University of Aberdeen

School of Biological Sciences

Gene expression following chronic viral infection

suspected to be a natural outbreak of pancreas

disease in farmed Atlantic salmon (Salmo salar L.)

Seamus Frederick McKim

Supervisors: Dr. Samuel A. Martin & Dr. Jun Zou

“A thesis submitted to the School of Biological Sciences for the Project element of a taught

degree of Master of Science, Applied Marine and Fisheries Ecology at University of

Aberdeen, 2012”

Aberdeen, August 2012

STUDENT DECLARATION

I hereby declare that this thesis is my own work and effort and that it has not

been submitted anywhere for any degree application. Where other sources of

information have been used, they have been acknowledged.

Signature: ………………………………………. Date: …………………………………………….

Gene expression following chronic viral infection suspected to be a natural

outbreak of pancreas disease in farmed Atlantic salmon (Salmo salar L.)

Seamus McKim

School of Biological Sciences, Zoology Building, University of Aberdeen, Tillydrone Avenue, Aberdeen, AB24

Email: shay.mckim@gmail.com

Abstract

Pancreas disease (PD), an economically important disease in farmed Atlantic salmon Salmo

salar L., is caused by salmonid alphviruses (SAV). A lack of convincing evidence detailing the

molecular responses following chronic viral myopathies exists. Clinical and gross

pathological findings were used to sort commercially farmed fish from a Scottish marine site

with a recurrent history of PD infection into two pools (1) Healthy/Asymptomatic, (2)

Diseased/’suspected PD’. Biometric data was used to determine condition factor and

evidence of feeding was analysed by creating a stomach fullness index. Condition factor (CF)

and stomach fullness rank for healthy fish was found to be significantly greater than that of

diseased fish. Few diseased fish (10%) showed signs of active feeding behaviour and

exhibited a significantly lower CF. Reverse transcription PCR and real-time qPCR assays for

the detection of the pathogen SAV in addition to the expression of the immune function

genes Mx and γ –IP and the protein degradation gene atrogin-1 were performed for heart

and skeletal muscle tissue. Attempts to confirm the presence and activity of SAV were

inconclusive. Gene expression analysis showed up-regulation of immune function genes

indicating stimulated immune response. Up regulation and expression was highest in

diseased heart tissues. Expression for atrogin-1 showed significant differences between

healthy and diseased heart tissue.

Introduction

Pancreas disease (PD), attributed to infection by Salmonid alphavirus (SAV) is a highly

significant disease in the production of farmed salmonids. The majority of cases affect

Atlantic salmon Salmo salar L. in the marine phase of culture occurring in their first or

second year at sea. Molecular analyses of salmonid alphaviruses show phylogenetic

relationships between isolates (Fringouelli et al., 2008). A total of six isolates, subtypes

SAV1-6. Subtypes 1, 4 and 5 are very closely related and are those to be confirmed to be

present in the British Isles and Ireland almost exclusively.

Histopathologically, the first indication of infection is observed in the pancreas with acute

necrosis of pancreatic tissues causing loss of exocrine pancreas. Concurrent damage occurs

in cardiac tissues (Ferguson et al., 1986a; McLoughlin & Graham, 2007). Lesions develop in

muscle tissues 3-4 weeks after the first observation of pancreatic and cardiac lesions

(McLoughlin & Graham, 2007). Under experimental conditions PD can affects a number of

other additional organs including the kidneys, liver and brain (McLoughlin et al., 2006). Focal

lesions forming in tissues may be highly localised or in extreme cases the entire organ(s)

may be affected. The heart is the first organ to recover morphologically after a PD outbreak

according to Jansen et al. (2010b).

One of the difficulties of studies regarding PD has traditionally been diagnosis which has

historically relied upon observations of the aforementioned histopathologies and clinical

signs. Severe complications exist with regard diagnosis due to the variability of associated

pathologies and also because of concomitant and secondary issues not exclusively or

consistently associated with PD being present (McVicar et al., 1987). These include other

diseases such as furunculosis, vibriosis and also the presence of and severity of affliction by

sea lice which may increase susceptibility. Real-time PCR tests are a far more sensitive

technique than serological analysis (Graham et al., 2003b; Hodneland & Endresen, 2006;

Christie et al., 2007). PD displays certain similarities, with pancreatic damage being a

common feature in cases of; infectious pancreatic necrosis (IPN) (Roberts & Pearson, 2005),

cardiomyopathy syndrome (CMS) (Ferguson et al, 1990) and heart and skeletal muscle

inflammation (HSMI) (Kongtorp et al., 2004a). While the aetiology of IPN, PD has been

confirmed, only very recently has the causative agent of CMS been identified and found to

be different to any salmon alphavirus, likely of the family totiviridae (Haugland et al, 2011).

No such information currently exists pertaining to HSMI.

A facet of our understanding of the pathogenesis of PD in salmonids which has been not

been investigated to any great extent, is the effect of the disease on the expression of genes

which control tissue or organ functionality. A poorly understood relationship even in this

generally little known area is PD and gene expression in muscle tissues (specifically heart

and skeletal) with which the disease is linked.

