 539.
88
Amatruda, T. T., Gerard, N. P., Gerard, C., & Simon, M. I. (1993). Specific
interactions of chemoattractant factor receptors with G-proteins. The Journal of
Biological Chemistry, 268(14), 10139-10144.
An, G., Wang, H., Tang, R., Yago, T., McDaniel, J. M., McGee, S., et al. (2008). P-
selectin glycoprotein ligand-1 is highly expressed on ly-6Chi monocytes and a
major determinant for ly-6Chi monocyte recruitment to sites of atherosclerosis
in mice. Circulation, 117(25), 3227-3237.
Aspenström, P. (1999). Effectors for the rho GTPases. Current Opinion in Cell
Biology, 11(1), 95.
Astrof, N., Salas, A., Shimaoka, M., Chen, J., & Springer, T. (2006). Importance of
force linkage in mechanochemistry of adhesion receptors. Biochemistry, 45(50),
15020.
Auffray, C., Fogg, D., Garfa, M., Elain, G., Join-Lambert, O., Kayal, S., et al. (2007).
Monitoring of blood vessels and tissues by a population of monocytes with
patrolling behavior. Science, 317(5838), 666-670.
Barleon, B., Sozzani, S., Zhou, D., Weich, H. A., Mantovani, A., & Marm, D. (1996).
Migration of human monocytes in response to vascular endothelial growth
factor (VEGF) is mediated via the VEGF receptor flt-1. Blood, 87(8), 3336-3343.
89
Bashaw, G. J., Kidd, T., Murray, D., Pawson, T., & Goodman, C. S. (2000).
Repulsive axon guidance: Abelson and enabled play opposing roles
downstream of the roundabout receptor. Cell, 101(7), 703-715.
Battye, R., Stevens, A., & Jacobs, J. R. (1999). Axon repulsion from the midline of
the drosophila CNS requires slit function. Development, 126(11), 2475-2481.
Battye, R., Stevens, A., Perry, R. L., & Jacobs, J. R. (2001). Repellent signaling by
slit requires the leucine-rich repeats. The Journal of Neuroscience, 21(12),
4290-4298.
Benard, V., Bohl, B. P., & Bokoch, G. M. (1999). Characterization of rac and cdc42
activation in chemoattractant-stimulated human neutrophils using a novel assay
for active GTPases. The Journal of Biological Chemistry, 274(19), 13198.
Bertoli-Avella, A., Conte, M., Punzo, F., de Graaf, B., Lama, G., La Manna, A., et al.
(2008). ROBO2 gene variants are associated with familial vesicoureteral reflux.
Journal of the American Society of Nephrology, 19(4), 825-831.
Bokoch, G. M. (2005). Regulation of innate immunity by rho GTPases. Trends in
Cell Biology, 15(3), 163.
Bos, J. L. (2003). Epac: A new cAMP target and new avenues in cAMP research.
Nature Reviews.Molecular Cell Biology, 4(9), 733.
90
Botelho, R. J., Teruel, M., Dierckman, R., Anderson, R., Wells, A., York, J. D., et al.
(2000). Localized biphasic changes in phosphatidylinositol-4,5-bisphosphate at
sites of phagocytosis. The Journal of Cell Biology, 151(7), 1353-1368.
Boulay, F., Naik, N., Giannini, E., Tardif, M., & Brouchon, L. (1997). Phagocyte
chemoattractant receptors. Annals of the New York Academy of Sciences, 832,
69-84.
Brakebusch, C., & Fssler, R. (2003). The integrin-actin connection, an eternal love
affair. EMBO Journal, 22(10), 2324-2333.
Bretscher, M. S. (1996). Getting membrane flow and the cytoskeleton to cooperate
in moving cells. Cell, 87(4), 601.
Brose, K., Bland, K. S., Wang, K. H., Arnott, D., Henzel, W., Goodman, C. S., et al.
(1999). Slit proteins bind robo receptors and have an evolutionarily conserved
role in repulsive axon guidance. Cell, 96(6), 795-806.
Brown, E. J. (1991). Complement receptors and phagocytosis. Current Opinion in
Immunology, 3(1), 76.
Bustelo, X. (2002). Regulation of vav proteins by intramolecular events. Frontiers in
Bioscience, 7, d24-d30.
Calderwood, D. A. (2004). Integrin activation. Journal of Cell Science, 117(5), 657.
91
Calderwood, D. A., Shattil, S. J., & Ginsberg, M. H. (2000). Integrins and actin
filaments: Reciprocal regulation of cell adhesion and signaling. The Journal of
Biological Chemistry, 275(30), 22607-22610.
Campbell, J. J., Hedrick, J., Zlotnik, A., Siani, M. A., Thompson, D. A., & Butcher, E.
C. (1998). Chemokines and the arrest of lymphocytes rolling under flow
conditions. Science, 279(5349), 381.
Campbell, J. J., Qin, S., Bacon, K. B., Mackay, C. R., & Butcher, E. C. (1996).
Biology of chemokine and classical chemoattractant receptors: Differential
requirements for adhesion-triggering versus chemotactic responses in lymphoid
cells. The Journal of Cell Biology, 134(1), 255.
Carman, C., & Springer, T. (2003). Integrin avidity regulation: Are changes in affinity
and conformation underemphasized? Current Opinion in Cell Biology, 15(5),
547-556.
Caron, E., & Hall, A. (1998). Identification of two distinct mechanisms of
phagocytosis controlled by different rho GTPases. Science, 282(5394), 1717-
1721.
Carson, M., Weber, A., & Zigmond, S. H. (1986). An actin-nucleating activity in
polymorphonuclear leukocytes is modulated by chemotactic peptides. The
Journal of Cell Biology, 103(6), 2707-2714.
92
Casey, P. J., Solski, P. A., Der, C. J., & Buss, J. E. (1989). p21ras is modified by a
farnesyl isoprenoid. Proceedings of the National Academy of Sciences of the
United States of America, 86(21), 8323-8327.
Castelli, W. P. (1984). Epidemiology of coronary heart disease: The framingham
study. The American Journal of Medicine, 76(2), 4.
Chan, J., Hyduk, S., & Cybulsky, M. (2003). Detecting rapid and transient
upregulation of leukocyte integrin affinity induced by chemokines and
chemoattractants. Journal of Immunological Methods, 273(1-2), 43-52.
Chapuis, F., Rosenzwajg, M., Yagello, M., Ekman, M., Biberfeld, P., & Gluckman, J.
C. (1997). Differentiation of human dendritic cells from monocytes in vitro.
European Journal of Immunology, 27(2), 431-441.
Chen, J. H., Wen, L., Dupuis, S., Wu, J. Y., & Rao, Y. (2001). The N-terminal
leucine-rich regions in slit are sufficient to repel olfactory bulb axons and
subventricular zone neurons. The Journal of Neuroscience, 21(5), 1548-1556.
Chen, J., Wu, W., Li, H., Fagaly, T., Zhou, L., Wu, J., et al. (2000). Embryonic
expression and extracellular secretion of xenopus slit. Neuroscience, 96(1),
231.
Clapham, D. E., & Neer, E. J. (1993). New roles for G-protein beta gamma-dimers
in transmembrane signalling. Nature, 365(6445), 403-406.
93
Combadire, C., Potteaux, S., Gao, J., Esposito, B., Casanova, S., Lee, E., et al.
(2003). Decreased atherosclerotic lesion formation in CX3CR1/apolipoprotein E
double knockout mice. Circulation, 107(7), 1009-1016.
Constantin, G., Majeed, M., Giagulli, C., Piccio, L., Kim, J. Y., Butcher, E. C., et al.
(2000). Chemokines trigger immediate beta2 integrin affinity and mobility
changes: Differential regulation and roles in lymphocyte arrest under flow.
Immunity, 13(6), 759.
Correia, I., Chu, D., Chou, Y., Goldman, R., & Matsudaira, P. (1999). Integrating the
actin and vimentin cytoskeletons: Adhesion-dependent formation of fimbrin-
vimentin complexes in macrophages. The Journal of Cell Biology, 146(4), 831.
Critchley, D. R., Holt, M. R., Barry, S. T., Priddle, H., Hemmings, L., & Norman, J.
(1999). Integrin-mediated cell adhesion: The cytoskeletal connection.
Biochemical Society Symposia, 65, 79-99.
Crittenden, J., Bergmeier, W., Zhang, Y., Piffath, C., Liang, Y., Wagner, D., et al.
(2004). CalDAG-GEFI integrates signaling for platelet aggregation and
thrombus formation. Nature Medicine, 10(9), 982-986.
Cybulsky, M. I., & Gimbrone, M. A. (1991). Endothelial expression of a mononuclear
leukocyte adhesion molecule during atherogenesis. Science, 251(4995), 788-
791.
94
Dallol, A., Da Silva, N., Viacava, P., Minna, J., Bieche, I., Maher, E., et al. (2002).
SLIT2, a human homologue of the drosophila Slit2 gene, has tumor suppressor
activity and is frequently inactivated in lung and breast cancers. Cancer
Research, 62(20), 5874-5880.
Dallol, A., Krex, D., Hesson, L., Eng, C., Maher, E., & Latif, F. (2003). Frequent
epigenetic inactivation of the SLIT2 gene in gliomas. Oncogene, 22(29), 4611-
4616.
Dallol, A., Morton, D., Maher, E., & Latif, F. (2003). SLIT2 axon guidance molecule
is frequently inactivated in colorectal cancer and suppresses growth of
colorectal carcinoma cells. Cancer Research, 63(5), 1054-1058.
Datta, A., Huber, F., & Boettiger, D. (2002). Phosphorylation of beta3 integrin
controls ligand binding strength. The Journal of Biological Chemistry, 277(6),
3943-3949.
DeBiasio, R. L., Wang, L. L., Fisher, G. W., & Taylor, D. L. (1988). The dynamic
distribution of fluorescent analogues of actin and myosin in protrusions at the
leading edge of migrating swiss 3T3 fibroblasts. The Journal of Cell Biology,
107(6), 2631-2645.
Defacque, H., Egeberg, M., Habermann, A., Diakonova, M., Roy, C., Mangeat, P.,
et al. (2000). Involvement of ezrin/moesin in de novo actin assembly on
phagosomal membranes. EMBO Journal, 19(2), 199-212.
95
DeFife, K. M., Jenney, C. R., Colton, E., & Anderson, J. M. (1999). Cytoskeletal and
adhesive structural polarizations accompany IL-13-induced human macrophage
fusion. The Journal of Histochemistry and Cytochemistry, 47(1), 65-74.
DeMali, K., Wennerberg, K., & Burridge, K. (2003). Integrin signaling to the actin
cytoskeleton. Current Opinion in Cell Biology, 15(5), 572-582.
Di Paolo, G., Pellegrini, L., Letinic, K., Cestra, G., Zoncu, R., Voronov, S., et al.
(2002). Recruitment and regulation of phosphatidylinositol phosphate kinase
type 1 gamma by the FERM domain of talin. Nature, 420(6911), 85-89.
Dickinson, R., Dallol, A., Bieche, I., Krex, D., Morton, D., Maher, E., et al. (2004).
Epigenetic inactivation of SLIT3 and SLIT1 genes in human cancers. The
British Journal of Cancer, 91(12), 2071.
Dunne, J., Ballantyne, C., Beaudet, A., & Ley, K. (2002). Control of leukocyte rolling
velocity in TNF-alpha-induced inflammation by LFA-1 and mac-1. Blood, 99(1),
336.
Eriksson, E. E., Xie, X., Werr, J., Thoren, P., & Lindbom, L. (2001). Importance of
primary capture and L-selectin-dependent secondary capture in leukocyte
accumulation in inflammation and atherosclerosis in vivo. The Journal of
Experimental Medicine, 194(2), 205.
Etienne-Manneville, S., & Hall, A. (2003). Cdc42 regulates GSK-3beta and
adenomatous polyposis coli to control cell polarity. Nature, 421(6924), 753-756.
96
Fenteany, G., & Glogauer, M. (2004). Cytoskeletal remodeling in leukocyte function.
Current Opinion in Hematology, 11(1), 15-24.
Finger, E. B., Puri, K. D., Alon, R., Lawrence, M. B., von Andrian, U. H., & Springer,
T. A. (1996). Adhesion through L-selectin requires a threshold hydrodynamic
shear. Nature, 379(6562), 266.
Friedl, P. (2004). Prespecification and plasticity: Shifting mechanisms of cell
migration. Current Opinion in Cell Biology, 16(1), 14.
Friedl, P., & Wolf, K. (2009). Proteolytic interstitial cell migration: A five-step
process. Cancer and Metastasis Reviews, 28(1-2), 129-135.
Fujiyama, A., & Tamanoi, F. (1990). RAS2 protein of saccharomyces cerevisiae
undergoes removal of methionine at N terminus and removal of three amino
acids at C terminus. The Journal of Biological Chemistry, 265(6), 3362-3368.
Gamblin, S. J., & Smerdon, S. J. (1998). GTPase-activating proteins and their
complexes. Current Opinion in Structural Biology, 8(2), 195-201.
Geissmann, F., Jung, S., & Littman, D. (2003). Blood monocytes consist of two
principal subsets with distinct migratory properties. Immunity, 19(1), 71-82.
Gertler, F. B., Bennett, R. L., Clark, M. J., & Hoffmann, F. M. (1989). Drosophila abl
tyrosine kinase in embryonic CNS axons: A role in axonogenesis is revealed
through dosage-sensitive interactions with disabled. Cell, 58(1), 103-113.
97
Gether, U. (2000). Uncovering molecular mechanisms involved in activation of G
protein-coupled receptors. Endocrine Reviews, 21(1), 90.
Giagulli, C., Scarpini, E., Ottoboni, L., Narumiya, S., Butcher, E., Constantin, G., et
al. (2004). RhoA and zeta PKC control distinct modalities of LFA-1 activation by
chemokines: Critical role of LFA-1 affinity triggering in lymphocyte in vivo
homing. Immunity, 20(1), 25-35.
Glogauer, M., Hartwig, J., & Stossel, T. (2000). Two pathways through Cdc42
couple the N-formyl receptor to actin nucleation in permeabilized human
neutrophils. The Journal of Cell Biology, 150(4), 785-796.
Glogauer, M., Marchal, C., Zhu, F., Worku, A., Clausen, B., Foerster, I., et al.
(2003). Rac1 deletion in mouse neutrophils has selective effects on neutrophil
functions. The Journal of Immunology, 170(11), 5652-5657.
Gordon, S. (1986). Biology of the macrophage. Journal of Cell Science.Supplement,
4, 267-286.
Gordon, S. (1998). The role of the macrophage in immune regulation. Research in
Immunology, 149(7-8), 685.
Grage-Griebenow, E., Flad, H. D., & Ernst, M. (2001). Heterogeneity of human
peripheral blood monocyte subsets. Journal of Leukocyte Biology, 69(1), 11-20.
Greenberg, S., & Grinstein, S. (2002). Phagocytosis and innate immunity. Current
Opinion in Immunology, 14(1), 136-145.
98
Guan, H., Zu, G., Xie, Y., Tang, H., Johnson, M., Xu, X., et al. (2003). Neuronal
repellent Slit2 inhibits dendritic cell migration and the development of immune
responses. The Journal of Immunology, 171(12), 6519-6526.
Gutierrez, L., Magee, A. I., Marshall, C. J., & Hancock, J. F. (1989). Post-
translational processing of p21ras is two-step and involves carboxyl-methylation
and carboxy-terminal proteolysis. EMBO Journal, 8(4), 1093-1098.
Gyetko, M. R., Todd, R. F., Wilkinson, C. C., & Sitrin, R. G. (1994). The urokinase
receptor is required for human monocyte chemotaxis in vitro. Journal of Clinical
Investigation, 93(4), 1380-1387.
Hackam, D., Rotstein, O., Schreiber, A., Zhang, W., & Grinstein, S. (1997). Rho is
required for the initiation of calcium signaling and phagocytosis by fcgamma
receptors in macrophages. The Journal of Experimental Medicine, 186(6), 955.
Halden, Y., Rek, A., Atzenhofer, W., Szilak, L., Wabnig, A., & Kungl, A. (2004).
Interleukin-8 binds to syndecan-2 on human endothelial cells. The Biochemical
Journal, 377(Pt 2), 533.
Hall, A. L., Warren, V., Dharmawardhane, S., & Condeelis, J. (1989). Identification
of actin nucleation activity and polymerization inhibitor in ameboid cells: Their
regulation by chemotactic stimulation. The Journal of Cell Biology, 109(5),
2207-2213.
