SENSITIVITY GAINS USING MICROFLOW LC/MSSENSITIVITY GAINS USING MICROFLOW LC/MS FOR OLIGONUCLEOTIDE ANALYSIS

Maki Terasaki1, Kenji Hirose1, Michael Donegan2, James Murphy2

1Nihon Waters K.K., 2Waters Corporation

INTRODUCTION

Recently there has been considerable interest in

RESULTS AND DISCUSSION

With bioanalytical method development it is not unusual to have aBlank

Recently there has been considerable interest inoligonucleotide therapeutics. Oligonucleotides are designedto interfere with mRNA expression and block production ofdisease related proteins. As a class of compounds,oligonucleotides pose a complex bioanalytical challenge.The polyanionic phosphate backbone presents difficultieswith non-specific binding to tubes and plates, binding toplasma proteins formation of multiple negative ion charge

With bioanalytical method development it is not unusual to have aproblematic sample clean up, or a difficult chromatographicseparation or even sometimes a challenging compound thatprefers to stick to plasma proteins. With oligonucleotide analysis,all three of those situations exist. Without proper chromatographicresolution, metabolites or even synthetic impurities will beerroneously calculated as the analyte of interest leading to anover estimation of the actual value Similarly if the OGN sticks to High Standard (20 μg/mL)plasma proteins, formation of multiple negative ion charge

states and the presence of highly adducted species. Thesefactors impact the level of quantitation possible andinfluence the extraction, chromatography and ESI behaviorrequired for successful analysis.

Microflow LC/MS has been shown to offer significantsensitivity gains over more traditional 2 1 x 50 mm UPLC

over estimation of the actual value. Similarly, if the OGN sticks toplasma proteins or sample vial, there could be an underestimationof actual levels. It has been shown many times thatphosphorylated compounds readily adhere to metal surfaces. Thefully thiorated compound that we have investigated contains 25such phosphate groups making it very likely to stick to surfaces.So not only is it critical to have a method that will address bindingto protein in the matrix it is also critical to address samples loss

Figure 4. Comparison of the high standard injection in plasma (20 μg/mL) and the blank immediately following. Carryover level is not detected

High Standard (20 μg/mL)

sensitivity gains over more traditional 2.1 x 50 mm UPLCapproaches. The reason for the observed signal gains inmicroflow lie in the fact that as column diameter decreases,peaks elute off of the LC column with a much lower volumeand therefore produce peaks with a higher signal-to-noise(S/N) ratio as compared to its UPLC counterpart. Figure 1depicts a schematic drawing of the microfluidic device usedfor this study

to protein in the matrix, it is also critical to address samples losson storage or adherence to injector valves or other metal surfaces.

The use of a phenol/chloroform/isoamyl alcohol liquid-liquidextraction is a useful method to extract oligonucleotides. Thephenol acts as a weak acid and helps to denature plasmaproteins and reduce the protein binding of OGN. Thechloroform/isoamyl alcohol further helps to precipitate proteins

The analyte was prepared in urine in the same manner as plasma.Results in urine show a linear range of 0.5-20 μg /mL also withvery low, non-detected carryover peak. Figure 5 shows thecarryover observed on the blank after the high standard (20μg/mL). Figure 6 shows the urine curve data and result table.

for this study.

Within this presentation, we will present novel extractiontechniques utilizing a combined liquid-liquid extraction andsolid phase extraction approach and address issuesspecifically problematic to oligonucleotide analysis such ascarryover and sensitivity.

chloroform/isoamyl alcohol further helps to precipitate proteinsand partition the OGN into the aqueous phase.1 The liquid-liquidextraction is then coupled to a solid phase extraction to bothfurther clean up the sample and also reduce the volume neededto evaporate.The analyte of interest is a fully thiorated oligonucleotide ofsequence CTCTCGCACCCATCTCTCTCCTTCT (ChemicalF l C237H310N72O131S24P24 MW 7776 42)

Finally, we wanted to compare analysis on a convention scaleUPLC to the data that we obtained using microflow LC/MS.

Comparative analysis on a conventional flow UPLC/MSoperated at 400 μL/min (2.1 x 50 mm BEH C18 column)showed significantly lower sensitivity with the linear range inboth plasma and urine at 1-500 μg/mL. Figure 7 shows the

Formula=C237H310N72O131S24P24, MW=7776.42)

A standard curve was prepared and was spiked into human plasma and urine. Attempts at abbreviated extraction techniques, such as protein precipitation for plasma and “dilute and shoot” for urine samples resulted in very low recovery of analyte (<10%). Linear range for plasma data using the liquid-liquid extraction

comparison of microflow to conventional UPLC.