In the context of salmon culture, of paramount importance is the rate at which muscle mass

is grown through protein deposition. In general, fish are exceptionally efficient in this

process of converting protein consumed to growth when compared to terrestrial

endotherms (Houlihan et al., 1995). This efficiency is affected by a plethora of factors

including nutrition (Gomez-Requeni et al., 2005) and health status (Johansen et al., 2006).

Growth in farmed fish has been shown to be reduced or even to cease altogether following

an outbreak of PD (McLouglin et al., 2002) for up to 2 months after PD being diagnosed. Fish

infected with PD lose muscle protein, even when the virus is cleared they do not put on

weight at the same rate as before.

Laboratory trials and challenges examining necrosis of skeletal musculature have proven

difficult to recreate. This appears a feature of experimental PD when compared with those

of the naturally occurring disease (Murphy et al., 1995; McLoughlin et al., 1995b). In

challenged fish degenerative changes produced in skeletal myofibres are also less severe

than those which have been reported in the field (McLoughlin et al., 1996). These authors

have hypothesised that the reason for this is that less intense muscular activity is exhibited

in experimentally reared fish. This is supported by evidence that peak mortalities in the field

have been closely related to severe skeletal myopathies (McLoughlin et al., 1995a). The

relative lack of mortality under experimental conditions may be explained in this way. Sub-

clinical disease has also been observed where fish close to harvest are confirmed as positive

to SAV associated antibodies but have not had a reported clinical outbreak or suspicion of

disease, although in some cases growth and performance may have been less than expected

(Graham et al., 2006). A large number of molecular markers are now available to sample

both antiviral activity and aspects of muscle protein physiology, in particular protein

degradation and in this respect the marker atrogin-1 is seen as being key (Tacchi et al.,

2010).

A knowledge gap therefore exists in the understanding of muscle atrophy (protein

degradation) over an extended period of viral activity. To date, little focus of efforts has

been given over to the study of in particular the effects of longer-term chronic infection and

fish which are asymptomatic, displaying no visible signs of infection. The aim of the present

paper is to attempt to further explore gene modulation in fish which are present during a

natural outbreak of PD with special reference to the regulation of immune function genes,

genes responsible for protein degradation and to link these to growth patterns and the long

term effects of disease in the production of cultured fish.

Materials and Methods

Study site and sampling location

Atlantic salmon from a commercial Scottish marine farm with a history of recurrent PD

infection were sampled at a single time-point in May 2012. Data on both fish welfare and

health status and clinical observations was provided by local fish health services. The time

period from the first instance of confirmed infection by SAV to the time of samples obtained

for use in the present study is >10 weeks. This extended length of time reflects the aim of

the study to investigate chronic natural infection and pathogenesis. The site and cage

selected and sampled from was chosen on a number of criteria; the area being considered

to be endemic for the virus, recent case history is indicative of the high probability of

clinical PD. Fish at the specified location had not been vaccinated against pancreas disease

(SAV). Clinically diseased and asymptomatic fish were collected from the same cage with

autopsy and tissue sampling taking place immediately after euthanasia.

Sampling and diagnostic submissions

Fish selected for study were based on early clinical signs consistent with pancreas disease

and further gross post-mortem findings. Fish were defined as being healthy/asymptomatic

or diseased. For the purposes of analysis, fish classed as healthy will be used as the

experimental control with which comparisons are made. The diagnostic approach used in

the two pools created can be seen in summarised form in figure 1.

In terms of clinical signs of PD infection, and chronologically are a cessation in feeding

followed by a marked increase in morbidity, indications of feeding behaviour were

evidenced in reports made by local fish welfare services. Uptake of feed by fish on an

individual basis was assessed by examining stomach contents and whether or not casts were

present in the intestinal tract. Stomach fullness on a scale of 0-5 (0 = empty, 5 = distended)

was visually measured to semi-quantify feeding activity. Other differential clinical signs used

to categorise fish were those that appeared lethargic and were observed to drift near or on

the surface at the sides of the cage. Exhibiting an inability to maintain their position within

Healthy/Asymptomatic

Active

Swimming behaviour

normal

Good body condition

Body free from damage

Diseased

Lethargic

Drifting/'whirling at or near

surface

Poor body condition

Lesions and ulceration

Fig. 1. Summaries of the approach used in the formation of the two pools of fish used in the present study, namely sub-

clinical/asymptomatic healthy fish and those displaying clinical outward indicators of infection.

the water column, fish categorised as being infected present classic ‘whirling’. As opposed

to this behavioural characteristic, control (healthy/asymptomatic) fish swam in normal

patterns typical of farmed salmon and displayed the ability to change depth and position at

will. Lice counts for all fish sampled varied between 0-2 per fish.

Sampling

Fish were netted and killed by percussive impact to the back of the head. Necropsy was

performed following identical protocols for all fish and principal gross pathological

observations made and recorded detailing internal and external signs of infection including

presence and severity of lesions, signs of muscle myopathies and characteristic necrosis of

pancreatic tissues. Fork length (FL, mm) and total body weight (BW, g) were recorded and

used to calculate condition factor (K=100*BW/FL-3). Condition factor, an indication of the

health/nutritional status of a fish was then used to assess growth and body fat component,

with diseased fish typically presenting both reduced growth and low body fat (Fig. 2). It is

also indicative of a decreased level of energy reserves. Lesions and muscle damage causing

predisposition to erosion and ulceration of fins and skin including scale loss are an additional

symptom and as such were also considered (Fig. 3).