99
Hao, J. C., Yu, T. W., Fujisawa, K., Culotti, J. G., Gengyo-Ando, K., Mitani, S., et al.
(2001). C. elegans slit acts in midline, dorsal-ventral, and anterior-posterior
guidance via the SAX-3/Robo receptor. Neuron, 32(1), 25-38.
Heit, B., Tavener, S., Raharjo, E., & Kubes, P. (2002). An intracellular signaling
hierarchy determines direction of migration in opposing chemotactic gradients.
Science Signaling, 159(1), 91.
Hirsch, E., Katanaev, V. L., Garlanda, C., Azzolino, O., Pirola, L., Silengo, L., et al.
(2000). Central role for G protein-coupled phosphoinositide 3-kinase gamma in
inflammation. Science, 287(5455), 1049-1053.
Holmes, G. P., Negus, K., Burridge, L., Raman, S., Algar, E., Yamada, T., et al.
(1998). Distinct but overlapping expression patterns of two vertebrate slit
homologs implies functional roles in CNS development and organogenesis.
Mechanisms of Development, 79(1-2), 57-72.
Holmes, G., & Niswander, L. (2001). Expression of slit-2 and slit-3 during chick
development. Developmental Dynamics, 222(2), 301-307.
Howard, T. H., & Meyer, W. H. (1984). Chemotactic peptide modulation of actin
assembly and locomotion in neutrophils. The Journal of Cell Biology, 98(4),
1265-1271.
100
Hume, D., Ross, I., Himes, S. R., Sasmono, R. T., Wells, C., & Ravasi, T. (2002).
The mononuclear phagocyte system revisited. Journal of Leukocyte Biology,
72(4), 621-627.
Huo, Y., Schober, A., Forlow, S. B., Smith, D., Hyman, M., Jung, S., et al. (2003).
Circulating activated platelets exacerbate atherosclerosis in mice deficient in
apolipoprotein E. Nature Medicine, 9(1), 61.
Imboden, J. B., & Stobo, J. D. (1985). Transmembrane signalling by the T cell
antigen receptor. perturbation of the T3-antigen receptor complex generates
inositol phosphates and releases calcium ions from intracellular stores. The
Journal of Experimental Medicine, 161(3), 446-456.
Imhof, B., & Aurrand-Lions, M. (2004). Adhesion mechanisms regulating the
migration of monocytes. Nature Reviews.Immunology, 4(6), 432.
Itoh, A., Miyabayashi, T., Ohno, M., & Sakano, S. (1998). Cloning and expressions
of three mammalian homologues of drosophila slit suggest possible roles for slit
in the formation and maintenance of the nervous system. Molecular Brain
Research, 62(2), 175-186.
Jiang, N., & Pisetsky, D. (2005). The effect of inflammation on the generation of
plasma DNA from dead and dying cells in the peritoneum. Journal of Leukocyte
Biology, 77(3), 296-302.
101
Jin, T., Zhang, N., Long, Y., Parent, C. A., & Devreotes, P. N. (2000). Localization of
the G protein betagamma complex in living cells during chemotaxis. Science,
287(5455), 1034-1036.
Johnson, Z., Proudfoot, A. E., & Handel, T. M. (2005). Interaction of chemokines
and glycosaminoglycans: A new twist in the regulation of chemokine function
with opportunities for therapeutic intervention. Cytokine Growth Factor Reviews,
16(6), 625.
Jones, G. E., Allen, W. E., & Ridley, A. J. (1998). The rho GTPases in macrophage
motility and chemotaxis. Cell Adhesion Communication, 6(2-3), 237-245.
Jones, S. L., Wang, J., Turck, C. W., & Brown, E. J. (1998). A role for the actin-
bundling protein L-plastin in the regulation of leukocyte integrin function.
Proceedings of the National Academy of Sciences of the United States of
America, 95(16), 9331-9336.
Jung, U., Norman, K. E., Scharffetter-Kochanek, K., Beaudet, A. L., & Ley, K.
(1998). Transit time of leukocytes rolling through venules controls cytokine-
induced inflammatory cell recruitment in vivo. Journal of Clinical Investigation,
102(8), 1526.
Kanellis, J., Garcia, G., Ping, L., Parra, G., Wilson, C., Rao, Y., et al. (2004).
Modulation of inflammation by slit protein in vivo in experimental crescentic
glomerulonephritis. The American Journal of Pathology, 165(1), 341.
102
Kansas, G. S. (1996). Selectins and their ligands: Current concepts and
controversies. Blood, 88(9), 3259.
Katagiri, K., Hattori, M., Minato, N., Irie, S. k., Takatsu, K., & Kinashi, T. (2000).
Rap1 is a potent activation signal for leukocyte function-associated antigen 1
distinct from protein kinase C and phosphatidylinositol-3-OH kinase. Molecular
and Cellular Biology, 20(6), 1956-1969.
Katagiri, K., Maeda, A., Shimonaka, M., & Kinashi, T. (2003). RAPL, a Rap1-binding
molecule that mediates Rap1-induced adhesion through spatial regulation of
LFA-1. Nature Immunology, 4(8), 741-748.
Keep, N. H., Barnes, M., Barsukov, I., Badii, R., Lian, L. Y., Segal, A. W., et al.
(1997). A modulator of rho family G proteins, rhoGDI, binds these G proteins
via an immunoglobulin-like domain and a flexible N-terminal arm. Structure,
5(5), 623-633.
Kennedy, J., Kelner, G. S., Kleyensteuber, S., Schall, T. J., Weiss, M. C., Yssel, H.,
et al. (1995). Molecular cloning and functional characterization of human
lymphotactin. The Journal of Immunology, 155(1), 203.
Kennedy, T. E., Serafini, T., de la Torre, J. R., & Tessier-Lavigne, M. (1994). Netrins
are diffusible chemotropic factors for commissural axons in the embryonic
spinal cord. Cell, 78(3), 425-435.
103
Kidd, T., Brose, K., Mitchell, K. J., Fetter, R. D., Tessier-Lavigne, M., Goodman, C.
S., et al. (1998). Roundabout controls axon crossing of the CNS midline and
defines a novel subfamily of evolutionarily conserved guidance receptors. Cell,
92(2), 205-215.
Kim, M., Carman, C., & Springer, T. (2003). Bidirectional transmembrane signaling
by cytoplasmic domain separation in integrins. Science, 301(5640), 1720-1725.
Kintscher, U., Goetze, S., Wakino, S., Kim, S., Nagpal, S., Chandraratna, R. A., et
al. (2000). Peroxisome proliferator-activated receptor and retinoid X receptor
ligands inhibit monocyte chemotactic protein-1-directed migration of monocytes.
European Journal of Pharmacology, 401(3), 259-270.
Kintscher, U., Goetze, S., Wakino, S., Kim, S., Nagpal, S., Chandraratna, R. A., et
al. (2000). Peroxisome proliferator-activated receptor and retinoid X receptor
ligands inhibit monocyte chemotactic protein-1-directed migration of monocytes.
European Journal of Pharmacology, 401(3), 259-270.
Kjoller, L., & Hall, A. (1999). Signaling to rho GTPases. Experimental Cell
Research, 253(1), 166-179.
Kramer, S. G., Kidd, T., Simpson, J. H., & Goodman, C. S. (2001). Switching
repulsion to attraction: Changing responses to slit during transition in
mesoderm migration. Science, 292(5517), 737-740.
104
Krugmann, S., Hawkins, P. T., Pryer, N., & Braselmann, S. (1999). Characterizing
the interactions between the two subunits of the p101/p110gamma
phosphoinositide 3-kinase and their role in the activation of this enzyme by G
beta gamma subunits. The Journal of Biological Chemistry, 274(24), 17152-
17158.
Kunkel, E. J., & Ley, K. (1996). Distinct phenotype of E-selectin-deficient mice. E-
selectin is required for slow leukocyte rolling in vivo. Circulation Research,
79(6), 1196.
Lanier, L. M., Gates, M. A., Witke, W., Menzies, A. S., Wehman, A. M., Macklis, J.
D., et al. (1999). Mena is required for neurulation and commissure formation.
Neuron, 22(2), 313-325.
Laudanna, C., Kim, J., Constantin, G., & Butcher, E. (2002). Rapid leukocyte
integrin activation by chemokines. Immunological Reviews, 186, 37.
Laurent, V., Loisel, T. P., Harbeck, B., Wehman, A., Grbe, L., Jockusch, B. M., et al.
(1999). Role of proteins of the Ena/VASP family in actin-based motility of listeria
monocytogenes. The Journal of Cell Biology, 144(6), 1245-1258.
Lawrence, M. B., Kansas, G. S., Kunkel, E. J., & Ley, K. (1997). Threshold levels of
fluid shear promote leukocyte adhesion through selectins (CD62L,P,E). The
Journal of Cell Biology, 136(3), 717.
105
Lesnik, P., Haskell, C., & Charo, I. (2003). Decreased atherosclerosis in CX 3 CR1–
/–mice reveals a role for fractalkine in atherogenesis. Journal of Clinical
Investigation, 111(3), 333.
Ley, K., Laudanna, C., Cybulsky, M., & Nourshargh, S. (2007). Getting to the site of
inflammation: The leukocyte adhesion cascade updated. Nature
Reviews.Immunology, 7(9), 678-689.
Li, Z., Jiang, H., Xie, W., Zhang, W., Smrcka, A., & Wu, D. (2000). Roles of PLC-2
and-3 and PI3K in chemoattractant-mediated signal transduction. Science's
STKE, 287(5455), 1046.
Liang, Y., Annan, R. S., Carr, S. A., Popp, S., Mevissen, M., Margolis, R. K., et al.
(1999). Mammalian homologues of the drosophila slit protein are ligands of the
heparan sulfate proteoglycan glypican-1 in brain. The Journal of Biological
Chemistry, 274(25), 17885-17892.
Libby, P., & Aikawa, M. (2002). Stabilization of atherosclerotic plaques: New
mechanisms and clinical targets. Nature Medicine, 8(11), 1257-1262.
Linder, S., & Aepfelbacher, M. (2003). Podosomes: Adhesion hot-spots of invasive
cells. Trends in Cell Biology, 13(7), 376-385.
Ling, K., Doughman, R., Firestone, A., Bunce, M., & Anderson, R. (2002). Type I
gamma phosphatidylinositol phosphate kinase targets and regulates focal
adhesions. Nature, 420(6911), 89-93.
106
Liu, D., Hou, J., Hu, X., Wang, X., Xiao, Y., Mou, Y., et al. (2006). Neuronal
chemorepellent Slit2 inhibits vascular smooth muscle cell migration by
suppressing small GTPase Rac1 activation. Circulation Research, 98(4), 480-
489.
Lotero, L. A., Jordn, J. A., Olmos, G., Alvarez, F. J., Tejedor, M. C., & Diez, J. C.
(2001). Differential in vitro and in vivo behavior of mouse ascorbate/Fe3 and
diamide oxidized erythrocytes. Bioscience Reports, 21(6), 857-871.
Luster, A. D. (1998). Chemokines--chemotactic cytokines that mediate
inflammation. New England Journal of Medicine, the, 338(7), 436.
Machesky, L. M., & Hall, A. (1997). Role of actin polymerization and adhesion to
extracellular matrix in rac- and rho-induced cytoskeletal reorganization. The
Journal of Cell Biology, 138(4), 913-926.
Marillat, V., Cases, O., Nguyen-Ba-Charvet, K. T., Tessier-Lavigne, M., Sotelo, C.,
& Chdotal, A. (2002). Spatiotemporal expression patterns of slit and robo genes
in the rat brain. Journal of Comparative Neurology, 442(2), 130-155.
Martel, V., Racaud-Sultan, C., Dupe, S., Marie, C., Paulhe, F., Galmiche, A., et al.
(2001). Conformation, localization, and integrin binding of talin depend on its
interaction with phosphoinositides. The Journal of Biological Chemistry,
276(24), 21217-21227.
107
Martenson, C., Stone, K., Reedy, M., & Sheetz, M. (1993). Fast axonal transport is
required for growth cone advance. Nature, 366(6450), 66-69.
Mattila, P., & Lappalainen, P. (2008). Filopodia: Molecular architecture and cellular
functions. Nature Reviews.Molecular Cell Biology, 9(6), 446-454.
McEver, R. P., & Cummings, R. D. (1997). Perspectives series: Cell adhesion in
vascular biology. role of PSGL-1 binding to selectins in leukocyte recruitment.
Journal of Clinical Investigation, 100(3), 485.
McLeod, S., Shum, A., Lee, R., Takei, F., & Gold, M. (2004). The rap GTPases
regulate integrin-mediated adhesion, cell spreading, actin polymerization, and
Pyk2 tyrosine phosphorylation in B lymphocytes. The Journal of Biological
Chemistry, 279(13), 12009-12019.
Mitra, S., Hanson, D., & Schlaepfer, D. (2005). Focal adhesion kinase: In command
and control of cell motility. Nature Reviews.Molecular Cell Biology, 6(1), 56-68.
Moore, K. J., Andersson, L. P., Ingalls, R. R., Monks, B. G., Li, R., Arnaout, M. A., et
al. (2000). Divergent response to LPS and bacteria in CD14-deficient murine
macrophages. The Journal of Immunology, 165(8), 4272-4280.
Muller, W. A. (2001). New mechanisms and pathways for monocyte recruitment.
The Journal of Experimental Medicine, 194(9), 47.
108
Muller, W. A. (2003). Leukocyte–endothelial-cell interactions in leukocyte
transmigration and the inflammatory response. Trends in Immunology, 24(6),
326-333.
Murga, C., Laguinge, L., Wetzker, R., Cuadrado, A., & Gutkind, J. S. (1998).
Activation of Akt/protein kinase B by G protein-coupled receptors. A role for
alpha and beta gamma subunits of heterotrimeric G proteins acting through
phosphatidylinositol-3-OH kinasegamma. The Journal of Biological Chemistry,
273(30), 19080-19085.
Murray, C. J. L., & Lopez, D. (1997). Global mortality, disability, and the contribution
of risk factors: Global burden of disease study. The Lancet, 349, 1436.
Nassar, N., Hoffman, G. R., Manor, D., Clardy, J. C., & Cerione, R. A. (1998).
Structures of Cdc42 bound to the active and catalytically compromised forms of
Cdc42GAP. Nature Structural Biology, 5(12), 1047-1052.
Neptune, E. R., & Bourne, H. R. (1997). Receptors induce chemotaxis by releasing
the betagamma subunit of gi, not by activating gq or gs. Proceedings of the
National Academy of Sciences of the United States of America, 94(26), 14489-
14494.
Nguyen Ba-Charvet, K. T. N., Brose, K., Ma, L., Wang KH., Marillat, V., Sotelo, C.,
et al. (2001). Diversity and specificity of actions of Slit2 proteolytic fragments in
axon guidance. The Journal of Neuroscience, 21(12), 4281.
109
Nguyen, D. H., Catling, A. D., Webb, D. J., Sankovic, M., Walker, L. A., Somlyo, A.
V., et al. (1999). Myosin light chain kinase functions downstream of Ras/ERK to
promote migration of urokinase-type plasminogen activator-stimulated cells in
an integrin-selective manner. The Journal of Cell Biology, 146(1), 149-164.
Nobes, C. D., & Hall, A. (1995). Rho, rac, and cdc42 GTPases regulate the
assembly of multimolecular focal complexes associated with actin stress fibers,
lamellipodia, and filopodia. Cell, 81(1), 53-62.
Olofsson, B. (1999). Rho guanine dissociation inhibitors:: Pivotal molecules in
cellular signalling. Cellular Signalling, 11(8), 545.
Pasternak, R., Criqui, M., Benjamin, E., Fowkes, F. G. R., Isselbacher, E.,
McCullough, P., et al. (2004). Atherosclerotic vascular disease conference:
Writing group I: Epidemiology. Circulation, 109(21), 2605-2612.
Piper, M., Georgas, K., Yamada, T., & Little, M. (2000). Expression of the vertebrate
slit gene family and their putative receptors, the robo genes, in the developing
murine kidney. Mechanisms of Development, 94(1-2), 213-217.
Prasad, A., Fernandis, A., Rao, Y., & Ganju, R. (2004). Slit protein-mediated
inhibition of CXCR4-induced chemotactic and chemoinvasive signaling
pathways in breast cancer cells. The Journal of Biological Chemistry, 279(10),
9115-9124.