Blank

followed by solid phase extraction was 0.1-10 μg /mL. Figure 2 shows the standard curve in plasma and the result table. Linearity is within 15% for the analyte without the use of an internal standard. One of the difficulties in working with OGN’s is finding a suitable internal standard. Many of the OGN compounds that might be used as internal standards will fragment to the same daughter ions and have interfering masses that will confound

High Standard (20 μg/mL)

analysis.

Figure 1. Scematic representation of ionKey microfluidic device used in this study

Figure 5. Comparison of the high standard injection in urine (20 μg/mL) and the blank immediately following. Carryover level is not detected

METHODS

ChromatographyIon pair chromatography was selected as the best method ofperforming the LC separation. The most common approach is touse trimethylamine (TEA) as the ion pair reagent and 1,1,1,3,3,3-hexafluoro-2-propanol as a means to adjust pH. It is thought thatthe mechanism by which HFIP functions is by taking advantage ofthe volatility of HFIP (bp 57oC). During the electrospray process,the HFIP is evaporated quickly at the droplet surface, leaving thehigher pH TEA to enhance the signal of the negative ionphosphorylated OGN’s. Chromatographically, running a very highpH solution would shorten column lifetime and provide poor peak

Figure 2. Standard curve of OGN in human plasma extracted with LLE-SPE approach.

Initial method development data of our analyte in neat solution showed that a blank injection after a high standard exhibited significant carryover building up over time and not clearing with repeated blank injections. (Fig. 3). Several modifiers were added in an attempt to remediate this. Citrate buffer (50 mM) showed little effect while undiluted plasma (0.1%) was able to clear the system of any interfering levels after just a few injections The

resolution. However, the HFIP/TEA combination allows for arelatively moderate pH for LC separation and a much higher oneduring the desolvation/ionization process.

Chromatographic separation was performed on a Waters BEHC18 iKey device (150 μm x 50 mm, 1.7 um). Mobile phase Aconsisted of 15 mM TEA and 400 mM HFIP in water (pH 7.8).

Figure 6. Standard curve of OGN in human urine extracted with LLE-SPE approach.

system of any interfering levels after just a few injections. The best results were obtained with the addition of 2 mM EDTA as the reconstitution solution. With EDTA, the blank injection immediately after the high standard in plasma was reduced to below 20% of the LOQ (Fig. 4).

(p )Mobile phase B consisted of 50/50 methanol:water containing 15mM TEA and 400 mM HFIP. Samples were run in direct injectmode using a 5 μL injection volume.

Mass spectrometric detection was conducted on a Waters TQSmass spectrometer operating in negative ion mode.

Extraction Protocol-LLE/SPE Analytical standards were prepared in lo-bind tubes in human

plasma and urine at concentrations of 0.1, 0.5, 1, 5, 10, and 20 ug/mL

In a 1.5 mL lo-bind eppendorf, 200 μL of sample was added to 300 μL of 5M NH4OH. Vortex

Add 200 μL of phenol/chloroform/isoamyl alcohol Vortex and

18th blank after tune solution

9th blank after tune solution

Figure 7. Comparison of a 1 μg/mL injection on ionKey vs a 10 μg/mL injection using conventional UPLC conditions Add 200 μL of phenol/chloroform/isoamyl alcohol. . Vortex and

shake for 10 minutes to extract Centrifuge at 14g for 15 min. Plasma proteins are denatured

and precipitated between layers Remove 400 μL of the top aqueous layer and transfer to a

clean lo-bind tube Condition HLB SPE plate with 1 mL of ACN and then with 1 mL

of 7mM TEA/400 mM HFIP Slowly drip

CONCLUSION

The use of a LLE/SPE method to extract a fully thioratedoligonucleotide has been successfully demonstrated using a microflow technique to provide enhanced

Figure 3. Carryover observed when injecting blank solutions immediately after a high concentration in neat solution

Tune solution (10 μg/mL)

μg/mL injection using conventional UPLC conditions

©2017 Waters Corporation MKT17206TO DOWNLOAD A COPY OF THIS POSTER, VISIT WWW.WATERS.COM/POSTERS

of 7mM TEA/400 mM HFIP. Slowly drip Add OGN sample that was extracted from LLE step Wash with 1 mL of 7mM TEA/400 mM HFIP Elute with 0.5 mL of 70:30 ACN/100 mM TEA

using a microflow technique to provide enhanced sensitivity and no carryover in plasma and urine matrices

References

1. van Dongen, W.D., Niessen, W.M.A., Bioanalysis, 2011, 3(5); 541-564.

immediately after a high concentration in neat solution.