A

B

Fig. 2. Fish 4 (A) and 7 (B) both typical pancreas disease showing poor condition factor fish with reduced body and caecal fat compared to a healthy farmed fish.

Tissue harvest

Ten healthy and 10 ‘PD’ fish sampled. A portion of tissue (~ 200mg) from both heart and

skeletal muscle was taken using individual sterile scalpels for both tissue types. Tissues were

transferred to labelled 2 ml tubes containing 1.5 ml of RNAlater (Ambion) for subsequent

RNA extraction. This resulted in 2 organ samples for each fish used in the study. Samples

were immediately chilled post removal at 4°C for 24h then transported to the laboratory for

storage at -80°C prior to further testing.

A

B

Fig. 3. Fish 2 (A) and fish 3 (B) showing extreme levels of erosion to skin and sub-dermal regions of flanks showing exposed

myomeres.

RNA Extraction

Total RNA was isolated from fish tissues following storage at -80°C. RNA extraction was

performed from ~ 100 mg of tissue which was homogenised using TRIZol (Invitrogen) and

tungsten carbide beads (2mm, Qiagen) as per the manufacturer’s instructions. The resultant

pellet after centrifugation was washed in 900 µl 80% ethanol then air dried and

resuspended in RNase-free H2O. The quality and purity of the RNA and the concentration

were assessed by Agilent Bioanalyser 2100 and spectrophotometry (NanoDrop). RNA

produced was then stored at -80°C to await further processing and cDNA synthesis.

RT-PCR and qRT-PCR

cDNA synthesis was completed by denaturing 2 µl of dissolved total RNA in the presence of

1µl random hexamer primer (Bioline) and RNase –free water (Sigma) (70 °C, 5 min). The RNA

was then placed on ice to cool. cDNA was then synthesised from the total RNA using 1µl of

Bioscript reverse transcriptase (10000 U, Bioline) in the presence of 5 μL of 5× Reaction

Buffer, 1 μL of dNTP (deoxynucleoside triphosphate mix 12.5 mM each), (Bioline) made up

to a final volume of 25 μl with water and incubated at 42 °C for 1.5 h.

Standard reverse transcription-PCR

Initially viability of cDNA was assessed by PCR with the housekeeping gene elongation

factor-1α (EF-1α) using the following protocol. The PCR was performed in a 50 µl reaction

volume containing 2 µl cDNA template, 2.5 µl 10×Taq buffer, 1 µl (10uM) of each PCR

primer, 2 µl (10 mM) dNTP mix, 0.5 µl BioTaq DNApolymerase and 38 µl H2O. The PCR

profile was as follows: one cycle at 95 °C for 3 min; then 35 cycles at 94 °C for 30 s; 55 °C for

45 s; and 72 °C for 90 s; followed by one final extension cycle at 72 ◦Cfor 10 min. PCR

products were visualized on a Web Green DNA (Web Scientific) stained agarose (2%) gel

using UV illumination. The protocol was then used to carry out standard PCR using the

QnsP1 primer set (Table 1) to detect the presence of SAV cDNA.

qRT-PCR

Real-time PCR analysis was performed with 2x SYBR Green Master Mix (Applied Biosystems).

2 µl of cDNA template was used in a final volume of 20 µl. qPCR was carried out in a 96-well

plate using the DNA engine OpticonTM system (MJ Research, Inc.) using the following

protocol: 95 °C for 5 min, then 35 cycles of 94 °C for 30°s, 55 °C for 30 s and 72 °C for 30 s,

with a final extension of 72 °C for 5 min. For each primer pair a negative control (template

replaced by same volume with RNA/DNA-free H2O) was also performed. For detection of

SAV a positive control was also carried. Endogenous control (normalisation of cDNA) was

provided by EF-1α, a housekeeping gene which has been developed for the purposes of

routine examination of salmonid tissues (Moore et al., 2005, Olsvik et al., 2005, Snow et al.,

2006, Bower and Johnston, 2009). The specificity of the PCR products produced from the

primer pairings was assessed by analysis of melting curves across the range 82 °C to 95 °C to

ensure that a single identifiable product had been identified. The efficiency of the

amplification procedure was calculated for each primer pair using a series of ten-fold

dilutions of pooled cDNA which were carried out on the same well plate used for each

experimental sample. The calculation for efficiency used the following equation: E = 10(-1/s)

in which s is the slope of the line produced from the dilution series when the log of dilution

is plotted against threshold cycle number (ΔCT). Relative expression of the gene transcripts

was determined using the arbitrary number allocation method. Measurements resultant

from qPCR were analysed by t-test. P-values of < 0.05 were considered to be significant with

the data generated from expression shown as mean ± the standard error. All primers used in

the present study were provided by Sigma.