110
Prasad, A., Qamri, Z., Wu, J., & Ganju, R. (2007). Slit-2/Robo-1 modulates the
CXCL12/CXCR4-induced chemotaxis of T cells. Journal of Leukocyte Biology,
82(3), 465-476.
Proudfoot, A. E., Power, C. A., & Wells, T. N. (2000). The strategy of blocking the
chemokine system to combat disease. Immunological Reviews, 177, 246-256.
Rajavashisth, T. B., Andalibi, A., Territo, M. C., Berliner, J. A., Navab, M.,
Fogelman, A. M., et al. (1990). Induction of endothelial cell expression of
granulocyte and macrophage colony-stimulating factors by modified low-density
lipoproteins. Nature, 344(6263), 254-257.
Randolph, G. J., Beaulieu, S., Lebecque, S., Steinman, R. M., & Muller, W. A.
(1998). Differentiation of monocytes into dendritic cells in a model of
transendothelial trafficking. Science, 282(5388), 480-483.
Ravetch, J. V., & Kinet, J. P. (1991). Fc receptors. Annual Review of Immunology,
9, 457-492.
Ray, L. B. (2004). STKE: Slit and robo in kidney formation. Science, 304(5675),
1215c.
Ridley, A. J. (2001). Rho proteins, PI 3-kinases, and monocyte/macrophage motility.
FEBS Letters, 498(2-3), 168.
111
Ridley, A. J., & Hall, A. (1992). The small GTP-binding protein rho regulates the
assembly of focal adhesions and actin stress fibers in response to growth
factors. Cell, 70(3), 389-399.
Ridley, A. J., & Hall, A. (1994). Signal transduction pathways regulating rho-
mediated stress fibre formation: Requirement for a tyrosine kinase. EMBO
Journal, 13(11), 2600-2610.
Ridley, A. J., Paterson, H. F., Johnston, C. L., Diekmann, D., & Hall, A. (1992). The
small GTP-binding protein rac regulates growth factor-induced membrane
ruffling. Cell, 70(3), 401-410.
Robinson, L. A., Nataraj, C., Thomas, D. W., Howell, D. N., Griffiths, R., Bautch, V.,
et al. (2000). A role for fractalkine and its receptor (CX3CR1) in cardiac allograft
rejection. The Journal of Immunology, 165(11), 6067.
Ronca, F., Andersen, J. S., Paech, V., & Margolis, R. U. (2001). Characterization of
slit protein interactions with glypican-1. The Journal of Biological Chemistry,
276(31), 29141-29147.
Rossi, D., & Zlotnik, A. (2000). The biology of chemokines and their receptors.
Annual Review of Immunology, 18, 217-242.
Rossman, K., Der, C., & Sondek, J. (2005). GEF means go: Turning on RHO
GTPases with guanine nucleotide-exchange factors. Nature Reviews.Molecular
Cell Biology, 6(2), 167-180.
112
Rothberg, J. M., & Artavanis-Tsakonas, S. (1992). Modularity of the slit protein.
characterization of a conserved carboxy-terminal sequence in secreted proteins
and a motif implicated in extracellular protein interactions. Journal of Molecular
Biology, 227(2), 367-370.
Rothberg, J. M., Hartley, D. A., Walther, Z., & Artavanis-Tsakonas, S. (1988). Slit:
An EGF-homologous locus of D. melanogaster involved in the development of
the embryonic central nervous system. Cell, 55(6), 1047-1059.
Rothberg, J. M., Jacobs, J. R., Goodman, C. S., & Artavanis-Tsakonas, S. (1990).
Slit: An extracellular protein necessary for development of midline glia and
commissural axon pathways contains both EGF and LRR domains. Genes
Development, 4(12A), 2169-2187.
Sakai, T., Jove, R., Fssler, R., & Mosher, D. F. (2001). Role of the cytoplasmic
tyrosines of beta 1A integrins in transformation by v-src. Proceedings of the
National Academy of Sciences of the United States of America, 98(7), 3808-
3813.
Salas, A., Shimaoka, M., Kogan, A., Harwood, C., von Andrian, U., & Springer, T.
(2004). Rolling adhesion through an extended conformation of integrin
alphaLbeta2 and relation to alpha I and beta I-like domain interaction. Immunity,
20(4), 393.
Sampath, R., Gallagher, P. J., & Pavalko, F. M. (1998). Cytoskeletal interactions
with the leukocyte integrin beta2 cytoplasmic tail. activation-dependent
113
regulation of associations with talin and alpha-actinin. The Journal of Biological
Chemistry, 273(50), 33588-33594.
Santiago-Martnez, E., Soplop, N., Patel, R., & Kramer, S. (2008). Repulsion by slit
and roundabout prevents Shotgun/E-cadherin-mediated cell adhesion during
drosophila heart tube lumen formation. The Journal of Cell Biology, 182(2),
241-248.
Sasaki, T., Irie-Sasaki, J., Jones, R. G., Oliveira-dos-Santos, A. J., Stanford, W. L.,
Bolon, B., et al. (2000). Function of PI3Kgamma in thymocyte development, T
cell activation, and neutrophil migration. Science, 287(5455), 1040-1046.
Sechi, A. S., & Wehland, J. (2000). The actin cytoskeleton and plasma membrane
connection: PtdIns(4,5)P(2) influences cytoskeletal protein activity at the
plasma membrane. Journal of Cell Science, 113 Pt 21, 3685-3695.
Servant, G., Weiner, O. D., Herzmark, P., Balla, T., Sedat, J. W., & Bourne, H. R.
(2000). Polarization of chemoattractant receptor signaling during neutrophil
chemotaxis. Science, 287(5455), 1037-1040.
Servet-Delprat, C., Arnaud, S., Jurdic, P., Nataf, S., Grasset, M., Soulas, C., et al.
(2002). Flt3 macrophage precursors commit sequentially to osteoclasts,
dendritic cells and microglia. BMC Immunology, 3, 15-15.
Shamri, R., Grabovsky, V., Gauguet, J., Feigelson, S., Manevich, E., Kolanus, W.,
et al. (2005). Lymphocyte arrest requires instantaneous induction of an
114
extended LFA-1 conformation mediated by endothelium-bound chemokines.
Nature Immunology, 6(5), 497.
Sheetz, M. P., Felsenfeld, D., Galbraith, C. G., & Choquet, D. (1999). Cell migration
as a five-step cycle. Biochemical Society Symposia, 65, 233-243.
Shimonaka, M., Katagiri, K., Nakayama, T., Fujita, N., Tsuruo, T., Yoshie, O., et al.
(2003). Rap1 translates chemokine signals to integrin activation, cell
polarization, and motility across vascular endothelium under flow. The Journal
of Cell Biology, 161(2), 417-427.
Shin, H. S., Snyderman, R., Friedman, E., Mellors, A., & Mayer, M. M. (1968).
Chemotactic and anaphylatoxic fragment cleaved from the fifth component of
guinea pig complement. Science, 162(851), 361.
Singer, S. J., & Kupfer, A. (1986). The directed migration of eukaryotic cells. Annual
Review of Cell Biology, 2, 337-365.
Smith, A., Bracke, M., Leitinger, B., Porter, J., & Hogg, N. (2003). LFA-1-induced T
cell migration on ICAM-1 involves regulation of MLCK-mediated attachment and
ROCK-dependent detachment. Journal of Cell Science, 116(15), 3123-3133.
Smith, J. D., Trogan, E., Ginsberg, M., Grigaux, C., Tian, J., & Miyata, M. (1995).
Decreased atherosclerosis in mice deficient in both macrophage colony-
stimulating factor (op) and apolipoprotein E. Proceedings of the National
Academy of Sciences of the United States of America, 92(18), 8264-8268.
115
Spillmann, D., Witt, D., & Lindahl, U. (1998). Defining the interleukin-8-binding
domain of heparan sulfate. The Journal of Biological Chemistry, 273(25),
15487-15493.
Srinivasan, S., Wang, F., Glavas, S., Ott, A., Hofmann, F., Aktories, K., et al.
(2003). Rac and Cdc42 play distinct roles in regulating PI(3,4,5)P3 and polarity
during neutrophil chemotaxis. The Journal of Cell Biology, 160(3), 375-385.
Strzelecka, A., Kwiatkowska, K., & Sobota, A. (1997). Tyrosine phosphorylation and
fcgamma receptor-mediated phagocytosis. FEBS Letters, 400(1), 11-14.
Sunderktter, C., Nikolic, T., Dillon, M., Van Rooijen, N., Stehling, M., Drevets, D., et
al. (2004). Subpopulations of mouse blood monocytes differ in maturation stage
and inflammatory response. The Journal of Immunology, 172(7), 4410-4417.
Symons, M. H., & Mitchison, T. J. (1991). Control of actin polymerization in live and
permeabilized fibroblasts. The Journal of Cell Biology, 114(3), 503-513.
Tacke, F., Alvarez, D., Kaplan, T., Jakubzick, C., Spanbroek, R., Llodra, J., et al.
(2007). Monocyte subsets differentially employ CCR2, CCR5, and CX3CR1 to
accumulate within atherosclerotic plaques. Journal of Clinical Investigation,
117(1), 185-194.
Tadokoro, S., Shattil, S., Eto, K., Tai, V., Liddington, R., de Pereda, J., et al. (2003).
Talin binding to integrin beta tails: A final common step in integrin activation.
Science, 302(5642), 103-106.
116
Tcherkezian, J., & Lamarche-Vane, N. (2007). Current knowledge of the large
RhoGAP family of proteins. Biology of the Cell, 99(2), 67-86.
Tcherkezian, J., & Lamarche-Vane, N. (2007). Current knowledge of the large
RhoGAP family of proteins. Biology of the Cell, 99(2), 67-86.
Tessier-Lavigne, M., & Goodman, C. S. (1996). The molecular biology of axon
guidance. Science, 274(5290), 1123-1133.
Tohyama, Y., Katagiri, K., Pardi, R., Lu, C., Springer, T., & Kinashi, T. (2003). The
critical cytoplasmic regions of the alphaL/beta2 integrin in Rap1-induced
adhesion and migration. Molecular Biology of the Cell, 14(6), 2570-2582.
Tole, S., Mukovozov, I., Huang, Y., Magalhaes, M. A. O., Yan, M., Crow, M., et al.
(2009). The axonal repellent, Slit2, inhibits directional migration of circulating
neutrophils. Journal of Leukocyte Biology, 86(6), 1403-1415.
Ulloa-Aguirre, A., Stanislaus, D., Janovick, J. A., & Conn, P. M. (1999). Structure-
activity relationships of G protein-coupled receptors. Archives of Medical
Research, 30(6), 420-435.
Van Furth, R., & Cohn, Z. (1968). The origin and kinetics of mononuclear
phagocytes. The Journal of Experimental Medicine, 128(3), 415.
van Furth, R., Nibbering, P. H., van Dissel, J. T., & Diesselhoff-den Dulk, M. M.
(1985). The characterization, origin, and kinetics of skin macrophages during
inflammation. The Journal of Investigative Dermatology, 85(5), 398-402.
117
Vanhaesebroeck, B., & Waterfield, M. D. (1999). Signaling by distinct classes of
phosphoinositide 3-kinases. Experimental Cell Research, 253(1), 239-254.
Vargesson, N., Luria, V., Messina, I., Erskine, L., & Laufer, E. (2001). Expression
patterns of slit and robo family members during vertebrate limb development.
Mechanisms of Development, 106(1-2), 175-180.
Vetter, I. R., & Wittinghofer, A. (2001). The guanine nucleotide-binding switch in
three dimensions. Science, 294(5545), 1299-1304.
Vielkind, S., Gallagher-Gambarelli, M., Gomez, M., Hinton, H., & Cantrell, D. (2005).
Integrin regulation by RhoA in thymocytes. The Journal of Immunology, 175(1),
350-357.
Viriyakosol, S., Fierer, J., Brown, G., & Kirkland, T. (2005). Innate immunity to the
pathogenic fungus coccidioides posadasii is dependent on toll-like receptor 2
and dectin-1. Infection and Immunity, 73(3), 1553-1560.
von Hundelshausen, P., Weber, K. S., Huo, Y., Proudfoot, A. E., Nelson, P. J., Ley,
K., et al. (2001). RANTES deposition by platelets triggers monocyte arrest on
inflamed and atherosclerotic endothelium. Circulation, 103(13), 1772.
Wang, H., Zhang, Y., Ozdamar, B., Ogunjimi, A., Alexandrova, E., Thomsen, G., et
al. (2003). Regulation of cell polarity and protrusion formation by targeting
RhoA for degradation. Science, 302(5651), 1775-1779.
118
Wang, K. H., Brose, K., Arnott, D., Kidd, T., Goodman, C. S., Henzel, W., et al.
(1999). Biochemical purification of a mammalian slit protein as a positive
regulator of sensory axon elongation and branching. Cell, 96(6), 771-784.
Wang, Y. L. (1985). Exchange of actin subunits at the leading edge of living
fibroblasts: Possible role of treadmilling. The Journal of Cell Biology, 101(2),
597.
Wiktor-Jedrzejczak, W., & Gordon, S. (1996). Cytokine regulation of the
macrophage (M phi) system studied using the colony stimulating factor-1-
deficient op/op mouse. Physiological Reviews, 76(4), 927-947.
Wills, Z., Marr, L., Zinn, K., Goodman, C. S., & Van Vactor, D. (1999). Profilin and
the abl tyrosine kinase are required for motor axon outgrowth in the drosophila
embryo. Neuron, 22(2), 291-299.
Wong, K., Ren, X. R., Huang, Y. Z., Xie, Y., Liu, G., Saito, H., et al. (2001). Signal
transduction in neuronal migration: Roles of GTPase activating proteins and the
small GTPase Cdc42 in the slit-robo pathway. Cell, 107(2), 209-221.
Worthylake, R. A., Lemoine, S., Watson, J. M., & Burridge, K. (2001). RhoA is
required for monocyte tail retraction during transendothelial migration. The
Journal of Cell Biology, 154(1), 147-160.
119
Worthylake, R., & Burridge, K. (2003). RhoA and ROCK promote migration by
limiting membrane protrusions. The Journal of Biological Chemistry, 278(15),
13578-13584.
Wu, J. Y., Feng, L., Park, H. T., Havlioglu, N., Wen, L., Tang, H., et al. (2001). The
neuronal repellent slit inhibits leukocyte chemotaxis induced by chemotactic
factors. Nature, 410(6831), 948-952.
Yamada, K. M., & Miyamoto, S. (1995). Integrin transmembrane signaling and
cytoskeletal control. Current Opinion in Cell Biology, 7, 681.
Yan, M., Di Ciano-Oliveira, C., Grinstein, S., & Trimble, W. (2007). Coronin function
is required for chemotaxis and phagocytosis in human neutrophils. The Journal
of Immunology, 178(9), 5769-5778.
Yen, H., Zhang, Y., Penfold, S., & Rollins, B. J. (1997). MCP-1-mediated
chemotaxis requires activation of non-overlapping signal transduction
pathways. Journal of Leukocyte Biology, 61(4), 529-532.
Yuan, W., Zhou, L., Chen, J. H., Wu, J. Y., Rao, Y., & Ornitz, D. M. (1999). The
mouse SLIT family: Secreted ligands for ROBO expressed in patterns that
suggest a role in morphogenesis and axon guidance. Developmental Biology,
212(2), 290-306.
120
Zallen, J. A., Yi, B. A., & Bargmann, C. I. (1998). The conserved immunoglobulin
superfamily member SAX-3/Robo directs multiple aspects of axon guidance in
C. elegans. Cell, 92(2), 217-227.
Ziegler-Heitbrock, H. W. L. (1996). Heterogeneity of human blood monocytes: The
CD14 CD16 subpopulation. Immunology Today, 17(9), 424.
Zigmond, S. H. (1974). Mechanisms of sensing chemical gradients by
polymorphonuclear leukocytes. Nature, 249, 450.
121
APPENDIX 1 The Axonal Repellent, Slit2, Inhibits Directional Migration of Circulating Neutrophils
A1.1 Abstract
In inflammatory diseases circulating neutrophils are recruited to sites of injury.
Attractant signals are provided by many different chemotactic molecules, such that
blockade of one may not effectively prevent neutrophil recruitment. The Slit family of
secreted proteins, and their transmembrane receptor, Roundabout (Robo), repel
axonal migration during central nervous system development. Emerging evidence
shows that by inhibiting the activation of Rho-family GTPases, Slit2/Robo also
inhibit migration of other cell types towards a variety of chemotactic factors, in vitro
and in vivo. The role of Slit2 in inflammation, however, has been largely unexplored.