Gene Name Primer Name Primer Sequence (5’-3’)) Accession Number

Amplicon Length

Annealing Temperature

EF-1 α (F) EF-1 α (R)

EF-1aF EF-1aR

CAAGGATATCCGTCGTGGCA ACAGCGAAACGACCAAGAGG

AF321836

327 bp 327 bp

55°C 55°C

Mx-1 (F) Mx-1 (R)

SS MX1F1 SS MX1R2

TGAGGACTCGGCAGAAAGGATGTA GGTCTTTCACCATCACCTCAAAGG

U66475

287 bp 287 bp

55°C 55°C

γ -IP (F) γ -IP (R)

IP10F IP10R

TGGTCAAGTTGGAGACGGTCA TGGAACGCATGGACACATTG

DR696064

360 bp 360bp

55°C 55°C

QnsP1 (F) QnsP1 (R)

Q nsP1 F primer Q nsP1 R primer

CCGGCCCTGAACCAGTT GTAGCCAAGTGGGAGAAAGCT

AY604235

107 bp 107 bp

60°C 60°C

Atrogin-1 (F) Atrogin-1 (R)

SS Fbx32Int F SSFbx32RcF5

GCACTAAAGAGCGTCATGGTTACTG GTCTGAAGGAGCTCCTTGATGG

DN165813

247 bp 247 bp

55°C 55°C

Table 1. Primers used for real-time PCR to assay gene expression of cDNas.

Results

Stomach fullness and condition factor

All fish (n=20) used for the present study (Table 2) were in the range 758g – 2925g ± 219 g in

weight, range attributable to condition/growth as all fish are from the same age cohort.

Significant differences between healthy and diseased fish with regard both weight and

condition factor (p-values of 0.002 and 0.01 respectively). No significant differences were

seen for fork length between the two pools of fish. Although total body weight is influenced

by whether food is present in the stomach and gut, the findings coupled with the significant

difference in condition factor indicate that a relationship exists in growth between diseased

and ‘healthy’ fish. Of the 10 fish characterised as being infected by PD 8/10 did not appear

to be feeding and had yellow casts present in the gut which is an indicator in the clinical

diagnosis of PD. For the 10 fish showing no clinical signs of infection 9/10 had food

particulates present in the stomach with yellow casts present in all fish.

Gross Pathology

Gross post-mortem observations found that all moribund fish (10/10) swimming near the

surface and close to the net were affected by both scale-loss and 9/10 had moderate to

extreme lesions upon their flanks both indicative of abrasion (Fig.3.). Fish not presenting

behavioural signs of disease were largely free from such indicators with 3/10 fish showing

minimal scale loss and only one fish with lesions (minor) on the flanks in the area

immediately forward of the caudal fin. Loss of exocrine pancreatic tissue is a characteristic

indicator of PD and close attention was paid to its status. In all fish sampled, necrosis was

found with a good number of fish almost completely lacking it. Petechial haemorrhaging

was observed on the surface of the pyloric caeca and associated fatty tissues in 6/10

n Fork length (mm) Body weight (g) Condtion factor Stomach fullness (0-5) Empty stomachs (%)

Healthy fish 10 578 ± 1.12 2652 ± 75.8 1.36 ± 0.08 1.9 ± 0.38 10 Diseased fish 10 539 ± 1.75 1751 ±232.4 1.07 ± 0.09 0.2 ± 0.13 80

All fish 20 559 ± 1.57 2242 ± 219 1.21 ± 0.09 1.05 ± 0.4 45

Table 2. Biometrical means and stomach fullness rank for pooled data recorded for farmed Atlantic salmon (± SE).

diseased fish and 3/10 health/asymptomatic fish. The kidneys and livers of the fish sampled

appeared to be enlarged in many cases with the release of haemorrhagic fluids common

upon dissection of both organs during tissue sampling. In clinically diseased pool, severe

necrosis of heart tissues (ventricle) was observed in 4 fish while only one fish displayed no

macroscopic lesions within the heart. For asymptomatic fish, only one was observed to have

lesions in heart tissues. Mild to moderate lesions in skeletal muscle tissues were found in

8/10 clinically diseased fish. Of the remaining fish within the pool, in one, severe lesions

affecting muscle tissues were observed and in one fish no lesions were observed. It was not

within the design of the present study to investigate further by histopathological analysis,

merely to make generalised observations of the health status of the fish and to categorise as

being either clinically diseased or healthy/asymptomatic.

Gene Expression Analysis

Twenty fish were screened for the presence of SAV by use of PCR detection using the QnsP1

primer set. Initially attempts were made to detect the virus by standard PCR using

numerous PCR protocols, however in all cases no viral presence could be detected in any of

the fish sampled from. Positive and negative controls performed as expected confirming the

integrity of cDNA used (Fig. 4a.) and that the SAV assay protocol utilised functioned

correctly and without contamination (Fig. 4b.). The range of EF-1α Ct values obtained for

both pools of fish was 14.38 to 26.35 with a mean of 18.73 ± 0.04 (SE).

1 2 3 4 5 6 7

300bp

200bp

100bp

4a

Fig.4a. Gel electrophoresis showing expression of EF-1α housekeeping gene (amplicon 327bp) in farmed Atlantic salmon

indicating consistent quality and quantity of RNA. Lanes 1-3 heart tissue, 4-5 muscle tissue from diseased altantic salmon.

Lane 6 +ve control using muscle tissue from PD challenge study where fish were experimentally infected with SAV (Z. Heidari

2012, pers. comm). Lane 7 –ve control (no template).

Existing studies using the same protocol (Z. Heidari 2012. Pers. comm) found that in a PD

challenge study, detection of SAV was confirmed in fish experimentally infected with SAV up

to 4 weeks post infection. Highlighted is the possibility that SAV may be present in such a

low concentration that a more sensitive methodology must be employed in order to detect

its presence. Given that real-time PCR is far more sensitive than end-point PCR, the use of

qRT-PCR was adopted. The results from qPCR were inconclusive. The virus was detected in

both tissues (heart and skeletal muscle) of all twenty fish sampled from, however the very

high Ct values generated suggest a very low viral presence and as such deemed to be

insufficiently reliable for further analysis.

The expression of the immune function gene Mx and γ –IP (also named IP-10/ CXCL10) and

in addition to the protein degradation gene Atrogin-1 was examined in heart and skeletal

muscle tissues from ten salmon defined as clinically afflicted with SAV and ten fish defined

as being subclinical or otherwise healthy. The relative expression of each gene was

normalised with EF-1α. Genes selected for expression analyses were expressed in both

tissue types (Table 1).

Immune function genes

The expression of data for the immune function gene Mx and the chemokine γ -IP (an IFN- γ

inducible protein) was very similar showing strong upregulation. Expression of Mx (Figure

Fig.4b. Gel electrophoresis showing PCR products amplified using QnsP1 primer set, confirming successful amplification of viral

DNA in positive control. Gel plate includes sample from the present study. Amplicon size is 107bp. Lanes 1,2,5,6 +ve control

muscle tissue from PD challenge experiment 4 weeks after initial infection(Z. Heidari 2012, pers. comm). (*) denotes –ve control

(no template). Lanes 7-12 are a selection of heart (7-9) and muscle tissues from fish used in the present study. Gel

electrophoresis confirms assay funtions correctly and that both positive and negative controls performed as expected.

1 2 * * 5 6 7 8 9 10 11 12

4b 400bp

300bp

200bp

100bp

5a, b), a major antiviral protein was shown to be significantly (P < 0.05) upregulated in both

the muscle and heart tissue of clinical fish when compared to control

(healthy/asymptomatic) fish (6 and 2 fold increase respectively). The expression was also

characterised by very high individual variances among fish. Expression of Mx was found to

be significantly greater in muscle tissue than in heart tissues. γ -IP expression (Fig. 5c, d)

broadly mirrored the expression of Mx. Significant upregulation was seen in both muscle

and heart tissue of diseased fish compared to control fish. A discernible and significant

difference is apparent when comparing the tissue types of both healthy and diseased fish. γ

–IP more highly expressed in muscle tissue than in heart with a very large increase in

expression seen in muscle (11 fold), whereas an only a two fold increase was seen in heart

tissue.

Fig 5a-d. Gene expression tissue distribution of Mx (a,b), γ –IP (c, d) in farmed Atlantic salmon during an outbreak of pancreas disease.

Heart and muscle tissues of healthy/asymptomatic fish from the same location were treated as a control Relative expression of each gene

was normalised with the expression of EF-1α.

Atrogin-1

The expression analysis for the protein degradation control gene atrogin-1 (Fig. 6a, b)

showed no significant difference in muscle tissue between the control and diseased fish,

however for heart tissue a significant downregulation of the gene was seen in diseased fish

(4 fold decrease). In common with both of the immune function genes examined, a very

high degree of individual variation characterised in terms of gene expression.

Discussion

The difficulties in detection of SAV in sample pools used for PCR assay can perhaps be

explained by the virological characteristics if SAV. Virological decreases in terms of viral

loading over time have been evidenced in a number of experimental challenge studies. For

PD, viral loading has been seen to peak early after infection but drop away rapidly to levels

which were undetectable by PCR (Z. Heidari 2012, pers. comm) (Fig.7).

Fig. 6a,b. Gene expression tissue distribution of atrogin-1 in farmed Atlantic salmon during an outbreak of pancreas disease. Heart and

muscle tissues of healthy/asymptomatic fish from the same location were treated as a control Relative expression of each gene was

normalised with the expression of EF-1α.

From additional studies of the relative quantification of viral RNA load (Andersen et al,

2007) the period between 3-5 weeks post infection is regarded as the optimal time to

achieve detection in all major organs and tissues of the fish. In view of this and the facts

concerning the present study, we could expect that we have sampled at a sub-optimal time

in which to detect SAV. However, while the results suggest that SAV activity is low, a

population could represent a potential viral reservoir for the rest of the production cycle

whereby a cyclic pathogenesis is present. In this model the most severely affected

percentage of fish die early (early mortality), close to the time initial infection whereas fish

unaffected in the initial outbreak are infected at that later date by carrier fish. In the interim

a period of viral clearance and recovery may be in effect. A number of studies have

however, illustrated that viral detection is possible at all stages of pathogenesis. Fish

sampled up to 6 months after initial infection have been shown to allow positive detection

(Desvignes et al., 2002; Andersen et al., 2007). In these prolonged chronic and largely sub-

clinical cases fish outwardly may display few clinical signs. The reason why subclinical

outbreaks occur is poorly understood, however Weston et al. (2005) attributed such

instances as being the result of infection by different SAV subtypes. This raises an interesting

question namely to what extent do subtypes affect gene expression with regard immune

function and the protein balance between deposition and degradation. As such, this area

warrants consideration and could form the basis of further studies. Given the stage of

pathogenesis present in the fish used in the present study it is also possible that survival

times, whether early or late mortality are characterised phenotypically perhaps indicating

Fig. 7. (Adapted from Z. Heidari, unpublished) Viral loading following experimental infection with salmon alphavirus

that resistance to disease at different stages of pathogenesis is explained by different

molecular host determinants. It is known that subtypes of infectious salmon anaemia virus

(ISAV) exist which are particularly pathogenic measured in terms of rate of replication and

scale of innate immune function up-regulation in addition to cellular stress (Jorgensen et al.,

2008). Several weeks are needed to develop acquired immune responses and until such a

time, the innate advantages possessed by some phenotypes are surely of high importance.