We isolated primary neutrophils from human peripheral blood and mouse bone
marrow, and detected Robo-1 expression. Using video-microscopic live cell
tracking, we found that Slit2 selectively impaired directional migration, but not
random movement, of neutrophils towards formyl-methionyl-leucyl-phenylalanine
(fMLP). Slit2 also inhibited neutrophil migration towards other chemoattractants,
namely C5a and interleukin (IL)-8. Slit2 inhibited neutrophil chemotaxis by
preventing chemoattractant-induced actin barbed end formation and cell
polarization. Slit2 mediated these effects by suppressing inducible activation of
Cdc42 and Rac2, but did not impair activation of other major kinase pathways
involved in neutrophil migration. We further tested the effects of Slit2 in vivo using
mouse models of peritoneal inflammation induced by sodium periodate, C5a, and
122
macrophage inflammatory protein-2 (MIP-2). In all instances, Slit2 effectively
reduced neutrophil recruitment (p < 0.01). Collectively, these data demonstrate that
Slit2 potently inhibits chemotaxis, but not random motion, of circulating neutrophils,
and point to Slit2 as a potential new therapeutic for preventing localized
inflammation.
123
A1.2 Introduction
Neutrophils are a critical component of the innate immune system and
provide the first line of defense against bacterial and fungal pathogens. During an
inflammatory response, neutrophils are recruited to sites of inflammation in a series
of coordinated interactions with vascular endothelial cells. Traffic signals are
provided by diverse chemoattractant molecules, including chemokines such as IL-8,
and bacterial products such as formylated peptides. These chemoattractants recruit
circulating neutrophils to sites of inflammation, and activate recruited neutrophils to
adhere firmly to the endothelium. While their potent anti-microbial arsenal makes
neutrophils efficient at fighting microorganisms, it is also capable of causing injury to
the surrounding tissue. Indeed, neutrophils inflict significant tissue damage in
inflammatory conditions including ischemia-reperfusion injury of solid organs, acute
respiratory distress syndrome, and rheumatoid arthritis [1-4]. Once recruited to sites
of injury, infiltrating neutrophils release reactive oxygen species and degradative
enzymes, fuelling local tissue destruction.
Anti-inflammatory drugs such as aspirin and glucocorticoids are widely used,
and yet, have shown modest success in reducing neutrophil-mediated injury. These
drugs attenuate activation of transcription factors such as NF-κB, thereby reducing
expression of cytokines [5]. An alternative approach to prevent neutrophil-mediated
tissue damage would be blockade of chemotactic pathways that recruit neutrophils
to sites of inflammation. Indeed, some chemokine receptor antagonists or blocking
antibodies have shown success in animal models and are undergoing clinical trials
[6]. However, given the number of chemoattractant signals that recruit neutrophils, it
124
is unlikely that targeting a single chemokine/chemokine receptor pathway would
achieve widespread clinical success. Thus, localized general blockade of
inflammatory chemoattractants could represent a clinically useful strategy to reduce
neutrophil-mediated tissue damage.
Clues as to how generalized blockade of neutrophil chemoattractant signals
might be realized are provided in the neurodevelopmental literature. The Slit family
of secreted proteins, together with their transmembrane receptor Roundabout
(Robo), repel migration of axons and neurons during development of the central
nervous system. Slit is expressed along the midline of the developing central
nervous system and its interaction with Robo prevents axons from repeatedly and
randomly crossing the midline [7, 8]. While the importance of Slit/Robo interactions
in development has been demonstrated, the intracellular signaling pathways that
lead to Slit-mediated inhibition of migration remain unclear. Data from Drosophila
suggests that Abelson kinase (Abl) and Enabled (Ena) proteins associate with the
intracellular domains of Robo-1 and may be involved in the repulsive response to
Slit2 [9]. Addition of extracellular Slit2 to neuronal cells results in the recruitment of
soluble Slit Robo guanosine triphosphatase (GTPase) activating protein 1 (srGAP1)
to the cytoplasmic tail of Robo-1 [10].
In addition to neuronal cells, Slit2 and Robo-1 also inhibit migration of other
cell types, including vascular smooth muscle cells, breast cancer cells, and brain
tumor cells [11-13]. Several studies have demonstrated that Slit2 inhibits migration
of haematopoietic cells, including murine macrophages, cultured cells of
granulocytic lineage, dendritic cells, and primary human T-lymphocytes, towards
125
chemoattractant signals [14-17]. Importantly, Slit2 not only inhibits cell migration
towards one type of chemoattractant signal, but towards many diverse signals,
including platelet-derived growth factor (PDGF) and the chemokines, CXCL12 and
CCL2 [12,13, 16, 17]. In vivo, Slit2 inhibits neoangiogenesis by impairing pathologic
migration of endothelial cells to vascular endothelial growth factor [18]. Existing data
point to a role for Slit2 as a generalized “anti-migration” signal, which universally
inhibits cell migration. However, the potential use of Slit2 to prevent inflammation
has been largely unexplored. In particular, there is a paucity of data addressing the
effects of Slit2 on migration of human leukocytes, especially neutrophils. Moreover,
the mechanisms by which Slit2 mediates its anti-migratory effects are incompletely
understood.
The aim of this study was to assess, in real-time, the effect of Slit2 on
recruitment of primary neutrophils. We observed that primary human and murine
neutrophils express the Slit2 receptor, Robo-1, and that Slit2 inhibits directional
migration, but not random migration, of neutrophils towards a chemotactic stimulus.
Our studies demonstrate that Slit2 mediates these effects by preventing
chemoattractant-induced cell polarization and generation of actin free barbed ends,
a pre-requisite for directional migration of neutrophils. Our data further suggest that
Slit2 prevents chemoattractant-induced free barbed end formation by suppressing
inducible activation of the small GTPases, Cdc42 and Rac2, but does not affect
activation of other major kinase pathways involved in neutrophil migration. To
investigate whether Slit2 prevents neutrophil chemotaxis in vivo, we used mouse
models of peritoneal inflammation, and observed a significant reduction in the
126
number of neutrophils recruited to the peritoneum in response to diverse
inflammatory stimuli, in the presence of Slit2 [19]. Taken together, these data
indicate a novel role for the axonal repellent, Slit2, as an anti-inflammatory agent
which specifically prevents chemotactic trafficking of circulating neutrophils.
127
A1.3 Materials and Methods
Reagents and antibodies. Unless otherwise stated, reagents were purchased from
Sigma-Aldrich (St. Louis, MO). Polymorphprep neutrophil separation medium was
purchased from Axis- Shield, Norway. The following primary antibodies were used:
anti-Robo-1 (Abcam, Cambridge, MA, and Santa Cruz Biotechnology, Santa Cruz,
CA), anti-myc 9E10 (Covance, QC, Canada), anti-human Cdc42 (Cell Signaling,
Danvers, MA), anti-human Rac2 (Upstate Biotechnology, Lake Placid, NY), anti-
mouse CD3 (BD Biosciences, Mississauga, Ontario, Canada), anti-B220 (BD
Biosciences), anti-NK1.1 (BD Biosciences), anti-F4/80 (Serotec, Raleigh, NC), anti-
Erk, anti-phospho-Erk, anti-p38 MAPK, anti-phospho-p38 MAPK, anti-Akt, and anti-
phospho-Akt. Rhodamine-conjugated phalloidin was from Invitrogen Canada
(Burlington, Ontario, Canada). The following secondary antibodies were used: Cy3-
conjugated anti-rabbit IgG, Cy2- conjugated anti-human IgG, phycoerythrin (PE)-
conjugated anti-rat IgG and anti-mouse IgG (Jackson Immunoresearch
Laboratories, Bar Harbor, ME), and horseradish peroxidase-conjugated anti-rabbit
IgG and anti-mouse IgG (Jackson Immunoresearch Laboratories). C5a was
purchased from Biovision, Inc. (Mountain View, CA), interleukin-8 (IL-8) from
Invitrogen, and macrophage inflammatory protein-2 (MIP-2) from R&D Systems
(Minneapolis, MN).
Isolation of primary human and murine neutrophils. Human blood was obtained from
healthy volunteers and neutrophils were isolated using two methods. For
experiments testing the activation of Rac and Cdc42, neutrophils were isolated by
128
dextran sedimentation as described with slight modifications [20]. Briefly, two
volumes of blood were mixed with one volume of 6% dextran T-500 in 0.9% NaCl
and set at room temperature until clear separation of layers was seen (about 30
min). The leukocyte-rich upper layer was collected and centrifuged at 260g at
room temperature for 5 min. The cell pellet was re-suspended in a volume of 0.9%
NaCl equal to the starting volume of blood, laid onto 10 ml of Ficoll-hypaque
solution, and centrifuged at 460g for 30 min. Red blood cells were lysed by adding
20 ml of ice-cold 0.2% NaCl for 30 s, resuspended in 20 ml of ice-cold 1.6% NaCl
and centrifuged at 250g at 4°C for 5 min. Neutrophils were re-suspended in ice-cold
PBS with 0.5% BSA. Cells were kept on ice for subsequent experimental use. The
purity of neutrophils isolated in this manner was assessed by modified Wright-
Giemsa stain (Hema-Tek Stain Pack; Bayer, Elkhart, IN) using an automated
stainer (Hema-Tek 2000; Bayer), and was consistently greater than 95%. For all
other experiments, the Polymorphprep gradient separation procedure was
performed according to the manufacturer‟s recommendations. Purified neutrophils
were suspended in PBS without calcium and kept at room temperature. Prior to use,
the neutrophils were re-suspended in HBSS with 1mM CaCl2 and 1mM MgCl2.
Experiments were performed within 1-2 h of isolation of neutrophils. Cell purity was
consistently >85-90%. Cell viability was >98% by Trypan blue exclusion. For
RTPCR experiments, a QIAmp RNA Blood Mini Kit (QIAGEN, Ontario, Canada)
was used to isolate total RNA from human leukocytes isolated from whole blood,
according to the manufacturer‟s specifications. Primary murine neutrophils were
isolated as previously described [19, 21]. Briefly, adult CD1 mice were killed by CO2
129
inhalation. Femurs and tibias were removed and bone marrow was extracted. Bone
marrow cells were layered onto discontinuous Percoll gradients of 81%/65%/55%.
Mature neutrophils were isolated from the 81%/65% interface. More than 85% of
cells were neutrophils as assessed by Wright-Giemsa staining.
Slit2 expression and purification. Stable human embryonic kidney (HEK) 293 cell
line expressing full-length human Slit2 with a c-myc-tag at its carboxyl terminus was
a kind gift from Drs. Rolando del Maestro (McGill University, Montreal, Canada) and
Yi Rao (Washington University, St. Louis, MO) and grown as described [22].
Recombinant Slit2 was purified from the conditioned medium using two methods.
Conditioned medium was concentrated and Slit2 purified by affinity chromatography
using anti-c-myc Ab 9E10 (Covance, QC, Canada) and Size Primary
Immunoprecipitation kit (Thermo Scientific, Rockford, IL) following the
manufacturer's instructions. Slit2 was also obtained by Superdex-200 size exclusion
chromatography. Briefly, conditioned medium was concentrated using Centricon
Plus-20 (Millipore, Billerica, MA) and loaded onto the column [16]. The column was
then washed with PBS and fractions containing Slit2 were pooled, concentrated,
aliquoted and stored in –80°C before use. The presence of Slit2 was verifed using
silver staining and immunoblotting with anti-myc Ab (Supplementary Figure
1A & B). The above protocol was repeated with conditioned medium from control
HEK293 cells to obtain control medium. This preparation of Slit2 was titrated and
used at a concentration of 0.6 µg/ml. In parallel assays, control medium was used in
lieu of Slit2.
130
Large scale preparation of Slit2 was performed by transfection of HEK293-EBNA1
cells. Briefly, human Slit2 cDNA (MGC: 177513; aa 26-1529 of NP_004778) was
amplified using forward (CTATCTAGACCTCAGGCGTGCCCGGCGCAGTGC) and
reverse (CTAGGATCCGGACACACACCTCGTACAGC) primers containing XbaI
and BamHI restriction sites. The amplified cDNA was cloned into the pTT28 vector
digested with NheI and BamHI. The pTT28 vector is a derivative of the pTT5 vector
[23, 24] and contains a synthetic and codon-optimized signal peptide
(MGELLLLLLLGLRLQLSLG) and a C-terminal (His)8G tag separated by NheI and
BamHI restriction sites. HEK293-EBNA1 cells (clone 6E) were transfected with 1
µg/ml cDNA as previously described [25]. Culture medium was harvested
120 h post-transfection, clarified by centrifugation (4,000 x g for 15 min), and filtered
through a 0.45 µm membrane. Slit2 secreted into the medium was purified by
immobilized metal-affinity chromatography using a Fractogel-cobalt column
equilibrated in PBS. Following washing steps with 5 column volumes (CV) of Wash1
Buffer (50 mM sodium phosphate pH 7.0 and 300 mM NaCl) followed by 5 CV of
Wash2 Buffer (50 mM sodium phosphate pH 7.0 , 300 mM NaCl and 25 mM
imidazole), bound Slit2 was eluted with Elution Buffer (50 mM sodium phosphate pH
7.0, 300 mM NaCl and 25 mM imidazole). The pooled eluted material was
immediately desalted on Econo-Pac™ 10 columns (Bio-Rad Laboratories,
Mississauga, ON) previously equilibrated with PBS according to the manufacturer‟s
specifications. Protein concentration was determined by absorbance at 280 nm
using a calculated Slit2 molar extinction coefficient of 114600
(http://ca.expasy.org/tools/protparam.html). For Western blots, proteins were
131
resolved on reducing SDS-PAGE (4–12% Nu-PAGE Bis-Tris gradient gel,
Invitrogen) followed by transfer to a 0.2 mm Protran nitrocellulose membrane
(Schleicher & Schuell, Keene, NH) in Tris-glycine buffer for 1 h at 300 mA. Purity
was verified by Ponceau staining and immunoblotting (Supplementary Figure 1C &
D). The membrane was incubated in blocking reagent (Roche Diagnostics, Laval,
Canada), and then probed with anti-polyHis-HRP Ab (Sigma-Aldrich) for 1 h
(Supplementary Figure 1D). Detection was performed using BM
Chemiluminescence Blotting Substrate (Roche Diagnostics) with a Kodak Digital
Science Image Station 440cf equipped with Kodak Digital Science 1D image
analysis software version 3.0 (Eastman Kodak, New York, NY). We measured
endotoxin levels in purified Slit2 stock preparations using ToxinSensor
Chromogenic LAL Endotoxin Assay Kit (GenScript Corp., Piscataway, NJ).
Endotoxin concentrations ranged from 0.2-0.8 ng/ml, yielding final experimental
concentrations of 12-40 pg/ml which are well below those thought to activate
leukocytes [26]. To verify this point, we added similar concentrations of endotoxin in
neutrophil Transwell assays, and found that such levels of endotoxin had no effect
on neutrophil migration (Supplementary Figure 2).
RT-PCR. RNA isolation and RT-PCR were performed using the QIAamp RNA blood
mini kit and the QIAGEN one-step RT-PCR kit (QIAGEN, Missisauga, ON) as
described [13]. As previously described, the following primers specific for Robo-1
were used: GGCCCCACTCCCCCTGTTCG (forward primer) and
TCCTCTTCTGGCGCATCCGTATCC (reverse primer) [13]. Amplified products were
132
analyzed by electrophoresis on 2% agarose gels containing ethidium bromide to
confirm primer specificity and PCR product size (278 bp).
Immunofluorescent labeling. Primary human and mouse neutrophils were allowed to
settle onto fibronectin-coated coverslips and to adhere for 3 minutes at room
temperature. The cells were fixed with 4% paraformaldehyde for 10 min at 4°C.
Neutrophils were stained with rabbit anti-Robo-1 Ab (1 µg/ml) for 2 h, washed and
then incubated with anti-rabbit-Cy3 secondary Ab for 1 h. In some experiments,
human or mouse neutrophils were incubated with fMLP (1 µM) for 3 min, following
incubation with purified Slit2 (4.5 µg/ml). Cells were fixed, permeabilized, and
incubated with rhodamine-conjugated phalloidin (1:500) for 30 min to visualize actin.
A Leica DMIRE2 spinning disc confocal microscope (Leica Microsystems, Toronto,
Ontario, Canada) equipped with a Hamamatsu back-thinned EM-CCD camera and
Volocity software (Improvision Inc., Lexington, MA) was used to capture images.