Our studies seem to indicate limited presence of SAV, however observed clinical signs and

gross pathological indicators seem at odd with such a conclusion. The assays for the

detection of are designed to amplify across all known subtypes of SAV Hodneland et al.,

2006) however they are specific to that pathogen and we cannot rule out the presence of

another virus with similar pathologies such as CMS or HSMI. If this were the case, it may

explain our findings that an immune response was found to be present in all fish sampled

from.

The findings of this report regarding the significantly lower CF in ‘diseased’ fish is supported

by Lerfall et al. (2012) who found a lower CF in salmon afflicted by PD. The elongate,

slimmer body shape seen in PD fish is an observation well supported by Einen et al. (1998,

1999) in studies of salmon deprived of feed. The issue of condition factor (CF) and

individuals showing poor growth in the period following initial infection is an area which has

generally received little attention. The loss of pancreatic tissue is seen as a primary feature

of PD as evidenced in the present study and the poor CF seen empirically for diseased fish in

this coupled with the stomach fullness rank are indicative that diseased fish have had a

decreased food intake or an inability to derive nutrition from feed in an efficient manner.

The ability to absorb and metabolise nutrients is seen as an explanation for evidence that

cages and farms with outbreaks and or chronic problems with PD produce fish with on

average a lower CF than locations where PD is either not present or at a lower intensity. It

may take several months to develop changes of this magnitude due to PD (Taksdal et al.,

2007). As it cannot be easily verified exactly the period of time since initial infection in the

the cage/location investigated in this report to the time sampling took place it is difficult to

evaluate the findings of this report in supporting this observation.

Whilst attempts made to detect SAV were inconclusive, the genetic markers used to indicate

a heightened immune response showed that the fish were responding to some immune

trigger. The up-regulation of Mx which is an important antiviral protein indicates that an

interferon induced antiviral response was occurring in both tissues, as is the expression of

γ–IP (IP-10) a chemokine which has been shown to be strongly induced by IFN-γ. The

induction of certain cytokine genes including IFN-γ has recently been shown to cause

apoptosis in host cells and also growth inhibition in mouse stellate cells (Dogra et al., 2006;

Fitzner et al., 2007). The physiological implications of such a relationship are not yet fully

understood.

Tropism which is the way in which viruses/pathogens have evolved to preferentially target

specific host species, or specific cell types within those species has been investigated

recently (Andersen et al., 2007). Recently (Jorgensen et al., 2008) reported similar findings

for infectious salmon anaemia virus (ISAV) where viral loading was also found to be higher in

certain tissues. Interestingly and perhaps a highly significant result of the paper was the fact

that viral load was markedly reduced when comparing the early mortalities (EM) of the

challenge to that of late mortality individuals. The paper went further still, hypothesising

that the dramatic innate immune responses seen in EM fish are linked to the fact that many

genes exhibiting heightened levels of expression such as the two genes assayed in the

present study (Mx & γ –IP) are known to be IFN dependent and consequently are

characterised by low tissue specificity. The heart while often the first tissue other than

pancreas to be affected in cases of PD is often the first organ to recover morphologically

after the peak in infection during PD outbreak Jansen et al. (2010b), and the higher

expression of antiviral and inflammatory transcripts in hearts tissue compared to skeletal

muscle might be expected in addition the speed of recovery of the cardiac tissues may be

indicative of prioritisation given over to the preservation critical to sustaining life. Indeed

findings from the present study are that a down-regulation of atrogin-1 a muscle

degradation protein occurs in cases of disease which lends support to this hypothesis.

However, it could also be viewed as the effect of a clinically affected fish entering the final

stages of pathogenesis immediately prior to death where a terminal outcome is assured and

there is a complete destruction of protein control mechanisms. The difference in expression

for atrogin-1 in skeletal muscle where it was significantly great could be an indicator of the

utilisation of muscle tissues and a catabolic fuel source.

Conclusion

Further evidence is provided for the relationship between growth and condition and

immune system status. The results from the present study have demonstrated farmed

Atlantic salmon can display significant variation in both biometrics and gene expression

during and as a result of viral immune challenges. Further work is required to understand

the influence SAV subtypes have in the pathogenesis of PD. While it is likely that the

regulation of the protein degradation gene atrogin-1 is influential in the growth of farmed

salmon its role in the determination in the growth rates salmon is not yet fully understood

and represents only a part of an expansive and very complex feedback system.

Acknowledgements

The author wishes to thank his supervisors for their contribution in this study. Thanked is

also the commercial fish farm from where all fish sampled originated. Zeynab Heidari and

Nick Pooley are also thanked for their invaluable assistance in the completion of this

manuscript.