Flow cytometry. Cell surface expression of Robo-1 was verified by incubating
human and mouse neutrophils with anti-Robo-1 Ab, followed by PE-conjugated
secondary Ab. Analysis was performed using a FACScalibur flow cytometer (BD
Biosciences) and FlowJo software (Tree Star, Inc., Ashland, OR), as previously
described [27, 28].
Immunoblotting. Freshly isolated human or mouse neutrophils were pre-treated with
either control medium or Slit2 for 10 min and then activated with fMLP (1 µM). Cells
133
were lysed using ice-cold 2x lysis buffer (1 x = 50 mM Tris, pH 7.5, 10% glycerol,
100 mM NaCl, 1% NP- 40, 5 mM MgCl2, 1 mM DTT, 1 mM PMSF, 1/100 protease
inhibitor cocktail and 1 mM NaVO3). Samples were run on SDS-PAGE, transferred
to 0.2 mm PVDF (Millipore) membrane and probed for Robo-1 or for both
phosphorylated and total Akt, Erk and p38 MAP kinase. Immunoreactive bands
were visualized by enhanced chemiluminescence (Amersham Biosciences, UK Ltd,
Buckinghamshire, UK) recorded on x-ray film. Prior to performing experiments, a
time-course study was performed to determine the optimal point at which to
measure phosphorylation of Akt, Erk, and p38 MAPK following exposure to fMLP.
Of samples harvested at 15 - 180 s, the maximum signal was observed at 30 s, and
therefore, a 30 s timepoint was used for all subsequent experiments.
Migration assay. Freshly isolated neutrophils (106 cells/ 100µl) were incubated with
medium alone, Slit2 (0.6 µg/ml), or control medium at 37°C for 10 minutes. Cells
were loaded into the top chamber of a 3 µm Transwell insert (Corning Life
Sciences, Corning, NY) in a 24-well plate. A coverslip was added to the bottom
chamber which was filled with 600 µl of HBSS alone, fMLP (1 µM), C5a (2 µg/ml), or
IL-8 (0.1 µg/ml) [29-32]. Into the bottom chamber Slit2, control medium, or HBSS
was dispensed. Transwell plates were incubated for 1 h at 37°C. To determine the
number of neutrophils which had migrated from the top to the bottom chamber, the
filter was removed and neutrophils in the lower chamber were rapidly spun down
onto the coverslips, fixed with 4% paraformaldehyde, washed, and labeled with
DAPI. A Leica DMIRE microscope was used to take representative 40x and 63x
134
high-power images. A Nikon light microscope was used to count at least 10 random
fields from each coverslip. The data represent the mean value ± SEM from at least
4 independent experiments for each treatment condition.
Micropipette chemotaxis assays. To measure neutrophil migration, round glass
coverslips (25-mm diameter; Thomas Scientific, Swedesboro, NJ) coated with
fibronectin were mounted in Leiden chambers, overlaid with 0.5 ml of the indicated
solution, and placed on the heated stage of a Leica DM IRB microscope (Leica
Microsystem, Richmond Hill, Ontario, Canada). Next, a 100 µl aliquot of the
neutrophil suspension containing 106 cells was added, and cells allowed to
settle for 10 min. To induce chemotaxis, a point-source of chemoattractant was
delivered using a glass micropipette [33-36]. Micropipettes were prepared from
borosilicate capillaries with an outer diameter of 1.0 mm and an inner diameter of
0.78 mm (Sutter, Novato, CA) using a model P-97 micropipette puller (Sutter). The
tips of the micropipettes were 1.0 µm in diameter. Precise positioning of the
micropipette in the visual field was accomplished using a model 5171
micromanipulator (Eppendorf, Hamburg, Germany). Although the distance between
the pipette and the individual cells adherent to the coverslip varied, the initial
average distance of the cells under observation (i.e., those in the microscopic field
under observation) ranged between 40 and 50 µm. The pipette remained stationary,
and diffusion of the chemoattractant generated a standing gradient [33-36]. Images
were acquired every 10 s until completion of the experiment. Only cells which
started and remained in the field of view over the entire course of videocapture were
135
analyzed. Using VolocityTM software (Improvision, Waltham, MA), the distance
traveled was measured by tracking the centroid of each cell over time. Four different
measures of chemotactic activity were assessed: total migration (distance), net
migration (displacement), speed (distance/time) and directionality
(displacement/distance). Total migration was defined as the sum of the absolute
distances traveled in all the individual time intervals. The net migration was
calculated as the difference between the initial distance of the cell with respect to
the pipette and that at the end of the experiment. Migration speed was calculated by
dividing the total distance travelled over the elapsed time. Directionality was
measured by obtaining a ratio of displacement over distance.
Actin free barbed end assay. To assess the effects of Slit2 on fMLP-induced actin
polymerization, actin nucleation activity was measured as enhancement of pyrene
actin fluorescence as previously described [21, 37, 38]. Briefly, human neutrophils
(5x106 /ml) were permeabilized for 10 s using 0.1 vol of OG buffer (PHEM buffer
containing 4% octyl glucoside, 10 µM phallacidin, 42 nM leupeptin, 10 mM
benzamidine, and 0.123 mM aprotinin) or NP-40 (final concentration of 1%).
Permeabilization was stopped by diluting the detergent with 3 vol of
buffer B (1 mM Tris, 1 mM EGTA, 2 mM MgCl2, 10 mM KCl, 5 mM β-
mercaptoethanol, 5 mM ATP; pH 7.4). We then assayed for nuclei by adding
pyrene-labeled rabbit skeletal muscle actin to a final concentration of 1 µM, and
followed the fluorescence increase with a microplate reader (FLUOstaroptima, BMG
136
Labtech, Nepean, Ontario, Canada) at excitation and emission wavelengths of 366
and 386 nm, respectively [21, 37].
Cdc42 and Rac2 activation assays. Prior to performing these experiments, a time-
course study was performed to determine the optimal point at which to measure
activation of Rac2 and Cdc42 following exposure to fMLP. Of samples harvested at
15 - 180 s, the maximum signal was observed at 30 s, and therefore, a 30 s time-
point was used for subsequent experiments. To assess the effects of Slit2 on fMLP-
induced activation of Cdc42 and Rac2, pull-down assays were performed as
previously described with slight modifications [39]. The p21-binding domain (PBD;
aa 67-150) of PAK1 in pGEX-4T3 vector was expressed as a GST fusion protein in
BL21 (DE3) E. coli cells. The GST-PBD fusion protein was affinity purified using
glutathione sepharose 4B beads (GE Healthcare Bio-Sciences, Piscataway, NJ).
Protein bound beads were aliquoted and stored at –80°C for later use. Human
neutrophils purified by dextran sedimentation (~1 x 107/sample) were diluted in 0.5
ml 37°C warmed HEPES-HBSS and incubated with purified Slit2 (0.6 µg/ml) at
37°C for 10 min. Cells were stimulated with fMLP (1 µM) for 30 s at 37°C and the
reaction was stopped by adding 0.5 ml ice-cold 2x lysis buffer (1x = 50 mM Tris, pH
7.5, 10% glycerol, 100 mM NaCl, 1% NP-40, 5 mM MgCl2, 1 mM DTT, 1mM PMSF,
1/100 protease inhibitor cocktail, and 1 mM NaVO3). Samples were centrifuged at
maximal speed in a bench-top centrifuge for 5 min at 4°C and an aliquot of
supernatant was used as loading control. The remaining supernatants were added
to GST-PBD glutathione beads (20 µg GST-PBD/sample). Samples were rotated at
137
4°C for 1 h, washed 3 times with cold wash buffer (50 mM Tris, pH 7.5, 40 mM
NaCl, 0.5% NP-40, 30 mM MgCl2, 1 mM DTT, 1 mM PMSF, 0.1 mM NaVO3) and 20
µl of 2x Laemmli loading buffer added. Samples were run on SDS-PAGE and
transferred onto a 0.2 mm PVDF (Millipore) membrane. Cdc42 and Rac2 were
detected using anti-human Cdc42 and anti-human Rac2 primary Ab and HRP-
conjugated secondary Ab. Densitometry analysis was performed on the blots using
Image J software. To examine the effects of Slit2 on spatial distribution of activated
Rac and Cdc42, assays were performed as previously described [33]. Briefly,
mouse bone marrow-derived neutrophils were isolated and 1x 106 cells were
suspended in Nucleofector solution supplemented with 6 µg cDNA expression
plasmids encoding each of yellow fluorescent protein-tagged p21-binding
domain of PAK (PAK-PBD-YFP), which selectively detects activated Rac and
Cdc42, together with red fluorescent protein-tagged H-Ras (H-Ras-RFP) to label the
plasma membrane [21, 33]. Cells were transfected using a Cell Line V
NucleofectorTM kit (Amaxa Biosystems, Amaxa, Inc.) and the NucleofectorTM
program Y-001 [21, 33]. Transfected cells were carefully recovered and transferred
to Iscove‟s Modified Dulbecco‟s Medium pre-warmed to 37°C and allowed to
recover for 2 h. Neutrophils were placed on coverslips coated with 1% BSA
mounted in an Attafluor cell chamber (Invitrogen) and exposed to a point source of
fMLP (1 µM) dispensed through a glass micropipette [21, 33]. In some experiments,
neutrophils were pre-incubated with purified Slit2 (4.5 µg/ml) for 10 min. Cells were
maintained on a microscope stage heated to 37°C, and digital images were
acquired every 3-5 s using a Leica DMIRE2 inverted fluorescence microscope
138
equipped with a Hamamatsu backthinned EM-CCD camera and spinning disc
confocal scan head [21, 33]. Images were acquired and analyzed using VolocityTM
software. Following chemotactic stimulation with fMLP, the ratio of the fluorescence
intensity of PAKPBD-YFP: H-Ras-RFP was compared at the leading edge of the
cell and the trailing edge of the cell [21, 33]. The normalized mean fluorescence
intensity was calculated for 19 cells from three independent experiments [33].
Mouse peritonitis experiments. To determine the effects of Slit2 on neutrophil
chemotaxis in vivo, we used a mouse model of sodium periodate-induced peritonitis
as previously described [19]. All procedures were carried out in accordance with the
Guide for the Humane Use and Care of Laboratory Animals and were approved by
the Hospital for Sick Children Research Institute Animal Care Committee. Adult
CD1 mice were injected intraperitoneally with Slit2 (100 ng) or control medium, then
1 h later with 1 ml of 5 mM sodium periodate in PBS [15]. After 3 h, mice were
euthanized and the peritoneal exudate collected by lavage with chilled PBS (5
ml/mouse). Infiltrating neutrophils were counted using an electronic cell counter
(Becton Dickinson) and neutrophil influx was confirmed by analyzing cytospun
slides. To determine whether Slit2 administered systemically prevents neutrophil
recruitment, purified Slit2 (1.8 µg in 0.2 ml normal saline) was administered by
intravenous tail-vein injection. One hour later, 1 ml PBS containing sodium
periodate (5 mM), C5a (10 µg), or MIP-2 (2.5 µg) was injected intraperitoneally [40,
41]. After 3 h, mice were euthanized, peritoneal exudate collected, and infiltrating
neutrophils counted as described above. The number of infiltrating
139
monocytes/macrophages, T lymphocytes, B lymphocytes, and natural killer cells
was determined by labeling cells with Ab directed to F4/80 (10 µg/ml), CD3 (5
µg/ml), B220 (2 µg/ml), or NK1.1 (2 µg/ml), respectively, and performing flow
cytometry as previously described [27, 28].
Statistical analysis. Analysis of variance (ANOVA) followed by Bonferonni post-hoc
testing was performed using SPSS statistical software to analyze the data from
Transwell experiments. In all other cases, the Student‟s t-test was used. p < 0.05
was considered significant.
140
A1.4 Results
1) Primary human and mouse neutrophils express the Slit2 receptor, Robo-1. Robo-
1 mRNA and protein expression were detected in both human and mouse
neutrophils (Figure 1A & B) [19, 21]. Since Robo-1 expression has previously been
demonstrated in primary human lymphocytes, as a positive control, we verified
Robo-1 expression in human leukocytes isolated from whole blood (Figure 1A) [16].
We detected two distinct bands for Robo-1 protein in mouse neutrophils, consistent
with the splice variants previously reported (Figure 1B) [42]. Using
immunofluorescence microscopy and flow cytometry, we detected Robo-1
expression on the surface of human and murine neutrophils (Figure 1C-E).
2) Slit2 inhibits migration of human neutrophils towards fMLP. We studied the
effects of Slit2 on Transwell migration of human neutrophils. As expected, basal
migration was minimal (Figure 2A & E), but increased in the presence of an fMLP
chemotactic gradient (Figure 2B & E; p < 0.001). When no chemotactic gradient
was present, purified Slit2 did not stimulate neutrophil transmigration (Figure 2D).
However, Slit2 prevented neutrophil migration towards fMLP in the lower chamber,
in a dose-dependent fashion (compare Figure 2B & C; Figure 2E, p < 0.001 for
the two highest Slit2 concentrations tested). When fPLC-enriched Slit2 from
conditioned medium of Slit2-expressing HEK-293T cells was tested, very similar
results were obtained (Supplementary Figure 3). In this instance, control medium
from mock-transfected cells had no effect on neutrophil migration, verifying that the
Slit2 preparation did not contain any factors that could inadvertently affect neutrophil
141
migration (Supplementary Figure 3; p < 0.05 vs no fMLP). Together, these data
demonstrate that Slit2 inhibits fMLP-induced migration of primary human neutrophils
in a dose-dependent fashion.
3) Slit2 inhibits migration of human neutrophils towards other chemoattractants. To
determine whether Slit2 inhibits neutrophil migration towards different
chemoattractant signals, we performed Transwell assays in which C5a or IL-8 were
placed in the lower chamber. Slit2 resulted in a four-fold and six-fold decrease in
neutrophil migration towards IL-8 and C5a, respectively (Figure 2F; IL-8: 93 ± 23
cells/field; IL-8 + Slit2: 23 ± 5 cells/field; C5a: 51 ± 10 cells/field; C5a + Slit2: 8 ± 3
cells/field; p < 0.001 for C5a and IL-8). These data demonstrate that Slit2 is a potent
inhibitor of neutrophil migration towards diverse types of chemotactic cue.
4) Slit2 inhibits directional but not random migration of human neutrophils. We next
determined whether the observed effects of Slit2 on neutrophil migration were due
to inhibition of cell chemotaxis or chemokinesis. Chemokinesis is defined as random
movement in response to a stimulant. Unlike chemokinesis, chemotaxis includes a
vectoral assessment of migration and is defined as directional migration in response
to a chemotactic gradient. Therefore, defects in chemokinesis result in the failure of
a cell to move while defects in chemotaxis result in the failure of a cell to move in
the right direction. In the absence of Slit2, neutrophils migrated efficiently towards a
point-source of fMLP (Supplementary Video 1 and Supplementary Figure 4A-C). In
the presence of Slit2, neutrophils moved randomly but failed to move towards the
142
micropipette (Supplementary Video 2 and Supplementary Figure 4D-F). These data
suggest that Slit2 does not inhibit generalized movement of neutrophils but rather,
their directionality. To refine the analysis, we tracked the centroid of each neutrophil
over time. Figure 3A depicts the migratory tracks of neutrophils exposed to an fMLP
gradient while Figure 3B represents the migratory tracks of neutrophils exposed to
fMLP in the presence of Slit2. The displacement, speed, and directionality were
determined for each cell. A neutrophil migrating efficiently (directly) up a
chemotactic gradient would have very similar displacement and distance
measurements. As such, its directionality value would be close to 1. Conversely, a
neutrophil moving randomly would have a smaller net displacement despite
traveling the same distance, thereby having a directionality value closer to 0.
Neutrophils incubated with fMLP alone had an average speed of 6.8 ± 0.6 µm/min,
no different from those incubated with fMLP together with Slit2 (6.5 ± 0.6 µm/min;
Figure 3C). In the presence of Slit2, the directionality ratio was significantly reduced
(Figure 3D; fMLP 0.61 ± 0.04; fMLP + Slit2 0.13 ± 0.04; p < 0.002). Taken together,
these data demonstrate that Slit2 does not inhibit the random movement and speed
of neutrophil migration but, rather, prevents directional migration towards a
chemotactic gradient.
5) Slit2 inhibits chemoattractant-stimulated actin free barbed end formation in
human neutrophils. We directly assayed the effects of Slit2 on actin free barbed end
formation, an event critical for formation of protruding lamellipodia and neutrophil
migration [21, 37, 43-46]. In pyrene-actin polymerization curves generated, the
143
slope is proportional to the free barbed end numbers [21, 37]. As expected,
unstimulated neutrophils demonstrated low basal levels of free barbed end
generation, but fMLP promoted a rapid, six-fold increase (Figure 4A & B; p < 0.04).
Similarly, when neutrophils were treated with control medium prior to stimulation
with fMLP, we observed a five-fold increase in the rate of actin polymerization as
compared to unstimulated cells (Figure 4A & B; p < 0.01). In the presence of Slit2,
fMLP-induced actin polymerization was considerably more modest, resulting in less
than a three-fold increase compared to unstimulated cells (Figure 4A & B; p < 0.04).
Slit2 significantly reduced fMLP-stimulated generation of actin filaments (Figure 4A
& B; p < 0.05 vs control medium). Accordingly, Slit2 inhibited accumulation of actin
at the leading edge of neutrophils following exposure to fMLP (Figure 4C).
Collectively, these data suggest that Slit2 inhibits directional migration of
neutrophils by disrupting generation of high-affinity free barbed ends that drive actin
filament elongation. This in turn inhibits actin assembly at the leading edge of
migrating cells, thus preventing efficient chemotaxis.
6) Slit2 inhibits chemoattractant-induced polarization and activation of Rac2 and
Cdc42 in primary human neutrophils. Following chemotactic stimulation, activation
of the Rho GTPases, Rac and Cdc42, plays a key role in the re-organization of actin
filaments [19, 21, 34]. Since the predominant isoform of Rac in human neutrophils is
Rac2, not Rac1, we specifically studied activation of Rac2 [47, 48]. We used GST
beads conjugated to the p21-binding domain of p21-activated kinase-1 (PAK-PBD)
to detect the activated, GTP-bound species of Rac and Cdc42 [39]. Unstimulated
144
neutrophils had low basal levels of activated Rac2 and Cdc42 (Figure 5A & B).
Exposure to fMLP increased levels of activated Cdc42 by five-fold, and of activated
Rac2 by three-fold (Figure 5A and B; p < 0.01 vs unstimulated for both Cdc42 and
Rac2). Slit2 did not affect basal levels of activated Rac2 and Cdc42, but significantly
inhibited fMLP-induced activation of these GTPases (Figure 5A & B; p < 0.05).
Upon stimulation with fMLP, levels of activated Cdc42 and Rac2 in the presence of
Slit2 were less than half those observed when Slit2 was not present (Figure 5B; p <
0.05). Moreover, Slit2 prevented spatial accumulation of activated Rac and Cdc42
at the leading edge of fMLP-stimulated neutrophils (Figure 5C & D; p < 0.001).
These data demonstrate that Slit2 inhibits neutrophil chemotaxis and actin
polymerization by preventing cell polarization and disrupting generation and
recruitment to the lamellipodium of activated Rac2 and Cdc42.
7) Slit2 does not inhibit chemoattractant-induced activation of other major kinase
pathways. We examined the effects of Slit2 on activation of a number of other
kinase pathways associated with neutrophil chemotaxis, namely, phosphoinositide
3-kinase (PI3K), Akt, Extracellular signal related kinase (Erk), and p38 mitogen-
activated protein kinase (MAPK) [49-52]. As expected, stimulation of neutrophils
with fMLP led to rapid phosphorylation of Akt, Erk and p38-MAPK (Figure 6A-D; p <
0.0005 for Akt; p < 0.05 for Erk; p < 0.05 for p-38 MAPK). Slit2 treatment had no
effect on the basal level of kinase activation (Figure 6A-D). Upon stimulation with
fMLP, resulting levels of activated Akt were comparable in the presence or absence
of Slit2, suggesting that Slit2 does not impair the ability of neutrophils to generate
145
PI(3,4,5)P3 (Figure 6A & B). Similarly, Slit2 treatment had no effect on fMLP-induced
phosphorylation of Erk and p38 MAP kinase (Figure 6A, C, and D). Collectively,
these data suggest that Slit2 inhibits neutrophil chemotaxis by specifically
preventing activation of Cdc42 and Rac2, but not activation of Akt, Erk, or p38
MAPKs.
8) Slit2 inhibits leukocyte recruitment in peritoneal inflammation. To study the
effects of Slit2 on neutrophil recruitment in vivo, we used a well-described mouse
model of chemical irritant peritonitis [43]. In the presence of control medium, sodium
periodate administration resulted in influx of 1.90 x106 ± 0.50 x106
neutrophils
(Figure 7A). When Slit2 was pre-administered by intraperitoneal injection, neutrophil
recruitment to the peritoneal cavity decreased six-fold (Figure 7A; 0.30 x106 ±
0.11x106; p < 0.05). When purified Slit2 was pre-administered intravenously by tail
vein injection, neutrophil influx fell from 0.86 x106 ± 0.10 x106
to 0.05 x106 ± 0.02
x106 (Figure 7B; p < 0.001). Although the number of other leukocyte subsets
recruited to the peritoneal cavity was small, Slit2 also inhibited infiltration of several
of them, especially monocytes/macrophages (Supplementary Table 1; p < 0.01).
Slit2 prevented neutrophil recruitment to the peritoneum in response to other
chemoattractant factors, namely C5a and MIP-2 (Figure 7B; C5a: 1.50 x106 ±
0.60x106; C5a + Slit2: 0.30 x106 ± 0.08 x106; p < 0.001; MIP-2: 1.12 x x106
±
0.24x106; MIP-2 + Slit2: 0.65 x 106 ± 0.19 x106, p < 0.01). These data demonstrate
that Slit2 acts as a potent inhibitor of chemotaxis for circulating neutrophils, as well
as for other leukocytes, towards diverse inflammatory stimuli.
146
A1.5 Discussion
The aim of this study was to assess the effect of Slit2 on the migration of
circulating neutrophils. We demonstrated that primary human neutrophils express
Robo-1 and that exogenous application of Slit2 blocks migration of neutrophils in
response to a chemotactic gradient. This observation is consistent with the effect of
Slit2 on other cells expressing Robo-1 on their surface. Indeed, Slit2/Robo-1 have
recently been shown to inhibit the migration of a number of different cell types,
including cells of hematopoetic lineage such as dendritic cells and T lymphocytes
[14-16]. A major finding of our study is that Slit2 did not inhibit all movement but
specifically the directed migration of neutrophils. This is a particularly important
distinction because neutrophil chemotaxis to sites of injury is an important
component of inflammatory tissue injury. Indeed, neutrophil-mediated tissue
damage is associated with a number of inflammatory conditions, including
rheumatoid arthritis and ischemia-reperfusion injury [2, 53]. The ability of Slit2 to
specifically disrupt neutrophil chemotaxis points to the potential use of this agent as
a novel therapeutic for inflammatory tissue injury.
While Slit2 has been shown to inhibit chemotactic migration of several cell
types, the mechanisms that mediate these effects remain poorly understood.
Neutrophil migration involves a complex series of events in which the cell, upon
sensing a chemotactic gradient, develops a polarized morphology with a wide
lamella at the front and a narrow tail-like uropod at the back. Critical to the
maintenance of this asymmetry and to forward propulsion is the rapid turnover of
actin filaments at the lamella. In this study, we demonstrated that treatment of
147
neutrophils with Slit2 led to a significant reduction in fMLP-stimulated generation of
free barbed ends which are required for rapid actin polymerization at the leading
edge [37]. This observation is consistent with data from neuronal cells linking Robo-
1 to proteins associated with the actin cytoskeleton, including Enabled kinase (Ena)
and slit-robo GTPase activating protein-1 (srGAP1) [9, 10]. However, to the best of
our knowledge, this study provides the first evidence directly linking Slit2 treatment
to a reduction in chemoattractant-stimulated high affinity actin filament ends.
In neutrophils undergoing chemotaxis, the family of small GTPases mediate
turnover of actin. Indeed, treatment of cells with Clostridium difficile toxin, which
inhibits GTPases by monoglucosylation, results in severe defects in actin turnover
and migration [54]. Seminal work describing the effects of introducing dominant-
negative cDNA constructs into HL-60 granolucytic cells identified Rac as the key
determinant of actin assembly, and Cdc42 as being responsible for maintaining the
direction of migration [34]. We observed that exogenous application of Slit2
prevented chemoattractant-induced activation and recruitment of both Cdc42 and
Rac2. These data are consistent with data from neuronal cells where Slit2 treatment
has been shown to recruit the novel GTPase activating protein srGAP1, and to
subsequently inactivate Cdc42 and inhibit axonal migration [10]. In HL-60
neutrophil-like cells, inhibition of Cdc42 using a dominant negative allele prevents
cells from efficiently moving up a chemotactic gradient, and results in extension of
random lamellae in all directions [34].
We found that Slit2 also prevented chemoattractant-induced activation of
Rac2. Similarly, Slit2 has been shown to suppress Rac activation in human vascular
148
smooth muscle cells, human T lymphocytes, and murine RAW 264.7 macrophages
[13, 15, 16]. In murine neutrophils, Rac1 and Rac2 are expressed at similar levels,
and each isoform has distinct functions. Neutrophils deficient in Rac1 display
normal migratory velocity but reduced directionality towards chemotactic gradients
[19]. In contrast, Rac2-deficient neutrophils demonstrate reduced migration speed,
but normal chemotactic migration [19]. Rac1-deficient neutrophils show a partial
reduction in chemoattractant-induced actin polymerization, and the kinetics of actin
assembly are delayed, preferentially inhibiting early rather than later events [43].
Overall, the effects of Slit2 we observed on neutrophil migratory characteristics are
highly reminiscent of Rac1 deficiency. In our experiments, rather than evaluate
overall actin assembly, we focused on a key regulatory feature of this process,
namely, generation of free high-affinity actin filament ends. Measurement of free
barbed end formation specifically measures the initial burst of actin activity following
chemotactic stimulation. Indeed, free barbed end generation of actin is required for
efficient cell chemotaxis. We found that Slit2 inhibited chemoattractant-induced
generation of free barbed ends by over 50%. This falls in between values observed
in Rac1- and Rac2-deficient neutrophils, in which a 30% defect and a 70% defect in
free barbed end generation has been reported, respectively [21]. It is interesting to
note that following chemotactic stimulation of both Slit2-treated human neutrophils
and Rac1-deficient murine neutrophils, random migration of cells remains intact
despite a partial defect in generation of actin high-affinity free barbed ends.
Emerging data supports the concept that it is not the total amount of actin
polymerization that governs cell motility, but rather, the spatiotemporal
149
dynamics of actin assembly within the migrating cell. In support of this notion is the
recent discovery that hematopoietic protein 1 (Hem-1) constitutes part of an
organizational complex that localizes to propagating waves of actin nucleation
within migrating neutrophils [55, 56]. These waves interact reciprocally with actin to
define and organize the leading edge of neutrophils [56]. In this way, net cell
movement results from the collective actions of multiple self-organizing actin-based
waves.
At the molecular and cellular level, Slit2‟s effects on neutrophil migration
share features akin to those seen in both Rac1- and Rac2-null mice. This may be
explained by the differences in expression of Rac isoforms between murine and
human neutrophils. In murine neutrophils, Rac1 and Rac2 are expressed at
equivalent concentrations. In human neutrophils, Rac2 expression is 4 to 40 times
greater than that of Rac1 [47, 48, 57]. Thus, in human neutrophils it is likely that
Rac2 mediates functions assumed by Rac1 in murine neutrophils. In human
neutrophils it has proven very difficult to delineate the individual functions of Rac1
and Rac2. The two GTPases are 92% homologous and the guanine nucleotide
exchange factors that regulate them are the same, rendering expression of mutant
proteins in neutrophil-like cell lines an ineffective means of dissecting the individual
roles played by Rac1 and Rac2 in chemotaxis. Moreover, human neutrophils are
small, terminally differentiated cells which are difficult to transfect, further
complicating the ability to experimentally manipulate them. Together, our data
suggest a mechanism of action whereby Slit2 binding to Robo-1 in human
neutrophils prevents chemoattractant-induced activation of Rac2 and Cdc42, with
150
consequent disruption of actin free barbed end formation, and ultimately, inhibition
of directional neutrophil migration.
Stimulation of neutrophils by fMLP also leads to rapid phospholipid
metabolism and activation of major kinase pathways, including Akt, Erk, and p38-
MAPK, responsible for transcriptional changes. Studies using specific inhibitors
demonstrate that disrupting each of these pathways significantly disrupts neutrophil
chemotaxis. However, exogenous treatment with Slit2 had no effect on the
chemoattractant-induced activation of any of the above pathways. We observed
normal activation of the Akt pathway in response to chemotactic stimulation,
suggesting that Slit2 does not inhibit phospholipid metabolism and specifically,
generation of PI(3,4,5)P3. These results were somewhat surprising, given the
important role played by PI(3,4,5)P3 in chemotactic migration of neutrophils. In one
study, neutrophils from PI3Kγ-deficient mice displayed reduced directional migration
towards chemotactic gradients [50]. Our data is, however, consistent with
observations in human HL-60 granulocytic cells expressing a dominant negative
allele of Cdc42. In these studies, suppression of Cdc42 still led to normal
PI(3,4,5)P3 production and Akt activation [34]. In yet another study, Slit2 prevented
chemokine-induced activation of PI3K in human breast cancer cells [12]. We further
found that in human neutrophils, Slit2 did not inhibit chemoattractant-induced
activation of Erk, nor p38-MAPK. These data are in concordance with those of
others, demonstrating that neither activation of p38-MAPK in Jurkat T lymphocytes
nor activation of Erk in human granulocytic cells was affected by Slit2 [16, 17]. In
another study, Slit2 prevented chemotaxis and chemoinvasion of breast cancer
151
cells towards the chemokine, CXCL12, and inhibited CXCL12-induced activation of
Erk [12]. These differential effects of Slit2 on inducible kinase activity may be
attributable to the different cell types used and to the different chemotactic agents
used to stimulate them.
To determine whether Slit2 can prevent neutrophil recruitment in vivo, we
used mouse models of peritoneal inflammation induced by local instillation of
sodium periodate, C5a, or MIP-2. We found that administration of Slit2, either
intraperitoneally or intravenously, significantly reduced neutrophil recruitment. This
is the first direct demonstration of Slit2‟s potent anti-chemotactic actions on
neutrophils in vivo. These data confirm a universal “antimigratory” role for Slit2, and
are in keeping with recent work showing that Slit2 prevents pathologic
neovascularization within the eye by inhibiting chemotaxis of endothelial cells
towards vascular endothelial growth factor [18]. In another study, Slit2 ameliorated
glomerulonephritis-associated kidney injury by inhibiting chemotactic infiltration of
macrophages [15]. Our results would suggest that localized or systemic delivery of
Slit2 may reduce neutrophil recruitment and subsequent tissue damage associated
with inflammation. Soluble Slit2 is relatively “sticky” and could potentially be locally
maintained at high concentration by adhering to extracelleular matrix proteins such
as glypican-1 [58]. Thus, after regional administration, Slit2 could be retained at
sites of inflammation, such as joints and transplanted organs, thereby alleviating
neutrophil-inflicted tissue injury associated with rheumatoid arthritis and ischemia
reperfusion injury. Because Slit2 blocks migration of several types of inflammatory
cells, including neutrophils, T lymphocytes, macrophages, and dendritic cells,
152
towards diverse chemotactic stimuli, it could act as a highly effective anti-
inflammatory agent [14-17]. Further studies are needed to explore the clinical use of
Slit2, or a Slit-like agent, for prevention and treatment of localized inflammation.
153
A1.6 Acknowledgments
The authors wish to thank Dr. Mohabir Ramjeesingh for technical assistance,
and Drs. Gilles St-Laurent, and Sylvie Perret for reagents. We are grateful to Dr.
Sergio Grinstein for reagents and for helpful advice. This work was supported by the
Canadian Institute of Health Research (L.A.R.), the Kidney Foundation of Canada
(L.A.R.), and an Early Researcher Award from the Ministry of Research and
Innovation, Government of Ontario (L.A.R.). L.A.R. holds a Canada Research Chair,
Tier 2.
154
A1.7 Authorship
S.T. designed and performed experiments, analyzed results, and helped with
manuscript preparation. I.M.M., Y-W.H., M.A.O.M., and M.Y. designed and
performed experiments and analyzed results. M.R.C., G-Y.L., and C.X.S. designed
and performed experiments. Y.D. generated critical reagents and helped with
manuscript preparation. M.G. designed experiments and helped with manuscript
preparation. L.A.R. designed experiments, interpreted results, and prepared the
manuscript.