Literature Cited

L. Andersen, A. Bratland, K. Hodneland, A. Nylund. 2007.Tissue tropism of salmonid alphaviruses (subtypes SAV1 and SAV3) in experimentally challenged Atlantic salmon (Salmo salar L.) Arch. Virol., 152 (2007), pp. 1871–1883

Boonyarom, O., Inui, K. (2006). Atrophy and hypertrophy of skeletal muscles: structural and functional aspects. Acta Physiol. 188, 77–89. Bower, N.I., Johnston, I.A. (2009) Selection of reference genes for expression studies with fish myogenic cell cultures. BMC Mol. Biol. 10. Christie, K. E., Graham, D. A., McLoughlin, M. F., Villoing, S., Todd, D., & Knappskog, D. (2007). Experimental infection of Atlantic salmon Salmo salar pre-smolts by i.p. injection with new Irish and Norwegian salmonid alphavirus (SAV) isolates: a comparative study. Diseases of Aquatic Organisms 75 (13-22).

Desvignes L., Quentel C., Lamour F., Le Ven A. (2002)Pathogenesis and immune response in Atlantic salmon (Salmo salar L.) parr experimentally infected with salmon pancreas disease virus (SPDV). Fish and Shellfish Immunology 2002;12:77-95 Dogra C, Changotra H, Mohan S, Kumar A. (2006) Tumor necrosis factorlike weak inducer of apoptosis inhibits skeletal myogenesis through sustained activation of nuclear factor-kappaB and degradation of MyoD protein. J Biol Chem 2006;281:10327–36. Einen, O., Waagan, B., Thomassen, M.S. (1998. Starvation prior to slaughter in Atlantic salmon (Salmo salar) — I. Effects on weight loss, body shape, slaughter- and fillet-yield, proximate and fatty acid composition. Aquaculture 166, 85–104. Einen, O.,Mørkøre, T., Rørå, A.M.B., Thomassen,M.S. (1999). Feed ration prior to slaughter— a potential tool for managing product quality of Atlantic salmon (Salmo salar). Aquaculture 178, 149–169 Ferguson H.W., Roberts R.J., Richards R.H., Collins R.O. & Rice D.A. (1986a) Severe degenerative cardiomyopathy associated with pancreas disease in Atlantic salmon, Salmo salar L. Journal of Fish Diseases 20, 95–98. Ferguson, H. W., Poppe, T., & Speare, D. J., (1990). Cardiyomayopathy in farmed Norwegian salmon. Diseases of Aquatic Organisms 8 (225-231). Fitzner B,Brock P, Nechutova H et al. (2007) Inhibitory effects of interferon-gamma on activation of rat pancreatic stellate cells are mediated by STAT1 and involve down-regulation of CTGF expression. Cell Signal 2007;19:782–90. Fringuelli, E., Rowley, H. M., Wilson, J. C., Hunter, R., Rodger, H., & Graham, D. A., (2008). Phylogenetic analyses and molecular epidemiology of European salmonid alphaviruses (SAV) based on partial E2 and nsP3 gene nucleotide sequences. Journal of Fish Diseases 31 (811-823). Gomez-Requeni, P., Calduch-Giner, J., de Celis, S.V.R., Medale, F., Kaushik, S.J., Perez- Sanchez, J. (2005). Regulation of the somatotropic axis by dietary factors in rainbow trout (Oncorhynchus mykiss). Br. J. Nutr. 94, 353–361. Graham, D. A., Rowley, H. M., Walker, I. W., Weston, J. H., Branson, E. J., & Todd, D., (2003b). First isolation of sleeping disease virus from rainbow trout, Oncorhynchus mykiss (Walbaum), in the United Kingdom. Journal of Fish Diseases 26 (691-694). Graham D.A., Jewhurst H., McLoughlin M.F., Sourd P., Rowley H.M., Taylor C. & Todd D. (2006a) Sub-clinical infection of farmed Atlantic salmon Salmo salar with salmonid alphavirus – a prospective longitudinal study. Diseases of Aquatic Organisms 72, 193–199. Haugland O, Mikalsen AB, Nilsen P, Lindmo K, Thu BJ, Eliassen TM, Roos N, Rode M, Evensen O., (2011) Cardiomyopathy syndrome of Atlantic salmon (Salmo salar L.) is caused by a dsRNA virus of the Totiviridae family. J Virol 2011. Houlihan, D.F., Carter, C.G., McCarthy, I.D. (1995). Protein turnover in animals. In: Wright, P., Walsh, P. (Eds.), Nitrogen metabolism and excretion. CRC Press, Boca Raton, pp. 1–29. Hodneland, K. & Endresen, C., (2006). Sensitive and specific detection of Salmonid alphavirus using real-time PCR (TaqMan®). Journal of Virological Methods 131 (184-192). Jansen, M.D., Wasmuth, M.A., Olsen, A.B., Gjerset, B., Modahl, I., Breck, O., Haldorsen, R.N., Hjelmeland, R., Taksdal, T., 2010a. Pancreas disease (PD) in sea-reared Atlantic salmon, Salmo salar L., in Norway; a prospective, longitudinal study of disease development and agreement between diagnostic test results. Journal of Fish Diseases 33, 723–736. Johansen, K.A., Sealey, W.M., Overturf, K.( 2006). The effects of chronic immune stimulation on muscle growth in rainbow trout. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 144, 520–531 Jorgensen, S.M., Afanasyev, S., Krasnov, A. ( 2008). Gene expression analyses in Atlantic salmon challenged with infectious salmon anemia virus reveal differences between individuals with early, intermediate and late mortality. BMC Genomics 9, 179. Karlsen M, Hodneland K, Endresen C, Nylund A (2006) Genetic stability within the Norwegian subtype of salmonid alphavirus (family Togaviridae) Arch Virol 151: 861–874 Kongtorp, R. T., Kjerstad, A., Taksdal, T., Guttvik, A., & Falk, K., (2004a). Heart and skeletal muscle inflammation in Atlantic salmon, Salmo salar L.: A new infectious disease. Journal of Fish Diseases 27 (351-358).