155
A1.8 References
1. Reutershan, J., Ley, K. (2004) Bench-to-bedside review: Acute respiratory
distress syndrome- how neutrophils migrate into the lumg. Crit Care 8, 453-461.
2. Weissmann, G., Korchak, H. (1984) Rheumatoid arthritis: the role of neutrophil
activation. Inflammation 8 Suppl, S3-S14.
3. Rossen, R.D., Swain, J.L., Michael, L.H., Weakley, S., Giannini, E., Entman, M.L.
(1985) Selective accumulation of the first component of complement and leukocytes
in ischemic canine heart muscle. A possible initiator of an extra myocardial
mechanism of ischemic injury. Circ Res 57, 119-130.
4. Lucchesi, B.R., Mullane, K.M. (1986) Leukocytes and ischemia-induced
myocardial injury. Annu Rev Pharmacol Toxicol 26, 201-204.
5. Panes, J., Perry, M., Granger, D.N. (1999) Leukocyte-endothelial cell adhesion:
avenues for therapeutic intervention. Br J Pharmacol 126, 537-550.
6. Charo, I.F., Ransohoff, R.M. (2006) The many roles of chemokines and
chemokine receptors in inflammation. N Engl J Med 354, 610-621.
7. Nguyen Ba-Charvet, K.T., Brose, K., Ma, L., Wang, K.H., Marillat, V., Sotelo, C.,
Tessier-Lavigne, M., Chedotal, A. (2001) Diversity and specificity of actions of Slit2
proteolytic fragments in axon guidance. J Neurosci 21, 4281-4289.
8. Brose, K., Bland, K.S., Wang, K.H., Arnott, D., Henzel, W., Goodman, C.S.,
Tessier-Lavigne, M., Kidd, T. (1999) Slit proteins bind Robo receptors and have an
evolutionarily conserved role in repulsive axon guidance. Cell 96, 795-806.
156
9. Bashaw, G.J., Kidd, T., Murray, D., Pawson, T., Goodman, C.S. (2000) Repulsive
axon guidance: Abelson and Enabled play opposing roles downstream of the
Roundabout receptor. Cell 101, 703-715.
10. Wong, K., Ren, X.-R., Huang, Y.-Z., Xie, Y., Liu, G., Saito, H., Tang, H., Wen,
L., Brady-Kalnay, S.M., Mei, L., Wu, J.Y., Xiong, W.-C., Rao, Y. (2001) Signal
transduction in neuronal migration: roles of GTPase activating proteins and the
small GTPase Cdc42 in the Slit-Robo pathway. Cell 107, 209-221.
11. Werbowetski-Ogilvie, T.E., Seyed Sadr, M., Jabado, N., Angers-Lostau, A.,
Agar, N.Y.R., Wu, J., Bjerkvig, R., Antel, J.P., Faury, D., Rao, Y., Del Maestro, R.F.
(2006) Inhibition of medulloblastoma cell invasion by Slit. Oncogene 25, 5103-5112.
12. Prasad, A., Fernandis, A.Z., Rao, Y., Ganju, R.K. (2004) Slit protein-mediated
inhibition of CXCR4-induced chemotactic and chemoinvasive signaling pathways in
breast cancer cells. J Biol Chem 279, 9115-9124.
13. Liu, D., Hou, J., Hu, X., Wang, X., Xiao, Y., Mou, Y., De Leon, H. (2006)
Neuronal chemorepellent Slit2 inhibits vascular smooth muscle cell migration by
suppressing small GTPase Rac1 activation. Circ Res 98, 480-489.
14. Guan, H., Zu, G., Tang, H., Johnson, M., Xu, X., Kevil, C., Xiong, W.-C., Elmets,
C., Rao, Y., Wu, J.Y., Xu, H. (2003) Neuronal repellent Slit2 inhibits dendritic cell
migration and the development of immune responses. J Immunol 171, 6519-6526.
15. Kanellis, J., Garcia, G.E., Li, P., Parra, G., Wilson, C.B., Han, S., Smith, C.W.,
Johnson, R.J., Wu, J.Y., Feng, L. (2004) Modulation of inflammation by Slit protein
in vivo in experimental crescentic glomerulonephritis. Am J Pathol 165, 341-351.
16. Prasad, A., Qamri, Z., Wu, J., Ganju, R.K. (2007) Slit-2/Robo-1 modulates the
157
CXCL12/CXCR4-induced chemotaxis of T cells. J Leukoc Biol 82, 465-476.
17. Wu, J.Y., Feng, L., Park, H.-T., Havlioglu, N., Wen, L., Tang, H., Bacon, K.B.,
Jiang, Z.-h., Zhang, X.-c., Rao, Y. (2001) The neuronal repellent Slit inhibits
leukocyte chemotaxis induced by chemotactic factors. Nature 410, 948-952.
18. Jones, C.A., Londin, N.R., Chen, H., Park, K.W., Sauvaget, D., Stockton, R.A.,
Wythe, J.D., Suh, W., Larrieu-Lahargue, F., Mukoutama, Y.-s., Lindblom, P., Seth,
P., Frias, A., Nishiya, N., Ginsberg, M.H., Gerhardt, H., Zhang, K., Li, D.Y. (2008)
Robo4 stabilizes the vascular network by inhibiting pathologic angiogenesis and
endothelial hyperpermeability. Nat Med 14, 448-453.
19. Sun, C.X., Downey, G.P., Zhu, F., Koh, A.L.Y., Thang, H., Glogauer, M. (2004)
Rac1 is the small GTPase responsible for regulating the neutrophil chemotaxis
compass. Blood 104, 3758-3765.
20. Clark, R.A., Volpp, B.D., Leidal, K.G., Nauseef, W.M. (1990) Two cytosolic
components of the human neutrophil respiratory burst oxidase traslocate to the
plasma membrane during cell activation. J Clin Invest 85, 714-721.
21. Sun, C.X., Magalhaes, M.A.O., Glogauer, M. (2007) Rac1 and Rac2
differentially regulate actin free barbed end formation downstream of the fMLP
receptor. J Cell Biol 179, 239-245.
22. Li, H.S., Chen, J.H., Wu, W., Fagaly, T., Zhou, L., Yuan, W., Dupuis, S., Jiang,
Z.H., Nash, W., Gick, C., Ornitz, D.M., Wu, J.Y., Rao, Y. (1999) Vertebrate slit, a
secreted ligand for the transmembrane protein roundabout, is a repellent for
olfactory bulb axons. Cell 96, 807-818.
158
23. Zhang, J., Liu, X., Bell, A., To, R., Nath Berall, T., Azizi, A., Li, J., Cass, B.,
Durocher, Y. (2009) Transient expression and purification of chimeric heavy chain
antibodies. Protein Expr Purif 65, 77-82.
24. Shi, C., Shin, Y.-O., Hanson, J., Cass, B., Loewen, M.C., Durocher, Y. (2005)
Purification and characterization of a recombinant G-protein-coupled receptor,
Saccharomyces cerevisiae Ste2p, transiently expressed in HEK203 EBNA1 cells.
Biochemistry 44, 15705-15714.
25. Durocher, Y., Perret, S., Kamen, A. (2002) High-level and high-throughput
recombinant protein production by transient transfection of suspension-growing
human 293-EBNA1 cells. Nucleic Acids Res 30, E9.
26. Moore, K.J., Andersson, L.P., Ingalls, R.R., Monks, B.G., Li, R., Arnaout, M.A.,
Golenbock, D.G., Freeman, M.W. (2000) Divergent responses to LPS and bacteria
in CD14-deficient murine macrophages. J Immunol 165, 4272-4280.
27. Robinson, L.A., Nataraj, C., Thomas, D.W., Cosby, J.M., Griffiths, R., Bautch,
V.L., Patel, D.D., Coffman, T.M. (2003) The chemokine CX3CL1 regulates NK cell
activity in vivo. Cellular Immunol 225, 122-130.
28. Robinson, L.A., Nataraj, C., Thomas, D.W., Howell, D.N., Griffiths, R., Bautch,
V., Patel, D.D., Feng, L., Coffman, T.M. (2000) A role for fractalkine and its receptor
(CX3CR1) in cardiac allograft rejection. J Immunol 165, 6067-6072.
29. Yan, M., Di Ciano-Oliveira, C., Grinstein, S., Trimble, W.S. (2007) Coronin
function is required for chemotaxis and phagocytosis in human neutrophils. J
Immunol 178, 5769- 5778.
159
30. Veldkamp, K.E., Heezius, H.C.J.M., Verhoef, J., van Strijp, J.A.G., Van Kessel,
K.P.M. (2000) Modulation of neutrophil chemokine receptors by Staphylococcus
aureus supernate. Infect Immun 68, 5908-5913.
31. Crawford, M.A., Aylott, C.V., Bourdeau, R.W., Bokoch, G.M. (2006) Bacillus
anthracis toxins inhibit human neutrophil NADPH oxidase activity. J Immunol 176,
7557-7565.
32. Fickl, H., Theron, A.J., Anderson, R., Mitchell, T.J., Feldman, C. (2007)
Palladium attenuates the pro-inflammatory interactions of C5a, interleukin-8 and
pneumolysin with human neutrophils. J Immunotoxicol 4, 247-252.
33. Magalhaes, M.A.O., Zhu, F., Sarantis, H., Gray-Owen, S.D., Ellen, R.P.,
Glogauer, M. (2007) Expression and translocation of fluorescent-tagged p21-
activated kinase-binding domain and PH domain of protein kinase B during murine
neutrophil chemotaxis. J Leukoc Biol 82, 559-566.
34. Srinivasan, S., Wang, F., Glavas, S., Ott, A., Hofmann, F., Aktories, K., Kalman,
D., Bourne, H.R. (2003) Rac and Cdc42 play distinct roles in regulating PI(3,4,5)P3
and polarity during neutrophil chemotaxis. J Cell Biol 160, 375-385.
35. Hayashi, H., Aharonovitz, O., Alexander, R.T., Touret, N., Furuya, W., Orlowski,
J., Grinstein, S. (2008) Na+/H+ exchange and pH regulation in the control of
neutrophil chemokinesis and chemotaxis. Am J Physiol Cell Physiol 294, C526-
C534.
36. Gardiner, E.M., Pestonjamasp, K.N., Bohl, B.P., Chamberlain, C., Hahn, K.M.,
Bokoch, G.M. (2002) Spatial and temporal analysis of Rac activation during live cell
chemotaxis. Curr Biol 12, 2029-2034.
160
37. Glogauer, M., Hartwig, J.H., Stossel, T.P. (2000) Two pathways through Cdc42
couple the N-formyl receptor to actin nucleation in permeabilized human
neutrophils. J Cell Biol 150, 785-796.
38. Barkalow, K., Witke, W., Kwiakowski, D.J., Hartwig, J.H. (1996) Coordinated
regulation of platelet actin filament barbed ends by gelsolin and capping protein. J
Cell Biol 134, 389-399.
39. Benard, V., Bohl, B.P., Bokoch, G.M. (1999) Characterization of Rac and Cdc42
activation in chemoattractant-stimulated human neutrophils using a novel assay for
active GTPases. J Biol Chem 274, 13198-13204.
40. de Haas, C.J.C., Veldkamp, K.E., Peschel, A., Weerkamp, F., Van Wamel,
W.J.B., Heezius, E.C.J.M., Poppelier, M.J.J.G., Van Kessel, K.P.M., van Strijp,
J.A.G. (2004) Chemotaxis inhibitory protein of Staphylcoccus aureus, a bacterial
antiinflammatory agent. J Exp Med 199, 687-695.
41. Bajt, M.L., Farhood, A., Jaeschke, H. (2001) Effects of CXC chemokines on
neutrophil activation and sequestration in hepatic vasculature. Am J Physiol
Gastrointest Liver Physiol 281, G1188-G1195.
42. Clark, K., Hammond, E., Rabbitts, P. (2002) Temporal and spatial expression of
two isoforms of the Dutt1/Robo1 gene in mouse development. FEBS Letters 523,
12-16.
43. Glogauer, M., Marchal, C.C., Zhu, F., Worku, A., Clausen, B.E., Foerster, I.,
Marks, P., Downey, G.P., Dinauer, M., Kwiakowski, D.J. (2003) Rac1 deletion in
mouse neutrophils has selective effects on neutrophil function. J Immunol 170,
5652-5657.
161
44. Condeelis, J. (2001) How is actin polymerization nucleated in vivo? Trends Cell
Biol 11, 288-293.
45. Ichetovkin, I., Grant, W., Condeelis, J. (2002) Cofilin produces newly
polymerized actin filaments that are preferred for dendritic nucleation by the Arp/3
complex. Curr Biol 12, 79-84.
46. Huang, T.Y., DerMardirossian, C., Bokoch, G.M. (2006) Cofilin phosphatases
and regulation of actin dynamics. Curr Opin Cell Biol 18, 26-31.
47. Li, S., Yamauchi, A., Marchal, C.C., Molitoris, J.K., Quilliam, L.A., Dinauer, M.C.
(2002) Chemoattractant-stimulated Rac activation in wild-type and Rac2-deficient
murine neutrophils: preferential activation of Rac1 and Rac2 gene dosage effect on
neutrophil functions. J Immunol 169, 5043-5051.
48. Quinn, M.T., Evans, T., Loetterle, L.R., Jesaitis, A.J., Bokoch, G.M. (1993)
Translocation of Rac correlates with NADPH oxidase activation. Evidence for
equimolar translocation of oxidase components. J Biol Chem 268, 20983-20987.
49. Coxon, P.Y., Rane, M.J., Uriarte, S., Powell, D.W., Singh, S., Butt, W., Chen,
Q., McLeish, K.R. (2003) MAPK-activated protein kinase-2 participates in p38
MAPKdependent and ERK-dependent functions in human neutrophils. Cell Signal
15, 993- 1001.
50. Hannigan, M., Zhan, L., Li, Z., Ai, Y., Wu, D., Huang, C.-K. (2002) Neutrophils
lacking phosphoinositide 3-kinase gamma show loss of directionality during N-
formyl-Met-Leu- Phe-induced chemotaxis. Proc Natl Acad Sci USA 99, 3603-3608.
162
51. Heit, B., Tavenere, S., Raharjo, E., Kubes, P. (2002) An intracellular signaling
hierarchy determines direction of migration in opposing gradients. J Cell Biol 159,
91-102.
52. Zu, Y.-L., Qi, J., Gilchrist, A., Fernandez, G.A., Vazquez-Abad, D., Kreutzer,
D.L., Huang, C.-K., Sha'afi, R.I. (1998) p38 mitogen-activated protein kinase
activation is required for human neutrophil function triggered by TNF-alpha or fMLP
stimulation. J Immunol 160, 1982-1989.
53. Kaminski, K.A., Bonda, T.A., Korecki, J., Musial, W.J. (2002) Oxidative stress
and neutrophil activation- the two keystones of ischemia/reperfusion injury. Int J
Cardiol 86, 41-59.
54. Sehr, P., Joseph, G., Genth, H., Just, I., Pick, E., Aktories, K. (1998)
Glucosylation and ADP ribosylation of rho proteins: effects of nucleotide binding,
GTPase activity, and effector coupling. Biochemistry 37, 5296-5304.
55. Weiner, O.D., Rentel, M.C., Ott, A., Brown, G.E., Jedrychowski, M., Yaffe, M.B.,
Gygi, S.P., Cantley, L.C., Bourne, H.R., Kirschner, M.W. (2006) Hem-1 complexes
are essential for Rac activation, actin polymerization, and myosin regulation during
neutrophil chemotaxis. PLoS Biol 4, e38.
56. Weiner, O.D., Marganski, W.A., Wu, L.F., Altschuler, S.J., Kirschner, M.W.
(2007) An actin-based wave generator organizes cell motility. PLoS Biol 5, e221.
57. Gu, Y., Filippi, M.-D., Cancelas, J.A., Siefring, J.E., Williams, E.P., Jasti, A.C.,
Harris, C.E., Lee, A.W., Prabhakar, R., Atkinson, S.J., Kwiakowski, D.J., Williams,
D.A. (2003) Hematopoietic cell regulation by Rac1 and Rac2 guanosine
triphosphatases. Science 302, 445-449.
163
58. Ronca, F., Andersen, J.S., Paech, V., Margolis, R.U. (2001) Characterization of
Slit protein interactions with glypican-1. J Biol Chem 276, 29141-29147.
164
A1.9 Figure Legends
Figure 1. Primary human and murine neutrophils express Robo-1. A, Primary
human neutrophils were isolated from venous blood of healthy volunteers, RNA was
extracted, and RTPCR was performed using specific primers for Robo-1. For
comparison, total RNA was isolated from human leukocytes from whole blood, and
RT-PCR similarly performed. B, Cell lysates from primary human neutrophils and
bone marrow-derived murine neutrophils were harvested and immunoblotting was
performed using anti-Robo-1 primary Ab and HRP-conjugated secondary Ab. C,
Human neutrophils were plated on fibronectin-coated coverslips and labeled
with anti-Robo-1 Ab followed by Cy3-conjugated secondary Ab. Cells were
examined using a Leica DMIRE2 spinning disc confocal microscope at 100x
magnification. Scale bar is 10 µm. Representative image from one of three separate
experiments. D, To detect cell surface expression of Robo-1, primary human
neutrophils were fixed, incubated with anti-Robo-1 Ab followed by PE-conjugated
secondary Ab or with secondary Ab alone, and analyzed using a FACScalibur flow
cytometer (BD Biosciences) and FlowJo software (Tree Star, Inc., Ashland,
OR). Representative image from one of three similar independent experiments.
Value indicates % of cells with positive labeling. E, Mouse bone marrow-derived
neutrophils were isolated and cell surface Robo-1 labeled as described in D.
Representative image from one of three similar independent experiments. Value
indicates % of cells with positive labeling.
165
Figure 2. Slit2 inhibits migration of human neutrophils towards diverse
chemoattractants. A-D, Primary human neutrophils were incubated with purified
Slit2 (4.5 µg/ml) for 10 min at 37 °C, then migration assays performed across 3 µm
Transwell inserts. The lower chamber contained HBSS or Slit2-containing HBSS in
the presence or absence of fMLP (1 µM). Neutrophils were placed in the upper
chamber and Transwell plates incubated for 1 h at 37 °C. The insert was removed,
and cells which had migrated from the upper to the lower chamber were gently
centrifuged onto coverslips and cell nuclei labeled with DAPI to facilitate
visualization. Representative high-power (63x) images of migrated cells from four
independent experiments were taken using a Leica deconvolution microscope: A,
HBSS. B, HBSS with fMLP. C, Slit2 with fMLP. D, Slit2. E, Transwell assays were
performed as described above, in the presence of the indicated concentrations of
Slit2. Random fields were counted using a Nikon light microscope. Mean number of
cells counted per 63x field ± SEM. *, p < 0.001; n=10. F, Transwell migration assays
were performed as described above. In the lower chamber was placed either C5a (2
µg/ml) or IL-8 (0.13 µg/ml), in the presence or absence of purified Slit2 (4.5 µg/ml).
*, p < 0.001; n = 4.
Figure 3: Slit2 inhibits neutrophil chemotaxis. Primary human neutrophils were
allowed to settle onto fibronectin-coated coverslips. A micropipette containing fMLP
(1 µM) was used to dispense a point-source and gradient of chemoattractant, and
neutrophil migration was monitored using time-lapse video microscopy. The cells
were maintained on the 37 °C-heated stage of a Leica DMIRE2 inverted microscope
166
equipped with a Hamamatsu back-thinned EM-CCD camera and spinning disc
confocal scan head. Digital pictures were acquired every 3 s. In some experiments,
neutrophils were also exposed to anti-myc Ab affinity-purified Slit2 (0.6 µg/ml).
VolocityTM (Improvision) software was used to track the centroid of migrating
neutrophils and thus calculate the total distance, net distance and speed of
migration. Directionality (displacement/distance) was used as a measure of
chemotaxis. A minimum of 8-10 cells for each condition were examined from each
of three separate experiments. Two to 3 cells from each quadrant were randomly
selected prior to initiating tracking. Only cells which started and remained in the field
of view over the entire course of video capture were analyzed. A, Migratory tracks
from one experiment where neutrophils were exposed to fMLP. „X‟ marks the
position of the micropipette. B, Migratory tracks from one experiment where
neutrophils were exposed to fMLP together with Slit2. „X‟ marks the position of the
micropipette. Panel inset depicts an enlarged view of the tracks made by a single
neutrophil. C, Graph depicting the mean migratory speed of neutrophils exposed to
fMLP alone or to fMLP in conjunction with Slit2. Mean values ± SEM for 3 separate
experiments. D, Graph depicting the mean directionality of neutrophils exposed to
fMLP alone or to fMLP together with Slit2. Mean values ± SEM for 3 separate
experiments. *, p < 0.002.
Figure 4: Slit2 inhibits chemoattractant-stimulated formation of actin free
barbed ends in human neutrophils. A, Time series analysis of the fluorescence
increase associated with actin polymerization. Briefly, 1x106 freshly isolated human
167
neutrophils were permeabilized for 10 s with 0.2% OG buffer, and the
permeabilization process was stopped by diluting the detergent with 3 vol of buffer
B, as described in „Materials and Methods‟. Cells were stimulated with fMLP (1 µM)
for 120 s in the presence of fPLC-enriched Slit2 (0.6 µg/ml) from conditioned
medium or control medium. Free barbed end generation was assayed by adding
pyrene-labeled rabbit skeletal muscle actin to a final concentration of 1 µM and
following the fluorescence increase using a microplate reader (FLUOstaroptima)
with fluorescence excitation and emission wavelengths of 355 and 405 nm,
respectively. Representative results of four separate experiments are shown. B,
Pyrene-actin incorporation was monitored as in (A) for 150s and the change in
slope of the curve was used as a measure of the rate of actin polymerization. Mean
rate of actin polymerization normalized to the unstimulated control ± SEM. *, p <
0.05; **, p < 0.04; ***, p < 0.01. C, Freshly isolated human and mouse neutrophils
were incubated with Slit2 and plated on fibronectin-coated coverslips in a 6 well
tissue culture plate. Cells were incubated with fMLP (1 µM) for 3 min, then fixed,
permeabilized with 0.1% Triton, and incubated with rhodamine-conjugated
phalloidin for 30 min to visualize actin. Cells were examined using a Leica DMIRE2
spinning disc confocal microscope at 100x magnification.
Figure 5: Slit2 prevents chemoattractant-induced activation and redistribution
of Rac2 and Cdc42. A, Neutrophils were activated with PBS or fMLP (1 µM for 30
s) in the presence or absence of anti-myc Ab affinity-purified Slit2 (0.6 µg/ml), and
cell lysates collected. GST beads conjugated to the p21-binding domain of PAK1
168
were used to pull down activated Cdc42 and Rac and immunoblotting was
performed using specific Ab directed against Cdc42 or Rac2. Blots shown are
representative of five independent experiments. B, Mean values ± SEM of
normalized band intensities from five independent experiments (*p < 0.01; ** p <
0.05). C, Neutrophils were isolated from murine bone marrow as described in
„Materials and Methods‟. One million cells were suspended in 100 µl NucleofectorTM
solution (Amaxa, Inc.) supplemented with 6 µg cDNA for PAK-PBD-YFP and H-Ras-
RFP. Cells were transfected using a Cell Line V NucleofectorTM kit and the
NucleofectorTM program Y-001. Transfected cells were carefully recovered with 500
µl Iscove‟s Modified Dulbecco‟s Medium (IMDM) pre-warmed to 37 °C, and
transferred to 1.5 ml pre-warmed IMDM supplemented with 10% FBS in six-well
plates for 2 h. After the recovery period, cells were incubated with purified Slit2 (4.5
µg/ml) for 10 min. Cells were mounted on a 1% BSA-coated coverslip in an Attafluor
cell chamber mounted on the 37 °C heated stage of a Leica DMIRE2 inverted
fluorescence microscope quipped with a Hamamatsu back-thinned EM-CCD
camera and spinning disc confocal scan head. Cells were exposed to a point-
source of chemoattractant using a glass micropipette containing fMLP (1 µM).
Digital pictures were taken every 3 s for 5 min, and images were acquired and
analyzed using Volocity software (Improvision Ltd). Images showing the distribution
of PAK-PBD-YFP, H-Ras-RFP, and the resulting GFP-RFP ratio at the leading edge
compared to the trailing edge of cells exposed to fMLP alone or fMLP in the
presence of Slit2. Arrow indicates the direction of the chemotactic gradient. Images
169
are representative of at least 19 cells analyzed from 3 separate experiments. D,
Experiments were performed as described in (C). Mean values ± SEM for the
normalized mean fluorescence intensity (MFI), calculated as the GFP:RFP ratio at
the leading edge compared to the trailing edge of the cell. A minimum of 19 cells
were analyzed from 3 separate experiments. *, p < 0.001.
Figure 6: Slit2 does not inhibit chemoattractant-induced activation of Akt, Erk,
or p38-MAPK. A, Neutrophils were incubated with fMLP and/or Slit2, as described
for Figure 5A. Cell lysates were collected, and immunoblotting was performed using
specific Ab detecting phospho-Akt, phospho-Erk, and phospho-p38 MAPK. Blots
were stripped and re-probed using Ab detecting total Akt, total Erk, and total p38
MAPK, respectively. Blots are representative of 3 independent experiments. B,
Band intensities for phospho-Akt (p-Akt) normalized to total Akt. Mean values ±
SEM for 3 independent experiments (*, p < 0.0005; **, p < 0.05). C, Band
intensities for phospho-Erk (p-Erk) normalized to total Erk. Mean values ± SEM for 3
independent experiments (**, p < 0.05). D, Band intensities for phospho-p38-MAPK
(p-p38) normalized to total p38-MAPK. Mean values ± SEM for 3 independent
experiments. (**, p < 0.05; ***, p < 0.005).
Figure 7: Slit2 inhibits neutrophil chemotaxis in vivo towards diverse
attractant stimuli. A, Adult CD1 mice were injected intraperitoneally with Slit2 (0.1
µg/mouse) or control medium, and 1 h later, with 1 ml of 5 mM sodium periodate
(NaIO4). After 3 h, mice were euthanized and the peritoneal exudates collected by
170
lavage with chilled PBS (5 ml/mouse). Infiltrating leukocytes were counted using an
electronic cell counter and the number of neutrophils quantified using Wright-
Giemsa stain. Mean values ± SEM from 5 separate experiments. *, p < 0.05; **, p <
0.01. B, Adult CD1 mice received an intravenous dose of purified Slit2 (1.8 µg in
0.2 ml normal saline) by tail-vein injection. One hour later, mice were given 1 ml of
NaIO4 (5 mM), C5a (10 µg), or MIP-2 (2.5 µg) by intraperitoneal injection. After 3 h,
mice were euthanized and the peritoneal exudates collected by lavage with chilled
PBS (5 ml/mouse). Infiltrating leukocytes were counted using an electronic cell
counter and the number of neutrophils quantified using Wright-Giemsa stain. Mean
values ± SEM from 4 to 6 separate experiments per treatment condition. *, p <
0.001; **, p < 0.01.
Supplementary Figure 1: Recombinant hSlit2 purified by size-exclusion
chromatography and cobalt-affinity chromatography. A-B, Conditioned medium
was harvested from HEK293- hSlit2-myc cells and control HEK-293 cells as
described in „Materials and Methods‟. Using size-exclusion chromatography,
fractionated samples were collected and were run in 8% SDSPAGE. A,
Representative gel for a sample from pooled fractions was silver stained. B,
Representative gel, transferred to a PVDF membrane and immunoblotting
performed using monoclonal anti-myc Ab. C-D, For larger-scale preparation of Slit2,
conditioned medium was harvested from HEK293-EBNA1 cells transfected with
pTT28-Slit2 expression plasmid, as described in „Materials and Methods‟. Slit2
secreted into the medium was purified by immobilized metal-affinity chromatography
171
using Fractogel-cobalt columns. Samples were desalted and immunoblotting
performed. Proteins were resolved on reducing NuPAGE 4-12% Bis-Tris gradient
gels, and transferred to nitrocellulose membranes. C, Representative membrane,
stained with Ponceau red solution. D, Representative membrane, probed with
antipolyHis- HRP Ab. For C and D, lanes are marked as follows: 1) harvested
medium 5 days posttransfection; 2) IMAC flow-through; 3) Wash1; 4) Wash 2; 5)
pooled eluted fractions from Fractogel-cobalt column.
Supplementary Figure 2: Measurement and verification of endotoxin levels
and activity present in Slit2 preparations. From each separate Slit2 preparation,
endotoxin levels were measured using ToxinSensor Chromogenic LAL Endotoxin
Assay Kit (GenScript Corp., Piscataway, NJ), according to the manufacturer‟s
specifications. Endotoxin concentrations ranged from 2.5-8.0 EU/ml, corresponding
to 0.2-0.8 ng/ml endotoxin, and yielding final experimental concentrations of 12-40
pg/ml, which are well below those thought to activate leukocytes. To verify this,
endotoxin (40 pg/ml) was added to Transwell assays, and effects on neutrophil
transmigration examined as described in „Materials and Methods‟ and in Figure 2.
n=2.
Supplementary Figure 3: Slit2 inhibits migration of primary human
neutrophils. Primary human neutrophils were incubated with FPLC-enriched Slit2
from conditioned medium (0.6 µg/ml) or with similar fractions from control medium
for 10 min at 37 °C, then migration assays performed across 3 µm Transwell
172
inserts. The lower chamber contained HBSS, control medium or Slit2 in the
presence or absence of fMLP (1 µM). Neutrophils were placed in the upper
chamber and Transwell plates incubated for 1 h at 37 °C. The insert was removed,
and cells which had migrated from the upper to the lower chamber were gently
centrifuged onto coverslips, fixed and random fields were counted using a Nikon
light microscope. Representative high-power (63x) images of migrated cells from
four independent experiments were taken using a Leica deconvolution microscope.
Mean number of cells counted per 63x field ± SEM for 4 independent experiments.
(*, p < 0.05).
Supplementary Figure 4: Slit2 inhibits directional migration of human
neutrophils. Primary human neutrophils were allowed to settle onto fibronectin-
coated coverslips. A micropipette containing fMLP (1 µM) was used to dispense a
point-source and gradient of chemoattractant, and neutrophil migration was
monitored using time-lapse video microscopy at 37 °C. A-C, Migration of neutrophils
exposed to a gradient of fMLP over the course of 5 minutes. D-F, Migration of
neutrophils exposed to a gradient of fMLP together with Slit2 (0.6 µg/ml) over 5
minutes. Representative images from one of five separate experiments. For 4
independent experiments. (*, p < 0.05).
Supplementary Video 1. Human neutrophils migrate effectively towards a
point source of fMLP. Glass coverslips were coated with fibronectin, mounted in a
Leiden chamber, and placed on the heated stage of a microscope. A suspension of
173
human neutrophils containing 106 cells/ 100 µl was added and allowed to settle for
10 min. To induce chemotaxis, a point-source of fMLP (1 µM) was delivered using a
borosilicate capillary micropipette. The pipette was held stationary and diffusion of
fMLP generated a standing gradient. Images were acquired using MetaMorph
software (Universal Imaging, West Chester, PA) running on a Dell Optiplex DGX
590 computer interfaced with a Photometrics camera via a 12-bit GPIB/IIA board
(National Instruments, Foster City, CA). Image acquisition was started upon the
pipette entering the field and images were obtained every 10 s until completion of
the experiment. Representative video from one of five separate experiments.
Supplementary Video 2. Slit2 inhibits directional migration of human
neutrophils towards a point source of fMLP. Experiments were performed as
described in „Supplementary Video 1‟. Neutrophils were also exposed to anti-myc
Ab affinity-purified Slit2 (0.6 µg/ml) and cell migration was monitored by time-lapse
videomicroscopy. Representative video from one of five separate experiments.
Supplementary Table 1. Leukocyte subsets recovered from peritoneal lavage
fluid following sodium periodate-induced peritonitis. Adult CD1 mice received
an intravenous dose of purified Slit2 (1.8 µg in 0.2 ml normal saline) by tail-vein
injection. One hour later, mice were given 1 ml of NaIO4 (5 mM) by intraperitoneal
injection. After 3 h, mice were euthanized and the peritoneal exudates collected by
lavage with chilled PBS (5 ml/mouse). The total number of cells was counted, and
the numbers of monocytes/macrophages, T lymphocytes, B lymphocytes, and
174
natural killer cells determined by labeling with Ab directed to F4/80, CD3, B220, and
NK1.1, respectively, followed by PE-conjugated secondary Ab. Flow cytometry was
performed using a FACScalibur flow cytometer and FlowJo software. Mean values ±
SEM from 4 separate experiments.
175
176
177
178
179
180
181