Jørgen Lerfall, Thomas Larsson, Sveinung Birkeland, Torunn Taksdal, Paw Dalgaard, Sergey Afanasyev, Målfrid T Bjerke, Turid Mørkøre. 2012. Effect of pancreas disease (PD) on quality attributes of raw and smoked fillets of Atlantic salmon (Salmo salar L.) Aquaculture (2012) v. 324-325, s. 209-217 doi: 10.1016/j.aquaculture.2011.11.003 McLoughlin, M. F., Nelson, R. T., McCormick, J. I. & Rowley, H. (1995b). Pathology of experimental pancreas disease in freshwater Atlantic salmon parr. Journal of Aquatic Animal Health 7, 104–110 McLoughlin, M. F., Nelson, R. T., Rowley, H. M., Cox, D. I., & Grant, A. N., (1996). Experimental pancreas disease in Atlantic salmon Salmo salar post-smolts induced by salmon pancreas disease virus (SPDV). Diseases of Aquatic Organisms 26 (117-124). McLoughlin M.F., Nelson R.T., McCormick J.I., Rowley H.M. & Bryson D.G. (2002) Clinical and histopathological features of naturally occurring pancreas disease in farmed Atlantic salmon, Salmo salar L. Journal of Fish Diseases 25, 33–43. McLoughlin, M., Graham, D. A., Norris, A., Matthews, D., Foyle, L., Rowley, H., Jewhurst, H., MacPhee, J., & Todd, D., (2006). Virological, serological and histopathological evaluation of fish strain susceptibility to experimental infection with salmonid alphavirus. Diseases of Aquatic Organisms 72 (125-133). McLoughlin, M. F. & Graham, D. A., (2007). Alphavirus infections in salmonids - a review. Journal of Fish Diseases 30 (511-531). McVicar A.H. (1987) Pancreas disease of farmed Atlantic salmon, Salmo salar, in Scotland: epidemiology and early pathology. Aquaculture 67, 71–78. Moore LJ, Somamoto T, Lie KK, Dijkstra JM, Hordvik I (2005) Characterisation of salmon and trout CD8a and CD8b. Mol Immunol 42: 1225–1234

Murphy, T. M., Drinan, E. M. & Gannon, F. (1995). Studies with an experimental model for pancreas disease of Atlantic salmon Salmo salar L. Aquaculture Research 26, 861–874. Nylund A, Plarre H, Hodneland K, Devold M, Aspehaug V, Aarseth M, Koren C, Watanabe K (2003) Haemorrhagic smolt syndrome (HSS) in Norway: pathology and associated virus-like particles. Dis Aquat Org 54: 15–27 Olsvik, P.A., Lie, K.K., Jordal, A.E.O., Nilsen, T.O., Hordvik, I. (2005. Evaluation of potential reference genes in real-time RT-PCR studies of Atlantic salmon. BMC Mol. Biol. 6, 21. Roberts, R. J. & Pearson, M. D., (2005). Infectious pancreatic necrosis in Atlantic salmon, Salmo salar L. Journal of Fish Diseases 28 (383-390). Snow M, McKay P, McBeath AJA, Black J, Doig F, et al. (2006) Development, application and validation of a taqman® real-time RT-PCR assay for the detection of infectious salmon anaemia virus (ISAV) in atlantic salmon (Salmo salar). Dev Biol (Basel) 126: 133–145. Tacchi L, Bickerdike R, Secombes CJ, Pooley NJ, Urquhart KL, Collet B, Martin SAM (2010) Ubiquitin E3 ligase atrogin-1 (Fbox-32) in Atlantic salmon (Salmo salar): sequence analysis, genomic structure and modulation of expression. Comp Biochem Physiol B Biochem Mol Biol 157(4):364–373 Taksdal, T., Olsen, A.B., Bjerkås, I., Hjortaas, M.J., Dannevig, B.H., Graham, D.A., McLoughlin, M.F., (2007). Pancreas disease (PD) in farmed Atlantic salmon Salmo salar L. and rainbow trout Oncorhynchus mykiss W. in Norway. Journal of Fish Diseases 30, 545–558. Weston JH, Graham DA, Branson E, Rowley HM, Walker IW, Jewhurst VA, Jewhurst HL, Todd D (2005) Nucleotide sequence variation in salmonid alphaviruses from outbreaks of salmon pancreas disease and sleeping disease. Dis Aquatic Org 66:105–111